Procesando

Espere un momento...

Configuración

Configuración

Ir a una solicitud

1. WO2020216984 - COMPOSICIÓN PARA EL TRATAMIENTO DE LOS EFECTOS SECUNDARIOS DE LA RADIOTERAPIA Y/O QUIMIOTERAPIA

Nota: Texto obtenido mediante procedimiento automático de reconocimiento óptico de caracteres.
Solo tiene valor jurídico la versión en formato PDF

[ ES ]

COMPOSICIÓN PARA EL TRATAMIENTO DE LOS EFECTOS SECUNDARIOS DE LA RADIOTERAPIA Y/O

QUIMIOTERAPIA

Campo de la técnica

La presente invención se encuentra en el campo de la biomedicina. En particular, proporciona una composición para el tratamiento y/o la prevención de los efectos secundarios de la radioterapia y/o quimioterapia en un animal o individuo. La presente invención también proporciona un kit para el tratamiento y/o la prevención de los efectos secundarios de la radioterapia y/o quimioterapia en un animal o individuo.

Estado de la técnica anterior

La oleuropeína es un compuesto químico que se puede extraer de la pulpa de las aceitunas verdes y las hojas de olivo de la variedad Olea europaea. La oleuropeína es el componente fenólico mayoritario de la pulpa de las aceitunas verdes y también se puede encontrar en el aceite de oliva extra virgen al que le da su sabor amargo.

Se ha demostrado que la oleuropeína es un compuesto activo que tiene propiedades antioxidantes, antiinflamatorias, antiaterogénicas, anticancerígenas, antimicrobianas y antivirales (Ornar, 2010, Sci Pharm 78 (2): 133-54). También se ha demostrado que la oleuropeína se puede usar para tratar cicatrices cutáneas o pieles ásperas o envejecidas (US 8,591,961) y para mejorar la cicatrización de la piel después de una incisión cutánea (Mehraein, et al., 2014, Cell J. 16 (1): 25-30).

El cáncer de mama afecta a aproximadamente 12 % de las mujeres en el mundo (McGuire et al., 2015, Cancers 7 (2): 908-29). Métodos comunes para tratar el cáncer de mama incluyen la radioterapia y la quimioterapia. La radioterapia y quimioterapia pueden dañar la piel causando, a modo de ejemplo, fibrosis, inflamación y dermatitis por radiación. Por eso, existe una necesidad de proporcionar composiciones capaces de prevenir, curar y/o paliar los efectos secundarios de la radioterapia y/o de la quimioterapia.

Los autores de la presente invención han desarrollado una composición para su uso en el tratamiento (preferiblemente como composición protectora post-tramiento, ya que el efecto se produce una vez las células han sido radiadas - restaura fenotipo y comunicación intercelular mediante gap junctions y reduce senescencia -) o la prevención de los efectos secundarios causados por la radioterapia y/o quimioterapia y un kit que comprende dicha composición para su mismo uso. En concreto, la presente invención restaura el fenotipo del fibroblasto dérmico, reduce el grado de senescencia celular e inhibe la síntesis del componente SASP ( senescence-associated secretory phenotype ) post-tratamiento para promover regeneración tisular y evitar fibrosis y otros efectos degenerativos.

Descripción de las figuras

Figura 1. Incremento de los niveles de conexina43 (Cx43) en fibroblastos dérmicos de pacientes de cáncer de mama sometidas a quimioterapia o radioterapia. A. Inmunofluorescencia para la detección de Cx43 (en rojo), en la que se aprecia un incremento de la Cx43 en fibroblastos dérmicos aislados de piel de pacientes con diferentes subtipos de cáncer de mama y que han sido tratadas con radioterapia o quimioterapia en comparación con fibroblastos de pacientes con patología benigna (no sometidos a tratamiento) (control sano, 4). Los núcleos celulares teñidos con DAPI aparecen en azul. Las muestras 1 (piel de la espalda) y 2 (piel en la zona de la mama) se corresponden con fibroblastos aislados de dos zonas de piel de la misma paciente con cáncer de mama Her2+. La muestra 1 no ha sido sometida a radioterapia, y la paciente había sido tratada con quimioterapia y anticuerpos anti-Her2 un año antes de la obtención de la muestra de piel. La muestra 2 sufrió radioterapia antes de su obtención. La muestra 3 corresponde a piel de una paciente con cáncer de mama luminal B Her2- sometida a quimioterapia neoadyuvante seis semanas antes de la toma de muestra. La muestra 4 proviene de una paciente con enfermedad benigna y no sometida a ningún tratamiento. B. El tratamiento con diferentes concentraciones de oleuropeína (0.1 mM, ImM y 10 mM durante 2 horas) de fibroblastos aislados de una donante con cáncer de mama Her2+ redujo los niveles de la Cx43 detectados en los fibroblastos aislados de las muestras de piel que han sido sometidas a radioterapia (izquierda) o a quimioterapia (derecha). Para realizar estos ensayos, se utilizó el mismo número de células y la tubulina o GAPDH fueron empleados como control de carga en los western blot. En todos los casos, la oleuropeína redujo entre un 50 a un 68% los niveles de la Cx43 tanto en fibroblastos dérmicos aislados de muestras de donantes sometidas a diferentes tratamientos (radioterapia y quimioterapia), como de fibroblastos de donantes no sometidas a ningún tratamiento, confirmando su uso para mejorar la cicatrización celular en situaciones tanto patológicas que desencadenan en un incremento de la Cx43 (como por ejemplo úlceras de pacientes con diabetes), como en situaciones no patológicas (la disminución de la Cx43 acelera el tiempo de regeneración y mejora la cicatrización de piel) (Ghatnekar et al., 2009; Laird and Lampe, 2018; Ongstad et al., 2013).

Figura 2. Pérdida de la capacidad de comunicación intercelular a través de uniones comunicantes (UCs) o gap junctions en fibroblastos dérmicos de pacientes sometidas a quimioterapia o radioterapia. Ensayo de acoplamiento celular o dye coupling en el que se estudia la transferencia de 5,6-carboxifluoresceína (verde) entre fibroblastos en contacto a través de UCs. Se utilizaron fibroblastos aislados de pacientes con diferentes subtipos de cáncer de mama y que han sido tratadas con quimioterapia y/o radioterapia en comparación con fibroblastos de pacientes con patología benigna (no sometidos a tratamiento) (control sano). Tanto la quimioterapia como la radioterapia, a pesar de aumentar los niveles de Cx43 en fibroblastos dérmicos, dan lugar a un menor porcentaje de acoplamiento celular con respecto a la actividad de las UCs en fibroblastos de donantes sanos. El gráfico representa el porcentaje de fibroblastos acoplados con fibroblastos adyacentes a través de UCs y detectados por inyección y transferencia de 5,6-carboxifluoresceína.

Figura 3. La oleuropeína restaura la comunicación intercelular a través de UCs y mejora el fenotipo celular. El tratamiento de fibroblastos dérmicos con oleuropeína 1 mM durante 4 h dio lugar a un cambio en la morfología celular acompañado de un mayor acoplamiento a través de UCs, analizado mediante la técnica de dye coupling. El asterisco (*) indica la célula en la que se ha inyectado el fluoróforo 5,6-carboxifluoresceína (verde). El porcentaje de células acopladas por UCs se representa en la gráfica C.

Figura 4. Los fibroblastos dérmicos aislados de piel sometida a radioterapia y/o quimioterapia muestran niveles elevados de senescencia celular. A. En el trabajo publicado por Campisi y colaboradores (Demaria et al., 2014) se identificaron las células que activan senescencia celular durante el proceso de regeneración en piel. Estos autores demostraron que los fibroblastos y células endoteliales, pero no los queratinocitos, sufren senescencia celular (Demaria et al., 2014) y acumulación de células senescentes o defectos en su eliminación desencadena en fibrosis (Mosteiro et al., 2016; Munoz-Espin and Serrano, 2014). La quimioterapia y la radioterapia incrementan senescencia celular en comparación con fibroblastos aislados de piel de donantes sanos. Para determinar el nivel de senescencia celular se ha cuantificado la señal azul de X-Gal utilizando el ensayo de la b-galactosidasa. En la gráfica se muestra el ratio de células senescentes con señal azul elevada frente al total celular (Radio; radioterapia. Quimio; quimioterapia). B. El tratamiento con 10 mM de oleuropeína durante las 72 horas posteriores a la exposición a la radiación redujo el porcentaje de senescencia en fibroblastos dérmicos (procedentes de piel de un donante sano) sometidos a radioterapia experimental de 55 Grays durante 30 minutos aproximadamente, de acuerdo con las especificaciones del modelo de acelerador lineal. En el gráfico se representa el ratio de células senescentes (señal azul elevada) frente al total celular. C. El tratamiento de fibroblastos dérmicos expuestos a radiación (55 Grays, 30 minutos) con 10 mM oleuropeína durante 48 horas redujo los niveles del factor de senescencia p53 a niveles similares al tratamiento con el senolítico dasatinib 0.2 mM combinado con oleuropeína 10 mM. Para inducir senescencia celular, los fibroblastos fueron tratados con bleomicina a 50 pg/pL. Se muestra el inmunoblot contra la proteína p53, empleando como controles de carga la tubulina y la tinción de rojo Ponceau ( Ponceau S Acid Red).

Figura 5. Efecto modulador post-radioterapia de la oleuropeína y BIRB796 en la senescencia celular y fenotipo secretor asociado a la senescencia (senescence-associated secretory phenotype, SASP). A. El tratamiento con oleuropeína 10 mM durante 72 horas de fibroblastos aislados de piel sana y sometidos a radioterapia experimental (55 Grays) logró disminuir la acumulación de células senescentes. Su combinación con el inhibidor de SASP BIRB796 (2.5 pM, 72 horas) no modificó el efecto de la oleuropeína detectándose una reducción similar en el porcentaje de células senescentes. Los niveles de senescencia celular se han cuantificado a modo de señal azul de X-Gal (ensayo b-galactosidasa). En la gráfica se muestra el ratio de células senescentes con señal azul elevada frente al total celular. B, C. La presencia de células senescentes limita la capacidad de regeneración tisular y su acumulación desencadena en fibrosis, al sintetizar y liberar enzimas implicados en el remodelado de la matriz, componente inflamatorio y factores como la IL-6 que participan en la reprogramación de las células vecinas (Mosteiro et al., 2016; Mosteiro et al., 2018). El tratamiento durante 72 horas de fibroblastos aislados de piel sana y sometidos a radioterapia experimental de 55 Grays con BIRB796 (2.5 mM) protege de la síntesis de componentes del SASP como la MMP-3, implicada en cicatrización al degradar diferentes tipos de colágenos y fibronectina (B). El tratamiento con oleuropeína disminuiría los niveles de senescencia celular (acumulación de células senescentes), y su combinación con BIRB796 reduciría el componente del SASP, interfiriendo así con el exceso de remodelado de la matriz extracelular (degradación de colágeno III, IV, IX y X y otros componentes de la piel). A mayores la presencia de BIRB796 disminuye la síntesis del componente inflamatorio (IL-Ib e IL-6) en presencia o en ausencia de oleuropeína (C), disminuyendo la inflamación en el tejido dañado en presencia de células senescentes. Los niveles de mRNA de MMP-3, IL-6 e IL-Ib fueron normalizados frente al gen control HPRT1 y representados en comparación a un control de fibroblastos sanos no radiados. Cabe destacar que BIRB796 es un inhibidor de nueva generación de p38 MAPK, molécula implicada en el proceso de senescencia en fibroblastos, y que, gracias a su eficacia y perfil toxicológico, ha logrado llegar a ensayos clínicos en fases II y III en enfermedades inflamatorias tales como artritis reumatoide (identificador en clinicaltrials.gov NCT02214888, Boehringer Ingelheim), Crohn, colitis ulcerosa y psoriasis (identificador NCT02209753, Boehringer Ingelheim). (Chiacchiera et al., 2012; Forcé et al., 2004; He et al., 2013; Ma et al., 2014; Mosteiro et al., 2018; Thalheimer et al., 2014; Zhang et al., 2014).

Figura 6. El tratamiento combinado oleuropeína BIRB796 favorece la migración del fibroblasto dérmico en un ensayo de cierre de herida o scratch. Ensayo de scratch en fibroblastos dérmicos procedentes originalmente de piel sana y radiados experimentalmente a 55 Grays, a los que se aplicaron tratamientos de oleuropeína 10 mM, BIRB796 2.5 mM o la combinación de ambos durante 24-48 horas. Se muestra el estado del ensayo a las 24 horas de realizar el scratch, así como la cuantificación del total de células presentes en el espacio original del scratch (delimitado por las líneas punteadas) tras esta franja temporal para cada una de las condiciones. El ensayo de cierre de herida es un método directo y económico para el estudio de la migración celular in vitro. Se basa en el hecho de que, al realizar una herida artificial (denominada scratch) en una monocapa de células confluentes, las células de los bordes recién creados se mueven hacia la apertura para cerrar el scratch hasta establecer nuevos contactos celulares. En términos generales, se realiza un scratch en una monocapa celular, se toman imágenes al inicio y a intervalos regulares durante la migración de las células, y finalmente se comparan para determinar la tasa de migración celular.

Figura 7. El tratamiento post-radioterapia con oleuropeína y BIRB796 reduce la producción del factor p53 y su diana p21, implicados en la senescencia celular en fibroblastos dérmicos. A. La radiación experimental de fibroblastos aislados de piel sana (muestra 1) a 55 Grays (muestra 2) supuso un incremento en los factores de senescencia p53 y p21. El tratamiento durante 72 h post-radiación con oleuropeína 10 mM (muestra 3) o el inhibidor de SASP BIRB796 2.5 mM (muestra 4) logró reducir eficazmente los niveles proteicos de ambos factores, siendo la combinación de ambos compuestos (muestra 5) la más efectiva para disminuir p21. B. Cuantificación de los niveles proteicos de p53 y p21 del western blot mostrado en A relativizados a la expresión del control de carga tubulina.

Figura 8. Efecto modulador post-radioterapia de la oleuropeína y BIRB796 en la senescencia celular en fibroblastos dérmicos. El tratamiento durante 72 horas de fibroblastos aislados de piel sana y sometidos a radioterapia experimental de 55 Grays con oleuropeína (10 mM), BIRB796 (2.5 mM) y la combinación de ambos reduce la expresión génica del factor de senescencia p21. El nivel de mRNA de p21 fue normalizado frente al gen control HPRT1 y representado en comparación a un control de fibroblastos sanos no radiados.

Figura 9. Nanocapsulas de oleuropeína. Fibroblastos dérmicos aislados de piel fueron tratados con oleuropeína encapsulada (oleuro-nanos) y marcada con Nile Red. En encapsulado no afecta a la capacidad de la oleuropeína para atravesar la membrana plasmática. El ensayo de viabilidad celular en fibroblastos dérmicos radiados (55Gy) demuestra que las nanos-oleuro no son tóxicas para la célula.

Figura 10. Efecto de las nanos-oleuro en fibroblastos dérmicos radiados. Las nanos-oleuro (10 mM) reducen los niveles de Cx43 y p21 en fibroblastos radiados. El tratamiento durante 72 horas de fibroblastos aislados de piel sana y sometidos a radioterapia experimental de 55 Grays con oleuropeína (10 mM), y nanos-oleuro (10 mM) reduce los niveles de expresión de Cx43, p21 y factores SASP como IL6, ILlb y MMP3. Los nivles de RNA fueron normalizados frente al gen control HPRT1 y representados en comparación a un control de fibroblastos sanos no radiados (no radio).

Breve descripción de la invención

La presente invención se dirige al uso de una composición para el tratamiento y/o la prevención de los efectos secundarios de la radioterapia y/o de la quimioterapia, preferiblemente como composición protectora post-tramiento, es decir, el efecto se produce una vez las células han sido radiadas (restaura fenotipo y gap junctions y reduce senescencia). Por lo tanto, dicha composición comprende dos compuestos químicos que pueden proteger y tratar tejidos que han sido afectados o están en riesgo de ser afectados por los efectos secundarios de la quimioterapia y/o radioterapia. La presente invención también se dirige a un kit que comprende la composición de la presente invención para el tratamiento y/o prevención de los efectos secundarios de la radioterapia y/o quimioterapia.

Descripción detallada de la invención

Definiciones

Si no se menciona específicamente lo contrario, el término“ comprende” se utiliza, en el contexto de esta solicitud, para indicar que la lista de componentes puede incluir aspectos opcionales mencionados o no mencionados. El término“ comprende” también puede incluir el concepto“ consiste en

Los términos“ tratamiento” o“ terapia”, tal como se emplean en la presente descripción, se refieren a un conjunto de medios higiénicos, farmacológicos, quirúrgicos y/o físicos cuya finalidad es la curación o el alivio de las enfermedades y/o síntomas. Los términos“ tratamiento” o“ terapia” comprenden tanto métodos profilácticos como curativos, ya que ambos están dirigidos al mantenimiento o restablecimiento de la salud. Independientemente del origen de la dolencia, enfermedad o discapacidad, su alivio, mediante la administración del remedio adecuado, se entiende como terapia o uso terapéutico en el contexto de la presente invención.

El término“prevención”, tal como se emplea en la presente descripción, se refiere a un conjunto de medios higiénicos, farmacológicos, quirúrgicos y/o físicos cuya finalidad es evitar que se desarrollen enfermedades y/o síntomas en un animal o individuo. El término“prevención” comprende métodos profilácticos, ya que está dirigido al mantenimiento de la salud.

El término“ radioterapia”, tal como se emplea en la presente descripción, se refiere a una forma de tratamiento basada en el empleo de radiaciones ionizantes. Dichas radiaciones ionizantes comprenden rayos X o radioactividad, la que incluye los rayos gamma y las partículas alfa.

El término“quimioterapia” , tal como se emplea en la presente descripción, se refiere a una forma de tratamiento basada en la administración de sustancias químicas para el tratamiento de una enfermedad, en particular del cáncer. El término“ quimioterapia” también se refiere a una forma de tratamiento basada en la administración de anticuerpos terapéuticos y/o fármacos para tratar a un individuo o animal que padece o está en riesgo de padecer cáncer.

En la presente invención, la radioterapia y/o quimioterapia pueden formar parte de una terapia neoadyuvante.

El término “ anticuerpo” tal como se emplea en la presente descripción, se refiere a moléculas de inmunoglobulinas y fragmentos inmunológicamente activos de moléculas de inmunoglobulinas, es decir, moléculas que contienen un sitio de fijación de antígeno que se une específicamente (inmunorreacciona). Ejemplos de fragmentos inmunológicamente activos, incluyen fragmentos F(ab) y F(ab’)2 que se pueden generar tratando el anticuerpo con una enzima tal y como la pepsina. Los anticuerpos pueden ser

policlonales (incluyen típicamente anticuerpos distintos dirigidos contra determinantes o epítopos distintos) 3 monoclonales (dirigidos contra un único determinante en el antígeno).

El anticuerpo monoclonal puede estar alterado bioquímicamente, por manipulación genética, o puede ser sintético, careciendo, posiblemente, el anticuerpo en su totalidad o en partes, de fragmentos o porciones que no son necesarias para el reconocimiento del antígeno y estando sustituidas por otras que confieren al anticuerpo propiedades ventajosas adicionales.

El anticuerpo puede ser también recombinante, quimérico, humanizado, sintético o una combinación de malquiera de los anteriores. Un“ anticuerpo o polipéptido recombinante” (rAC) es un anticuerpo que ha sido producido en una célula hospedadora que ha sido transformada o transfectada con el ácido nucleico que codifica para el polipéptido o antígeno, o produce el polipéptido o antígeno como resultado de la recombinación homologa.

El término“ anticuerpos terapéuticos’' tal como se emplea en la presente descripción, se refiere a un medicamento para el tratamiento del cáncer que, sin limitarse, comprende: trastuzumab, rituximab, gemtuzumab ozogamicin, alemtuzumab, ibritumomab tiuxetan, tositumomab-I-131, cetuximab, bevacizumab, panitumumab, ofatumumab, ipilimumab, brentuximab vedotin, pertuzumab, ado-trastuzumab emtansine y/o obinutuzumab.

El término“fármacos” tal como se emplea en la presente descripción, se refiere a un medicamento para el tratamiento de enfermedades, como por ejemplo el cáncer, y, sin limitarse, comprende: abiraterona, iltretamina, anhidrovinblastina, auristatina, bexaroteno, bicalutamida, BMS 184476, 2, 3, 4, 5, 6-pentafluoro-N-(3-fluoro-4-metoxifenol)benceno sulfonamida, bleomicina, N,N-dimetil-L-valil-L-valil-N-metil-L-valil-L-proly- 1- Lproline-t-butilamida, caquectina, cemadotina, clorambucil, ciclofosfamida, 3',4'-iideshidro-4,-desoxi-8,-Norvin-caleukoblastina, docetaxol, doxetaxel, carboplatino, carmustina, cisplatino, :riptoficina, citarbina, dacarbazina (DTIC), dactinomicina, daunorrubicina, decitabina dolastatina, ioxorrubicina (adriamicina), etopósido, 5-fluorouracilo, finasterida, flutamida, hidroxiurea and tiidroxiureataxanos, ifosfamida, liarozol, lonidamina, lomustina (CCNU), MDV3100, mecloretamina, melfalán, isetionato de mivobulina, rizoxina, sertenef, estreptozocina, mitomicina, metotrexato, taxanos, nilutamida, onapriston, paclitaxel, prednimustina, procarbazina, RPR109881, fosfato de stramustina, tamoxifeno, tasonermina, taxol, tretinoína, vinblastina, vincristina, sulfato de vindesina, y/o vinflunina.

El término “ terapia neoadyuvante” tal como se emplea en la presente descripción, se refiere a un tratamiento que se administra como primer paso para reducir el tamaño del tumor antes del tratamiento principal que generalmente consiste en cirugía. Entre los ejemplos de terapia adyuvante están la quimioterapia, la radioterapia y la terapia hormonal.

Los términos“ efecto secundario” o“ reacción adversa a medicamentos”, tal como se emplean en la presente descripción, se refieren a cualquier respuesta a un medicamento que sea nociva y no intencionada, y que tenga lugar a dosis que se apliquen normalmente en el animal o individuo para la profilaxis, el diagnóstico o el tratamiento de enfermedades y/o síntomas.

Los términos “ individuo”,“ paciente” o “ sujeto” se usan de manera intercambiable en la presente descripción, y no pretenden ser limitativos en ningún aspecto, pudiendo ser el“individuo” ,“ paciente” o “ sujeto” de cualquier edad, sexo y condición física. El término“animal”, tal como se emplea en la presente descripción, se refiere a cualquier organismo que es eucariota, heterótrofo y pluricelular que no es un ser humano.

El término“cantidad terapéuticamente efectiva” se refiere a una cantidad de sustancia química o compuesto químico en la composición que tiene un efecto terapéutico y es capaz de aliviar o curar los efectos secundarios de la radioterapia y/o quimioterapia.

Componente activo

En un primer aspecto, la presente invención proporciona una composición (de aquí en adelante composición de la invención) para su uso en un método de tratamiento y/o prevención contra los efectos secundarios de la radioterapia y/o quimioterapia, preferiblemente como composición protectora post-tratamiento. En una realización preferida, la composición comprende un compuesto químico según la fórmula (I):


Fórmula (I)

donde

R1-R2 son, independientemente, -OH, -NH2 o -SH; preferiblemente R1 y R2 son -OH;

R3 y R5 son, independientemente, hidrógeno, alquilo C1-C6, alquenilo C2-C6, alquinilo C2-C6, arilo, OH, alkoxi C1-C6, halógeno, NO2, N¾ o COOCH3; preferiblemente R3 es COOCH3 y R5 es hidrógeno;

XI -X3 son, independientemente, oxígeno, azufre, CFL o carboxi; preferiblemente XI, X2 y X3

R4 es hidrógeno, alkoxi C1-C6, glucosa, b-D-glucopiranosa, alquilo C1-C6, alquenilo C2-C6, alquinilo C2-C6, arilo, -OH, halógeno, NO2, NH3, carbohidrato, amino ácido, nucleótido, lípido, o su enantiómero; preferiblemente R4 es glucosa, o su enantiómero.

En un aspecto alternativo al primer aspecto, la presente invención proporciona una composición para su uso en un método de tratamiento y/o prevención contra los efectos secundarios de la radioterapia y/o quimioterapia, preferiblemente como composición protectora post-tratamiento con radioterapia y/o quimioterapia, donde dicha composición comprende un compuesto químico según la fórmula (II) (compuesto BIRB 796),


o un análogo al compuesto de fórmula II que comprende la siguiente estructura química:


donde con el objetivo de no incrementar innecesariamente el número de páginas de este documento, hacemos referencia explícita a la definición dada para cada uno de los radicales Arl, X, Ar2, L y Q mostrados en la fórmula arriba, a lo expuesto en la columna 6, línea 48, hasta la columna 10, línea 33, de la solicitud de patente US6319921B1. Adicionalmente, como ejemplos concretos de análogos del BIRB

796, incorporamos por referencia explícita los compuestos expresamente mencionados desde la columna 10, línea 55, hasta la columna 17, primera línea, de la solicitud de patente US6319921B1.

Adicionalmente, la presente invención también incluye análogos del BIRB 796 tales como los mostrados en la patente US6319921B1, documento que incorporamos íntegramente por referencia.

El término“ componente activo” tal como se emplea en la presente invención, se refiere a un compuesto químico según la fórmula (I) y/o (II) y/o un análogo del compuesto de fórmula II tal y como se describe arriba. Se hace notar que de forma preferida e impregnando cualquier aspecto o realización de la presente invención, dicho componente activo (I) se puede combinar con BIRB 796 (Doramapimod) o un análogo del mismo en una misma composición o en un“kit of parts” de forma que su administración, se pueda realizar de manera simultánea o secuencial o en cualquier orden.

De esta forma el componente activo de la composición de la presente invención se selecciona de un compuesto químico según la fórmula (I) o (II) o un análogo del compuesto de fórmula II, o cualquier combinación de los mismos.

En una realización preferida, la composición comprende un extracto vegetal que contiene una cantidad terapéuticamente efectiva del compuesto químico según la fórmula (I) opcionalmente en combinación con un compuesto de fórmula (II) y/o un análogo del compuesto de fórmula II. El extracto puede comprender cualquier extracto obtenido mediante una extracción de etanol, acetona, ácido inorgánico y orgánico o base y/o solución acuosa de cualquier tejido vegetal donde se puede extraer una cantidad terapéuticamente efectiva del compuesto químico según la fórmula (I). En una realización preferida, la composición comprende un extracto derivado de Olea europaea, Ligustrum obtusifolium, Fraxinus excelsior, F. angustifolia, F. chinensis, Syringa josikaea, S. vulgaris, Philyrea latifolia, Ligustrum ovalifolium, L. vulgare, o de cualquier otro género perteneciente a la familia Oleaceae.

En otra realización preferida, el compuesto químico según la fórmula (I) es oleuropeína. La oleuropeína es un compuesto químico según la fórmula (III):


Fórmula (III)

La composición de la presente invención se usa en un método para tratar y/o prevenir los efectos secundarios de la radioterapia y/o quimioterapia en la piel de un individuo o animal. Por ejemplo, pero sin limitarse, la composición se usa en un método para tratar los efectos secundarios derivados del tratamiento con radioterapia y/o quimioterapia, preferiblemente efectos secundarios en la piel como fíbrosis, inflamación, dermatitis por radiación, fragilidad cutánea, erosiones en los pliegues cutáneos, pérdida de uñas, o sequedad cutánea causado(s) por la radioterapia y/o la quimioterapia.

En una realización preferida, el individuo o animal padece o está en riesgo de padecer cáncer. En una realización preferida, el cáncer se selecciona de un grupo que comprende: cáncer de próstata, mama, ovario, endometrio, cérvix, cáncer linfoide, cáncer de cerebro, cabeza y cuello, leucemia, cáncer de pulmón, cáncer colorrectal, cáncer de tiroides, cáncer renal, adrenal, cáncer de hígado, estómago, cáncer intestinal, riñón, mieloma múltiple, cáncer de pulmón de células no pequeñas, cáncer de páncreas, glioblastoma, melanoma, cáncer de colon, linfomas y/o tumores neuroendocrinos. Preferiblemente, el cáncer o tumor es cáncer de mama, cerebro, cabeza y cuello y linfomas. Aún más preferiblemente, el cáncer o tumor es cáncer de mama.

Aditivos

En una realización preferida, la composición además comprende uno o más aditivos, tales como un solvente portador, un conservante, un surfactante, un agente de gelatinización y/o un compensador de pH.

Un“ olvente portador” se refiere al componente de la composición en el que está disuelto el componente activo. El solvente portador de la presente invención puede incluir, pero sin limitarse, vaselina, agua, lanolina, polietilenglicol, alcoholes y/o aceites vegetales.

Un“ conservante” se refiere a una sustancia que detiene o minimiza el deterioro causado por la presencia de diferentes tipos de microorganismos. El conservante de la presente invención puede incluir, pero sin limitarse, metilparabén, propilparabeno, alcohol bencílico, sorbato de potasio, etilohexilglicerina, fenoxietanol, EDTA, extracto de semilla de pomelo, aceite de té de árbol, benzoato sódico y/o ácido dehidroacético.

Un“ surfactante” se refiere a una sustancia que influye por medio de la tensión superficial en la superficie de contacto entre dos fases. El surfactante de la presente invención puede incluir, pero sin limitarse, lauril sulfato de sodio, lauril sulfato de amonio, disódico lauril sulfosuccinato, cocamfocarboxiglicinato, cocoaminopropil betaína y/o alfa olefin sulfonato.

Un“ agente de gelatinizaciόn,, se refiere a una sustancia que puede gelificar el líquido en el que esta disuelto. El agente de gelatinización de la presente invención puede incluir, pero sin limitarse, agar-agar, alginina, carragenano, colágeno, almidón de maíz, gelatina, goma guar, goma de algarrobo, pectinapectina y/o goma xantana.

El compensador de pH puede incluir, pero sin limitarse, ácido cítrico, ácido láctico, lactato de sodio, acetato de sodio, fosfato de sodio, citrato de sodio, borato de sodio y/o gluconato de sodio.

En una realización preferida, la composición puede, además, comprender fosfolípidos, amino ácidos, vitaminas y/o péptidos. Los fosfolípidos, amino ácidos, vitaminas y/o péptidos pueden ayudar a proteger, hidratar y/o regenerar la piel.

Administración

En una realización preferida, la composición se administra mediante un sistema de liberación tópico. La composición de la presente invención puede ser un gel, crema o ungüento. Dicha composición se puede administrar sobre el área afectada por los efectos secundarios de la radioterapia y/o quimioterapia. Dicha composición también se puede administrar de manera preventiva sobre el área en riesgo de ser afectada por los efectos secundarios de la radioterapia y/o quimioterapia. Por ejemplo, pero sin limitarse, la composición se puede aplicar sobre la piel afectada o en riego de ser afectada por los efectos secundarios de la radioterapia y/o quimioterapia, y se puede frotar suavemente durante algunos minutos para que la piel pueda absorber el componente activo.

En una realización preferida, la composición se administra inmediatamente después de una sesión de radioterapia y/o quimioterapia o en uno o dos días después de la sesión. En otra realización preferida, la composición se usa para tratar los efectos secundarios de la radioterapia y/o quimioterapia después de 1-4 semanas del tratamiento con radioterapia y/o quimioterapia y en otra realización aún más preferida, la composición se usa para disminuir las cicatrices que surgieron a causa de los efectos secundarios de la radioterapia y/o quimioterapia.

La composición de la presente invención se puede administrar una o más veces. Una dosis de la composición puede comprender 0,5 1000 mg del componente activo. Preferiblemente una dosis comprende 0,5 100 mg, 0,5 50 mg, 0,5 25 mg, 0,5 10 mg, 0,5 2,5 mg, 1,0 2,5 mg o 1,5 2,5 mg de componente activo. En una realización preferida, la composición contiene una cantidad terapéuticamente efectiva del componente activo de la presente invención.

Kit

En un segundo aspecto, la presente invención proporciona un kit para su uso tras el tratamiento y/o la prevención de los efectos secundarios de la radioterapia y/o quimioterapia en un animal o individuo, donde dicho kit comprende la composición de la presente invención, tal y como se ha descrito anteriormente. Se hace notar que dicho kit podría configurarse como un kit por partes (“kit of parts”) conteniendo en recipientes separados una composición que comprenda como principio activo el compuesto de fórmula (I),

y una composición que comprenda el compuesto de fórmula (II) y/o un análogo del compuesto de fórmula II.

En una realización preferida, la composición del kit comprende un extracto vegetal que contiene una cantidad terapéuticamente efectiva del compuesto químico según la fórmula (I) y opcionalmente un compuesto de fórmula (II) y/o un análogo del compuesto de fórmula II. El extracto puede comprender cualquier extracto obtenido mediante una extracción de etanol, acetona, ácido inorgánico y orgánico o base y/o solución acuosa de cualquier tejido vegetal donde se puede extraer una cantidad terapéuticamente efectiva del compuesto químico según la fórmula (I). En una realización preferida la composición del kit comprende un extracto derivado de Olea europaea, Ligustrum obtusifolium, etc. En otra realización preferida, el compuesto químico según la fórmula (I) es oleuropeína (fórmula III).

El kit de la presente invención se usa en un método para tratar y/o prevenir los efectos secundarios de la radioterapia y/o quimioterapia en la piel de un individuo o animal. Por ejemplo, pero sin limitarse, el kit se usa en un método para tratar y/o prevenir los efectos secundarios derivados del tratamiento con radioterapia y/o quimioterapia, preferiblemente efectos secundarios en la piel como fibrosis, inflamación, dermatitis por radiación, fragilidad cutánea, erosiones en los pliegues cutáneos, pérdida de uñas, o sequedad cutánea causado(s) por la radioterapia y/o la quimioterapia.

Ejemplos

Aislamiento de fibroblastos primarios, cultivo celular y tratamientos

Se obtuvieron biopsias de tejido cutáneo de pacientes femeninas del Complejo Hospitalario Universitario de A Coruña - Xerencia Xestión Integrada A Coruña (CHUAC-XXIAC) a partir de operaciones de extirpación de patología benigna (fíbroadenoma, muestras de piel sana no tratada) e intervenciones oncológicas (muestras de piel sometida a radioterapia y quimioterapia). Se contó con el consentimiento informado firmado de cada una de las pacientes (2015/029, C.0003333, 2016/077). Para el aislamiento de fibroblastos primarios a partir de estas muestras, se eliminó la grasa hipodérmica con ayuda de un bisturí, y se segmentaron las epidermis en fragmentos de aproximadamente lxl cm (explantes). Se rayó con un bisturí una placa Petri adherente de 100 cm2 a modo de cuadrícula, y se colocó cada uno de los explantes en las intersecciones resultantes con la epidermis hacia arriba y la dermis en contacto con la placa. Tras unos minutos de incubación en la estufa de cultivo celular a 37°C para favorecer la adhesión, se añadió medio Dulbecco's Modified Eagle Médium (DMEM, Invitrogen Life Technologies) suplementado con 20% de suero bovino fetal y 1% de penicilina/estreptomicina (100 U/mL de penicilina, 100 pg/mL de estreptomicina; Gibco, Invitrogen Corporation) y se dejaron en la estufa de cultivo celular a 37°C, 5% C02 y saturación de humedad con cambios de medio periódicos hasta que se observaron fibroblastos primarios. Una vez alcanzado un 70% de confluencia se desecharon los explantes y se transfirieron las células a otra placa de cultivo, expandiéndolas regularmente en medio DMEM al 10% de suero bovino fetal y 1% de

penicilina/estreptomicina. En los experimentos se emplearon fibroblastos dérmicos primarios sanos y procedentes de piel sometida a radioterapia y quimioterapia en pases de cultivo intermedios (pases 5 a 10). Se sometieron a tratamientos con diversas moléculas con el fin de observar su efecto sobre la conexina43 (Cx43) y el proceso de senescencia celular: oleuropeína (Extrasynthese), el agente senolítico dasatinib (Bristol-Myers Squibb Pharma EEIG), el agente inductor de senescencia bleomicina (Almirall ®) y el inhibidor de SASP BIRB796 (MedChemExpress). Las concentraciones de trabajo de dichos compuestos fueron determinadas mediante revisión bibliográfica y ensayos de viabilidad celular (MTT).

Radiación de fibroblastos en cultivo primario

Para simular los efectos de la radioterapia sobre fibroblastos dérmicos sanos, se llevaron a cabo ensayos de radioterapia experimental donde las células se expusieron a 55 Grays en el acelerador lineal de electrones Varían TrueBeam (Servicio de Radioterapia del Centro Oncológico de Galicia). Para ello se transportaron las células en soportes de cultivo celular herméticos con 1 cm de medio de cultivo de grosor para asegurar una radiación uniforme, que se renovó a las 5 horas de realizar la radiación.

Inmunofluorescencia.

Fibroblastos dérmicos en cultivo primarios fueron fijados con paraformaldehído al 2% en PBS. Tras lavar con PBS, se incubaron con una solución de glicina 0.1M, 10 minutos a temperatura ambiente. Las membranas fueron permeabilizadas con una solución de Tritón X-100 al 0.2% en PBS, durante 10 minutos a temperatura ambiente. Para bloquear sitios de unión inespecíficos en la preparación, las células se incubaron durante 30 minutos con una solución de albúmina de suero bovino al 1% en PBS suplementado con Tween-20 al 0.1% (PBS-T). Posteriormente, se incubaron las células con el anticuerpo primario conejo anti-Cx43 (C6219, Sigma-Aldrich) durante 1 hora a temperatura ambiente. Tras el lavado del exceso de anticuerpo primario con PBS-T, el anticuerpo secundario cabra anti-conejo marcado con isotiocianato de fluoresceína (FITC) (F2765, Invitrogen) se incubó durante 1 hora, a temperatura ambiente y en oscuridad. Se eliminó el exceso de anticuerpo secundario con PBS-T y se tiñeron los núcleos con 4',6-diamino-2-fenilindol (DAPI) durante 4 minutos a temperatura ambiente y oscuridad. Por último, se lavó exceso de DAPI y se montaron las preparaciones con glycergel para su posterior análisis en el microscopio.

Western Blot.

La lisis celular de los fibroblastos se llevó a cabo en un tampón frío en hielo (NaCl 150 mM; Tris-HCl 50 mM, EDTA 5 mM, NP-40 0.5%, SDS 0.1%, Sarkosyl 0.5%). Cantidades iguales de proteínas fueron separadas en un gel desnaturalizante de acrilamida/bis-acrilamida al 10% con SDS y transferidas a una membrana de polifluoruro de vinilideno en un Trans-Blot® SD Semi-Dry Transfer Cell. Tras el bloqueo de uniones inespecíficas de la membrana mediante una incubación de 1 hora a temperatura ambiente con una solución de leche al 5% en un tampón TBS-T (Tris 20 mM, NaCl 150 mM, Tween-20 0.05%), las membranas se incubaron con el correspondiente anticuerpo primario durante 16 horas a 4°C, en rotación. El exceso de anticuerpo se eliminó mediante sucesivos lavados con tampón TBS-T, tras lo que se incubó

con el anticuerpo secundario marcado con horseradish peroxidase (HRP) durante 1 hora a temperatura ambiente, en rotación. Tras eliminar el exceso de anticuerpo secundario mediante lavados con TBS-T, la señal se visualizó mediante quimioluminiscencia en una cámara de revelado Amersham Imager 600. Se utilizaron los anticuerpos primarios ratón anti-tubulina (T9026, Sigma-Aldrich), conejo anti-Cx43 (C6219, Sigma-Aldrich), ratón anti-p53 (sc-126, Santa Cruz Biotechnology), ratón anti-p21 (sc-6246, Santa Cruz Biotechnology) y ratón anti-GAPDH (6C5, Thermo Fisher Scientific), y los secundarios oveja anti-ratón (NA-931, Sigma-Aldrich) y cabra anti-conejo (A6154, Sigma-Aldrich).

Acoplamiento celular mediante Dye coupling.

Los fibroblastos fueron cultivados hasta una confluencia aproximada del 70%. Se inyectó una solución de 5,6-carboxifluoresceína en una célula y se evaluó la transferencia de este fluoróforo a células adyacentes.

Tinción hematoxilina para determinación fenotípica

Para estudiar el fenotipo de los diversos tipos celulares, se cultivaron los fibroblastos sobre coverslips de vidrio previamente tratadas con hidrobromuro de poli-D-Lisina (Sigma) para garantizar adherencia, hasta alcanzar un 80% de confluencia. A continuación se fijaron con paraformaldehído al 4% y se lavaron con tampón fosfato salino (PBS). Se realizó la tinción con hematoxilina de Gilí III durante 5 minutos. Se procedió a la deshidratación mediante pases en concentraciones crecientes de alcohol (80° - 90° - 100°) y finalmente en xileno. Se montaron en portaobjetos y se observaron y fotografiaron en un microscopio Olympus BX61.

Ensayo de senescencia b-galactosidasa

Se determinó el grado de senescencia y actividad b-galactosidasa de las muestras mediante el análisis de la tinción azul X-Gal, empleando el Senescence Cells Histochemical Staining Kit (Sigma). Se siguió el protocolo especificado por el fabricante. De forma resumida, se cultivaron las células en coverslips de vidrio previamente tratadas con hidrobromuro de poli-D-Lisina, se fijaron y se incubaron durante toda la noche en la solución de tinción en una estufa a 37°C en ausencia de C02. Finalmente se montaron y se observaron y fotografiaron en un microscopio Olympus BX61. Se realizó el contaje de las células positivas para X-Gal, diferenciándose entre tinción moderada y tinción elevada, y se calculó su ratio frente al total celular. Se empleó el software de análisis de imagen ImageJ (NIH).

Análisis de expresión génica (qPCR)

Para la extracción de ARN de los diversos tipos celulares se empleó TRI Reagent (MRC), siguiendo las instrucciones del fabricante. Una vez aislado se sometió a un tratamiento con ADNasa para eliminar los posibles restos de ADN contaminante (1 pL de ADNasa, 2 pL de tampón de reacción 10X -200 mM Tris-HCL pH 8.4, 20 mM MgC12, 500 mM KC1- y completando con agua hasta 20 pL). Para ello se incubó la reacción a 37°C 15 minutos y finalmente se paró con 25mM de ácido etilendiaminotetraacético (EDTA) a pH 8 durante 15 minutos a 65°C. Se cuantificó la cantidad y calidad del ARN obtenido en el Nanodrop ND- 1000. A partir del ARN extraído en el paso anterior se obtuvo el ADN complementario (ADNc) empleando el kit Superscript®VILOTM cDNA Synthesis Kit (Invitrogen), realizándose la retrotranscripción de 1 pg de ARN. El programa de retrotranscripción comprendió los siguientes pasos: 10 minutos a 25°C, 60 minutos a 42°C, 5 minutos a 85°C y mantenimiento de las muestras a 4°C. Finalmente se amplificó el ADN obtenido utilizando PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientifíc) en el equipo LightCycler 480 lnstrument Roche Applied Science. Se realizaron réplicas de cada condición, empleándose cebadores sentido y antisentido específicos para los genes de interés: hipoxantinafosforibosiltransferasa 1 (HPRT1), interleucina-ΐb (IL-1B), interleucina-6 (IL-6), p21 y metaloproteinasa-3 de matriz (MMP-3). El programa de reacción consistió en los siguientes pasos: incubación de 10 min a 95°C, amplificación de 50 ciclos de 10 segundos a 95°C y 1 min a 65°C y enfriamiento durante 20 segundos hasta 4°C. Se empleó como gen de referencia el HPRT1, y se analizaron los niveles de expresión génica referenciándolos a un control celular (células no radiadas o radiadas no sometidas a ningún tratamiento).

Los cebadores utilizados se detallan a continuación: HPRT1 : TTGAGTTTGGAAACATCTGGAG (sentido), GCCCAAAGGGAACTGATAGTC (antisentido). IL-Ib: CGAATCTCCGACCACCACTAC (sentido), TCCATGGCCACAACAACTGA (antisentido). 1L-6: T GT AGCCGCCCC ACACA (sentido), GGATGT ACCGAATTT GTTT GT A (antisentido). MMP-3: CCCTGGGTCTCTTTCACTCA (sentido), GCT GAC AGC ATCAAAGGAC A (antisentido)

Viabilidad celular

Fibroblastos sometidos a radioterapia experimental de 55 Grays fueron cultivados hasta alcanzar un 80% de confluencia. A continuación fueron tratados durante 72 h con diversas concentraciones de oleuropeína, nanopartículas vacías y nanopartículas con oleuropeína encapsulada. Finalizados los tratamientos, se lavaron las células con PBS, se fijaron con paraformaldehido al 4% en PBS 10 minutos y se tiñeron con una solución de violeta de cresilo acetato (Sigma) 10 minutos. Se lavaron dos veces con PBS y se dejaron secar. Por último se disolvió el violeta de cresilo con una solución al 30% de ácido acético en agua destilada durante 15 minutos, tomándose 100 pL de cada muestra por duplicado y midiendo la absorbancia a 570 nm en un lector Nano Quant Infinite M200.

Internalización de nanopartículas en fibroblastos radiados

Nanopartículas marcadas con Nile Red vacías y cargadas con diversas concentraciones de oleuropeína se añadieron, diluidas en medio de cultivo, a fibroblastos radiados en cultivo. Tras un tiempo de 4 h, se tiñeron los núcleos celulares con Floechst (Invitrogen) diluido en medio de cultivo a 100 ng/mL durante 45 minutos y se fotografiaron las células mediante un microscopio confocal de fluorescencia Feica TCS SP8.

Ensayo de cicatrización, de cierre de herida o Scratch assay.

Se sembraron los fibroblastos en placas de cultivo de 6 pocilios y se dejaron crecer hasta alcanzar una confluencia del 90 - 100%. En ese momento, se realizó una herida o scratch en el centro del pocilio con la ayuda de una punta de pipeta de 100 pL, permaneciendo su eje longitudinal siempre perpendicular al fondo del pocilio. A continuación, se lavó cuidadosamente cada pocilio con medio de cultivo (DMEM al 10% de suero bovino fetal y 1% de penicilina/estreptomicina) para eliminar células que pudieran haberse desprendido, y finalmente se aplicaron los tratamientos experimentales en medio DMEM al 10% de suero bovino fetal y 1% de penicilina/estreptomicina suplementado con los diversos compuestos objeto de estudio. Se fotografió cada pocilio al microscopio el día de inicio del scratch y cada 24 h hasta la finalización del experimento. Se cuantificó el total de células presentes en el espacio original de la herida para cada condición.