処理中

しばらくお待ちください...

設定

設定

出願の表示

1. KR1020100074220 - METHOD OF MODIFYING ISOELECTRIC POINT OF ANTIBODY VIA AMINO ACID SUBSTITUTION IN CDR

注意: このテキストは、OCR 処理によってテキスト化されたものです。法的な用途には PDF 版をご利用ください。

[ KO ]
CDR의 아미노산 치환에 의해 항체의 등전점을 개변하는 방법{Method of modifying isoelectric point of antibody via amino acid substitution in CDR}
기 술 분 야
 본 발명은 CDR의 아미노산 치환에 의해, 항체의 항원에 대한 결합활성을 유지하면서 등전점을 개변하는 방법, 항체의 혈장 중 약물동태(혈중동태)를 제어하는 방법, 등전점이 개변된 항체를 유효성분으로서 함유하는 의약 조성물 및 그의 제조방법 등에 관한 것이다.
 또한, 본 발명은 항IL-6 수용체 항체, 항글리피칸3 항체 및 항IL-3 수용체 항체의 CDR영역의 표면에 노출되는 아미노산 잔기의 개변에 의해, 당해 항체 항IL-6 수용체 항체, 항글리피칸3 항체 및 항IL-3 수용체 항체의 혈장 중 반감기를 제어하는 방법, 아미노산 잔기의 개변에 의해 혈장 중 반감기가 제어된 항체(항IL-6 수용체 항체, 항글리피칸3 항체 및 항IL-31 수용체 항체), 당해 항체를 유효성분으로서 포함하는 의약 조성물 및 그들의 의약 조성물의 제조방법에 관한 것이다.
 또한 본 발명은 항IL-6 수용체 항체를 유효성분으로서 함유하는 의약 조성물 및 그의 제조방법에 관한 것이다.
배경기술
 항체는 혈장 중 반감기가 길고, 부작용도 적은 측면에서 의약품으로서 주목받고 있다. 그 중에서도 IgG형의 항체 의약은 다수 시판되고 있어, 현재도 수많은 항체 의약이 개발되고 있다(비특허문헌 1, 비특허문헌 2). 현재 시판되고 있는 항체 의약은, 키메라 항체, 인간화 항체, 인간 항체가 대부분이나, 인간화 항체 또는 인간 항체를 개량하여 약효·편리성·비용을 개선시켜 보다 우수한 특성을 갖는 항체 의약이 현재 다수 개발되어 있다. 이들 항체 의약에 적용 가능한 기술로서 다양한 기술이 개발되고 있어, 이펙터기능, 항원 결합능, 약물동태, 안정성을 향상시키거나, 또는, 면역원성 리스크를 저감시키는 기술 등이 보고되어 있다. 약효를 증강시키거나, 또는, 투여량을 저감시키는 방법으로서, IgG 항체의 Fc영역의 아미노산 치환에 의해 항체의존성 세포장해활성(ADCC활성)이나 보체의존성 세포장해활성(CDC활성)을 증강시키는 기술이 보고되어 있다(비특허문헌 3, 4). 또한, 항원 결합능, 항원 중화능을 향상시키는 기술로서, 친화성 성숙(affinity maturation) 기술(비특허문헌 5)이 보고되어 있어, 가변영역의 CDR영역 등의 아미노산에 변이를 도입함으로써 항원으로의 결합활성을 향상시키는 것이 가능하다.
 현재의 항체 의약이 안고 있는 문제로서, 투여 단백량이 매우 큰 것에 의한 높은 제조비용을 들 수 있다. 또한 투여형태에 대해서는, 만성적인 자기면역질환의 경우는 피하투여 제제가 바람직하나, 일반적으로 피하투여 제제는 고농도제제인 것이 필요하여, IgG 타입의 항체 제제의 경우, 안정성 등의 측면에서 일반적으로는 100 ㎎/㎖ 정도의 제제가 한도라고 생각된다(비특허문헌 6). 지속적인 치료효과를 발휘할 수 있도록 항체의 혈장 중 반감기를 길게 함으로써 투여 단백질량을 작게 하고, 긴 투여간격에서의 피하투여를 가능하게 하여, 저비용 또한 편리성이 높은 우수한 특성을 갖는 항체 의약을 제공하는 것이 가능하다.
 항체의 긴 혈장 중 반감기에는 FcRn이 크게 관여하고 있어, 항체의 아이소타입간의 혈장 중 반감기의 차이에 관해서는, IgG1 및 IgG2가 가장 혈장 중 반감기가 길고, IgG3 및 IgG4가 그것보다 떨어지는 것이 알려져 있다(비특허문헌 7). 혈장 중 반감기가 우수한 IgG1 및 IgG2의 항체의 혈장 중 반감기를 더욱 연장하는 방법으로서, FcRn으로의 결합을 증강하는 정상영역(constant region)의 아미노산 치환이 보고되어 있다(비특허문헌 8, 9, 10). 그러나, 정상영역으로의 인공적인 아미노산 변이의 도입은 면역원성의 관점에서 과제가 존재한다. 그것에 대해, 최근, 항체의 가변영역의 아미노산에 변이를 도입함으로써 항체의 약물동태를 향상시키는 방법이 보고되었다(특허문헌 1).
 특허문헌 1에 의하면, 등전점을 변화시킴으로써 IgG의 약물동태를 제어하는 것이 가능하고, 항체 가변영역의 프레임워크에 아미노산 치환을 도입함으로써 항체의 항원으로의 결합활성을 감약시키지 않고 항체의 등전점을 저하시켜 항체의 혈장 중 반감기를 길게 하는 것이 가능한 것이 보고되어 있다. 구체적으로는, 예를 들면 Kabat numbering에 있어서의 H10, H12, H23, H39, H43, H105에 아미노산 치환을 도입함으로써 항체의 항원으로의 결합활성을 감약시키지 않고 항체의 등전점을 저하시키는 것이 가능하다. 또한 다른 프레임워크 서열에 대해서도 결합활성을 감약시키지 않고 아미노산 변이를 도입하는 것도 가능하나, 대폭 등전점을 저하시키기 위해서는, 프레임워크 서열로의 아미노산 치환의 도입만으로는 불충분한 경우가 생각되었다. 왜냐하면, 아미노산 치환 후의 프레임워크 서열은 일반적으로 면역원성을 낮게 하기 위해서 인간 항체 서열을 사용하나, 인간 항체 프레임워크 서열은 고도로 보존되어 있어 다양성이 적은 것으로부터 아미노산 치환에 대한 자유도가 작기 때문이다. 그 때문에, 프레임워크에 아미노산 치환을 도입하는 것만으로 항체의 등전점을 저하시키는 것이 불충분한 경우에, 추가적으로 등전점을 저하시키는 것이 곤란하였다.
 한편, CDR 서열은, 체세포 변이에 의해 방대한 다양성을 갖고, 항원으로의 결합을 획득하기 위한 다양성을 가지고 있는 점에서, 아미노산 치환의 자유도는 프레임워크와 비교해서 현저히 크다. 그러나, CDR 서열은 항원으로의 강한 결합활성을 발휘하기 위한 가장 중요한 요소로, 일반적으로 CDR 서열의 아미노산 치환은 항체의 항원에 대한 결합활성에 영향을 미치는 것이 알려져 있다. 그 때문에, CDR 서열의 아미노산 치환에 의해 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 것은 곤란하다. 또한, CDR 서열은, 항원의 종류에 따라 크게 상이하기 때문에, 항체의 종류에 의존하지 않고, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 CDR 서열의 아미노산을 치환하는 것은 매우 곤란하다고 생각되어 왔다. 실제로, 이것은, 이하에 나타내는 많은 사상(事象)으로부터 용이하게 추찰할 수 있다.
 비인간 동물종의 항체를 인간화할 때는, 일반적으로 비인간 동물종의 CDR 서열을 인간 프레임워크 서열에 이식하는 CDR 그래프팅이 사용된다. CDR 그래프팅에 의해 얻어진 인간화 항체가 키메라 항체와 동등한 결합활성을 나타내지 않는 경우는 CDR의 구조를 결정하는 프레임워크 서열의 일부를 그 항체의 유래하는 비인간 동물종의 항체의 프레임워크 서열에 아미노산 치환함으로써 결합활성을 회복시키는 것이 가능하다(비특허문헌 11). 이와 같이 CDR의 서열 및 구조는 그 항체가 갖는 항원으로의 결합활성과 특이성에 매우 중요하다. 또한, 항체 CDR 중에 있어서의 아스파라긴산 잔기의 이성화반응, 아스파라긴 잔기의 탈아미드화반응, 메티오닌 잔기의 산화반응에 의한 항체 CDR 잔기의 변화에 의해 항체의 항원으로의 결합활성의 감약은 널리 알려져 있는 것으로부터도(비특허문헌 12), CDR 서열은 항체의 항원에 대한 결합활성에 매우 중요하다. 또한, 항체의 H사슬 CDR2 서열에 아미노산 치환을 도입한 경우, 많은 경우 항원 결합활성이 대폭 감약하고, 또한 항체의 발현량도 감소하는 것이 보고되어 있다(비특허문헌 13~15). 특히 H51에 아미노산 치환을 도입한 경우, 항체의 발현량이 현저히 감소하는 것을 알 수 있다(비특허문헌 16). 또한, 항체의 H사슬 CDR3 서열에 변이를 도입한 경우, 대부분의 경우 항원 결합활성이 대폭 감약하는 것이 보고되어 있다(비특허문헌 17, 18). 또한, 항체의 CDR 서열의 알라닌·스캐닝을 행한 경우, CDR에 존재하는 아미노산을 알라닌으로 치환함으로써, 대부분의 경우가 그 항체의 항원으로의 결합활성은 대폭 감약하고(비특허문헌 19~23), 또한 알라닌으로 치환했을 때의 항원에 대한 결합활성으로의 영향은 항체의 종류에 따라 상이하다고 생각된다. 즉, 일반적으로, 항체의 CDR 서열의 아미노산 치환에 의해, 항원에 대한 결합활성이 감약한다고 생각되고 있어, 항체의 종류에 의존하지 않고, 항체의 항원에 대한 결합활성을 대폭 감약시키지 않는 아미노산 치환 개소는 지금까지 보고가 없다.
 보다 우수한 특성을 갖는 항체분자를 창제하기 위한 항체공학에 있어서, 항체의 CDR 서열로의 아미노산 치환은 친화성·성숙을 목적으로 행해지는 경우가 대부분이다. 친화성·성숙은 일반적으로 어느 친항체분자의 CDR 서열에 대해, 랜덤화한 CDR 서열을 갖는 항체 라이브러리를 파지 또는 리보솜 상에 제시하고, 항원으로의 패닝에 의해, 항원으로의 결합활성을 보다 향상시킨 항체를 취득하는 방법으로, 이 방법에 의해, 항원으로의 결합활성을 향상시키는 항체의 CDR 서열로의 아미노산 치환을 발견하는 것이 가능하다(비특허문헌 5, 24~26). 그러나, 이 방법에 의해 얻어지는 항원으로의 결합활성이 향상되는 아미노산 치환은, 항체의 종류에 따라 상이하기 때문에, 항체의 종류에 의존하지 않고, 항원으로의 결합활성을 향상시키는 CDR 서열에 있어서의 아미노산 치환개소는 지금까지 보고가 없다. 친화성·성숙 이외에는, 특정 개소의 CDR 서열의 아미노산을 치환함으로써 항체의 포유류 세포에 있어서의 발현량을 향상시키는 방법이 보고되어 있다 특허문헌 2에 의하면, 특정 개소의 CDR 서열의 아미노산을 특정 서열로 치환함으로써, 항체의 종류에 의존하지 않고, 항체의 포유류 세포에 있어서의 발현량을 향상시키는 것이 가능하다. 또한, 항체의 면역원성을 감약시키기 위해서 항체의 CDR 서열 중에 존재하는 T-cell 에피토프를 회피하는 de-immunization이 보고되어 있으나, 항체의 종류에 의존하지 않고, 항체의 결합활성을 감약시키지 않으며, CDR 서열 중에 존재하는 T-cell 에피토프를 제거하는 아미노산 치환의 방법은 지금까지 보고되어 있지 않다(비특허문헌 27, 28).
 이와 같이, 항체의 CDR 서열은 항원과의 결합에 깊이 관여하는 것으로부터, CDR 서열의 아미노산 치환에 의한 결합활성의 감약은 일반적이고, CDR 서열의 아미노산 치환에 의한 항원으로의 결합활성으로의 영향은 항체의 종류에 따라 상이하다. 특허문헌 1에 있어서, CDR에 있어서의 아미노산 치환에 의한 등전점의 제어예가 나타내어져 있으나, 항체의 종류에 따라서는, 항원으로의 결합활성을 감약할 가능성이 있는 것을 생각할 수 있다. 또한, 항체의 종류에 의존하지 않고 공통하는 아미노산 치환에 의해 항체의 발현을 향상시키는 방법이 보고되어 있으나, 항체의 항원으로의 결합활성을 향상시키는 것, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 T-cell 에피토프를 제거하는 방법은 지금까지 보고는 없다. 더구나, 항체의 종류에 의존하지 않고, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 아미노산을 치환할 수 있는 항체의 CDR 서열에 관한 보고도 일절 이루어져 있지 않다.
 또한, 본 발명의 선행기술문헌을 이하에 나타낸다.
 비특허문헌 1: Monoclonal antibody successes in the clinic, Janice M Reichert, Clark J Rosensweig, Laura B Faden & Matthew C Dewitz, Nature Biotechnology 23, 1073-1078 (2005)
 비특허문헌 2: Pavlou AK, Belsey MJ., The therapeutic antibodies market to 2008., Eur J Pharm Biopharm. 2005 Apr;59(3):389-96.
 비특허문헌 3: Presta LG. Engineering of therapeutic antibodies to minimize immunogenicity and optimize function. Adv Drug Deliv Rev. 2006 Aug 7;58(5-6):640-56.
 비특허문헌 4: Kim SJ, Park Y, Hong HJ., Antibody engineering for the development of therapeutic antibodies., Mol Cells. 2005 Aug 31;20(1):17-29. Review.
 비특허문헌 5: Fujii I. Antibody affinity maturation by random mutagenesis. Methods Mol Biol. 2004;248:345-59.
 비특허문헌 6: Shire SJ, Shahrokh Z, Liu J. Challenges in the development of high protein concentration formulations. J Pharm Sci. 2004 Jun;93(6):1390-402.
 비특허문헌 7: Salfeld JG. Isotype selection in antibody engineering.Nat Biotechnol. 2007 Dec;25(12):1369-72.
 비특허문헌 8: Hinton PR, Johlfs MG, Xiong JM, Hanestad K, Ong KC, Bullock C, Keller S, Tang MT, Tso JY, Vasquez M, Tsurushita N. Engineered human IgG antibodies with longer serum half-lives in primates.J Biol Chem. 2004 Feb 20;279(8):6213-6.
 비특허문헌 9: Hinton PR, Xiong JM, Johlfs MG, Tang MT, Keller S, Tsurushita N., An engineered human IgG1 antibody with longer serum half-life., J Immunol. 2006 Jan 1;176(1):346-56
 비특허문헌 10: Ghetie V, Popov S, Borvak J, Radu C, Matesoi D, Medesan C, Ober RJ, Ward ES., Increasing the serum persistence of an IgG fragment by random mutagenesis., Nat Biotechnol. 1997 Jul;15(7):637-40
 비특허문헌 11: Almagro JC, Fransson J. Humanization of antibodies. Front Biosci. 2008 Jan 1;13:1619-33.
 비특허문헌 12: Liu H, Gaza-Bulseco G, Faldu D, Chumsae C, Sun J. Heterogeneity of monoclonal antibodies. J Pharm Sci. 2008 Jul;97(7):2426-47
 비특허문헌 13: Chen C, Roberts VA, Rittenberg MB. Generation and analysis of random point mutations in an antibody CDR2 sequence: many mutated antibodies lose their ability to bind antigen. J Exp Med. 1992 Sep 1;176(3):855-66.
 비특허문헌 14: Chen C, Martin TM, Stevens S, Rittenberg MB .Defective secretion of an immunoglobulin caused by mutations in the heavy chain complementarity determining region 2. J Exp Med. 1994 Aug 1;180(2):577-86
 비특허문헌 15: Wiens GD, Heldwein KA, Stenzel-Poore MP, Rittenberg MB. Somatic mutation in VH complementarity-determining region 2 and framework region 2: differential effects on antigen binding and Ig secretion. J Immunol. 1997 Aug 1;159(3):1293-302.
 비특허문헌 16: Wiens GD, Lekkerkerker A, Veltman I, Rittenberg MB. Mutation of a single conserved residue in VH complementarity-determining region 2 results in a severe Ig secretion defect. J Immunol. 2001 Aug 15;167(4):2179-86.
 비특허문헌 17: Zwick MB, Komori HK, Stanfield RL, Church S, Wang M, Parren PW, Kunert R, Katinger H, Wilson IA, Burton DR. The long third complementarity-determining region of the heavy chain is important in the activity of the broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2F5. J Virol. 2004 Mar;78(6):3155-61.
 비특허문헌 18: Komissarov AA, Marchbank MT, Calcutt MJ, Quinn TP, DEU tscher SL Site-specific mutagenesis of a recombinant anti-single-stranded DNA Fab. Role of heavy chain complementarity-determining region 3 residues in antigen interaction. J Biol Chem. 1997 Oct 24;272(43):26864-70.
 비특허문헌 19: Gerstner RB, Carter P, Lowman HB. Sequence plasticity in the antigen-binding site of a therapeutic anti-HER2 antibody. J Mol Biol. 2002 Aug 30;321(5):851-62.
 비특허문헌 20: Vajdos FF, Adams CW, Breece TN, Presta LG, de Vos AM, Sidhu SS. Comprehensive functional maps of the antigen-binding site of an anti-ErbB2 antibody obtained with shotgun scanning mutagenesis. J Mol Biol. 2002 Jul 5;320(2):415-28.
 비특허문헌 21: Pons J, Rajpal A, Kirsch JF. Energetic analysis of an antigen/antibody interface: alanine scanning mutagenesis and double mutant cycles on the HyHEL-10/lysozyme interaction.Potein Sci. 1999 May;8(5):958-68.
 비특허문헌 22: Leong SR, DeForge L, Presta L, Gonzalez T, Fan A, Reichert M, Chuntharapai A, Kim KJ, Tumas DB, Lee WP, Gribling P, Snedecor B, Chen H, Hsei V, Schoenhoff M, Hale V, Deveney J, Koumenis I, Shahrokh Z, McKay P, Galan W, Wagner B, Narindray D, Hebert C, Zapata G. Adapting pharmacokinetic properties of a humanized anti-interleukin-8 antibody for therapeutic applications using site-specific pegylation. Cytokine. 2001 Nov 7;16(3):106-19.
 비특허문헌 23: Xiang J, Srivamadan M, Rajala R, Jia Z. tudy of B72.3 combining sites by molecular modeling and site-directed mutagenesis. Protein Eng. 2000 May;13(5):339-44.
 비특허문헌 24: Rothe A, Hosse RJ, Power BE. Ribosome display for improved biotherapeutic molecules. Expert Opin Biol Ther. 2006 Feb;6(2):177-87.
 비특허문헌 25: Schmitz U, Versmold A, Kaufmann P, Frank HG. Phage display: a molecular tool for the generation of antibodies--a review. Placenta. 2000 Mar-Apr;21 Suppl A:S106-12.
 비특허문헌 26: Rajpal A, Beyaz N, Haber L, Cappuccilli G, Yee H, Bhatt RR, Takeuchi T, Lerner RA, Crea R A general method for greatly improving the affinity of antibodies by using combinatorial libraries.. Proc Natl Acad Sci U S A. 2005 Jun 14;102(24):8466-71.
 비특허문헌 27: De Groot AS, Knopp PM, Martin W. De-immunization of therapeutic proteins by T-cell epitope modification. Dev Biol (Basel). 2005;122:171-94.
 비특허문헌 28: http://www.algonomics.com/proteinengineering/tripole_ applications.php
 특허문헌 1: WO/2007/114319
 특허문헌 2: US/2006/0019342
발명의 상세한 설명
   해결하려는 과제
 본 발명은 이와 같은 상황을 감안하여 이루어진 것으로, 그 목적은, 항체의 가변영역을 포함하는 폴리펩티드의 항원에 대한 결합활성을 유지하면서 등전점을 개변하는 방법, 항체의 혈장 중 반감기를 제어하는 방법, 혈장 중 반감기가 제어된 항체를 유효성분으로서 함유하는 의약 조성물 및 당해 항체 및 당해 항체를 유효성분으로서 포함하는 의약 조성물의 제조방법을 제공하는 것에 있다.
 또한, 본 발명은, 항IL-6 수용체 항체, 항글리피칸3 항체 및 항IL-31 수용체 항체의 CDR영역의 표면에 노출되는 아미노산 잔기의 개변에 의해, 당해 항체의 혈장 중 반감기를 제어하는 방법, 아미노산 잔기의 개변에 의해 혈장 중 반감기가 제어된 항IL-6 수용체 항체, 항글리피칸3 항체 및 항IL-31 수용체 항체, 당해 항체의 제조방법 및 당해 항체를 유효성분으로서 포함하는 의약 조성물을 제공하는 것을 목적으로 한다.
 또한 본 발명은, 인간화 항IL-6 수용체 IgG1 항체인 TOCILIZUMAB의 가변영역 및 정상영역의 아미노산 서열을 개변함으로써, 항원 중화능을 증강시키면서, 혈장 중 체류성을 향상시킴으로써 투여빈도를 적게 하여 지속적으로 치료효과를 발휘하고, 또한, 면역원성, 안전성, 물성을 개선시켜, TOCILIZUMAB보다 우수한 제2세대 분자로 되는 의약 조성물 및 그들의 의약 조성물의 제조방법을 제공하는 것도 또한 목적으로 한다.
   과제의 해결 수단
 본 발명자들은, 항체의 가변영역을 포함하는 폴리펩티드에 있어서, 당해 가변영역의 항원에 대한 결합활성을 유지하면서, 당해 폴리펩티드의 등전점을 개변하는 방법에 대해서, 예의 연구를 행하였다. 그 결과, 본 발명자들은 항체의 가변영역의 상보성 결정영역(CDR)을 구성하는 아미노산 잔기 중, 당해 가변영역의 항원에 대한 결합활성을 유지하면서, 그 등전점을 개변할 수 있는 CDR 아미노산 서열 상의 특정 위치를 발견하였다. 또한, 항체의 가변영역을 포함하는 폴리펩티드의 등전점을 조절함으로써 당해 폴리펩티드의 혈장 중 반감기를 제어할 수 있는 것, 또한, 등전점의 차를 이용함으로써, 헤테로다량체로 되는, 항체의 가변영역을 포함하는 폴리펩티드를 효율적으로 제조할 수 있는 것을 발견하였다. 구체적으로는, 항체의 가변영역을 구성하는 아미노산 서열 중의 아미노산 잔기 중, 항체 가변영역의 항원에 대한 결합활성 등의 항체가 갖는 기능이나, 그 구조에 영향을 미치지 않고, 항체분자 표면의 전하를 조절할 수 있는 특정 CDR 아미노산 서열 상의 위치를 동정(同定)하였다. 또한 본 발명자들은, 당해 항체 표면전하를 조절함으로써 등전점을 개변하고, 항체의 가변영역을 포함하는 폴리펩티드의 혈장 중 반감기를 제어할 수 있는 것을 확인하고, 이와 같이 하여 혈장 중 반감기가 제어된 항체가, 실제로 항원에 대한 결합활성을 유지하고 있는 것을 확인하였다. 또한, 본 발명자들은, 항체의 혈장 중 반감기를 제어함으로써, 항체를 비롯한 세포상해활성을 발휘하는 항체가 갖는 암세포에 대한 종양증식억제효과가 증대하는 것을 확인하여 본 발명을 완성시켰다. 또한, CDR의 전하를 조절함으로써 등전점을 개변하고, 상이한 2개 이상의 항원에 결합하는 항체로 되는 헤테로다이머를 분리·정제할 수 있는 것을 확인하였다.
 또한 본 발명자들은, 제1세대의 인간화 항IL-6 수용체 IgG1 항체인 TOCILIZUMAB의 가변영역 및 정상영역의 아미노산 서열을 개변함으로써, 약효를 증강시키면서, 혈장 중 체류성을 향상시킴으로써 투여빈도를 적게 하여 지속적으로 치료효과를 발휘하며, 또한, 면역원성, 안전성, 물성(안정성 및 균일성)을 개선시켜서, TOCILIZUMAB보다 우수한 제2세대 분자의 창제를 향해, 예의 연구를 행하였다. 그 결과, 본 발명자들은, TOCILIZUMAB의 가변영역에 있어서, 항원으로의 결합능(친화성)을 향상시키는 CDR 변이를 복수 발견하여 그 조합에 의해 대폭 친화성을 향상시키는 것에 성공하였다. 또한 본 발명자들은, 가변영역 서열의 등전점을 저하시키는 개변을 도입함으로써 혈장 중 체류성을 향상시키는 것에 성공하였다. 또한 본 발명자들은, TOCILIZUMAB의 프레임워크에 잔존하는 마우스 유래의 서열 및 가변영역에 있어서 인 실리코(in silico)로 예측된 T-cell 에피토프 펩티드의 수를 저감시켜 면역원성 리스크를 저감시키는 것에 성공하였다. 또한, 동시에 고농도에 있어서의 안정성을 향상시키는 것에도 성공하였다. 또한 본 발명자들은, TOCILIZUMAB의 정상영역에 있어서, 새로운 T-cell 에피토프 펩티드의 출현을 최소한으로 하면서, Fcγ 수용체에 결합을 나타내지 않고, 산성조건하에서의 안정성, 힌지영역의 디설피드에 유래하는 이질성(heterogeneity), H사슬 C 말단에 유래하는 이질성, 고농도 제제에 있어서의 안정성을 개선시킨 신규한 정상영역 서열을 발견하는 것에 성공하였다. 이들 CDR영역 아미노산 서열의 개변, 가변영역 아미노산 서열의 개변, 정상영역 아미노산 서열의 개변을 조합시킴으로써 TOCILIZUMAB보다 우수한 제2세대 분자의 창제에 성공하였다.
 보다 구체적으로는, 이하 [1]~[44]를 제공하는 것이다.
 [1] 항체의 가변영역을 포함하는 폴리펩티드에 있어서, 당해 가변영역의 항원에 대한 결합활성을 유지하면서 등전점을 개변하는 방법으로서, 당해 폴리펩티드의 상보성 결정영역(CDR)의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하를 개변하는 것을 포함하는 방법,
 [2] 상기 항체의 가변영역을 포함하는 폴리펩티드가 추가적으로 FcRn 결합영역을 포함하는 [1]에 기재된 방법,
 [3] 상기 항체의 가변영역을 포함하는 폴리펩티드가 IgG 항체인 [1]에 기재된 방법,
 [4] 상기 항체의 가변영역을 포함하는 폴리펩티드가 키메라 항체, 인간화 항체 또는 인간 항체인 [1]에 기재된 방법,
 [5] 상기 항체의 가변영역을 포함하는 폴리펩티드가 적어도 2종류의 항원과 결합하는 다중 특이성 폴리펩티드인 [1]에 기재된 방법,
 [6] 상기 아미노산 잔기의 전하의 개변이 아미노산 치환인 [1]에 기재된 방법,
 [7] 상기 아미노산 잔기의 전하의 개변이 이론등전점을 1.0 이상 변화시키는 개변인 [1]에 기재된 방법,
 [8] CDR영역의 표면에 노출 가능한 아미노산 잔기가, 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기 또는 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기인 [1]에 기재된 방법,
 [9] [1] 내지 [8] 중 어느 하나에 기재된 방법에 의해 얻어지는, 등전점이 개변된 항체의 가변영역을 포함하는 폴리펩티드,
 [10] [1] 내지 [8] 중 어느 하나에 기재된 방법에 의해 항체의 가변영역을 포함하는 폴리펩티드의 등전점을 개변하는 것을 포함하는, 당해 폴리펩티드의 혈장 중 약물동태를 제어하는 방법,
 [11] 상기 약물동태의 제어가, 혈장 중 클리어런스(CL), 농도곡선하면적(AUC), 평균 혈장 중 체류시간, 혈장 중 반감기(t1/2) 중 어느 하나의 파라미터의 신장 또는 감소인 [10]에 기재된 방법,
 [12] [10]에 기재된 방법에 의해 얻어지는, 혈장 중 약물동태가 제어된 항체의 가변영역을 포함하는 폴리펩티드,
 [13] 등전점이 개변된 항체 가변영역을 포함하는 폴리펩티드의 제조방법으로서, (a) 당해 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 개변되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하고,
 (b) 숙주세포를 당해 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로부터 항체 가변영역을 포함하는 폴리펩티드를 회수하는 것
 을 포함하는 방법,
 [14] 상기 항체의 가변영역을 포함하는 폴리펩티드가 추가적으로 FcRn 결합영역을 포함하는 [13]에 기재된 방법,
 [15] 상기 항체의 가변영역을 포함하는 폴리펩티드가 IgG 항체인 [13]에 기재된 방법,
 [16] 상기 항체의 가변영역을 포함하는 폴리펩티드가 키메라 항체, 인간화 항체 또는 인간 항체인 [13]에 기재된 방법,
 [17] 상기 항체의 가변영역을 포함하는 폴리펩티드가 2종 이상의 항원과 결합하는 다중 특이성 폴리펩티드인 [13]에 기재된 방법,
 [18] 상기 아미노산 잔기의 전하의 개변이 아미노산 치환인 [13]에 기재된 방법,
 [19] 상기 아미노산 잔기의 전하의 개변이 이론등전점을 1.0 이상 변화시키는 개변인 [13]에 기재된 방법,
 [20] CDR영역의 표면에 노출 가능한 아미노산 잔기가, 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기 또는 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기인 [13]에 기재된 방법,
 [21] [13] 내지 [20] 중 어느 하나에 기재된 방법에 의해 얻어지는, 등전점이 개변된 항체의 가변영역을 포함하는 폴리펩티드,
 [22] [13] 내지 [20] 중 어느 하나에 기재된 방법에 의해 항체의 가변영역을 포함하는 폴리펩티드의 등전점을 개변하는 것을 포함하는, 혈장 중 약물동태가 제어된 항체 가변영역을 포함하는 폴리펩티드의 제조방법,
 [23] 상기 약물동태의 제어가, 혈장 중 클리어런스(CL), 농도곡선하면적(AUC), 평균 혈장 중 체류시간, 혈장 중 반감기(t1/2) 중 어느 하나의 파라미터의 신장 또는 감소인 [22]에 기재된 방법,
 [24] [22]에 기재된 방법에 의해 제조된, 혈장 중 약물동태가 제어된 항체의 가변영역을 포함하는 폴리펩티드,
 [25] 항체의 가변영역을 갖는 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드의 제조방법으로서,
 (a) 당해 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 개변되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하는 것을 포함하고, 당해 핵산의 개변이, 개변 전과 비교하여, 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 증대하도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하고,
 (b) 숙주세포를 그 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로부터 다중 특이성 항체를 회수하는 것
 을 포함하는 방법,
 [26] 숙주세포 배양물로부터 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드를 회수하는 공정이 표준적인 크로마토그래피에 의해 행해지는 [25]에 기재된 방법,
 [27] 상기 핵산의 개변에 있어서, 제1 폴리펩티드의 호모다량체, 제2 폴리펩티드의 호모다량체 및 제1 폴리펩티드와 제2 폴리펩티드의 헤테로다량체의 표준적인 크로마토그래피를 사용한 분석에 의한 피크가, 개변 전과 비교하여, 보다 분리된 피크가 되도록, 핵산을 개변하는 [25]에 기재된 방법,
 [28] 상기 다중 특이성 폴리펩티드가 다중 특이성 항체인 [25]에 기재된 방법,
 [29] [27]에 기재된 방법에 의해 제조되는 다중 특이성 항체,
 [30] 상기 다중 특이성 항체가 이중 특이성 항체인 [29]에 기재된 다중 특이성 항체,
 [31] 인간 유래의 CDR, 인간 이외의 동물 유래의 CDR 및 합성 CDR로 이루어진 군으로부터 선택되는 CDR, 인간 유래의 프레임워크영역(FR) 및 인간 정상영역을 포함하는 항체로서, CDR의 표면에 노출 가능한 하나 이상의 아미노산 잔기가 야생형 CDR의 대응하는 위치의 아미노산 잔기와는 상이한 전하를 갖는 아미노산 잔기로서, 개변 전의 항체와 비교하여, 항원에 대한 결합활성을 유지하면서 등전점이 개변된 항체,
 [32] 상기 인간 정상영역이 인간 Fc영역을 포함하는 [31]에 기재된 항체,
 [33] 등전점의 개변에 의해 혈장 중 약물동태가 제어된 [31]에 기재된 항체,
 [34] 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기, 또는, 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 개변되어, 당해 아미노산 잔기의 개변 전과 비교하여, 등전점이 개변된 IgG 항체,
 [35] 상기 개변된 아미노산 잔기가, 이하의 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기로부터 선택되는 [34]에 기재된 항체;
 (a) 글루타민산(E), 아스파라긴산(D);
 (b) 리신(K), 아르기닌(R), 히스티딘(H),
 [36] 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 항체로서, 제1 폴리펩티드의 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기, 또는, 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가 전하를 갖고, 제1 폴리펩티드와 제2 폴리펩티드의 등전점이 서로 상이한 다중 특이성 항체,
 [37] 제2 폴리펩티드의 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기, 또는, 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가, 상기 제1 폴리펩티드에 있어서 선택되는 아미노산 잔기가 갖는 전하와는 반대의 전하를 갖거나, 또는 전하를 갖지 않는 [36]에 기재된 항체,
 [38] 상기 전하를 갖는 아미노산 잔기와 당해 아미노산 잔기와는 반대의 전하를 갖는 아미노산 잔기의 조합이, 이하의 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기로부터 각각 선택되는 [36]에 기재된 항체;
 (a) 글루타민산(E), 아스파라긴산(D);
 (b) 리신(K), 아르기닌(R), 히스티딘(H),
 [39] 상기 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 항체로서, 제1 폴리펩티드의 호모다량체 및 제2 폴리펩티드의 호모다량체가 표준적인 크로마토그래피를 사용한 분석에 의해 분리된 피크가 되는, [36]에 기재된 항체,
 [40] [31] 내지 [39]에 기재된 항체 및 의약적으로 혀용되는 담체를 포함하는 조성물,
 [41] [31] 내지 [39]에 기재된 항체를 구성하는 폴리펩티드를 코드하는 핵산,
 [42] [41]에 기재된 핵산을 갖는 숙주세포,
 [43] [42]에 기재된 숙주세포를 배양하는 공정, 세포배양물로부터 폴리펩티드를 회수하는 공정을 포함하는 [31] 내지 [39]에 기재된 항체의 제조방법,
 [44] 항체의 가변영역을 포함하는 폴리펩티드에 있어서, 당해 폴리펩티드의 항원에 대한 결합활성을 유지하면서, 당해 폴리펩티드의 상보성 결정영역(CDR)의 표면에 노출 가능한 아미노산 잔기를 치환하는 방법으로서, 적어도 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기, 또는, 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기를 치환하는 방법.
 또한 본 발명은 이하 [1] 내지 [38]을 제공하는 것이다.
 [1] 이하의 단계로 되는 혈중동태가 제어된 글리피칸3 항체의 제조방법;
 (a) 글리피칸3 항체의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하의 개변을 초래하는 하나 이상의 아미노산 잔기를 코드하는 핵산을 개변하고,
 (b) 당해 핵산이 발현하도록 당해 핵산을 보유하는 숙주세포를 배양하여,
 (c) 당해 숙주세포의 배양물로부터 글리피칸3 항체를 회수하는 것을 포함하는 방법,
 [2] 상기 혈중동태의 제어가, 혈중 반감기, 평균 혈중 체류시간, 혈중 클리어런스 중 어느 하나의 파라미터의 신장 또는 감축인 [1]에 기재된 방법,
 [3] 공정 (a)에 있어서의 아미노산 잔기의 전하의 개변이 아미노산 치환에 의한 [1]에 기재된 방법,
 [4] 상기 글리피칸3 항체의 표면에 노출 가능한 아미노산 잔기가, 글리피칸3 항체 중의 FcRn 결합영역 이외의 영역에 있는 [1]에 기재된 방법,
 [5] 상기 FcRn 결합영역이 Fc영역으로 되는 [4]에 기재된 방법,
 [6] 글리피칸3 항체가 IgG 항체인 [1]에 기재된 방법,
 [7] 그 전하가 개변되는 아미노산 잔기가, IgG 항체의 중쇄 가변영역 또는 경쇄 가변영역의 아미노산 잔기인 [6]에 기재된 방법,
 [8] 상기 글리피칸3 항체가 상보성 결정영역(CDR), 인간 유래의 프레임워크영역(FR) 및 인간 정상영역을 포함하는 글리피칸3 항체로서, 공정(a)에 있어서의 아미노산 잔기의 전하의 개변이, 개변에 제공하는 항체의 CDR 또는 FR 중의 항체 표면에 노출 가능한 하나 이상의 아미노산 잔기로부터, 당해 아미노산 잔기와 상이한 전하를 갖는 아미노산 잔기로의 개변인 것을 특징으로 하는 [7]에 기재된 방법,
 [9] 상기 글리피칸3 항체가, 그 Fc영역에 결합한 푸코오스 함량이 저하된 항체인 [8]에 기재된 방법,
 [10] [1] 내지 [9]에 기재된 방법에 의해 제조되는 글리피칸3 항체,
 [11] 이하의 단계로 되는 상보성 결정영역(CDR), 인간 유래의 프레임워크영역(FR) 및 인간 정상영역을 포함하는 글리피칸3 항체의 Tm값의 증대를 초래하는, 글리피칸3 항체를 구성하는 하나 이상의 아미노산 잔기의 개변을 특징으로 하는 글리피칸3 항체의 안정화방법;
 (a) 개변에 제공하는 글리피칸3 항체의 Tm값의 증대를 초래하는 하나 이상의 아미노산 잔기를 코드하는 핵산을 개변하고,
 (b) 당해 핵산이 발현하도록 당해 핵산을 보유하는 숙주세포를 배양하여,
 (c) 당해 숙주세포의 배양물로부터 항체를 회수하는 것을 포함하는 방법,
 [12] 공정(a)에 있어서의 아미노산 잔기가, 그 H사슬 또는 L사슬의 FR1영역 또는/및 FR2영역에 존재하는 것을 특징으로 하는 [11]에 기재된 방법,
 [13] [12]에 기재된 H사슬의 FR2영역의 아미노산 잔기를 VH4 서브클래스의 FR2영역의 아미노산 잔기로 치환하는 것을 특징으로 하는 [12]에 기재된 방법,
 [14] [12]에 기재된 L사슬의 FR2영역의 아미노산 잔기를 VK3 서브클래스의 FR2영역의 아미노산 잔기로 치환하는 것을 특징으로 하는 [12]에 기재된 방법,
 [15] 이하의 단계로 되는 항체의 세포상해활성을 제어하는 방법;
 (a) 세포상해활성을 갖는 항체의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하의 개변을 초래하는 하나 이상의 아미노산 잔기를 코드하는 핵산을 개변하고,
 (b) 당해 핵산이 발현하도록 당해 핵산을 보유하는 숙주세포를 배양하여,
 (c) 당해 숙주세포의 배양물로부터 항체를 회수하는 것을 포함하는 방법,
 [16] 상기 혈중동태의 제어가, 혈중 반감기, 평균 혈중 체류시간, 혈중 클리어런스 중 어느 하나의 파라미터의 제어인 [15]에 기재된 방법,
 [17] 공정(a)에 있어서의 아미노산 잔기의 전하의 개변이 아미노산 치환에 의한 [15]에 기재된 방법,
 [18] 상기 항체의 표면에 노출 가능한 아미노산 잔기가, 항체 중의 FcRn 결합영역 이외의 영역에 있는 [15]에 기재된 방법,
 [19] 상기 FcRn 결합영역이 Fc영역으로 되는 [18]에 기재된 방법,
 [20] 글리피칸3 항체가 IgG 항체인 [15]에 기재된 방법,
 [21] 그 전하가 개변되는 아미노산 잔기가, IgG 항체의 중쇄 가변영역 또는 경쇄 가변영역의 아미노산 잔기인 [20]에 기재된 방법,
 [22] 상기 항체가 인간 이외의 동물 유래의 상보성 결정영역(CDR), 인간 유래의 프레임워크영역(FR) 및 인간 정상영역을 포함하는 항체로서, 공정(a)에 있어서의 아미노산 잔기의 전하의 개변이, 개변에 제공하는 항체의 CDR 또는 FR 중의 항체 표면에 노출 가능한 하나 이상의 아미노산 잔기로부터, 당해 아미노산 잔기와 상이한 전하를 갖는 아미노산 잔기로의 개변인 것을 특징으로 하는 [21]에 기재된 방법,
 [23] 상기 항체의 Fc영역에 결합한 푸코오스 함량이 저하된 항체인 [22]에 기재된 방법,
 [24] [15] 내지 [23]에 기재된 방법에 의해 제조되는 항체,
 [25] 항체가 글리피칸3 항체인 [24]에 기재된 항체,
 [26] 서열번호:195로 표시되는 H사슬 V영역을 구성하는 아미노산 잔기에 대해 이하의 어느 하나 또는 그 이상의 치환;
 (a) 19번째의 아미노산 잔기인 K의 T로의 치환,
 (b) 43번째의 아미노산 잔기인 Q의 E로의 치환,
 (c) 63번째의 아미노산 잔기인 K의 S로의 치환,
 (d) 65번째의 아미노산 잔기인 K의 Q로의 치환,
 (e) 66번째의 아미노산 잔기인 G의 D로의 치환,
 이 실시된 H사슬 V영역 및
 서열번호:201로 표시되는 L사슬 V영역을 구성하는 아미노산 잔기에 대해 이하의 어느 하나 또는 그 이상의 치환;
 (f) 27번째의 아미노산 잔기인 Q의 E로의 치환,
 (g) 79번째의 아미노산 잔기인 K의 T로의 치환,
 (h) 82번째의 아미노산 잔기인 R의 S로의 치환,
 이 실시된 L사슬 V영역,
 을 포함하는 항체,
 [27] 서열번호:197로 표시되는 H사슬 및 서열번호:203으로 표시되는 L사슬로 되는 [26]에 기재된 항체,
 [28] 서열번호:198로 표시되는 H사슬 및 서열번호:204로 표시되는 L사슬로 되는 [26]에 기재된 항체,
 [29] 서열번호:195로 표시되는 H사슬 V영역을 구성하는 아미노산 잔기에 대해 이하의 어느 하나 또는 그 이상의 치환;
 (a) 43번째의 아미노산 잔기인 Q의 K로의 치환,
 (b) 52번째의 아미노산 잔기인 D의 N으로의 치환,
 (c) 107번째의 아미노산 잔기인 Q의 R로의 치환,
 이 실시된 H사슬 V영역 및
 서열번호:201로 표시되는 L사슬 V영역을 구성하는 아미노산 잔기에 대해 이하의 어느 하나 또는 그 이상의 치환;
 (d) 17번째의 아미노산 잔기인 E의 Q로의 치환,
 (e) 27번째의 아미노산 잔기인 Q의 R로의 치환,
 (f) 105번째의 아미노산 잔기인 Q의 R로의 치환,
 이 실시된 L사슬 V영역,
 을 포함하는 항체,
 [30] 서열번호:198로 표시되는 H사슬 가변영역 및 서열번호:204로 표시되는 L사슬 가변영역을 포함하는 [29]에 기재된 항체,
 [31] 서열번호:199로 표시되는 H사슬 가변영역 및 서열번호:205로 표시되는 L사슬 가변영역을 포함하는 [29]에 기재된 항체,
 [32] 인간 항체의 C영역을 갖는 [26] 내지 [31]에 기재된 항체,
 [33] [32]에 기재된 항체 및 의약적으로 허용되는 담체를 포함하는 조성물,
 [34] [32]에 기재된 항체를 유효성분으로서 포함하는 암치료제,
 [35] 암이 간암인 [34]에 기재된 암치료제,
 [36] [26] 내지 [31]에 기재된 항체를 구성하는 폴리펩티드를 코드하는 핵산,
 [37] [36]에 기재된 핵산을 보유하는 숙주세포,
 [38] [37]에 기재된 숙주세포를 배양하는 공정 및 세포배양물로부터 폴리펩티드를 회수하는 공정을 포함하는 [26] 내지 [31]에 기재된 항체의 제조방법.
 또한 본 발명은, 이하 [1]~[41]을 제공하는 것이다.
 [1] 이하의 (a)~(y) 중 어느 하나에 기재된 항IL-6 수용체 항체;
 (a) 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환되어 있는 CDR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (b) 서열번호:1에 기재된 아미노산 서열에 있어서 5번째의 Trp가 다른 아미노산으로 치환되어 있는 CDR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (c) 서열번호:2에 기재된 아미노산 서열에 있어서 1번째의 Tyr이 다른 아미노산으로 치환되어 있는 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (d) 서열번호:2에 기재된 아미노산 서열에 있어서 8번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (e) 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (f) 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (g) 서열번호:3에 기재된 아미노산 서열에 있어서 2번째의 Leu가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (h) 서열번호:3에 기재된 아미노산 서열에 있어서 5번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (i) 서열번호:3에 기재된 아미노산 서열에 있어서 7번째의 Ala가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (j) 서열번호:3에 기재된 아미노산 서열에 있어서 8번째의 Met가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (k) 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser 및 5번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (l) 서열번호:3에 기재된 아미노산 서열에 있어서 2번째의 Leu, 7번째의 Ala 및 8번째의 Met가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (m) 서열번호:4에 기재된 아미노산 서열에 있어서 1번째의 Arg가 다른 아미노산으로 치환되어 있는 CDR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (n) 서열번호:4에 기재된 아미노산 서열에 있어서 4번째의 Gln이 다른 아미노산으로 치환되어 있는 CDR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (o) 서열번호:4에 기재된 아미노산 서열에 있어서 9번째의 Tyr이 다른 아미노산으로 치환되어 있는 CDR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (p) 서열번호:4에 기재된 아미노산 서열에 있어서 11번째의 Asn이 다른 아미노산으로 치환되어 있는 CDR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (q) 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR2를 갖는 경쇄 가변영역을 포함하는 항체,
 (r) 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (s) 서열번호:6에 기재된 아미노산 서열에 있어서 3번째의 Gly가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (t) 서열번호:4에 기재된 아미노산 서열에 있어서 9번째의 Tyr이 다른 아미노산으로 치환되어 있는 CDR1 및 서열번호:6에 기재된 아미노산 서열에 있어서 3번째의 Gly가 다른 아미노산으로 치환되어 있는 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (u) 서열번호:6에 기재된 아미노산 서열에 있어서 5번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (v) 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln 및 5번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (w) 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR2 및 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser 및 5번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (x) (k)에 기재된 중쇄 가변영역 및 (v)에 기재된 경쇄 가변영역을 포함하는 항체, 또는
 (y) (e)의 CDR2를 추가적으로 포함하는 (x)에 기재된 항체,
 [2] 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr이 다른 아미노산으로 치환되어 있는 CDR2를 갖는 경쇄 가변영역을 포함하는 항IL-6 수용체 항체,
 [3] 이하의 (a)~(y) 중 어느 하나에 기재된 항IL-6 수용체 항체;
 (a) 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg가 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (b) 서열번호:7에 기재된 아미노산 서열에 있어서 16번째의 Gln이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (c) 서열번호:7에 기재된 아미노산 서열에 있어서 23번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (d) 서열번호:7에 기재된 아미노산 서열에 있어서 30번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (e) 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg, 16번째의 Gln, 23번째의 Thr 및 30번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (f) 서열번호:8에 기재된 아미노산 서열에 있어서 8번째의 Arg가 다른 아미노산으로 치환된 FR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (g) 서열번호:9에 기재된 아미노산 서열에 있어서 4번째의 Met가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (h) 서열번호:9에 기재된 아미노산 서열에 있어서 5번째의 Leu가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (i) 서열번호:9에 기재된 아미노산 서열에 있어서 16번째의 Arg가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (j) 서열번호:9에 기재된 아미노산 서열에 있어서 27번째의 Val이 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (k) 서열번호:9에 기재된 아미노산 서열에 있어서 4번째의 Met, 5번째의 Leu, 16번째의 Arg 및 27번째의 Val이 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (l) 서열번호:10에 기재된 아미노산 서열에 있어서 3번째의 Gln이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체,
 (m) 서열번호:11에 기재된 아미노산 서열에 있어서 18번째의 Arg가 다른 아미노산으로 치환된 FR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (n) 서열번호:12에 기재된 아미노산 서열에 있어서 11번째의 Lys가 다른 아미노산으로 치환된 FR2를 갖는 경쇄 가변영역을 포함하는 항체,
 (o) 서열번호:13에 기재된 아미노산 서열에 있어서 23번째의 Gln이 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (p) 서열번호:13에 기재된 아미노산 서열에 있어서 24번째의 Pro가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (q) 서열번호:13에 기재된 아미노산 서열에 있어서 27번째의 Ile가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (r) 서열번호:13에 기재된 아미노산 서열에 있어서 23번째의 Gln, 24번째의 Pro 및 27번째의 Ile가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (s) 서열번호:14에 기재된 아미노산 서열에 있어서 10번째의 Lys가 다른 아미노산으로 치환된 FR4를 갖는 경쇄 가변영역을 포함하는 항체,
 (t) 서열번호:10에 기재된 아미노산 서열에 있어서 5번째의 Ser이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체,
 (u) 서열번호:10에 기재된 아미노산 서열에 있어서 3번째의 Gln 및 5번째의 Ser이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체,
 (v) 서열번호:184에 기재된 아미노산 서열을 갖는 FR3를 갖는 중쇄 가변영역을 포함하는 항체,
 (w) (e)에 기재된 FR1, (f)에 기재된 FR2, (k)에 기재된 FR3 및 (l) 또는 (u)에 기재된 FR4를 포함하는 중쇄 가변영역을 포함하는 항체,
 (x) (m)에 기재된 FR1, (n)에 기재된 FR2, (r)에 기재된 FR3 및 (s)에 기재된 FR4를 포함하는 경쇄 가변영역을 포함하는 항체, 또는
 (y) (w)에 기재된 중쇄 가변영역 및 (x)에 기재된 경쇄 가변영역을 포함하는 항체,
 [4] 이하의 (a)~(l) 중 어느 하나에 기재된 항IL-6 수용체 항체;
 (a) 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환된 CDR1을 갖는 중쇄 가변영역을 포함하는 항체,
 (b) 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (c) 서열번호:2에 기재된 아미노산 서열에 있어서 16번째의 Ser이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (d) 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr 및 16번째의 Ser이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체,
 (e) 서열번호:4에 기재된 아미노산 서열에 있어서 1번째의 Arg가 다른 아미노산으로 치환된 CDR1을 갖는 경쇄 가변영역을 포함하는 항체,
 (f) 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr이 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체,
 (g) 서열번호:5에 기재된 아미노산 서열에 있어서 4번째의 Arg가 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체,
 (h) 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr 및 4번째의 Arg가 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체,
 (i) 서열번호:6에 기재된 아미노산 서열에 있어서 5번째의 Thr이 다른 아미노산으로 치환된 CDR3를 갖는 경쇄 가변영역을 포함하는 항체,
 (j) (a)에 기재된 CDR1, (d)에 기재된 CDR2 및 서열번호:3에 기재된 아미노산 서열을 갖는 CDR3를 포함하는 중쇄 가변영역을 포함하는 항체,
 (k) (e)에 기재된 CDR1, (h)에 기재된 CDR2 및 (i)에 기재된 CDR3를 포함하는 경쇄 가변영역을 포함하는 항체, 또는
 (l) (j)에 기재된 중쇄 가변영역 및 (k)에 기재된 경쇄 가변영역을 포함하는 항체,
 [5] 이하의 (a)~(f) 중 어느 하나에 기재된 항IL-6 수용체 항체;
 (a) 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산 서열로 치환된 CDR1, 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr 및 16번째의 Ser이 다른 아미노산으로 치환된 CDR2 및 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser 및 5번째의 Thr이 다른 아미노산으로 치환된 CDR3를 포함하는 중쇄 가변영역을 포함하는 항체,
 (b) 서열번호:4에 기재된 아미노산 서열에 있어서 1번째의 Arg가 다른 아미노산으로 치환된 CDR1, 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr 및 4번째의 Arg가 다른 아미노산으로 치환된 CDR2 및 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln 및 5번째의 Thr이 다른 아미노산으로 치환된 CDR3를 포함하는 경쇄 가변영역을 포함하는 항체,
 (c) 서열번호:22에 기재된 아미노산 서열을 갖는 중쇄 가변영역을 포함하는 항체,
 (d) 서열번호:23에 기재된 아미노산 서열을 갖는 경쇄 가변영역을 포함하는 항체,
 (e) (a)에 기재된 중쇄 가변영역 및 (b)에 기재된 경쇄 가변영역을 포함하는 항체,
 또는
 (f) (c)에 기재된 중쇄 가변영역 및 (d)에 기재된 경쇄 가변영역을 포함하는 항체,
 [6] 이하의 (a)~(c) 중 어느 하나에 기재된 인간 항체 정상영역;
 (a) 서열번호:19에 기재된 아미노산 서열에 있어서, 329번째(EU 넘버링 446번째)의 Gly와 330번째(EU 넘버링 447번째)의 Lys가 양쪽 결손되어 있는 것을 특징으로 하는 인간 항체 정상영역,
 (b) 서열번호:20에 기재된 아미노산 서열에 있어서, 325번째(EU 넘버링 446번째)의 Gly와 326번째(EU 넘버링 447번째)의 Lys가 양쪽 결손되어 있는 것을 특징으로 하는 인간 항체 정상영역,
 (c) 서열번호:21에 기재된 아미노산 서열에 있어서, 326번째(EU 넘버링 446번째)의 Gly와 327번째(EU 넘버링 447번째)의 Lys가 양쪽 결손되어 있는 것을 특징으로 하는 인간 항체 정상영역,
 [7] 서열번호:20에 기재된 아미노산 서열에 있어서, 209번째(EU 넘버링 330번째), 210번째(EU 넘버링 331번째) 및 218번째(EU 넘버링 339번째)의 아미노산이 다른 아미노산으로 치환된 IgG2 정상영역,
 [8] 서열번호:20에 기재된 아미노산 서열에 있어서, 276번째(EU 넘버링 397번째)의 아미노산이 다른 아미노산으로 치환된 IgG2 정상영역,
 [9] 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131번째), 102번째(EU 넘버링 219번째) 및/또는 16번째(EU 넘버링 133번째)의 아미노산이 다른 아미노산으로 치환된 IgG2 정상영역,
 [10] 서열번호:20에 기재된 아미노산 서열에 있어서, 20번째(EU 넘버링 137번째) 및 21번째(EU 넘버링 138번째)의 아미노산이 추가적으로 다른 아미노산으로 치환되어 있는 것을 특징으로 하는, [9]에 기재된 IgG2 정상영역,
 [11] 서열번호:20에 기재된 아미노산 서열에 있어서, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg 및/또는 298번째(EU 넘버링 419번째)의 Gln이 다른 아미노산으로 치환된 IgG2 정상영역,
 [12] 서열번호:20에 기재된 아미노산 서열에 있어서, 209번째(EU 넘버링 330번째), 210번째(EU 넘버링 331번째), 218번째(EU 넘버링 339번째), 276번째(EU 넘버링 397번째), 14번째(EU 넘버링 131번째), 16번째(EU 넘버링 133번째), 102번째(EU 넘버링 219번째), 20번째(EU 넘버링 137번째) 및 21번째(EU 넘버링 138번째)의 아미노산이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [13] [12]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [14] 서열번호:20에 기재된 아미노산 서열에 있어서, 276번째(EU 넘버링 397번째), 14번째(EU 넘버링 131번째), 16번째(EU 넘버링 133번째), 102번째(EU 넘버링 219번째), 20번째(EU 넘버링 137번째) 및 21번째(EU 넘버링 138번째)의 아미노산이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [15] [14]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [16] 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu, 21번째(EU 넘버링 138번째)의 Ser, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg 및 298번째(EU 넘버링 419번째)의 Gln이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [17] [16]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [18] 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu, 21번째(EU 넘버링 138번째)의 Ser, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg, 298번째(EU 넘버링 419번째)의 Gln 및 313번째(EU 넘버링 434번째)의 Asn이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [19] [18]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [20] 서열번호:21에 기재된 아미노산 서열에 있어서, 289번째(EU 넘버링 409번째)의 아미노산이 다른 아미노산으로 치환되어 있는 것을 특징으로 하는 IgG4 정상영역,
 [21] 서열번호:21에 기재된 아미노산 서열에 있어서, 289번째(EU 넘버링 409번째), 14번째, 16번째, 20번째, 21번째, 97번째, 100번째, 102번째, 103번째, 104번째 및 105번째(EU 넘버링 131, 133, 137, 138, 214, 217, 219, 220, 221, 222번째), 113번째, 114번째 및 115번째(EU 넘버링 233, 234, 235번째)의 아미노산이 다른 아미노산으로 치환되고, 또한 116번째(EU 넘버링 236번째)의 아미노산이 결손된 아미노산 서열을 갖는 IgG4 정상영역,
 [22] [21]에 기재된 IgG4 정상영역에 있어서, 추가적으로 326번째(EU 넘버링 446번째)의 Gly와 327번째(EU 넘버링 447번째)의 Lys가 결실된 IgG4 정상영역,
 [23] 서열번호:20에 기재된 아미노산 서열에 있어서, 209번째(EU 넘버링 330번째)의 Ala, 210번째(EU 넘버링 331번째)의 Pro, 218번째(EU 넘버링 339번째)의 Thr, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu, 21번째(EU 넘버링 138번째)의 Ser이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [24] [23]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [25] 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131)의 Cys, 16번째(EU 넘버링 133)의 Arg, 102번째(EU 넘버링 219)의 Cys, 20번째(EU 넘버링 137)의 Glu, 21번째(EU 넘버링 138)의 Ser이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역,
 [26] [25]에 기재된 IgG2 정상영역에 있어서, 추가적으로 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역,
 [27] 서열번호:24에 기재된 아미노산 서열을 갖는 정상영역,
 [28] 서열번호:118에 기재된 아미노산 서열을 갖는 정상영역,
 [29] 서열번호:25에 기재된 아미노산 서열을 갖는 정상영역,
 [30] 서열번호:151에 기재된 아미노산 서열을 갖는 정상영역,
 [31] 서열번호:152에 기재된 아미노산 서열을 갖는 정상영역,
 [32] 서열번호:153에 기재된 아미노산 서열을 갖는 정상영역,
 [33] 서열번호:164에 기재된 아미노산 서열을 갖는 정상영역,
 [34] 서열번호:194(M40△GK)에 기재된 아미노산 서열을 갖는 인간 항체 정상영역,
 [35] 서열번호:192(M86△GK)에 기재된 아미노산 서열을 갖는 인간 항체 정상영역,
 [36] [6] 내지 [35] 중 어느 하나에 기재된 정상영역을 갖는 항체,
 [37] IL-6 수용체에 결합하는 것을 특징으로 하는, [36]에 기재된 항체,
 [38] IL-6 수용체로의 결합활성이 1 nM 이하인 항인간 IL-6 수용체 항체,
 [39] 전장 항체의 실측등전점이 7.0 이하 또는 가변영역의 이론등전점이 5.0 이하인 항인간 IL-6 수용체 항체,
 [40] 20 mM Histidine-HCl, 150 mM NaCl, pH 6.5~7.0의 완충액 하에서 항체농도가 100 ㎎/mL인 조건하에 있어서, 25℃에서 1개월 경과 후의 항체의 회합체비율의 증가가 0.3% 이하인 것을 특징으로 하는 항IL-6 수용체 항체,
 [41] [36] 내지 [40] 중 어느 하나에 기재된 항체를 포함하는 의약 조성물.
도면의 간단한 설명
 도 1은 WT와 RD_6의 BaF/gp130 중화활성을 나타내는 그래프이다.
도 2는 rhIL-s6R(R&D systems)과 WT의 상호작용의 센서그램(sensorgram)을 나타내는 그래프이다.
도 3은 rhIL-s6R(R&D systems)과 RD_6의 상호작용의 센서그램을 나타내는 그래프이다.
도 4a는 WT와 비교하여 친화성·중화활성이 향상되는 CDR 변이의 리스트를 나타내는 도면이다.
도 4b는 도 4a의 계속을 나타내는 도면이다.
도 5는 조합에 의해 친화성·중화활성이 향상되는 CDR 변이의 리스트를 나타내는 도면이다.
도 6은 WT와 RDC23의 BaF/gp130 중화활성을 나타내는 그래프이다.
도 7은 rhIL-s6R(R&D systems)과 RDC23의 상호작용의 센서그램을 나타내는 그래프이다.
도 8은 rhsIL-6R과 WT의 상호작용의 센서그램을 나타내는 그래프이다.
도 9는 rhsIL-6R과 RDC23의 상호작용의 센서그램을 나타내는 그래프이다.
도 10은 SR344와 WT의 상호작용의 센서그램을 나타내는 그래프이다.
도 11은 SR344와 RDC23의 상호작용의 센서그램을 나타내는 그래프이다.
도 12는 WT와 H53L28의 BaF/gp130 중화활성을 나타내는 그래프이다.
도 13은 SR344와 H53/L28의 상호작용의 센서그램을 나타내는 그래프이다.
도 14는 WT, H53/L28을 마우스에 정맥 내 투여 후의 혈장 중 농도추이를 나타내는 그래프이다.
도 15는 WT, H53/L28을 마우스에 피하투여 후의 혈장 중 농도추이를 나타내는 그래프이다.
도 16은 WT와 PF1의 BaF/gp130 중화활성을 나타내는 그래프이다.
도 17은 SR344와 PF1의 상호작용의 센서그램을 나타내는 그래프이다.
도 18은 WT, PF1의 고농도 안정성 시험결과를 나타내는 그래프이다.
도 19는 WT, PF1을 인간 IL-6 수용체 형질전환 마우스에 정맥 내 투여 후의 혈장 중 농도추이를 나타내는 그래프이다.
도 20은 WT, PF1을 인간 IL-6 수용체 형질전환 마우스에 정맥 내 투여 후의 비결합형 인간 가용형 IL-6 수용체 농도추이를 나타낸 그래프이다.
도 21은 염산 용출법에 의해 정제한 WT-IgG1, WT-IgG2, WT-IgG4, IgG2-M397V, IgG4-R409K의 겔 여과 크로마토그래피에 의한 회합체 함량의 분석결과를 나타내는 그래프이다.
도 22는 WT-IgG1, WT-IgG2, WT-IgG4의 양이온 교환 크로마토그래피(IEC) 분석결과를 나타내는 도면이다.
도 23은 WT-IgG2의 힌지영역의 추정 디설피드 결합양식을 나타내는 도면이다.
도 24는 WT-IgG2-SKSC의 힌지영역의 추정 디설피드 결합양식을 나타내는 도면이다.
도 25는 WT-IgG2와 IgG2-SKSC의 양이온 교환 크로마토그래피(IEC) 분석결과를 나타내는 도면이다.
도 26은 인간화 PM1 항체, H사슬 C말단 △K 항체, H사슬 C말단 △GK 항체의 양이온 교환 크로마토그래피(IEC) 분석결과를 나타내는 도면이다.
도 27은 WT-IgG1, WT-IgG2, WT-IgG4, WT-M14△GK, WT-M17△GK, WT-M11△GK의 FcγRI에 대한 결합량의 비교를 나타내는 도면이다.
도 28은 WT-IgG1, WT-IgG2, WT-IgG4, WT-M14△GK, WT-M17△GK, WT-M11△GK의 FcγRIIa에 대한 결합량의 비교를 나타내는 도면이다.
도 29는 WT-IgG1, WT-IgG2, WT-IgG4, WT-M14△GK, WT-M17△GK, WT-M11△GK의 FcγRIIb에 대한 결합량의 비교를 나타내는 도면이다.
도 30은 WT-IgG1, WT-IgG2, WT-IgG4, WT-M14△GK, WT-M17△GK, WT-M11△GK의 FcγRIIIa(Val)에 대한 결합량의 비교를 나타내는 도면이다.
도 31은 WT-IgG1, WT-M14△GK, WT-M17△GK, WT-M11△GK의 고농도 안정성시험에 있어서의 회합체 증가량을 나타내는 그래프이다.
도 32는 WT-IgG1, WT-M14△GK, WT-M17△GK, WT-M11△GK의 고농도 안정성시험에 있어서의 Fab 단편 증가량을 나타내는 그래프이다.
도 33은 WT-IgG2와 WT-M14△GK와 WT-M31△GK의 양이온 교환 크로마토그래피(IEC) 분석결과를 나타내는 도면이다.
도 34는 WT와 F2H/L39-IgG1의 BaF/gp130 중화활성을 나타내는 그래프이다.
도 35는 게잡이원숭이에 있어서 WT와 PF1과 F2H/L39-IgG1을 1.0 ㎎/㎏ 피하투여했을 때의 항체 혈장 중 농도추이를 나타내는 그래프이다.
도 36는 게잡이원숭이에 있어서의 WT와 F2H/L39-IgG1 투여군의 CRP 농도추이를 나타내는 그래프이다.
도 37은 게잡이원숭이에 있어서의 WT와 F2H/L39-IgG1 투여군의 비결합형 게잡이원숭이 IL-6 수용체 농도추이를 나타내는 그래프이다.
도 38은 WT-IgG1 및 WT-M14를 인간 FcRn 형질전환 마우스에 정맥 내 투여 후의 혈장 중 농도추이를 나타낸 그래프이다.
도 39는 WT-IgG1, WT-M14 및 WT-M58을 인간 FcRn 형질전환 마우스에 정맥 내 투여 후의 혈장 중 농도추이를 나타낸 그래프이다.
도 40은 WT-IgG1, WT-M44, WT-M58, WT-M73의 인간 FcRn 형질전환 마우스에 정맥 내 투여 후의 혈장 중 농도추이를 나타낸 그래프이다.
도 41은 항IL-6 수용체 항체 WT, 항IL-6 수용체 항체 F2H/L39, 항IL-31 수용체 항체 H0L0, 항RANKL 항체인 DNS의 정상영역이 미치는 이질성으로의 영향을 양이온 교환 크로마토그래피에 의해 평가한 도면이다.
도 42는 항IL-6 수용체 항체 WT, 항IL-6 수용체 항체 F2H/L39의 CH1 도메인의 시스테인이 미치는 이질성으로의 영향을 양이온 교환 크로마토그래피에 의해 평가한 도면이다.
도 43은 항IL-6 수용체 항체 WT의 CH1 도메인의 시스테인이 미치는 변성 피크로의 영향을 DSC에 의해 평가한 도면이다.
도 44는 TOCILIZUMAB, 대조 및 Fv5-M83의 BaF/gp130에 있어서의 중화활성을 나타내는 그래프이다.
도 45는 TOCILIZUMAB, Fv3-M73및 Fv4-M73의 BaF/gp130에 있어서의 중화활성을 나타내는 그래프이다.
도 46은 TOCILIZUMAB, 대조, Fv3-M73, Fv4-M73 및 Fv5-M83을 게잡이원숭이에 정맥 내 투여 후의 혈장 중 농도추이를 나타낸 그래프이다.
도 47은 TOCILIZUMAB, 대조, Fv3-M73, Fv4-M73 및 Fv5-M83을 게잡이원숭이에 정맥 내 투여 후의 CRP 농도추이를 나타낸 그래프이다.
도 48은 TOCILIZUMAB, 대조, Fv3-M73, Fv4-M73 및 Fv5-M83을 게잡이원숭이에 정맥 내 투여 후의 가용형 IL-6 수용체의 중화율의 추이를 나타낸 그래프이다.
도 49는 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 DSC(시차주사 열량계) 측정으로부터 얻어진 차트이다.
도 50은 고 pI 등전점 전기영동에 있어서의 H0L0 항체 및 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 영동상이다.
도 51은 저 pI 등전점 전기영동에 있어서의 H0L0 항체 및 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 영동상이다.
도 52는 H15L4 항체 및 H0L0 항체를 사용한 경합 ELISA에 의한 항원인 글리피칸3에 대한 결합활성을 나타내는 도면이다.
도 53은 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체 및 H0L0 항체를 사용한 경합 ELISA에 의한 항원인 글리피칸3에 대한 결합활성을 나타내는 도면이다.
도 54는 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체 및 H0L0 항체를 사용한 경합 ELISA에 의한 항원인 글리피칸3에 대한 결합활성을 나타내는 도면이다.
도 55는 H0L0 항체, Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체 및 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 인간 간암이식 마우스 모델에 있어서의 항종양 효과를 나타낸다.
도 56은 H0L0 항체, Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체 및 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 인간 간암이식 마우스 모델에 있어서의 항체 혈장 중 농도를 나타낸다.
도 57은 인간 간암세포주 Hep G2 세포에 대한 각 피험 항체에 의한 ADCC활성을 나타낸다.
도 58은 6R_b_H1L1, 6R_b_H2L2, 6R_b_H2L3, 6R_b_H2L4의 BaF/6R에 있어서의 IL-6 수용체 중화활성을 나타내는 도면이다.
도 59는 GPC_H1L1 항체 및 GPC_H2L2 항체를 사용한 경합 ELISA에 의한 항원인 글리피칸3에 대한 결합활성을 나타내는 도면이다.
도 60은 GPC_H2L2 항체 및 GPC_H3L3 항체를 사용한 경합 ELISA에 의한 항원인 글리피칸3에 대한 결합활성을 나타내는 도면이다.
도 61은 6R_a_H1H3L3, GPC3_H2H3L3 및 31R_H1aH2aL2의 양이온 교환 크로마토그래피에 의한 A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머의 피크 분리를 나타내는 도면이다.
발명을 실시하기 위한 구체적인 내용
 본 발명은, 항체의 가변영역을 포함하는 폴리펩티드에 있어서, 당해 가변영역의 항원에 대한 결합활성을 유지하면서 등전점을 개변하는 방법으로서, 당해 폴리펩티드의 상보성 결정영역(CDR)의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하를 변환하는 것을 포함하는 방법을 제공한다. 또한 본 발명은, 당해 방법에 의해 얻어지는 등전점이 개변된 항체의 가변영역을 포함하는 폴리펩티드(예를 들면, 인간 유래의 CDR, 인간 이외의 동물 유래의 CDR 및 합성 CDR로 이루어진 군으로부터 선택되는 CDR, 인간 유래의 프레임워크영역(FR) 및 인간 정상영역을 포함하는 항체로서, CDR의 표면에 노출 가능한 하나 이상의 아미노산 잔기가 야생형 CDR이 대응하는 위치의 아미노산 잔기와는 상이한 전하를 갖는 아미노산 잔기로서, 개변 전의 항체와 비교하여, 항원에 대한 결합활성을 유지하면서 등전점이 개변된 항체)를 제공한다.
 본 발명의 방법의 바람직한 태양으로서는, 항체의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하를 개변하는 것을 포함하는 방법이다. 즉, 항체의 아미노산 잔기의 전하를 개변하고, 그 등전점(pI)을 변화시킴으로써, 당해 항체의 혈장 중 약물동태(혈중동태)를 제어할 수 있다. 그 결과로서, 혈장 중 약물동태가 제어된 항체는, 제어되지 않는 항체에 비해, 예를 들면, 암세포에 대한 보다 우수한 항종양활성을 발휘할 수 있다.
 본 발명의 방법에 있어서, 항원에 대한 결합활성을 유지한다는 것은, 개변 전의 펩티드의 결합활성과 비교하여 적어도 80% 이상, 바람직하게는 85% 이상, 특히 바람직하게는 90% 이상의 활성을 갖는 것을 의미한다. 또한, 항체가 항원에 결합했을 때, 당해 항체가 갖는 기능이 유지되는 정도의 결합활성이 유지되어 있으면 되어, 예를 들면, 생리조건하, 37℃에 있어서 측정되는 친화성이 100 nM 이하이면 되고, 바람직하게는 50 nM 이하, 보다 바람직하게는 10 nM 이하, 더욱 바람직하게는 1 nM 이하이다. 본 발명의 방법에 의해 얻어지는 등전점이 개변된 항체의 가변영역을 포함하는 폴리펩티드가, 항원에 대한 결합활성을 유지하고 있는지 여부는, 공지의 방법, 예를 들면, BIACORE(분자간 상호작용 해석), 세포증식 어세이, ELISA(효소결합 면역흡착 검정법), EIA(효소면역측정법), RIA(방사면역측정법) 또는 형광면역법 등에 의해 측정하는 것이 가능하다.
 본 발명의 「항체의 가변영역을 포함하는 폴리펩티드」로서는, 예를 들면 항체, 저분자화합물, Scaffold 단백질 등을 들 수 있으나 이들에 한정되지 않는다.
 본 발명에 있어서 Scaffold 단백질은, 하나 이상의 항원에 결합할 수 있는 입체구조적으로 안정한 펩티드이면 사용할 수 있다. 그와 같은 펩티드로서는, 예를 들면, 항체 가변영역 단편, 피브로넥틴, Protein A 도메인, LDL 수용체 A 도메인, 리포칼린 등 외에, Nygren등(Current Opinion in Structural Biology, 7:463-469(1997), Journal of Immunol Methods, 290:3-28(2004)), Binz등(Nature Biotech 23:1257-1266(2005)), Hosse등(Protein Science 15:14-27(2006))에 기재된 분자를 들 수 있다.
 본 발명에 있어서, 「항체」라는 용어는 가장 넓은 의미로 사용되고, 목적하는 생물학적 활성을 나타내는 한, 단일클론항체, 다중클론항체, 항체 변이체(키메라 항체, 인간화 항체, 저분자화 항체(항체 단편도 포함함), 다중 특이성 항체 등)가 포함된다. 본 발명에 있어서는, 이들 항체의 취득(제작)시에, 본 발명의 항체 개변방법을 바람직하게 사용할 수 있다.
 본 발명에 있어서의 「항체」에는, 전술한 바와 같이 아미노산 잔기의 전하를 개변한 항체에 대해서, 추가적으로 아미노산의 치환, 결실, 부가 및/또는 삽입 등에 의해, 아미노산 서열이 개변된 항체가 포함된다. 또한, 아미노산의 치환, 결실, 부가 및/또는 삽입, 또는 키메라화나 인간화 등에 의해, 아미노산 서열이 개변된 항체에 대해서, 추가적으로, 아미노산 잔기의 전하가 개변된 항체가 포함된다. 즉, 마우스 항체를 인간화하는 공정과 동시에 개변해도 되고, 또는, 인간화 항체를 추가적으로 개변하는 것이어도 된다.
 아미노산의 치환, 결실, 부가 및/또는 삽입, 및 인간화, 키메라화 등의 아미노산 서열의 개변은, 당업자에게 공지의 방법에 의해 행하는 것이 가능하다. 마찬가지로, 본 발명에 있어서의 항체를 재조합 항체로서 제작할 때 이용하는 항체의 가변영역 및 정상영역도, 아미노산의 치환, 결실, 부가 및/또는 삽입, 또는 키메라화나 인간화 등에 의해 그 아미노산 서열을 개변해도 된다.
 본 발명에 있어서의 항체는 마우스 항체, 인간 항체, 랫트 항체, 토끼 항체, 염소 항체, 낙타 항체 등, 어떤 동물 유래의 항체여도 된다. 또한, 예를 들면, 키메라 항체 중에서도 인간화 항체 등의 아미노산 서열을 치환한 개변 항체여도 된다. 또한, 각종 분자를 결합시킨 항체 수식물, 항체 단편, 저분자 항체 등 어떠한 항체여도 된다.
 「키메라 항체」란, 상이한 동물 유래의 서열을 조합시켜서 제작되는 항체이다. 예를 들면, 마우스 항체의 중쇄, 경쇄의 가변(V)영역과 인간 항체의 중쇄, 경쇄의 정상(C)영역으로 되는 항체를 예시할 수 있다. 키메라 항체의 제작은 공지이고, 예를 들면, 항체 V영역을 코드하는 DNA를 인간 항체 C영역을 코드하는 DNA와 연결하고, 이것을 발현벡터에 삽입하고 숙주에 도입하여 생산시킴으로써 키메라 항체를 얻을 수 있다.
 또한 본 발명에 있어서의 저분자화 항체는, 항원으로의 결합능을 가지고 있으면 특별히 그 구조, 제조법 등은 한정되지 않는다. 저분자화 항체 중에는, 전장 항체보다도 높은 활성을 갖는 항체도 존재한다(Orita et al., Blood(2005) 105: 562-566). 본 명세서에 있어서, 「저분자화 항체」란, 전장 항체(whole antibody, 예를 들면 whole IgG 등)의 일부분이면 특별히 한정되지 않으나, 중쇄 가변영역(VH) 또는 경쇄 가변영역(VL)을 포함하고 있는 것이 바람직하다. 바람직한 항체 단편의 예로서는, 예를 들면, Fab, F(ab')2, Fab', Fv 등을 들 수 있다. 항체 단편 중의, VH 또는 VL의 아미노산 서열은, 치환, 결실, 부가 및/또는 삽입에 의해 개변되어 있어도 된다. 또한 항원으로의 결합능을 유지하는 한, VH 및 VL의 일부를 결손시켜도 된다. 예를 들면, 전술한 항체 단편 중 「Fv」는, 완전한 항원인식부위와 결합부위를 포함하는 최소의 항체 단편이다. 「Fv」는, 하나의 VH 및 하나의 VL이 비공유 결합에 의해 강하게 결합한 다이머(VH-VL 다이머)이다. 각 가변영역의 3개의 상보성 결정영역(complementarity determining region; CDR)에 의해, VH-VL 다이머의 표면에 항원 결합부위를 형성한다. 6개의 CDR이 항체에 항원 결합부위를 부여하고 있다. 그러나, 하나의 가변영역(또는, 항원에 특이적인 3개의 CDR만을 포함하는 Fv의 절반)이어도, 전결합부위보다도 친화성은 낮으나, 항원을 인식하고, 결합하는 능력을 갖는다. 따라서, 이와 같은 Fv보다 작은 분자도 본 발명에 있어서의 저분자화 항체에 포함된다. 또한, 저분자화 항체의 가변영역은 키메라화나 인간화되어 있어도 된다.
 저분자화 항체는, VH와 VL의 양쪽을 포함하고 있는 것이 바람직하다. 저분자화 항체의 예로서는, Fab, Fab', F(ab')2 및 Fv 등의 항체 단편, 및 항체 단편을 이용해서 제작될 수 있는 scFv(단일 사슬 Fv)(Huston et al., Proc. Natl. Acad. Sci. USA (1988) 85: 5879-83; Pluckthun「The Pharmacology of Monoclonal Antibodies」Vol.113, Resenburg 및 Moore편, Springer Verlag, New York, pp.269-315, (1994)), Diabody(Holliger et al., Proc. Natl. Acad. Sci. USA (1993) 90: 6444-8; EP404097호; WO93/11161호; Johnson et al., Method in Enzymology (1991) 203: 88-98; Holliger et al., Protein Engineering (1996) 9: 299-305; Perisic et al., Structure (1994) 2: 1217-26; John et al., Protein Engineering (1999) 12(7): 597-604; Atwell et al., Mol.Immunol. (1996) 33: 1301-12), sc(Fv)2(Hudson et al, J Immunol. Methods (1999) 231: 177-89 ; Orita et al., Blood(2005) 105: 562-566), Triabody(Journal of Immunological Methods (1999) 231: 177-89) 및 Tandem Diabody(Cancer Research (2000) 60: 4336-41) 등을 들 수 있다.
 항체 단편은, 항체를 효소, 예를 들면 파파인, 펩신 등의 프로테아제에 의해 처리해서 얻을 수 있다(Morimoto et al., J. Biochem. Biophys. Methods (1992) 24: 107-17; Brennan et al., Science (1985) 229: 81 참조). 또한, 그 항체 단편의 아미노산 서열을 토대로 하여, 유전자 재조합에 의해 제조하는 것도 가능하다.
 항체 단편을 개변한 구조를 갖는 저분자화 항체는, 효소처리 또는 유전자 재조합에 의해 얻어진 항체 단편을 이용하여 구축할 수 있다. 또는, 저분자화 항체 전체를 코드하는 유전자를 구축하고, 이것을 발현벡터에 도입한 후, 적당한 숙주세포에서 발현시키는 것도 가능하다(예를 들면, Co et al., J. Immunol. (1994) 152: 2968-76; Better and Horwitz, Methods Enzymol. (1989) 178: 476-96; Pluckthun and Skerra, Methods Enzymol. (1989) 178: 497-515; Lamoyi, Methods Enzymol. (1986) 121: 652-63; Rousseaux et al., Methods Enzymol. (1986) 121: 663-9; Bird and Walker, Trends Biotechnol. (1991) 9: 132-7 참조).
 또한, 상기 「scFv」는, 2개의 가변영역을 필요에 따라 링커 등을 매개로 하여 결합시킨 단일 사슬 폴리펩티드이다. scFv에 포함되는 2개의 가변영역은, 통상, 하나의 VH와 하나의 VL이나, 2개의 VH 또는 2개의 VL이어도 된다. 일반적으로 scFv 폴리펩티드는, VH 및 VL 도메인 사이에 링커를 포함하고, 그것에 의해 항원 결합을 위해 필요한 VH 및 VL의 쌍부분(paired portion)이 형성된다. 통상, 동일한 분자 내에서 VH 및 VL 사이에서 쌍부분을 형성시키기 위해서, 일반적으로, VH 및 VL을 연결하는 링커를 10 아미노산 이상의 길이의 펩티드 링커로 한다. 그러나, 본 발명에 있어서의 scFv의 링커는, scFv의 형성을 방해하지 않는 한, 이와 같은 펩티드 링커에 한정되지 않는다. scFv의 총설로서, Pluckthun『The Pharmacology of Monoclonal Antibody』Vol.113(Rosenburg and Moore ed., Springer Verlag, NY, pp.269-315 (1994))를 참조할 수 있다.
 또한, 「디아바디(diabody;Db)」는, 유전자 융합에 의해 구축된 2가(bivalent)의 항체 단편을 가리킨다(P.Holliger et al., Proc.Natl.Acad.Sci.USA 90: 6444-6448 (1993), EP404,097호, WO93/11161호 등). 디아바디는, 2개의 폴리펩티드 사슬로 구성되는 다이머로, 폴리펩티드 사슬은 각각, 동일한 사슬 중에서 경쇄 가변영역(VL) 및 중쇄 가변영역(VH)이, 서로 결합할 수 없을 정도로 짧아, 예를 들면, 5잔기 정도의 링커에 의해 결합되어 있다. 동일 폴리펩티드 사슬 상에 코드되는 VL과 VH는, 그 사이의 링커가 짧기 때문에 단쇄 V영역 프래그먼트를 형성할 수 없어 이량체를 형성하기 때문에, 디아바디는 2개의 항원 결합부위를 갖게 된다. 이때 2개의 상이한 에피토프(a,b)에 대한 VL과 VH를 VLa-VHb와 VLb-VHa의 조합으로 5잔기 정도의 링커로 결합한 것을 동시에 발현시키면 이중 특이성 Db로서 분비된다.
 Diabody는, 2분자의 scFv를 포함하는 것으로부터, 4개의 가변영역을 포함하고, 그 결과, 2개의 항원 결합부위를 갖는 것이 된다. 다이머를 형성시키지 않는 scFv의 경우와 달리, Diabody의 형성을 목적으로 하는 경우, 통상, 각 scFv 분자 내의 VH 및 VL 사이를 연결하는 링커는, 펩티드 링커로 하는 경우에는, 5 아미노산 전후의 것으로 한다. 그러나, Diabody를 형성하는 scFv의 링커는, scFv의 발현을 방해하지 않고, Diabody의 형성을 방해하지 않는 한, 이와 같은 펩티드 링커에 한정되지 않는다.
 복수 있는 항체의 아이소타입 중, IgG 항체는 그 분자량이 충분히 크기 때문에, 그 주요한 대사경로는 신배설(renal excretion)에 의한 경로는 아니다. Fc영역을 그 분자의 일부분으로서 갖는 IgG 항체는, 혈관 등의 내피세포에서 발현하고 있는 태아성 Fc 수용체(FcRn)의 샐비지 경로(salvage pathway)에 의해 재활용됨으로써, 긴 생체 내 반감기를 갖는 것이 알려져 있다. IgG 항체는 주로 내피세포에 있어서의 대사경로에 의해 대사되는 것으로 생각되고 있다(He XY, Xu Z, Melrose J, Mullowney A, Vasquez M, Queen C, Vexler V, Klingbeil C, Co MS, Berg EL. Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin. J Immunol. (1998), 160(2), 1029-35). 즉, 내피세포에 비특이적으로 삽입된 IgG 항체가 FcRn에 결합함으로써 IgG 항체는 재활용되는 한편으로, 결합할 수 없었던 IgG 항체는 대사된다고 생각되고 있다. FcRn으로의 결합활성이 저하되도록 그 Fc 부분이 개변된 IgG 항체의 혈장 중 반감기는 짧아진다. 반대로 FcRn으로의 결합활성을 높이기 위해서 IgG 항체의 Fc영역을 구성하는 아미노산 잔기를 개변함으로써, IgG 항체의 혈장 중 반감기는 신장될 수 있다(He XY, Xu Z, Melrose J, Mullowney A, Vasquez M, Queen C, Vexler V, Klingbeil C, Co MS, Berg EL. Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin. J Immunol. (1998), 160(2), 1029-35). 상기한 바와 같이, 종래의 IgG 항체의 혈장 중 약물동태의 제어방법은, Fc영역을 구성하는 아미노산 잔기를 개변하는 것에 의한 FcRn으로의 결합활성의 개변에 의해 행해져 왔다. 그러나, 하기의 실시예에서도 나타내는 바와 같이, 본 발명에 있어서는, 항체의 혈장 중 반감기는 높은 상관을 가지고 pI에 의존하는 것이 명백해졌다. 즉, 그 개변이 면역원성의 획득을 초래할 가능성이 있는 Fc를 구성하는 아미노산 서열을 개변하지 않고, 항체의 혈장 중 반감기를 제어하는 것이 가능한 것이 나타내어졌다.
 특정 이론에 구속되는 것을 의도하는 것은 아니나, 본 발명자들은 현재 다음과 같이 생각하고 있다. 내피세포로의 비특이적인 IgG 항체의 삽입속도는, 음전하를 띠는 세포 표면과 IgG 항체의 물리화학적인 클론 상호작용에 의존한다고 생각된다. 그 때문에, IgG 항체의 pI를 저하(상승)시킴으로써 클론 상호작용이 저감(증대)됨으로써 내피세포로의 비특이적인 삽입이 감소(증대)하는 결과, 내피세포에 있어서의 대사를 감소(증대)시킴으로써 혈장 중 약물동태를 제어할 수 있었다고 생각된다. 내피세포와 세포 표면 음전하의 클론 상호작용은 물리화학적인 상호작용이기 때문에, 이 상호작용은 항체를 구성하는 아미노산 서열 자체에 일의적으로 의존하지 않는다고 생각된다. 그 때문에, 본 발명에서 발견된 혈장 중 약물동태의 제어방법은, 특정 항체에만 적용되는 것이 아니라, 항체의 가변영역을 포함하는 임의의 폴리펩티드에 널리 적용 가능하다. 그와 같은 펩티드로서는, 분자량 5만 이상의 펩티드가 바람직하고, 분자량 10만 이상의 펩티드가 보다 바람직하며, 또한, 분자량 14만 이상의 펩티드가 바람직하다. 이와 같은 펩티드라면, 주 대사경로가 신배설이 되지 않아 본 발명의 혈장 중 약물동태 제어효과를 충분히 얻는 것이 가능하다. 또한, 본 발명에 있어서의 클론 상호작용의 저감(증대)이란, 척력(repulsive force)으로 표시되는 쿨롱력(Coulomb force)의 증대(감소)를 의미한다.
 본 발명에 있어서의 FcRn 결합영역을 포함하는 폴리펩티드는, IgG 항체에 한정되지 않고, Fc 수용체(FcRn)와 결합 가능한(결합활성 또는 친화성을 갖는) 단백질이면 된다. 바람직하게는, 본 발명에 있어서의 FcRn 결합영역을 포함하는 폴리펩티드는, 특별히 제한되지 않으나, 항체의 Fc영역 또는 Fc 유사 영역을 포함하는 단백질이다. Fc영역은 개변된 Fc영역을 사용하는 것도 가능하여, 예를 들면, 상기의 J Immunol. (1998), 160(2), 1029-35의 개변된 Fc영역을 사용할 수 있다. 본 발명에 있어서의 FcRn 결합영역을 포함하는 폴리펩티드로서는, 예를 들면, IgG 항체를 들 수 있다. 또한, 이들 항체(단백질)의 개변체이더라도, FcRn과 결합 가능한 단백질이면, 본 발명의 FcRn 결합영역을 포함하는 폴리펩티드에 포함된다. 본 발명에 있어서 FcRn 결합영역을 포함하는 폴리펩티드의 가장 바람직한 예로서는, IgG 항체를 들 수 있다.
 본 발명의 항체로서 IgG 항체를 사용하는 경우, IgG 타입의 항체분자라면 어떠한 서브타입이어도 되고, 다중 특이성(예를 들면 이중 특이성)의 IgG 항체여도 된다. 이 이중 특이성 항체는 2종류의 상이한 에피토프에 대해서 특이성을 갖는 항체로, 상이한 항원을 인식하는 항체 외에, 동일한 항원 상의 상이한 에피토프를 인식하는 항체도 포함된다. 또한, 항체분자여도, scFv나 Fab와 같이 신배설이 주요한 대사경로인 저분자화 항체의 경우는 전술한 바와 같이 pI로는 혈장 중 약물동태를 제어할 수 없으나, 본 발명은 신배설이 주요한 대사경로가 아닌 항체의 가변영역을 포함하는 폴리펩티드라면 어떠한 항체분자형이어도 적용 가능하여, 예를 들면, scFv-Fc, dAb-Fc, Fc 융합 단백질 등을 들 수 있다. 이들 분자의 신배설은 주요한 대사경로는 아니기 때문에, 본 발명에서 발견된 방법에 의해 pI를 변화시킴으로써 혈장 중 약물동태를 제어하는 것이 가능하다. 본 발명을 적용할 수 있는 항체분자는, 항체 유사 분자여도 된다. 항체 유사 분자란, 타겟분자에 결합함으로써 기능을 발휘하는 분자로(Binz HK, Amstutz P, Pluckthun A., Engineering novel binding proteins from nonimmunoglobulin domains., Nat Biotechnol. 2005 Oct;23(10):1257-68.), 예를 들면, DARPins, Affibody, Avimer 등을 들 수 있다.
 또한, 본 발명의 항체가, 예를 들면 이중 특이성의 항글리피칸3 항체인 경우는, 당해 항체는 글리피칸3와 글리피칸3 이외의 항원의 에피토프에 대해 특이적으로 결합하는 것도 가능하다. 예를 들면, 글리피칸3 이외의 항원으로서는, NK세포, 세포상해성 T세포, LAK세포 등을 리크루트하기 위해 이들의 세포에 특이적으로 결합하는 표면 항원을 바람직하게 이용할 수 있다. 선암(腺癌) 관련 항원인 MUC1을 인식하는 항체 MUSE11과 LAK 세포 표면 항원을 인식하는 항체 OKT3로 제작된 이중 특이성 항체를 사용하여, 담관암에 대해 LAK 세포에 의한 세포상해활성이 발휘된 것이 나타내어져 있다(Katayose Y, Kudo T, Suzuki M, Shinoda M, Saijyo S, Sakurai N, Saeki H, Fukuhara K, Imai K, Matsuno S. MUC1-specific targeting immunotherapy with bispecific antibodies: inhibition of xenografted human bile duct carcinoma growth. Cancer Res. (1996) 56(18), 4205-12). 상기 MUC1을 인식하는 항체 MUSE11 대신에, 본 발명이 제공하는 혈장 중 약물동태가 개선된 글리피칸3 항체를 바람직하게 사용할 수 있다. 또한, 본 발명이 제공하는 이중 특이성의 글리피칸3 항체로서는, 글리피칸3 분자의 상이한 에피토프를 인식하는 항체도 바람직하게 이용 가능하다.
 또한, 상기 「이중 특이성 항체」는, 예를 들면, 중쇄 가변영역 및 경쇄 가변영역이 단일 사슬로서 연결한 구조의 항체(예를 들면, sc(Fv)2)여도 된다. 또한 중쇄 가변영역(VH) 및 경쇄 가변영역(VL)이 연결된 scFv(또는 sc(Fv)2)를 Fc영역(CH1 도메인을 결손한 정상영역)과 결합한 항체 유사 분자(예를 들면, scFv-Fc)여도 된다. scFv-Fc로 되는 다중 특이성 항체는 제1 폴리펩티드가 VH1-linker-VL1-Fc이고, 제2 폴리펩티드가 VH2-linker-VL2-Fc로 되는 (scFv)2-Fc형의 구조를 갖는다. 또는 single domain antibody를 Fc영역과 결합시킨 항체 유사 분자여도 된다(Curr Opin Drug Discov Devel. 2006, 9(2), 184-93).
 본 발명에 있어서 아미노산 잔기의 전하의 개변은, 아미노산 치환을 통해 행할 수 있다. 아미노산 치환은 후술하는 방법에 의해 행할 수 있다.
 또한 본 발명에 있어서의, 치환의 대상이 되는 CDR영역의 표면에 노출 가능한 아미노산 잔기는, 항원으로의 결합활성 유지의 관점에서, 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기 또는 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기인 것이 바람직하다. 이들의 아미노산 잔기의 치환은, 아미노산 잔기의 치환 전에 항체의 가변영역을 포함하는 폴리펩티드가 갖고 있었던 기능(항원으로의 결합활성 등)을 유지하고 있는 점, 또한, 당해 치환이 항체의 종류에 따르지 않는 점에서 유용하다.
 또한 본 발명은, 항체의 가변영역을 포함하는 폴리펩티드의 등전점을 개변함으로써, 당해 폴리펩티드의 약물동태를 제어하는 방법을 제공한다. 또한 당해 방법에 의해서 얻어지는 약물동태가 제어된 항체의 가변영역을 포함하는 폴리펩티드도 본 발명에 포함된다.
 본 발명에 있어서 「혈장 중 약물동태가 제어된」이란, 항체를 구성하는 아미노산의 개변 전과 개변 후에 있어서의 항체의 혈장 중 약물동태를 비교하여, 혈장 중 약물동태가 목적하는 방향으로 개변되어 있는 것을 의미한다. 즉, 항체의 약물(혈장 중) 반감기를 신장하는 것을 소망하는 경우는, 「혈장 중 약물동태의 제어」란, 항체의 혈장 중 반감기가 신장하는 것을 말한다. 항체의 혈장 중 반감기를 짧게 하는 것을 소망하는 경우는, 「혈장 중 약물동태의 제어」란, 항체의 혈장 중 반감기를 단축하는 것을 말한다.
 본 발명에 있어서 항체의 혈장 중 약물동태가 목적하는 방향으로 개변되어 있는지 여부, 즉 혈장 중 약물동태가 소망하는 대로 제어되고 있는지 여부는, 예를 들면, 마우스, 랫트, 토끼, 개, 원숭이 등을 사용한 동태시험을 실시함으로써 적절히 평가될 수 있다. 또한, 본 발명에 있어서의 「혈장 중 반감기의 신장」 또는 「혈장 중 반감기의 단축」은, 보다 구체적으로는, 혈장 중 반감기(t1/2)라는 파라미터 외에, 평균 혈장 중 체류시간, 혈장 중 클리어런스(CL), 농도곡선하면적(AUC) 등 중 어느 하나의 파라미터에 의해서도 파악될 수 있다「약물동태학(pharmacokinetics) 연습에 의한 이해」(난잔도)). 예를 들면, 체내동태 해석 소프트 WinNonlin(Pharsight)에 부속하는 프로토콜에 따라 Noncompartmental 해석이 실시됨으로써, 본 발명이 제공하는 「혈장 중 동태의 제어」가 이들의 파라미터를 사용하여 적절히 평가될 수 있다.
 또한, 혈장 중 약물동태의 제어에 의해 항체의 기능을 지속시키는 것이 가능하다. 예를 들면, 세포상해활성을 갖는 항체에 본 발명의 방법을 적용하면, 그 기능을 지속시키는 것이 가능해지고, 세포상해활성효과, 안타고니스트활성, 아고니스트활성 등의 개변 전의 폴리펩티드가 갖는 기능의 지속시간을 조절하는 것이 가능해진다.
 본 발명에 있어서 「표면에 노출 가능한 아미노산 잔기」란, 통상, 항체를 구성하는 폴리펩티드의 표면에 있는 아미노산 잔기를 지칭한다. 「폴리펩티드의 표면에 있는 아미노산 잔기」란, 그 측쇄가 용매분자(통상은 수분자인 경우가 많다.)에 접할 수 있는 아미노산 잔기를 말하고, 반드시 그 측쇄 전부가 용매분자에 접할 필요는 없으며, 그 측쇄의 일부라도 용매분자에 접하는 경우에는, 그 아미노산 잔기는 표면에 있는 아미노산으로 규정된다. 시판의 소프트웨어를 사용한 호몰로지 모델링 등에 의해, 당업자는 폴리펩티드나 항체의 호몰로지 모델을 제작할 수 있다. 당해 호몰로지 모델을 토대로 하여, 적절한 항체를 구성하는 폴리펩티드의 표면에 있는 아미노산 잔기가 「폴리펩티드의 표면에 있는 아미노산 잔기」로서 적절히 선택될 수 있다.
 본 발명에 있어서 「표면에 노출 가능한 아미노산 잔기」는, 특별히 제한되지 않으나, 항체 중의 FcRn 결합영역의 밖에 있는 아미노산 잔기인 것이 바람직하다. 이 FcRn 결합영역이란, 예를 들면, Fc영역을 바람직하게 들 수 있다.
 본 발명의 항체에 있어서 전하를 개변해야 할 아미노산 잔기는, 항체의 중쇄 가변영역 또는 경쇄 가변영역을 구성하는 아미노산 잔기인 것이 바람직하다. 당해 가변영역으로서는, 구체적으로는, 상보성 결정영역(CDR), 프레임워크영역(FR)을 바람직하게 들 수 있다.
 당업자라면, 항체 가변영역에 있어서의 표면 아미노산 잔기는 호몰로지 모델링 등에 의해 제작된 호몰로지 모델에 의해 적절히 선택하는 것이 가능하다. 즉, H사슬 가변영역의 Kabat 넘버링을 토대로 하는 아미노산 잔기인 H1, H3, H5, H8, H10, H12, H13, H15, H16, H19, H23, H25, H26, H31, H39, H42, H43, H44, H46, H61, H62, H64, H65, H68, H71, H72, H73, H75, H76, H81, H82b, H83, H85, H86, H105, H108, H110, H112 중에서, 항체 가변영역에 있어서의 표면 아미노산 잔기가 적절히 선택될 수 있다. 예를 들면, 서열번호:195로 표시되는 인간화 글리피칸3 항체의 H사슬 FR영역에 있어서는, 1, 3, 5, 8, 10, 12, 13, 15, 16, 19, 23, 25, 26, 39, 42, 43, 44, 46, 69, 72, 73, 74, 76, 77, 82, 85, 87, 89, 90, 107, 110, 112, 114번째의 아미노산 잔기가 표면 아미노산으로서 예시될 수 있으나, 본 발명은 이들에 한정되지 않는다. 또한 H사슬 CDR 중의 표면 아미노산 잔기는, 동일한 호몰로지 모델에 의해 선택될 수 있다. 즉, Kabat 넘버링을 토대로 하는 아미노산 잔기인 H97은 거의 모든 항체에서 표면에 노출되어 있다. 예를 들면, 서열번호:195로 표시되는 인간화 글리피칸3 항체의 H사슬 CDR에 있어서의 101번째의 세린이 당해 아미노산 잔기에 상당하는 것이다. 서열번호:195로 표시되는 인간화 글리피칸3 항체의 H사슬 CDR에 있어서의 기타 아미노산 잔기로서는 52, 54, 62, 63, 65, 66번째의 아미노산 잔기를 바람직하게 들 수 있다.
 L사슬 가변영역에 있어서는, Kabat 넘버링을 토대로 하는 아미노산 잔기인 L1, L3, L7, L8, L9, L11, L12, L16, L17, L18, L20, L22, L24, L27, L38, L39, L41, L42, L43, L45, L46, L49, L53, L54, L55, L57, L60, L63, L65, L66, L68, L69, L70, L74, L76, L77, L79, L80, L81, L85, L100, L103, L105, L106, L107 중에서 항체 가변영역에 있어서의 표면 아미노산 잔기가 적절히 선택될 수 있다. 예를 들면 서열번호:195로 표시되는 인간화 글리피칸3 항체의 1, 3, 7, 8, 9, 11, 12, 16, 17, 18, 20, 22, 43, 44, 45, 46, 48, 49, 50, 54, 62, 65, 68, 70, 71, 73, 74, 75, 79, 81, 82, 84, 85, 86, 90, 105, 108, 110, 111, 112를 표면 아미노산으로서 예시할 수 있으나, 본 발명은 이들에 한정되지 않는다. 또한 L사슬 CDR 중의 표면 아미노산 잔기는, 그것에 의해 H사슬 CDR 중의 표면 아미노산 잔기가 결정되는 호몰로지 모델과 동일한 호몰로지 모델에 의해 선택될 수 있다. 서열번호:201로 표시되는 인간화 글리피칸3 항체의 L사슬 CDR에 있어서의 아미노산 잔기로서는, 24, 27, 33, 55, 59번째의 아미노산 잔기를 바람직하게 들 수 있다.
 본 발명이 제공하는 방법에 있어서의 아미노산 잔기의 「개변」이란, 구체적으로는, 원래의 아미노산 잔기를 다른 아미노산 잔기로 치환하는 것, 원래의 아미노산 잔기를 결실시키는 것, 새로운 아미노산 잔기를 부가하는 것 등을 말하나, 바람직하게는, 원래의 아미노산 잔기를 다른 아미노산 잔기로 치환하는 것을 가리킨다. 즉, 본 발명에 있어서의 「아미노산 잔기의 전하의 개변」이란, 바람직하게는 아미노산 치환을 들 수 있다.
 본 발명이 제공하는 글리피칸3 항체는, 상기 「아미노산 잔기의 전하의 개변」을 행하기 위해, 예를 들면, 서열번호:195로 표시되는 인간화 글리피칸3 항체를 구성하는 H사슬 가변영역 중의 19, 43, 52, 54, 62, 63, 65, 66, 107번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:201로 표시되는 인간화 글리피칸3 항체를 구성하는 L사슬 가변영역 중의 24, 27, 33, 55, 59, 79, 82, 105번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 상기 아미노산 잔기 중, 당해 전하가 개변된 아미노산 잔기 이외의 아미노산 잔기는, 목적으로 하는 혈장 중 약물동태의 제어효과가 얻어지고 있으면 개변될 필요는 없으나, 적절히, 개변된 아미노산 잔기와 동종의 전하를 갖거나, 또는 전하를 갖지 않도록 적절히 개변될 수 있다.
 본 발명이 제공하는 항인간 IL-6 수용체 항체(6R_a_H1L1)의 CDR에 있어서, 항원에 대한 결합활성을 유지하면서, 상기 「아미노산 잔기의 전하의 개변」을 행하기 위해, 예를 들면, 서열번호:221로 표시되는 항인간 IL-6 수용체 항체를 구성하는 H사슬 가변영역 중의 kabat 넘버링에 의한 31, 64, 65번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:224로 표시되는 항인간 IL-6 수용체 항체를 구성하는 L사슬 가변영역 중의 kabat 넘버링에 의한 24, 27, 53, 55번째의 아미노산 서열로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 상기 아미노산 잔기 중, 당해 전하가 개변된 아미노산 잔기 이외의 아미노산 잔기는, 목적으로 하는 혈장 중 약물동태의 제어효과가 얻어지고 있으면 개변될 필요는 없으나, 적절히, 개변된 아미노산 잔기와 동종의 전하를 갖거나, 또는 전하를 갖지 않도록 적절히 개변될 수 있다.
 본 발명이 제공하는 항인간 IL-6 수용체 항체(6R_b_H1L1)의 CDR에 있어서, 항원에 대한 결합활성을 유지하면서, 상기 「아미노산 잔기의 전하의 개변」을 행하기 위해서, 예를 들면, 서열번호:227로 표시되는 항인간 IL-6 수용체 항체를 구성하는 H사슬 가변영역 중의 kabat 넘버링에 의한 31번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:229로 표시되는 항인간 IL-6 수용체 항체를 구성하는 L사슬 가변영역 중의 kabat 넘버링에 의한 24, 53, 54, 55번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 상기 아미노산 잔기 중, 당해 전하가 개변된 아미노산 잔기 이외의 아미노산 잔기는, 목적으로 하는 혈장 중 약물동태의 제어효과가 얻어지고 있으면 개변될 필요는 없으나, 적절히, 개변된 아미노산 잔기와 동종의 전하를 갖거나, 또는 전하를 갖지 않도록 적절히 개변될 수 있다.
 본 발명이 제공하는 항인간 GPC3 항체의 CDR에 있어서, 항원에 대한 결합활성을 유지하면서, 상기 「아미노산 잔기의 전하의 개변」을 행하기 위해, 예를 들면, 서열번호:233으로 표시되는 항인간 GPC3 항체를 구성하는 H사슬 가변영역 중의 kabat 넘버링에 의한 61, 62, 64, 65번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:236으로 표시되는 항인간 GPC3 항체를 구성하는 L사슬 가변영역 중의 kabat 넘버링에 의한 24, 27번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 상기의 아미노산 잔기 중, 당해 전하가 개변된 아미노산 잔기 이외의 아미노산 잔기는, 목적으로 하는 혈장 중 약물동태의 제어효과가 얻어지고 있으면 개변될 필요는 없으나, 적절히 개변된 아미노산 잔기와 동종의 전하를 갖거나, 또는 전하를 갖지 않도록 적절히 개변될 수 있다.
 본 발명이 제공하는 항인간 IL-31 수용체 항체의 CDR에 있어서, 항원에 대한 결합활성을 유지하면서, 상기 「아미노산 잔기의 전하의 개변」을 행하기 위해서, 예를 들면, 서열번호:239로 표시되는 항인간 IL-31 수용체 항체를 구성하는 H사슬 가변영역 중의 kabat 넘버링에 의한 61, 62, 64, 65번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:242로 표시되는 항인간 IL-31 수용체 항체를 구성하는 L사슬 가변영역 중의 kabat 넘버링에 의한 24, 54번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기의 전하가 바람직하게 개변된다. 상기 아미노산 잔기 중, 당해 전하가 개변된 아미노산 잔기 이외의 아미노산 잔기는, 목적으로 하는 혈장 중 약물동태의 제어효과가 얻어지고 있으면 개변될 필요는 없으나, 적절히, 개변된 아미노산 잔기와 동종의 전하를 갖거나, 또는 전하를 갖지 않도록 적절히 개변될 수 있다.
 아미노산 중에는, 전하를 띤 아미노산이 존재하는 것이 알려져 있다. 일반적으로, 양의 전하를 띤 아미노산(양전하 아미노산)으로서는, 리신(K), 아르기닌(R), 히스티딘(H)이 알려져 있다. 음의 전하를 띤 아미노산(음전하 아미노산)으로서는, 아스파라긴산(D), 글루타민산(E) 등이 알려져 있다. 이들 이외의 아미노산은 전하를 갖지 않는 아미노산으로서 알려져 있다.
 상기 「개변된 아미노산 잔기」로서는, 바람직하게는, 이하의 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기로부터 적절히 선택되나, 특별히 이들 아미노산에 제한되지 않는다.
 (a) 글루타민산(E), 아스파라긴산(D)
 (b) 리신(K), 아르기닌(R), 히스티딘(H)
 또한, 원래의(개변 전의) 아미노산 잔기가 이미 전하를 갖는 경우, 전하를 갖지 않는 아미노산 잔기가 되도록 개변하는 것도 본 발명의 바람직한 태양의 하나이다. 즉, 본 발명에 있어서의 개변으로서는, (1) 전하를 갖는 아미노산으로부터 전하를 갖지 않는 아미노산으로의 치환, (2) 전하를 갖는 아미노산으로부터 당해 아미노산과는 반대의 전하를 갖는 아미노산으로의 치환, (3) 전하를 갖지 않는 아미노산으로부터 전하를 갖는 아미노산으로의 치환을 들 수 있다.
 본 발명에 있어서는, 항체의 등전점(pI)이 변화되도록, 항체를 구성하는 아미노산 잔기가 개변되는 것이 바람직하다. 또한, 개변되는 아미노산 잔기가 복수 존재하는 경우에는, 개변에 제공되는 아미노산 잔기 중에 전하를 갖지 않는 아미노산 잔기가 소수 정도 포함될 수 있다.
 본 발명이 제공하는 글리피칸3 항체에 있어서의 「아미노산 잔기의 전하의 개변」의 바람직한 예로서는 이하의 것을 들 수 있다. pI값을 증가시키는 개변으로서는, 예를 들면, 서열번호:195로 표시되는 인간화 글리피칸3 항체를 구성하는 H사슬 가변영역 중의 Q43K, D52N, Q107R 중 하나 이상의 치환을 행할 수 있고, 특히 바람직하게는 서열번호:198로 표시되는 아미노산 서열로 개변된다. 또한, 예를 들면, 서열번호:201로 표시되는 인간화 글리피칸3 항체를 구성하는 L사슬 가변영역 중의 E17Q, Q27R, Q105R 중 하나 이상의 치환을 행할 수 있고, 특히 바람직하게는 서열번호:204로 표시되는 아미노산 서열로 개변된다. 한편, pI값을 감소시키는 개변으로서는, 서열번호:195로 표시되는 인간화 글리피칸3 항체를 구성하는 H사슬 가변영역 중의 K19T, Q43E, K63S, K65Q, G66D 중 어느 하나 이상의 치환을 행할 수 있고, 특히 바람직하게는 서열번호:197로 표시되는 아미노산 서열로 개변된다. 또한, 예를 들면, 서열번호:201로 표시되는 인간화 글리피칸3 항체를 구성하는 L사슬 가변영역 중의 Q27E, K79T, R82S 중 하나 이상의 치환을 행할 수 있고, 특히 바람직하게는 서열번호:203으로 표시되는 아미노산 서열로 개변된다.
 본 발명이 제공하는 항인간 IL-6 수용체 항체(6R_a_H1L1)에 있어서의 「아미노산 잔기의 전하의 개변」의 바람직한 예로서는, 표 20에 기재된 아미노산 치환 중 하나 이상의 아미노산 치환을 들 수 있다.
 본 발명이 제공하는 항인간 IL-6 수용체 항체(6R_b_H1L1)에 있어서의 「아미노산 잔기의 전하의 개변」의 바람직한 예로서는, 표 22에 기재된 아미노산 치환 중 하나 이상의 아미노산 치환을 들 수 있다.
 본 발명이 제공하는 항인간 GPC3 항체에 있어서의 「아미노산 잔기의 전하의 개변」의 바람직한 예로서는, 표 24에 기재된 아미노산 치환 중 하나 이상의 아미노산 치환을 들 수 있다.
 본 발명이 제공하는 항인간 IL-31 수용체 항체에 있어서의 「아미노산 잔기의 전하의 개변」의 바람직한 예로서는, 표 27에 기재된 아미노산 치환 중 하나 이상의 아미노산 치환을 들 수 있다.
 본 발명에 있어서 개변에 제공되는 아미노산 잔기의 수는, 특별히 제한되지 않으나, 예를 들면, 항체의 가변영역을 개변하는 경우, 항원과의 결합활성을 저하시키지 않기 위해, 또한 면역원성을 높이지 않기 위해, 목적의 제어된 혈장 중 약물동태를 달성하기 위한 필요 최저한의 아미노산 잔기가 개변되는 것이 바람직하다. 또한, 항원과의 결합활성의 증대를 초래하는 아미노산 잔기의 개변이나, 면역원성의 저하를 초래하는 아미노산 잔기의 개변을 적절히 조합시키는 것도 또한 바람직하게 실시될 수 있다.
 항체의 항원 결합활성의 측정에는 공지의 수단을 사용할 수 있다. 예를 들면, ELISA(효소결합 면역흡착 검정법), EIA(효소면역측정법), RIA(방사면역측정법) 또는 형광면역법 등을 사용할 수 있다. 일반적인 교시서인 「Antibodies A Laboratory Manual. Ed Harlow, David Lane, Cold Spring Harbor Laboratory, 1988」에 상기의 방법이 기재되어 있다.
 세포에 대한 항체의 결합활성을 측정하는 방법으로서는, 예를 들면, Antibodies A Laboratory Manual.(Ed Harlow, David Lane, Cold Spring Harbor Laboratory, 1988) 중의 359-420페이지에 기재되어 있는 방법을 들 수 있다. 즉, 세포를 항원으로 하는 BIACORE, 세포증식 어세이, ELISA나 FACS(fluorescence activated cell sorting)의 원리에 의해 평가할 수 있다. ELISA 포맷에 있어서는, 세포로의 항체의 결합활성은, 효소반응에 의해 생성하는 시그널 레벨을 비교함으로써 정량적으로 평가된다. 즉, 각 강제발현세포를 고정화한 ELISA 플레이트에 피험 항체를 첨가하고, 피험 항체를 인식하는 효소 표지 항체를 이용하여, 세포에 결합한 항체가 검출된다. 또는 FACS에 있어서는, 피험 항체의 희석계열을 제작하고, 각 강제발현세포에 대한 항체결합 역가(titer)를 결정함으로써, 세포에 대한 결합활성을 비교할 수 있다.
 ELISA 플레이트 등의 담체에 결합되어 있지 않은, 완충액 등에 현탁한 세포 표면 상에 발현하고 있는 항원과 당해 항원에 대한 항체의 결합은 FACS 포맷에 의해 측정할 수 있다. 이와 같은 측정에 사용하는 플로우 사이토미터로서는, 예를 들면, FACSCanto TM II, FACSAria TM, FACSArray TM, FACSVantage TM SE, FACSCalibur TM (이상, BD Biosciences)이나, EPICS ALTRA HyPerSort, Cytomics FC 500, EPICS XL-MCL ADC, EPICS XL ADC, Cell Lab Quanta/Cell Lab Quanta SC(이상, Beckman Coulter) 등을 들 수 있다.
 항체의 항원에 대한 결합활성의 바람직한 측정방법의 일례로서, 항원을 발현하는 세포와 피험 항체를 반응시키고, 피험 항체를 인식하는 FITC 표지한 이차 항체로 세포를 염색한 후, FACSCalibur(BD)에 의해 측정을 행하여, 그 형광강도를 CELL QUEST Software(BD)를 사용해서 해석하는 방법을 들 수 있다. 본 방법에 의하면, 항원을 발현하는 세포 표면 상의 항원에 대해 결합한 피험 항체를 특이적으로 인식하는 FITC 표지한 이차 항체로 염색 후, FACSCalibur에 의해 측정을 행한 경우에 있어서, 그 형광강도를 CELL QUEST Software를 사용해서 해석하는 방법에 의해 얻어지는 Geometric Mean의 값(피험 Geo-Mean값)을, 대조 항체를 사용해서 얻어지는 대조 Geo-Mean값과 비교함으로써 판단할 수 있다. Geo-Mean값(Geometric Mean)을 구하는 계산식은, CELLQUEST Software User' s Guide (BD biosciences사)에 기재되어 있다.
 또한, 항체가 투여되는 인간의 체내에 있어서의 면역원성을 높이지 않기 위해서, 개변된 아미노산 서열이 인간 서열(인간 유래의 천연의 항체에 발견되는 서열)인 것이 바람직하나 본 발명은 이것에 한정되지 않는다. 또한, 개변 후에 복수의 FR의 각각(FR1, FR2, FR3, FR4)이 인간 서열이 되도록, 등전점이 변화되도록 도입한 개변 이외의 개소에 변이가 바람직하게 도입될 수 있다. 이와 같이 하여 각 FR을 인간 서열로 치환하는 방법은 비특허문헌(Ono K, Ohtomo T, Yoshida K, Yoshimura Y, Kawai S, Koishihara Y, Ozaki S, Kosaka M, Tsuchiya M., The humanized anti-HM1.24 antibody effectively kills multiple myeloma cells by human effector cell-mediated cytotoxicity.,Mol Immunol. (1999) 36(6), 387-395)에서 보고되어 있다. 또한, 항체의 등전점을 변화시키기 위해서, 각 FR의 전하가 변화되도록 다른 인간 FR로 개변해도 된다(예를 들면 항체의 등전점이 저하되도록 FR3를 다른 인간 FR과 교환해도 된다). 이와 같은 인간화방법은 비특허문헌(Dall'Acqua WF, Damschroder MM, Zhang J, Woods RM, Widjaja L, Yu J, Wu H.., Antibody humanization by framework shuffling., Methods. (2005) 36(1), 43-60)에서 보고되어 있다.
 또한, 약간의 표면 전하의 개변에 의해서는 목적으로 하는 제어된 혈장 중 약물동태에 도달하지 않는 경우에, 표면 전하의 개변과 혈장 중 약물동태의 평가를 반복해서 행함으로써, 목적으로 하는 제어된 혈장 중 약물동태를 나타내는 목적하는 항체가 바람직하게 취득될 수 있다.
 비특허문헌(He XY, Xu Z, Melrose J, Mullowney A, Vasquez M, Queen C, Vexler V, Klingbeil C, Co MS, Berg EL. Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin. J Immunol. (1998), 160(2), 1029-35)에는, 항E, P-Selection 항체의 키메라 항체(IgG4)인 chimeric EP5C7.g4와 인간화 항체(IgG4)인 HuEP5C7.g4의 붉은털 원숭이에 있어서의 혈장 중 약물동태를 비교하여, 양자의 혈장 중 약물동태는 동등한 것이 나타내어져 있다. 또한 비특허문헌(Gobburu JV, Tenhoor C, Rogge MC, Frazier DE Jr, Thomas D, Benjamin C, Hess DM, Jusko WJ. Pharmacokinetics/dynamics of 5c8, a monoclonal antibody to CD154 (CD40 ligand) suppression of an immune response in monkeys. J Pharmacol Exp Ther. (1998) 286(2), 925-30)에는, 항CD154 항체의 키메라형 항체인 ch5d8과 인간화 항체인 Hu5c8의 게잡이원숭이에 있어서의 혈장 중 약물동태를 비교하여, 양자의 혈장 중 약물동태는 동등한 것이 나타내어져 있다. 비특허문헌(Kashmiri SV, Shu L, Padlan EA, Milenic DE, Schlom J, Hand PH., Generation, characterization, and in vivo studies of humanized anticarcinoma antibody CC49., Hybridoma. (1995) 14(5), 461-73)에는, 키메라 항체인 cCC49와 인간화 항체인 HuCC49의 마우스에 있어서의 혈장 중 약물동태가 동등한 것이 나타내어져 있다. 또한 비특허문헌(Graves SS, Goshorn SC, Stone DM, Axworthy DB, Reno JM, Bottino B, Searle S, Henry A, Pedersen J, Rees AR, Libby RT., Molecular modeling and preclinical evaluation of the humanized NR-LU-13 antibody., Clin Cancer Res. (1999) 5(4), 899-908) 및 비특허문헌(Couto JR, Blank EW, Peterson JA, Ceriani RL., Anti-BA46 monoclonal antibody Mc3: humanization using a novel positional consensus and in vivo and in vitro characterization., Cancer Res. (1995) 55(8), 1717-22)에는, 마우스에 있어서의 평가에 있어서, 마우스 항체와 인간화 항체의 혈장 중 약물동태·분포가 동등한 것이 나타내어져 있어, 마우스 Fc 및 인간 Fc는 함께 마우스 FcRn에 교차하는 것으로부터, 동 키메라 항체와 동 인간화 항체의 혈장 중 약물동태·분포는 동등하다고 생각된다. 이들의 예에 나타내어져 있는 바와 같이, 동일한 CDR을 갖는 키메라 항체와 인간화 항체 사이에서 혈장 중 약물동태는 동등하다. 즉, 비특허문헌(Ghetie V, Popov S, Borvak J, Radu C, Matesoi D, Medesan C, Ober RJ, Ward ES., Increasing the serum persistence of an IgG fragment by random mutagenesis., Nat Biotechnol. (1997) 15(7), 637-40) 등에 나타내어지는 공지의 방법에 의해 인간화한 경우, 키메라 항체와 비교하여 혈장 중 약물동태는 동등하여, 공지의 방법으로는 혈장 중 약물동태가 제어된 인간화 항체를 제작할 수 없다.
 이것에 대해, 본 발명에서 발견된 방법을 사용하면, 키메라 항체를 인간화할 때, 키메라 항체의 표면에 노출 가능한 아미노산 잔기에 개변을 가하여 항체의 pI가 개변됨으로써, 키메라 항체와 비교하여 혈장 중 약물동태가 제어된(즉, 그 혈장 중 반감기를 신장하거나 또는 그 혈장 중 반감기를 단축한) 인간화 항체가 제작될 수 있다. 혈장 중 약물동태를 제어하기 위한 인간화 항체의 표면에 노출 가능한 아미노산의 개변은, 항체의 인간화와 동시에 실시되어도 되고, 또는, 인간화 항체를 출발재료로서 사용하여 그 표면에 노출 가능한 아미노산 잔기를 개변함으로써, 인간화 항체의 pI를 추가적으로 개변해도 된다.
 본 발명에 있어서의 등전점의 값은, 당업자 공지의 등전점 전기영동에 의해 측정하는 것이 가능하다. 또한, 이론등전점의 값은, 유전자 및 아미노산 서열 해석 소프트웨어(Genetyx 등)를 사용해서 계산할 수 있다. 본 발명에 있어서, 예를 들면, 혈장 중 약물동태의 충분한 제어를 위해서 등, 등전점을 대폭으로 변화시킬 필요가 있는 경우에 유용하다. 특히 이론등전점의 값으로 1.0 이상 등전점의 값을 변화시킬 필요가 있는 경우가 바람직하고, 3.0 이상 필요한 경우에 보다 바람직하다.
 비특허문헌(Adams CW, Allison DE, Flagella K, Presta L, Clarke J, Dybdal N, McKeever K, Sliwkowski MX. Humanization of a recombinant monoclonal antibody to produce a therapeutic HER dimerization inhibitor, pertuzumab., Cancer Immunol Immunother. (2006) 55(6), 717-27)에는, 동일한 인간 항체의 FR 서열을 사용해서 인간화를 행한 3종류의 인간화 항체 trastuzumab, bevacizumab, pertuzumab의 혈장 중 약물동태는 거의 동등한 것이 기재되어 있다. 즉, 동일한 FR 서열을 사용하여 인간화를 행한 경우, 혈장 중 약물동태는 거의 동등하다. 본 발명에서 발견된 방법에 의하면, 전술한 바와 같은 인간화의 공정에 더하여, 항체의 표면에 노출 가능한 아미노산 잔기로 개변을 가하여 항체의 pI를 개변시킴으로써, 약물(혈장 중) 농도를 제어하는 것이 가능해진다.
 또한, 본 발명의 방법은, 인간 항체에도 적용할 수 있다. 인간 항체 라이브러리나 인간 항체생산 마우스 등으로 제작된 인간 항체의 표면에 노출 가능한 아미노산 잔기로 개변을 가하여, 인간 항체의 pI가 개변됨으로써, 최초에 제작된 인간 항체의 혈장 중 약물동태에 비해 그 혈장 중 약물동태가 제어된(즉, 그 혈장 중 반감기를 신장하거나, 또는, 그 혈장 중 약물동태를 단축한) 인간 항체를 제작 가능하다.
 항체가 갖는 pI값이 감소함으로써, 항체의 혈장 중 반감기가 신장한다. 그것과는 반대로 항체의 pI값이 증대함으로써, 혈장 중 반감기가 단축되고, 항체의 조직 이행성이 향상되는 것이 알려져 있다(Vaisitti T, Deaglio S, Malavasi F., Cationization of monoclonal antibodies: another step towards the "magic bullet"?, J Biol Regul HomeostAgents. (2005) 19(3-4), 105-12, Pardridge WM, Buciak J, Yang J, Wu D. Enhanced endocytosis in cultured human breast carcinoma cells and in vivo biodistribution in rats of a humanized monoclonal antibody after cationization of the protein. (1998) 286(1), 548-54). 그러나, 당해 항체는 면역원성이 증가하고, 또한, 세포 내로의 내재화활성도 증대하는 것으로부터, ADCC나 CDC활성 등의 그 활성의 발휘에 세포 내로의 내재화활성이 저해요인이 되는 세포상해활성 등의 기구를 통해 암치료에 대한 효과를 나타내는 항체에 적용하기 위해서, 추가적인 개량이 요구되고 있었다. 즉, ADCC나 CDC활성 등의 그 활성의 발휘에 세포 내로의 내재화활성이 저해요인이 되는 세포상해활성 등의 기구를 통해 암치료에 대한 효과를 나타내는 항체에 대해서는, pI값의 증가 또는 감소 중 어느 것이 종양억제효과의 증강을 초래하는지는 알 수 없었다. 본 발명에 있어서는, pI값이 감소한 인간화 항체의 개변 항체와 pI값이 증가한 인간화 항체의 개변 항체를 제작하고, 양자의 항종양효과를 비교 검토함으로써, 어느 개변이 높은 종양억제효과를 초래하는지가 검증되었다. 그 결과, 놀랍게도, pI값이 감소한 인간화 항체가 간암에 대해 보다 우수한 효과를 발휘하는 것이 나타났다.
 본 발명에 있어서의 「항체」에는, 전술한 바와 같이 아미노산 잔기의 전하가 개변된 항체를 출발재료로 사용하고, 당해 항체를 구성하는 아미노산 잔기의 치환, 결실, 부가 및/또는 삽입 등에 의해, 그 아미노산 서열이 더욱 개변된 항체가 포함된다. 또한, 본 발명에 있어서의 「항체」에는, 아미노산 잔기의 치환, 결실, 부가 및/또는 삽입, 또는 키메라화나 인간화 등에 의해, 아미노산 서열이 개변된 항체를 출발재료로 사용하여, 당해 항체를 구성하는 아미노산 잔기의 전하가 추가적으로 개변된 항체도 또한 포함된다.
 본 발명이 제공하는 항체의 특성의 향상을 목적으로 하는 개변의 예시로서, 항체의 안정성을 높이는 것을 목적으로 하는 개변(이하, 안정성의 개변이라 지칭한다.)을 바람직하게 들 수 있다. 수용액 중의 항체는 천연상태와 불활성인 변성상태의 두 상태 사이에서 평형화되어 있다. 천연상태의 안정성은 열역학 제2법칙(△G=△H-T△S)으로 표시되는 바와 같이, 계의 기브스 자유 에너지(Gibbs free energy) 변화 △G 및 그의 내역인 엔탈피 변화 △H(폴리펩티드 사슬 중의 소수성 상호작용이나 수소결합 등의 변화에 기인)와 엔트로피 변화 △S(용매합과 입체구조의 자유도의 변화에 기인)의 균형에 의존한다. 양의 값의 △G는 단백질의 천연상태인 편이 단백질의 변성상태보다도 안정한 것을 의미하고, △G가 보다 큰 양의 값을 나타내는 경우에는 단백질의 천연상태의 안정성이 더욱 증대한다. 단백질이 변성하기 위해서는 이 안정화에 기여하고 있는 힘을 파괴할 필요가 있다. 예를 들면 단백질용액을 고온에 노출시킴으로써 입체구조의 자유도가 증대하고, 단백질의 안정화에 기여하는 인자가 약해짐으로써 단백질의 열변성이 발생되나, 이 경우 -T△S항목이 변성을 지배하게 된다. 단백질의 열변성에 의한 언폴딩의 △H는, 본 명세서에 기재된 실시예에 있어서 구체적으로 기재되는 바와 같이 DSC(differential scanning calorimetry; 시차주사 열량 측정법)를 사용하여 직접적으로 측정될 수 있다. 단백질의 열변성 프로세스에 있어서의 DSC 커브는 변성중점(Tm)으로 불리는 피험 단백질에 고유한 온도를 사이에 끼워 흡열 피크가 된다. 당해 피크를 적분함으로써 변성 엔탈피 변화가 얻어진다. 일반적으로 Tm의 값은 열안정성의 하나의 지표이다. DSC에 의해 단백질이 열변성을 일으킬 때의 열용량 변화(△Cp)도 측정될 수 있다. 열변성에 부수적으로 발생하는 열용량 변화는, 주로 단백질이 천연상태에서 존재할 때 분자 표면에 노출되어 있지 않은 아미노산 잔기가 단백질의 변성에 수반하여 용매분자에 노출된 결과 수화(水和)하는 것에 기인한다.
 상기한 바와 같이, 본 발명이 제공하는 방법에 있어서의 아미노산 잔기의 「개변」이란, 구체적으로는, 원래의 아미노산 잔기를 다른 아미노산 잔기로 치환하는 것, 원래의 아미노산 잔기를 결실시키는 것, 새로운 아미노산 잔기를 부가하는 것 등을 말하나, 바람직하게는, 원래의 아미노산 잔기를 다른 아미노산 잔기로 치환하는 것을 말한다. 즉, 본 발명에 있어서의 항체의 안정성의 개변을 위해서는, 바람직하게는 아미노산 치환에 의한 개변이 사용된다. 항체를 구성하는 아미노산 잔기에 대해 안정성의 개변이 실시된 결과, 항체의 상기 Tm값이 증대한다. 즉, 항체의 안정성의 개변이 실시된 지표로서 상기 Tm값이 바람직하게 사용된다.
 본 발명이 제공하는 글리피칸3 항체는, 상기 「안정성의 개변」을 행하기 위해, 서열번호:195로 표시되는 인간화 글리피칸3 항체를 구성하는 H사슬 가변영역 중의 37, 40, 48, 51번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가 바람직하게 개변된다. 또한, 예를 들면, 서열번호:201로 표시되는 인간화 글리피칸3 항체를 구성하는 L사슬 가변영역 중의 2, 25, 42, 48, 50, 83, 84번째의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가 바람직하게 개변된다. 상기 아미노산 잔기 중, 당해 안정성의 개변이 실시된 아미노산 잔기 이외의 아미노산 잔기는, 목적하는 Tm값이 얻어지고 있으면 개변될 필요는 없으나, 적절히, 개변에 제공한 인간화 글리피칸3 항체의 Tm값과 동일 정도이거나, 또는 그 이상의 Tm값을 가지도록 적절히 개변될 수 있다.
 안정성의 개변은, 개변에 제공하는 인간화 항체를 구성하는 각 아미노산 잔기를 랜덤으로 개변함으로써 실시될 수 있다. 또한, 개변에 제공하는 인간화 항체를 구성하는 아미노산 서열의 일부를, Tm값이 높은 기존의 항체를 구성하는 아미노산 서열로서, 또한, 당해 개변에 제공하는 인간화 항체의 아미노산 서열의 일부와 항체의 입체구조 상관의 관점에서 대응하는 서열로 치환함으로써도 실시될 수 있다. 치환되는 아미노산 잔기의 위치는 한정되지 않으나, FR영역 중의 아미노산 잔기가 바람직하게 개변될 수 있다. 또한, CDR영역 중의 아미노산 잔기여도 항원으로의 결합활성의 감축을 수반하지 않는 한, 적절히 개변될 수 있다. 또한, 개변되는 아미노산 잔기의 수는 특별히 한정되지 않고, FR영역의 특정 세그먼트를 목적하는 세그먼트로 치환함으로써도 실시된다. 당해 세그먼트는 FR영역 중, FR1, FR2, FR3, FR4의 각 세그먼트 모두를 개변하는 것도 가능하고, 또한, 하나 또는 그 이상의 각 세그먼트의 개변의 조합에 의해서도 실시될 수 있다.
 FR영역의 세그먼트를 개변하는 경우에는, H사슬 또는 L사슬의 FR2영역을 바람직한 예로서 들 수 있다. 예를 들면, 서열번호:195로 표시되는 VH1b의 서브클래스를 갖는 인간화 글리피칸3 항체의 H사슬의 FR2를 VH4의 서브클래스로 개변하는 아미노산 잔기의 개변, 즉, 37번째의 발린을 이소류신으로 치환하는 V37I, 마찬가지로 A40P, M48I, L51I의 개변을, 바람직한 구체예로서 들 수 있다. 또한, 예를 들면, 서열번호:201로 표시되는 VK2의 서브클래스를 갖는 인간화 글리피칸3 항체의 L사슬 FR2영역의 VK3의 서브클래스로의 개변, 즉, L42Q, S48A, Q50R의 개변, 더 나아가서는 FR1의 생식세포계열의 서열로의 개변에 상당하는 V2I의 개변을 바람직한 구체예로서 들 수 있다.
 항체를 구성하는 아미노산 잔기의 치환, 결실, 부가 및/또는 삽입, 및 인간화, 키메라화 등의 아미노산 서열의 개변은, 모두 당업자에게 공지의 방법에 의해 바람직하게 행해질 수 있다. 마찬가지로, 본 발명이 제공하는 항체를 재조합 항체로서 제작할 때, 항체의 가변영역 및 정상영역을 구성하는 아미노산 잔기의 치환, 결실, 부가 및/또는 삽입이 바람직하게 행해진다.
 본 발명에 있어서의 항체는 마우스 항체, 인간 항체, 랫트 항체, 토끼 항체, 염소 항체, 낙타 항체 등, 어떤 동물 유래의 항체도 바람직하게 사용된다. 또한, 예를 들면, 키메라 항체, 그 중에서도 인간화 항체 등과 같이, 그 아미노산 서열이 치환된 개변 항체도 바람직하게 사용될 수 있다. 또한, 각종 분자가 결합된 항체 수식물도 바람직하게 사용될 수 있다.
 「키메라 항체」란, 상이한 동물 유래의 서열을 조합시켜서 제작되는 항체이다. 예를 들면, 마우스 항체의 H사슬, L사슬의 가변(V)영역과 인간 항체의 H사슬, L사슬의 정상(C)영역으로 구성되는 항체가 바람직하게 예시될 수 있다. 키메라 항체의 제작방법은 공지이다. 예를 들면, 항체 V영역을 코드하는 DNA와 인간 항체 C영역을 코드하는 DNA를 인프레임에서 융합한 재조합 DNA가, 통상 사용되는 발현벡터에 삽입된다. 당해 벡터가 도입된 숙주세포를 배양함으로써, 그 배양액으로부터 키메라 항체가 적절히 취득 또는 단리될 수 있다.
 인간화 항체는, 재구성(reshaped) 인간 항체로도 불려, 인간 이외의 포유동물, 예를 들면 마우스 등으로부터 단리되는 항체의 상보성 결정영역(CDR; complementary determining region)과 인간 항체의 프레임워크영역(FR; framework region)이 연결되어 있는 항체이다. 인간화 항체를 코드하는 DNA 서열은, 복수개의 올리고뉴클레오티드를 주형으로서 사용한 오버랩 PCR 반응에 의해 합성될 수 있다. 오버랩 PCR 반응의 재료, 그 실시방법은, WO98/13388 등에 기재되어 있다. 본 발명의 인간화 항체의 가변영역을 코드하는 DNA는, 서로 오버랩하는 뉴클레오티드 서열을 가지도록 제작한 복수개의 올리고뉴클레오티드로부터 오버랩 PCR에 의해 얻어지고, 이것은 인간 항체 정상영역을 코드하는 DNA와 인프레임에서 코돈 서열이 형성되도록 연결된다. 상기와 같이 연결된 DNA는, 이어서 발현벡터에 당해 DNA가 발현하도록 삽입되어, 숙주에 도입된다.
 CDR을 동정하기 위한 방법은 공지이다(Kabat et al., Sequence of Proteins of Immunological Interest (1987), National Institute of Health, Bethesda, Md.; Chothiaet al., Nature (1989) 342, 877). 또한, 그 일반적인 유전자 재조합수법도 공지이다(유럽특허출원 공개번호 EP125023호 공보, WO96/02576호 공보 참조). 이들 공지의 방법을 사용함으로써, 예를 들면, 마우스 항체 등의 비인간동물로부터 취득된 항체의 CDR이 결정된 후에, 당해 CDR과 인간 항체의 FR이 연결된 재조합 항체를 코드하는 DNA가 구축된다. CDR을 매개로 하여 연결되는 인간 항체의 FR은, CDR이 양호한 항원 결합부위를 형성하도록 선택된다. 필요하다면, 재구성 인간 항체의 CDR이 적절한 항원 결합부위를 형성하도록, 항체의 가변영역에 있어서의 FR의 아미노산 잔기가 적절히 개변될 수 있다(Sato et al., Cancer Res.(1993) 53, 851-6). 개변에 제공하는 FR 중의 아미노산 잔기로서는, 항원에 대해 비공유결합에 의해 직접 결합하는 잔기(Amit et al., Science (1986) 233, 747-53), CDR 구조에 영향 또는 작용하는 잔기(Chothia et al., J. Mol. Biol. (1987) 196, 901-17) 및 VH-VL 상호작용에 관련하는 잔기(EP239400호 특허공보)가 포함된다.
 당해 DNA가 삽입된 통상 사용되는 발현벡터에 의해 형질전환 또는 형질도입된 숙주세포가 생산하는, 당해 DNA가 코드하는 인간화 항체는, 당해 숙주세포를 배양함으로써, 당해 배양액으로부터 단리된다.
 본 발명이 제공하는 항체가 항체, 인간화 항체 또는 인간 항체인 경우에는, 당해 항체의 C영역으로서 인간 항체 유래의 C영역이 바람직하게 사용된다. 예를 들면 H사슬 C영역으로서는, Cγ1, Cγ2, Cγ3, Cγ4가, L사슬 C영역으로서는, Cκ, Cλ가 각각 바람직하게 사용될 수 있다. 또한, 항체 또는 그 생산의 안정성을 개선하기 위해, 인간 항체 C영역이 적절히 수식될 수 있다. 본 발명이 제공하는 키메라 항체는, 인간 이외의 포유동물로부터 취득되는 항체의 V영역과 인간 항체의 C영역에 의해서 바람직하게 구성된다. 한편, 인간화 항체는, 바람직하게는 인간 이외의 포유동물로부터 취득되는 항체의 CDR과, 인간 항체의 FR 및 C영역에 의해 바람직하게 구성된다. 또한, 인간 항체는, 인간으로부터 취득되는 항체의 CDR과, 인간 항체의 FR 및 C영역에 의해 바람직하게 구성된다. 인간 항체의 C영역은, IgG(IgG1, IgG2, IgG3, IgG4), IgM, IgA, IgD 및 IgE 등의 아이소타입에 대응하는 고유의 아미노산 서열로 구성된다. 본 발명이 제공하는 인간화 항체의 C영역으로서, 어느 아이소타입에 속하는 항체의 C영역도 바람직하게 사용된다. 바람직하게는, 인간 IgG의 C영역이 사용되나, 이것에 한정되지 않는다. 또한, 인간화 항체 또는 인간 항체의 FR로서 이용되는 인간 항체의 FR도 특별히 한정되지 않고, 어느 아이소타입에 속하는 항체의 FR도 바람직하게 사용된다.
 면역원성의 저하를 목적으로서, 비특허문헌(Ono K, Ohtomo T, Yoshida K, Yoshimura Y, Kawai S, Koishihara Y, Ozaki S, Kosaka M, Tsuchiya M., The humanized anti-HM1.24 antibody effectively kills multiple myeloma cells by human effector cell-mediated cytotoxicity., Mol Immunol. (1999) 36(6), 387-395)에서 기재되는 방법과 유사한 방법을 사용함으로써 FR영역을 구성하는 아미노산 잔기의 전부 또는 일부를 생식세포계열의 서열로 치환하는 것도 적용될 수 있다. 생식세포계열의 서열은 면역원성이 낮을 것이라는 합리적 예측을 토대로 하여, 인간화 항체의 FR영역을 구성하는 아미노산 서열이 생식세포계열의 아미노산 서열과 얼라인먼트함으로써 비교된다(Abhinandan K. R. and Martin C. R., J. Mol. Biol., (2007) 369, 852-862). 항원에 대한 결합활성을 상실시키지 않는 범위에 있어서, 당해 비교에 있어서 상이한 인간화 항체의 FR영역을 구성하는 아미노산 잔기가, 생식세포계열의 서열에 있어서의 아미노산 잔기로 치환될 수 있다. 구체적인 예로서는 서열번호:195로 표시되는 H사슬 가변영역을 구성하는 아미노산 잔기 중, 70번째의 L을 I로, 87번째의 T를 R로, 97번째의 T를 A로 치환하는 개변 등을 들 수 있다. 또한, 서열번호:201로 표시되는 L사슬 가변영역을 구성하는 아미노산 잔기 중, 25번째의 S를 A로 치환하는 개변 등을 들 수 있다.
 본 발명이 제공하는 개변된 키메라 항체, 인간화 항체 및 인간 항체의 가변영역 및 정상영역은, 항원에 대한 결합 특이성을 나타내는 한, 개변에 제공된 항체의 가변영역 및 정상영역을 구성하는 하나 또는 그 이상의 아미노산의 결실, 치환, 삽입 및/또는 부가 등이 바람직하게 실시될 수 있다.
 인간 유래의 서열을 이용한 키메라 항체, 인간화 항체 및 인간 항체는, 인간 체내에 있어서의 면역원성이 저하되어 있기 때문에, 치료목적 등으로 인간에 투여하는 치료용 항체로서 사용되는 경우에 유용하다고 생각된다.
 본 발명의 방법에 있어서의 변이 도입 전의 항체의 H사슬 또는 L사슬을 코드하는 유전자의 서열로서는, 기지의 서열이 사용될 수 있고, 그 외에는, 당업자에게 공지의 방법에 의해, 항체 유전자의 신규한 서열이 취득될 수 있다. 당해 유전자는, 예를 들면, 항체 라이브러리로부터 바람직하게 취득될 수 있다. 또한, 당해 유전자는 단일클론항체를 생산하는 하이브리도마의 mRNA를 주형으로서 사용한 RT-PCR법 등의 공지의 수법을 사용하여 클로닝함으로써도 취득될 수 있다.
 항체 라이브러리에 대해서는 이미 많은 항체 라이브러리가 공지이다. 또한, 항체 라이브러리의 제작방법도 공지이기 때문에, 당업자는 적절히 항체 라이브러리를 입수 또는 제작할 수 있다. 예를 들면, 바람직한 항체 라이브러리로서, Clackson et al., Nature (1991) 352, 624-8, Marks et al., J. Mol. Biol. (1991) 222, 581-97, Waterhouseset al., Nucleic Acids Res. (1993) 21, 2265-6, Griffiths et al., EMBO J. (1994) 13, 3245-60, Vaughan et al., Nature Biotechnology (1996) 14, 309-14 및 일본국 특허공표 평20-504970호 공보 등의 문헌에 의해 개시된 항체 파지 라이브러리가 예시된다. 그 외에, 진핵세포에 있어서 라이브러리를 제작하는 방법(WO95/15393호 팸플릿)이나 리보솜 제시법 등의 공지의 방법이 바람직하게 사용된다. 또한, 인간 항체 라이브러리를 출발재료로 사용하여, 패닝에 의해 인간 항체를 취득하는 기술이 당업자에게 있어서 알려져 있다. 즉, 인간 항체의 H사슬 및 L사슬의 가변영역이 인프레임에서 융합된 단일 사슬 항체(scFv)가 파지 디스플레이법에 의해 파지의 표면에 발현된다. 항원에 대해 결합한 파지를 선택함으로써, 항원에 결합하는 scFv를 코드하는 유전자가 당해 파지로부터 단리된다. 당해 유전자의 서열을 동정함으로써, 항원에 결합하는 항체의 H사슬 및 L사슬의 가변영역을 코드하는 DNA의 서열이 결정될 수 있다. 당해 서열을 갖는 항체 유전자는 적절히 발현벡터에 삽입되고, 후술하는 바와 같은 적절한 숙주세포 중에서 발현함으로써 인간 항체가 적절히 취득된다. 이들의 방법은 이미 주지로, WO92/01047, WO92/20791, WO93/06213, WO93/11236, WO93/19172, WO95/01438, WO95/15388에 개시된 방법이 예시된다.
 단일클론항체를 생산하는 하이브리도마로부터 항체를 코드하는 유전자를 취득하는 방법은, 기본적으로는 공지 기술이 채용될 수 있다. 이하에 상세히 기술하나, 간단하게는, 통상의 면역방법에 따라 목적하는 감작항원에 의해 동물이 면역된 후에, 당해 동물로부터 얻어지는 면역세포가, 통상의 세포융합법에 의한 공지의 친세포와의 세포융합에 공여된다. 통상의 스크리닝법에 따라, 단일클론항체 생산세포(하이브리도마)가 스크리닝되고, 선택된 하이브리도마로부터 취득된 mRNA를 주형으로서 사용하여 항체의 가변영역(V영역)의 cDNA가 역전사효소에 의해 합성된다. 당해 cDNA를 목적하는 항체 정상영역(C영역)을 코드하는 DNA와 인프레임에서 융합함으로써 항체 유전자가 바람직하게 취득된다.
 보다 구체적으로는, 이하와 같은 예시를 바람직하게 들 수 있으나, 본 발명은 이들의 예에 한정되지 않는다. 본 발명에 의해 제공되는 항체를 얻기 위해서 사용되는 감작항원은, 면역원성을 갖는 완전 항원이어도 되고, 면역원성을 나타내지 않는 합텐 등을 포함하는 불완전 항원이어도 된다. 예를 들면, 전장 단백질, 또는 그의 부분 폴리펩티드 또는 펩티드 등이 바람직하게 사용될 수 있다. 서열번호:207로 표시되는 가용형 GPC3 코어 폴리펩티드는 그 바람직한 구체예로서 들 수 있다. 그 외에, 다당류, 핵산, 지질 등으로 구성되는 물질도 또한 항원으로서 작용하는 것이 알려져 있어, 본 발명의 항체가 결합하는 항원은 전술한 물질의 태양에 특별히 한정되지 않는다. 항원의 조제는, 당업자에게 공지의 방법에 의해 바람직하게 행해지고, 예를 들면, 바큘로바이러스를 사용한 방법(예를 들면, WO98/46777 등) 등이 바람직하게 사용될 수 있다. 항원의 면역원성이 낮은 경우에는, 알부민 등의 면역원성을 갖는 거대분자에 결합된 당해 항원에 의해 동물이 바람직하게 면역될 수 있다. 또한, 감작항원이 세포막을 관통하는 분자인 경우에는, 필요하다면, 당해 분자의 세포외영역의 폴리펩티드 단편이 감작항원으로서 바람직하게 사용된다. 또는, 당해 분자를 세포 표면 상에 발현하는 세포를 감작항원으로서 바람직하게 사용할 수 있다. 또한, 감작항원이 불용성 분자인 경우에는, 당해 분자를 다른 수용성 분자와 결합함으로써 가용화하고, 당해 가용화한 결합분자가 감작항원으로서 바람직하게 사용된다.
 항체생산세포는, 상기 적절한 감작항원을 사용해서 동물이 면역됨으로써 바람직하게 얻어진다. 또는, 항체를 생산할 수 있는 림프구를 인 비트로(in vitro)에서 면역함으로써, 항체생산세포가 취득될 수 있다. 면역되는 동물로서는, 각종 척추동물, 포유동물이 사용될 수 있다. 특히, 설치목, 토끼목, 영장목의 동물이 면역되는 동물로서 일반적으로 사용된다. 마우스, 랫트, 햄스터 등의 설치목, 토끼 등의 토끼목, 게잡이원숭이, 붉은털 원숭이, 망토비비, 침팬지 등의 원숭이 등의 영장목의 동물이 예시된다. 그 외에, 인간 항체 유전자의 레퍼토리를 그 게놈 상에 보유하는 형질전환 동물도 알려져 있어, 이와 같은 동물을 사용함으로써 인간 항체가 바람직하게 얻어진다(WO96/34096; Mendez et al., Nat. Genet. (1997) 15, 146-56 참조). 이와 같은 형질전환 동물의 사용 대신에, 예를 들면, 인간 림프구가 in vitro에서 목적하는 항원 또는 목적하는 항원을 발현하는 세포에 의해 감작된 후에, 인간 골수종 세포, 예를 들면 U266과 세포 융합됨으로써, 당해 항원으로의 결합활성을 갖는 목적하는 인간 항체가 바람직하게 얻어진다(일본국 특허공고 평1-59878호 공보 참조). 또한, 인간 항체 유전자의 모든 레퍼토리를 그 게놈 상에 보유하는 형질전환 동물이 목적하는 항원으로 면역됨으로써(WO93/12227, WO92/03918, WO94/02602, WO96/34096, WO96/33735 참조) 목적하는 인간 항체가 바람직하게 취득될 수 있다.
 동물의 면역은, 예를 들면, 감작항원이 Phosphate-Buffered Saline(PBS) 또는 생리식염수 등으로 적절히 희석, 현탁되고, 필요하다면 애쥬반트와 혼합함으로써 유화된 후, 당해 감작항원이 동물의 복강 내 또는 피하에 주사함으로써 실시된다. 그 후, 바람직하게는, 프로인트 불완전 애쥬반트와 혼합한 감작항원이 4~21일마다 수회 투여된다. 면역된 동물 중에 있어서의 감작항원에 대한 항체생산의 확인은, 감작항원에 대한 당해 동물의 혈청 중의 항체 역가를 관용의 방법, 예를 들면, 효소결합 면역흡착 분석(ELISA), 플로우 사이토메트리(FACS) 등의 공지의 분석법에 의해 측정함으로써 실시될 수 있다.
 하이브리도마는, 목적하는 감작항원으로 면역된 동물 또는 림프구에 의해 얻어진 항체생산세포를, 세포 융합을 위해 관용되는 융합제(예를 들면, 폴리에틸렌글리콜)를 사용해서 골수종 세포와 융합함으로써 제작될 수 있다(Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) 59-103). 하이브리도마의 제작은, 예를 들면, 밀스테인등의 방법(G. Kohler and C. Milstein, Methods Enzymol. (1981) 73, 3-46) 등에 따라 바람직하게 행해질 수 있다. 상기 방법에 의해 제작된 하이브리도마 세포를 배양·증식함으로써, 당해 하이브리도마에 의해 생산된 항원 단백질에 특이적으로 결합하는 단일클론항체가 취득된다. 면역침강, 방사면역분석(RIA), 효소결합 면역흡착분석(ELISA), 플로우 사이토메트리(FACS) 등의 공지의 분석법에 의해, 당해 단일클론항체의 항원 단백질에 대한 결합 특이성이 적절히 측정될 수 있다. 그 후, 필요하다면, 목적하는 특이성, 결합활성 또는 활성이 측정된 항체를 생산하는 하이브리도마가, 한계희석법 등의 수법에 의해 바람직하게 서브클로닝되어, 당해 하이브리도마에 의해 생산된 단일클론항체가 단리될 수 있다.
 계속해서, 선택된 항체를 코드하는 유전자가 전술한 하이브리도마 또는 항체생산세포(감작 림프구 등)로부터, 당해 유전자에 특이적으로 결합 가능한 프로브(예를 들면, 항체 정상영역을 코드하는 서열에 상보적인 올리고뉴클레오티드 등)를 사용해서 클로닝될 수 있다. 또한, 하이브리도마 또는 항체생산세포(감작 림프구)로부터 취득된 mRNA를 주형으로서 사용하는 RT-PCR법에 의해 클로닝될 수 있다. 면역글로불린은, 그 구조 및 기능의 상위를 토대로 하여, IgA, IgD, IgE, IgG 및 IgM의 5개의 상이한 클래스로 분류된다. 또한, 각 클래스는 몇 개의 아이소타입(예를 들면, IgG1, IgG2, IgG3 및 IgG4; IgA1 및 IgA2 등)으로 분류된다. 본 발명에 의해 제공되는 항체는, 이들 중 어느 클래스 및 서브클래스에 속하는 항체에 유래하는 것이어도 되고, 어느 하나의 클래스 및 서브클래스에 특별히 한정되지 않으나, IgG 클래스에 속하는 항체는 특히 바람직한 것으로서 들 수 있다.
 항체의 H사슬 및 L사슬을 구성하는 아미노산 서열을 코드하는 유전자는, 유전자공학적 수법에 의해 적절히 개변될 수 있다. 예를 들면, 마우스 항체, 랫트 항체, 토끼 항체, 햄스터 항체, 양 항체, 낙타 항체 등의 항체를 구성하는 아미노산 서열을 코드하는 핵산 잔기를 개변함으로써, 인간에 대한 이종 항원성을 저하시키는 것 등을 목적으로 하는 인위적 개변이 실시된 유전자 재조합 항체, 예를 들면, 키메라 항체, 인간화 항체 등이 적절히 제작될 수 있다. 키메라 항체는, 인간 이외의 포유동물, 예를 들면, 마우스 유래의 항체의 H사슬, L사슬의 가변영역과 인간 항체의 H사슬, L사슬의 정상영역으로 구성되는 항체로, 예를 들면, 마우스에서 유래하는 항체의 가변영역을 코드하는 DNA를 인간 항체의 정상영역을 코드하는 DNA와 연결하고, 이것을 발현벡터에 삽입한 재조합 벡터를 숙주에 도입한 후에 발현함으로써 얻을 수 있다. 인간화 항체는, 재구성(reshaped) 인간 항체로도 불리나, 인간 이외의 포유동물, 예를 들면 마우스 등으로부터 단리되는 항체의 상보성 결정영역(CDR; complementary determining region)과 인간 항체의 프레임워크영역이 인프레임에서 코돈 서열이 형성되도록 연결된 항체이다. 이 인간화 항체를 코드하는 DNA 서열은, 복수개의 올리고뉴클레오티드를 주형으로서 사용한 오버랩 PCR 반응에 의해 합성될 수 있다. 오버랩 PCR 반응의 재료, 그 실시방법은, WO98/13388 등에 기재되어 있다.
 본 발명의 유전자 재조합 항체의 가변영역을 코드하는 DNA는, 서로 오버랩하는 뉴클레오티드 서열을 가지도록 제작한 복수개의 올리고뉴클레오티드로부터 오버랩 PCR에 의해 얻어지고, 이것은 인간 항체 정상영역을 코드하는 DNA와 인프레임에서 코돈 서열이 형성되도록 연결된다. 상기와 같이 연결된 DNA는, 이어서 발현벡터에 당해 DNA가 발현하도록 삽입되어, 숙주에 도입된다. 당해 DNA에 의해 코드된 항체는, 당해 숙주를 배양함으로써 발현한다. 발현한 항체는, 당해 숙주의 배양액 등으로부터 적절히 정제함(EP239400; WO96/02576 참조)으로써 얻어진다. CDR을 매개로 하여 연결되는 인간화 항체의 FR은, 상보성 결정영역이 항원에 대한 양호한 항원 결합부위를 형성하는 것이 선택된다. 필요에 따라, 재구성 인간 항체의 상보성 결정영역이 항원에 대한 적절한 항원 결합부위를 형성하도록 선택된 항체의 가변영역의 FR을 구성하는 아미노산 잔기가 적절히 치환됨으로써 개변될 수 있다(K. Sato et al., Cancer Res. (1993) 53, 851-856).
 전술한 인간화에 관한 개변 이외에, 예를 들면, 항체가 인식하는 항원과의 결합활성 등의 항체의 생물학적 특성을 개선하기 위한 개변이 실시될 수 있다. 본 발명에 있어서의 개변은, 부위특이적 돌연변이(예를 들면, Kunkel, Proc. Natl. Acad. Sci. USA (1985) 82, 488 참조), PCR 변이, 카세트 변이 등의 방법에 의해 바람직하게 행해질 수 있다. 일반적으로, 그 생물학적 특성이 개선된 개변 항체를 구성하는 아미노산 서열은, 70% 이상, 보다 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상(예를 들면, 95% 이상, 97%, 98%, 99% 등)의 동일성 및/또는 유사성을, 개변에 제공하는 항체(즉, 개변 항체의 기초가 된 항체)를 구성하는 아미노산 서열에 대해 갖는다. 본 명세서에 있어서, 서열의 동일성 및/또는 유사성이란, 서열 동일성이 최대의 값을 취하도록 필요에 따라 서열을 정렬화 및 갭 도입한 후, 개변 항체의 기초가 된 항체를 구성하는 아미노산 잔기와 동일(동일한 잔기) 또는 유사(일반적인 아미노산의 측쇄의 특성을 토대로 하여 동일한 그룹으로 분류되는 아미노산 잔기)한 아미노산 잔기의 비율을 말한다. 통상, 천연의 아미노산 잔기는, 그 측쇄의 성질을 토대로 하여 (1) 소수성: 알라닌, 이소류신, 발린, 메티오닌 및 류신; (2) 중성친수성: 아스파라긴, 글루타민, 시스테인, 트레오닌 및 세린; (3) 산성: 아스파라긴산 및 글루타민산; (4) 염기성: 아르기닌, 히스티딘 및 리신; (5) 사슬의 배향에 영향을 주는 잔기: 글리신 및 프롤린; 및 (6) 방향족성: 티로신, 트립토판 및 페닐알라닌의 그룹으로 분류될 수 있다.
 또한, 항체의 기능의 증강을 목적으로 하는 개변으로서, 예를 들면 인간화 항체를 비롯한 항체가 발휘하는 세포상해활성의 향상도 구체적 일태양으로서 바람직하게 들 수 있다. 세포상해활성으로서는, 예를 들면 항체의존성 세포개재성 세포상해(antibody-dependent cell-mediated cytotoxicity: ADCC)활성, 보체의존성 세포상해(complement-dependent cytotoxicity: CDC)활성 등이 바람직한 예로서 예시될 수 있다. 본 발명에 있어서, CDC활성이란 보체계에 의한 세포상해활성을 말한다. 한편 ADCC활성이란 표적 세포의 세포 표면 항원에 특이적 항체가 부착되었을 때, 그 Fc부분에 Fcγ 수용체 보유 세포(면역세포 등)가 Fcγ 수용체를 매개로 하여 결합하여, 표적 세포에 상해를 부여하는 활성을 말한다. 피험 항체가 ADCC활성을 갖는지 여부 또는 CDC활성을 갖는지 여부는 공지의 방법에 의해 측정될 수 있다(예를 들면, Current protocols in Immunology, Chapter7. Immunologic studies in humans, Editor, John E, Coligan et al., John Wiley & Sons, Inc.,(1993) 등).
 구체적으로는, 먼저, 이펙터세포, 보체용액, 표적세포의 조제가 실시된다.
 (1) 이펙터세포의 조제
 CBA/N 마우스 등으로부터 비장을 적출하고, RPMI1640배지(Invitrogen) 중에서 비장세포가 분리된다. 10% 소 태아 혈청(FBS, HyClone)을 포함하는 동일 배지로 세정 후, 세포농도를 5×10 6 세포/㎖로 조제함으로써, 이펙터세포가 조제될 수 있다.
 (2) 보체용액의 제조
 Baby Rabbit Complement(CEDARLANE)을 10% FBS 함유 배지(Invitrogen)에서 10배 희석하여, 보체용액이 조제될 수 있다.
 (3) 표적세포의 조제
 피험 항체가 결합하는 항원 단백질을 발현하는 세포를 0.2 mCi의 51Cr-크롬산나트륨(GE 헬스케어 바이오사이언스)과 함께, 10% FBS 함유 DMEM배지 중에서 37℃에서 1시간 배양함으로써 당해 표적세포가 방사성 표지될 수 있다. 피험 항체가 결합하는 항원 단백질을 발현하는 세포로서는, 피험 항체가 결합하는 항원 단백질을 코드하는 유전자로 형질전환된 세포, 난소암, 전립선암, 유방암, 자궁암, 간암, 폐암, 췌장암, 위암, 방광암 및 대장암 세포 등이 이용될 수 있다. 방사성 표지 후, 당해 세포를 10% FBS 함유 RPMI1640배지로 3회 세정하고, 세포농도를 2×10 5 세포/㎖ 조제함으로써, 당해 표적세포가 조제될 수 있다.
 ADCC활성 또는 CDC활성은 하기에 기술하는 방법에 의해 측정될 수 있다. ADCC활성 측정의 경우는, 96웰 U자상 바닥 플레이트(Becton Dickinson)에, 표적세포와, 피험 항체를 50 ㎕씩 첨가하고, 빙상에서 15분간의 반응이 실시된다. 그 후, 이펙터세포 100 ㎕가 첨가된 반응 혼합액은, 탄산가스 인큐베이터 내에서 4시간 인큐베이트된다. 피험 항체의 최종농도는 0~10 ㎍/㎖의 범위 내에서 적절히 사용될 수 있다. 당해 인큐베이션 후, 100 ㎕의 상청이 회수되고, 감마 카운터(COBRAII AUTO-GAMMA, MODEL D5005, Packard Instrument Company)로 당해 상청이 갖는 방사활성이 측정된다. 세포상해활성(%)은 얻어진 방사활성의 값을 사용하여 (A-C)/(B-C)×100의 계산식을 토대로 하여 계산될 수 있다. A는 각 피검 항체의 시료를 사용한 경우의 방사활성(cpm), B는 1% NP-40(nacalai tesque)을 첨가한 시료를 사용한 경우의 방사활성(cpm), C는 표적세포만을 포함하는 시료를 사용한 경우의 방사활성(cpm)을 나타낸다.
 한편, CDC활성 측정의 경우는, 96웰 바닥이 평평한 플레이트(Becton Dickinson)에, 표적세포와 피험 항체가 50 ㎕씩 첨가되어, 빙상에서 15분간의 반응이 실시된다. 그 후, 보체용액 100 ㎕이 첨가된 반응 혼합액은, 탄산가스 인큐베이터 내에서 4시간 인큐베이트된다. 피험 항체의 최종농도는 0~3 ㎍/㎖의 범위 내에서 적절히 사용될 수 있다. 배양 후, 100 ㎕의 상청이 회수되고, 감마 카운터로 당해 상청이 갖는 방사활성이 측정된다. 세포상해활성은 ADCC활성의 측정과 동일하게 하여 계산될 수 있다.
 한편, 항체 콘쥬게이트에 의한 세포상해활성 측정의 경우는, 96웰 바닥이 평평한 플레이트(Becton Dickinson)에, 표적세포와 피험 항체 콘쥬게이트가 50 ㎕씩 첨가되어, 빙상에서 15분간의 반응이 실시된다. 당해 플레이트는 탄산가스 인큐베이터 내에서 1~4시간 인큐베이트된다. 항체의 최종농도는 0~3 ㎍/㎖의 범위 내에서 적절히 사용될 수 있다. 배양 후, 100 ㎕의 상청이 회수되어, 감마 카운터로 당해 상청이 갖는 방사활성이 측정된다. 세포상해활성은 ADCC활성의 측정과 동일하게 하여 계산될 수 있다.
 항체의 H사슬 및 L사슬의 가변영역은, 전술한 바와 같이, 통상 3개의 CDR과 4개의 FR에 의해 구성되어 있다. 본 발명의 바람직한 태양에 있어서 「개변」에 제공하는 아미노산 잔기로서는, 예를 들면, CDR 또는 FR을 구성하는 아미노산 잔기 중에서 적절히 선택될 수 있다.
 또한, 당업자라면, 항체의 가변영역의 FR을 구성하는 아미노산 서열로서, 인간 또는 마우스 등의 생물에 있어서 실재하는 서열을, Kabat 등의 공공 데이터베이스 등을 이용하여 바람직하게 취득할 수 있다.
 본 발명의 바람직한 태양에 있어서는, 본 발명의 방법에 의해 혈장 중 약물동태가 제어된 인간화 항체를 제공한다. 당해 인간화 항체는, 예를 들면, 인간 이외의 동물 유래의 상보성 결정영역(CDR), 인간 유래의 프레임워크영역(FR) 및 인간 C영역을 포함하는 인간화 항체로서, CDR 또는 FR에 있어서 항체 표면에 노출 가능한 하나 이상의 아미노산 잔기가 원래의 항체의 CDR 또는 FR이 대응하는 위치의 아미노산 잔기와는 상이한 전하를 갖는 아미노산 잔기로, 동일한 C영역을 갖는 키메라 항체에 비해 혈장 중 약물동태가 제어된 인간화 항체이다.
 또한 본 발명의 바람직한 태양에 있어서는, 본 발명의 방법에 의해 혈장 중 약물동태가 제어된 인간 항체를 제공한다. 당해 인간 항체는, 예를 들면, 인간 유래의 상보성 결정영역(CDR), 인간 유래의 프레임워크영역(FR) 및 인간 C영역을 포함하는 인간 항체로서, CDR 또는 FR에 있어서 항체 표면에 노출 가능한 하나 이상의 아미노산 잔기가 원래의 항체의 CDR 또는 FR이 대응하는 위치의 아미노산 잔기와는 상이한 전하를 갖는 아미노산 잔기로, 동일한 C영역을 갖는 키메라 항체에 비해 혈장 중 약물동태가 제어된 인간 항체이다.
 상기 인간 정상영역이란, 바람직하게는, 야생형 인간 Fc영역을 포함하는 영역을 말하나, 개변된 Fc도 바람직하게 사용될 수 있다. 상기 「개변된 Fc」로서는, 당해 Fc를 구성하는 아미노산 잔기가 개변된 것도 포함될 수 있고, 또한, 당해 Fc부분에 실시된 수식이 개변된 것도 포함될 수 있다. 당해 Fc부분에 부가된 당사슬 수식의 양식을 개변하는 것을, 상기 수식 개변의 구체예로서 바람직하게 들 수 있다. 본 명세서에 있어서, 참고 실시예로서 구체적으로 개시되는 「항체의 Fc영역에 결합한 푸코오스 함량이 저하된 항체」를 그와 같은 바람직한 구체예로서 들 수 있다.
 「항체의 Fc영역에 결합한 푸코오스 함량이 저하된 항체」란, 대조로 하는 항체와 비교한 경우에, 결합하고 있는 푸코오스량이 유의하게 적고, 바람직하게는 검출할 수 없는 항체를 말한다. 통상은, 항체 1분자를 구성하는 2분자의 H사슬의 Fc영역에 존재하는 2개소의 당사슬 결합부위에 결합한 N-글리코시드 결합 당사슬에 푸코오스가 부가된다. 본 발명에 있어서 「항체의 Fc영역에 결합한 푸코오스 함량이 저하된 항체」란, 이와 같은 통상의 항체를 대조로서 비교한 경우에 있어서, 대조 항체가 갖는 총 당사슬 함량의 50% 이하, 바람직하게는 25% 이하, 더욱 바람직하게는 10% 이하, 특히 바람직하게는 0% 이하의 푸코오스 함량을 갖는 항체를 말한다. 푸코오스 함량은, 하기에 참고 실시예로서 구체적으로 나타내는 해석방법을 사용해서 측정할 수 있다. 당해 푸코오스 함량이 저하된 항체의 제작방법은, 본원 발명의 참고 실시예로서 기재하는 것 외에, 예를 들면, 푸코실 트랜스페라아제를 결실한 동물세포에 의해 제작하는 방법(Biotechnol Bioeng. (2004), 87(5), 614-22), 복합 분지 당사슬 수식이 개변된 동물세포에 의해 제작하는 방법(Biotechnol Bioeng. (2006) 93(5), 851-61) 등을 바람직하게 그 예시로서 들 수 있다. 또한, 동물세포 이외의 세포를 숙주세포로서 제작하는 방법으로서는, 식물세포에 의해 제작하는 방법(Nature Biotechnology (2006) 24, 1591-7) 또는 효모세포에 의해 제작하는 방법(Nature Biotechnology (2006) 24, 210-5) 등도 바람직하게 들 수 있다.
 본 발명의 제조방법의 바람직한 태양으로서는, 등전점이 개변된 항체 가변영역을 포함하는 폴리펩티드의 제조방법으로서,
 (a) 당해 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 변환되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하고,
 (b) 숙주세포를 당해 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로 하는 항체 가변영역을 포함하는 폴리펩티드를 회수하는 것을 포함하는 방법이다.
 또한 본 발명의 제조방법의 바람직한 태양으로서는, 혈장 중 약물동태가 제어된 항체 가변영역을 포함하는 폴리펩티드의 제조방법으로서,
 (a) 당해 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 변환되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하고,
 (b) 숙주세포를 당해 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로 하는 항체 가변영역을 포함하는 폴리펩티드를 회수하는 것을 포함하는 방법이다.
 또한 당해 방법에 의해 제조되는 혈장 중 약물동태가 제어된 항체의 가변영역을 포함하는 폴리펩티드도 본 발명에 포함된다.
 또한 본 발명은, 항체의 가변영역을 갖는 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드의 제조방법을 제공한다. 또한 본 발명은, 당해 방법에 의해 제조되는 다중 특이성 폴리펩티드를 제공한다. 본 발명의 제조방법의 바람직한 태양으로서, 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 증대하도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하는 것을 포함하는 방법이다. 즉, 제1 폴리펩티드와 제2 폴리펩티드의 아미노산 서열의 전하를 바꿈으로써, 폴리펩티드에 등전점(pI)의 차이를 증대시키고, 당해 등전점의 차이를 이용하여 다중 특이성 항체를 제조할 수 있다. 상세하게는 이하의 (a)~(c)의 공정을 포함하는 제조방법이다.
 (a) 제1 폴리펩티드와 제2 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 개변되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하는 것을 포함하고, 당해 핵산의 개변이, 개변 전과 비교하여, 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 증대하도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하고,
 (b) 숙주세포를 그 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로부터 다중 특이성 항체를 회수하는 것
 본 발명에 있어서의 폴리펩티드란, 통상, 10 아미노산 정도 이상의 길이를 갖는 펩티드 및 단백질을 가리킨다. 또한, 통상, 생물 유래의 폴리펩티드이나, 특별히 한정되지 않고, 예를 들면, 인공적으로 설계된 서열로 되는 폴리펩티드여도 된다. 또한, 천연 폴리펩티드 또는 합성 폴리펩티드, 재조합 폴리펩티드 등 중 어느 것이어도 된다. 또한, 상기 폴리펩티드의 단편도 또한, 본 발명의 폴리펩티드에 포함된다.
 본 발명에 있어서 「항체의 가변영역을 갖는 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드」란, 적어도 2종 이상의 상이한 항원 또는 동일 항원 내의 상이한 에피토프에 결합하는 항원의 가변영역을 포함하는 폴리펩티드로서, 항체의 가변영역을 포함하는 폴리펩티드에 대해서는 상기와 같이, 예를 들면 항체, 저분자화 항체, Scaffold 단백질 등이 포함된다.
 본 발명에 있어서 「폴리펩티드의 등전점의 차가 증대하는」이란, 2종 이상의 폴리펩티드에 있어서, 표면 아미노산의 전하의 개변을 행함으로써, 서로의 등전점이 같아지지 않는 것, 또는, 2종 이상의 폴리펩티드 간의 등전점 차를 보다 크게 하는 것을 말한다. 등전점의 차는, 예를 들면, 등전점 전기영동 등의 수법을 사용함으로써 관찰할 수 있다. 또한 본 발명에 있어서는, 당해 폴리펩티드의 구조나 기능(활성)을 유지하면서 등전점을 제어하는 것이 바람직하다.
 즉 본 발명은, 항체의 가변영역을 갖는 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드의 제조방법으로서,
 (a) 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 1.0 이상, 바람직하게는 1.2 이상, 더욱 바람직하게는 1.5 이상이 되도록, CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 개변되도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하고,
 (b) 숙주세포를 그 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로부터 다중 특이성 항체를 회수하는 것을 포함하는 다중 특이성 항체의 제조방법을 제공한다.
 또한 본 발명은, 항체의 가변영역을 갖는 제1 폴리펩티드 및 제2 폴리펩티드를 포함하는 다중 특이성 폴리펩티드를 정제하기 위한 다중 특이성 폴리펩티드의 개변방법을 제공한다. 본 발명의 정제방법의 바람직한 태양으로서는, 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 증대하도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하는 것을 포함하는 방법이다. 즉, 제1 폴리펩티드와 제2 폴리펩티드의 아미노산 잔기의 전하를 바꿈으로써, 폴리펩티드에 등전점(pI)의 차이를 도입하고, 당해 등전점의 차이를 이용하여 다중 특이성 항체를 정제할 수 있다. 상세하게는 이하의 (a)~(c)의 공정을 포함하는 정제방법이다.
 (a) 제1 폴리펩티드와 제2 폴리펩티드의 CDR영역의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하가 개변되도록, 당해 아미노산 잔기를 포함하는 폴리펩티드를 코드하는 핵산을 개변하는 것을 포함하고, 당해 핵산의 개변이, 개변 전과 비교하여, 제1 폴리펩티드와 제2 폴리펩티드의 등전점의 차가 증대하도록 제1 폴리펩티드의 아미노산 잔기를 코드하는 핵산 및 제2 폴리펩티드의 아미노산 잔기를 코드하는 핵산의 양쪽 또는 어느 한쪽을 개변하고,
 (b) 숙주세포를 그 핵산이 발현하도록 배양하여,
 (c) 숙주세포 배양물로부터 표준적인 크로마토그래피에 의해 그 다중 특이성 항체를 정제하는 것
 또한, 상기 정제방법에 의해 정제하는 공정을 포함하는 다중 특이성 항체의 제조방법도 본 발명에 포함된다.
 본 발명의 상기 방법에 있어서 「핵산을 개변하는」이란, 본 발명에 있어서의 「개변」에 의해 도입되는 아미노산 잔기에 대응하는 코돈이 되도록 핵산 서열을 개변하는 것을 말한다. 보다 구체적으로는, 개변 전의 아미노산 잔기에 상당하는 코돈을, 개변에 의해 도입되는 아미노산 잔기의 코돈이 되도록, 개변에 제공하는 코돈을 구성하는 핵산을 개변하는 것을 말한다. 통상, 목적의 아미노산 잔기를 코드하는 코돈이 되도록, 코돈을 구성하는 핵산의 적어도 1염기를 치환하는 유전자조작 또는 변이처리를 행하는 것을 의미한다. 즉, 개변에 제공하는 아미노산 잔기를 코드하는 코돈은, 개변에 의해 도입되는 아미노산 잔기를 코드하는 코돈에의해 치환된다. 이와 같은 핵산의 개변은, 당업자에게 있어서 공지의 기술, 예를 들면, 부위특이적 변이유발법, PCR 변이도입법 등을 사용해서, 적절히 실시하는 것이 가능하다.
 또한, 본 발명에 있어서의 핵산은, 통상, 적당한 벡터로 보유(삽입)되고, 숙주세포로 도입된다. 당해 벡터로서는, 삽입한 핵산을 안정하게 유지하는 것이면 특별히 제한되지 않고, 예를 들면 숙주에 대장균을 사용하는 것이면, 클로닝용 벡터로서는 pBluscript 벡터(Stratagene) 등이 바람직하나, 시판의 각종 벡터가 이용 가능하다. 본 발명의 폴리펩티드를 생산하기 위해 벡터가 사용되는 경우에는, 특히 발현벡터가 유용하다. 발현벡터로서는, 시험관 내, 대장균 내, 배양세포 내, 생물개체 내에서 폴리펩티드를 발현하는 벡터이면 특별히 제한되지 않고, 예를 들면, 시험관 내 발현이면 pBest 벡터(프로메가), 대장균이면 pET 벡터(invitrogen), 배양세포이면 pME18S-FL3 벡터(GenBank Accession No.AB009864), 생물개체이면 pME18S 벡터(Mol Cell Biol.(1988) 8, 466-472) 등이 바람직하다. 벡터로의 본 발명의 DNA의 삽입은, 통상의 방법에 의해, 예를 들면, 제한효소 사이트를 사용한 리가아제반응에 의해 바람직하게 행해질 수 있다(Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons.Section 11.4-11.11).
 상기 숙주세포로서는 특별히 제한은 없고, 목적에 따라 각종 숙주세포가 사용된다. 폴리펩티드를 발현시키기 위한 세포로서는, 예를 들면, 세균세포(예: 스트렙토코커스, 스타필로코커스, 대장균, 스트렙토마이세스, 고초균), 진균세포(예: 효모, 아스페르길루스), 곤충세포(예: 드로소필라S2, 스포도프테라SF9), 동물세포(예: CHO, COS, HeLa, C127, 3T3, BHK, HEK293, Bowes 흑색종 세포) 및 식물세포를 예시할 수 있다. 숙주세포로의 벡터 도입은, 예를 들면, 인산칼슘 침전법, 전기 펄스 천공법(Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons.Section 9.1-9.9), 리포펙션법, 마이크로인젝션법 등의 공지의 방법으로 행하는 것이 가능하다.
 숙주세포에 있어서 발현한 폴리펩티드(항체)를 소포체의 내강에, 세포 주변강에 또는 세포외의 환경에 분비시키기 위해서, 적당한 분비 시그널이 목적의 항체에 바람직하게 삽입될 수 있다. 이들의 시그널은 목적의 폴리펩티드(항체)에 특유의 내인성 시그널, 또는 이종 시그널이 바람직하게 이용될 수 있다.
 상기 제조방법에 있어서의 폴리펩티드(항체)의 회수는, 본 발명의 폴리펩티드(항체)가 배지에 분비되는 경우는, 배지의 회수에 의해 실시된다. 본 발명의 항체가 세포 내에 생산되는 경우는, 그 세포가 먼저 용해되고, 그 후에 항체가 회수된다.
 재조합 세포배양물로부터 회수된 본 발명의 항체의 정제를 위해서는, 황산암모늄 또는 에탄올 침전, 산 추출, 음이온 또는 양이온 교환 크로마토그래피, 포스포셀룰로오스 크로마토그래피, 소수성 상호작용 크로마토그래피, 친화성 크로마토그래피, 히드록실아파타이트 크로마토그래피 및 렉틴 크로마토그래피를 포함하는 방법이 바람직하게 사용될 수 있다.
 본 발명에 있어서, 핵산을 개변하는 폴리펩티드는, 바람직하게는, 제1 폴리펩티드의 호모다량체, 제2 폴리펩티드의 호모다량체 및 제1 폴리펩티드와 제2 폴리펩티드의 헤테로다량체이다. 제1 폴리펩티드의 호모다량체, 제2 폴리펩티드의 호모다량체 및 제1 폴리펩티드와 제2 폴리펩티드의 헤테로다량체로서는, 실시예에 기재된 것을 들 수 있으나 이들에 한정되지 않는다.
 본 발명에 있어서의 표준적인 크로마토그래피로서는, 양이온 교환 크로마토그래피, 음이온 교환 크로마토그래피, 소수 크로마토그래피, 히드록시아파타이트 크로마토그래피, 소수 전하 상호작용 크로마토그래피, 크로마토포커싱 등을 들 수 있으나, 이들에 한정되지 않는다.
 본 발명의 상기 방법에 있어서, 제1 폴리펩티드 및 제2 폴리펩티드는, 중쇄 가변영역(VH)을 포함하고 있는 것이 바람직하다. 그 가변영역에는, 예를 들면 상보성 결정영역(CDR), 프레임워크영역(FR)이 포함되어 있어도 된다.
 또한 본 발명의 상기 방법에 있어서는, 다중 특이성 폴리펩티드의 가변영역이, 경쇄 가변영역을 포함하고 있는 것이 바람직하다.
 또한 본 발명의 상기 방법에 있어서, 제1 폴리펩티드 및 제2 폴리펩티드는, 중쇄 정상영역을 포함하고 있는 것이 바람직하다. 중쇄 정상영역으로서는, 제1 폴리펩티드와 제2 폴리펩티드에 pI 차가 발생하는 것이 보다 바람직하다. 이와 같은 중쇄 정상영역으로서는, pI 차를 갖는 항체의 중쇄 정상영역을 들 수 있고, 원래 pI에 차가 있는 IgG1, IgG2, IgG3, IgG4의 중쇄 정상영역을 사용해서 제1과 제2 폴리펩티드에 pI 차를 도입하는 것도 가능하고, 제1과 제2 폴리펩티드 중의 중쇄 정상영역에 있어서의, 이들 서브클래스간의 등전점의 차이에 기인하는 아미노산만, 또는 그들의 등전점에는 영향을 주지 않는 인접하는 아미노산을 동시에 개변함으로써 비야생형 인간 정상영역을 제작하고, 2개의 정상영역에 pI 차를 도입하는 것도 가능하다. 정상영역에 pI 차를 도입하기 위한 개변 개소로서는, 예를 들면 H사슬 정상영역의 EU 넘버링으로, H사슬 137번째, 196번째, 203번째, 214번째, 217번째, 233번째, 268번째, 274번째, 276번째, 297번째, 355번째, 392번째, 419번째, 435번째를 들 수 있다.
 또한, 중쇄 정상영역의 당사슬을 제거함으로써 pI 차가 발생하는 것으로부터, 당사슬 부가부위의 297번째도 pI 차를 도입하기 위한 개선 개소로서 들 수 있다.
 또한 본 발명에는, 상기 제1 폴리펩티드 및 제2 폴리펩티드가 중쇄 정상영역을 포함하는 방법에 대해, 상기 제1 폴리펩티드 및 제2 폴리펩티드가 중쇄 가변영역을 포함하는 방법, 및/또는 상기 다중 특이성 항체가 경쇄 가변영역을 포함하는 제3 폴리펩티드를 포함하고, 상기 제1 폴리펩티드 및 상기 제2 폴리펩티드가 각각 그 제3 폴리펩티드와 다량체를 형성하는 방법을 조합시킨 방법도 포함된다.
 또한 상기 방법에 의해 제조되는 다중 특이성 폴리펩티드도 본 발명에 포함된다.
 또한 본 발명에 의해 제공되는 다중 특이성 항체에 있어서의 제1 폴리펩티드가 중쇄 가변영역을 포함하고 있는 경우에는, 상기 「등전점의 차가 증대하도록」하기 위해서, 예를 들면 그 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가 전하를 가지도록 하는 태양을 들 수 있다. 또한, 경쇄 가변영역을 포함하고 있는 경우에는, 상기 「등전점의 차가 증대하도록」하기 위해서, 예를 들면 그 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가 저하를 가지도록 하는 태양을 들 수 있다. 상기의 넘버링으로 나타내어진 제1 폴리펩티드의 아미노산 잔기 중, 당해 전하를 갖는 아미노산 잔기 이외의 아미노산 잔기는, 제1 폴리펩티드와 제2 폴리펩티드의 등전점에 차가 생겨 있으면, 당해 전하를 갖는 아미노산 잔기와 동종의 전하여도 되고, 전하를 가지고 있지 않아도 되며, 반대의 전하여도 된다.
 본 발명의 상기 다중 특이성 항체는, 바람직하게는, 제2 폴리펩티드가 제1 폴리펩티드의 전하를 갖는 아미노산 잔기와는 반대의 전하를 갖거나, 또는 전하를 갖지 않는 것을 특징으로 한다. 상세하게는, 제2 폴리펩티드가 중쇄 가변영역을 포함하고, 그 중쇄 가변영역에 있어서의 Kabat 넘버링에 의한 31번 위치, 61번 위치, 62번 위치, 64번 위치 및 65번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가, 상기 제1 폴리펩티드에 포함되는 가변영역에 있어서 선택되는, 전하를 가지도록 하는 아미노산 잔기와는 반대의 전하를 갖거나, 또는 전하를 갖지 않는, 다중 특이성 항체이다. 또한, 경쇄 가변영역을 포함하는 경우에는, 그 경쇄 가변영역에 있어서의 Kabat 넘버링에 의한 24번 위치, 27번 위치, 53번 위치, 54번 위치 및 55번 위치의 아미노산 잔기로부터 선택되는, 하나 이상의 아미노산 잔기가, 상기 제1 폴리펩티드에 포함되는 가변영역에 있어서 선택되는, 전하를 가지도록 하는 아미노산 잔기와는 반대의 전하를 갖거나, 또는 전하를 갖지 않는, 다중 특이성 항체이다. 상기의 넘버링으로 나타내어진 제2 폴리펩티드의 아미노산 잔기 중, 당해 전하를 갖는 아미노산 잔기 이외의 아미노산 잔기는, 제1 폴리펩티드와 제2 폴리펩티드의 등전점에 차가 생겨 있으면, 당해 전하를 갖는 아미노산 잔기와 동종의 전하여도 되고, 전하를 갖고 있지 않아도 되며, 반대의 전하여도 된다.
 또한 다중 특이성 항체가 항체의 정상영역을 포함하는 경우에, 그 등전점을 저하시키기 위해서는, 예를 들면, 137번 위치는 IgG2 또는 IgG4의 서열, 196번 위치는 IgG1 또는 IgG2 또는 IgG4의 서열, 203번 위치는 IgG2 또는 IgG4의 서열, 214번 위치는 IgG2의 서열, 217번 위치는 IgG1 또는 IgG3 또는 IgG4의 서열, 233번 위치는 IgG1 또는 IgG3 또는 IgG4의 서열, 268번 위치는 IgG4의 서열, 274번 위치는 IgG2 또는 IgG3 또는 IgG4의 서열, 276번 위치는 IgG1 또는 IgG2 또는 IgG4의 서열, 355번 위치는 IgG4의 서열, 392번 위치는 IgG3의 서열, 419번 위치는 IgG4의 서열, 435번 위치는 IgG1 또는 IgG2 또는 IgG4의 서열을 적용하는 것이 바람직하다. 또한, 등전점을 상승시키기 위해서는, 예를 들면, 137번 위치는 IgG1 또는 IgG3의 서열, 196번 위치는 IgG3의 서열, 203번 위치는 IgG1 또는 IgG3의 서열, 214번 위치는 IgG1 또는 IgG3 또는 IgG4의 서열, 217번 위치는 IgG2의 서열, 233번 위치는 IgG2의 서열, 268번 위치는 IgG1 또는 IgG2 또는 IgG3의 서열, 274번 위치는 IgG1의 서열, 276번 위치는 IgG3의 서열, 355번 위치는 IgG1 또는 IgG2 또는 IgG3의 서열, 392번 위치는 IgG1 또는 IgG2 또는 IgG4의 서열, 419번 위치는 IgG1 또는 IgG2 또는 IgG3의 서열, 435번 위치는 IgG3의 서열을 적용하는 것이 바람직하다.
 이들 서열의 적용은, 양 H사슬에 충분한 등전점의 차가 생기면 되고, 반드시 모든 서열을 적용할 필요는 없다.
 상기 항체에 있어서, 「동종의 전하를 갖는」이란, 예를 들면, 중쇄 가변영역에 있어서의 상기 Kabat 넘버링에 의한 아미노산 잔기, 또는 중쇄 정상영역에 있어서의 상기 EU 넘버링에 의한 아미노산 잔기 모두가, 하기 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기를 갖는 것을 의미한다.
 (a) 글루타민산(E), 아스파라긴산(D)
 (b) 리신(K), 아르기닌(R), 히스티딘(H)
 또한, 「반대의 전하를 갖는」이란, 예를 들면, 중쇄 가변영역 및/또는 중쇄 정상영역을 갖는 제2 폴리펩티드에 있어서의 상기 Kabat 넘버링 또는 상기 EU 넘버링에 의한 아미노산 잔기 중 하나 이상의 아미노산 잔기가, 제1 폴리펩티드에 포함되는 중쇄 가변영역 및/또는 중쇄 정상영역에 있어서의 대응하는 위치의 아미노산 잔기로서, 상기 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기를 갖는 경우에, 나머지 아미노산 잔기가 상이한 군에 포함되는 아미노산 잔기를 갖는 것을 의미한다.
 즉 본 발명에 있어서는, 상기 동종의 전하를 갖는 아미노산 잔기가, 상기 (a) 또는 (b) 중 어느 하나의 군에 포함되는 아미노산 잔기로부터 선택되는 다중 특이성 항체를 제공한다.
 또한, 원래의(개변 전의) 아미노산 잔기가 이미 전하를 갖는 경우, 전하를 갖지 않는 아미노산 잔기가 되도록 개변하는 것도 본 발명의 바람직한 태양의 하나이다.
 본 발명에 있어서는, 제1 폴리펩티드와 제2 폴리펩티드의 등전점(pI)에 차가 증대하도록, 아미노산 잔기가 개변되는 것이 바람직하다. 또한, 개변에 의해 도입되는 아미노산 잔기가 복수인 경우, 이들 아미노산 잔기 중에 전하를 갖지 않는 아미노산 잔기가 소수 정도 포함되어 있어도 된다.
 또한 본 발명은, 본 발명의 방법에 의해 혈장 중 약물동태가 제어된 폴리펩티드(예를 들면 IgG 항체 등의 항체) 및 의약적으로 허용되는 담체를 포함하는 조성물(약제)에 관한 것이다.
 본 발명에 있어서 의약 조성물이란, 통상, 질환의 치료 또는 예방 또는 검사·진단을 위한 약제를 말한다.
 본 발명의 의약 조성물은, 당업자에게 공지의 방법에 의해 바람직하게 제제회될 수 있다. 예를 들면, 물 또는 그 이외의 약학적으로 허용될 수 있는 용액과의 무균성 용액 또는 현탁액제의 주사제의 형태로서 비경구적으로 사용될 수 있다. 예를 들면, 약리학상 허용되는 담체 또는 매체, 구체적으로는, 멸균수나 생리식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 향미제, 부형제, 비히클, 방부제, 결합제 등과 적절히 조합되어, 일반적으로 인정된 제약 실시에 요구되는 단위용량형태로 혼화함으로써, 바람직하게 제제화될 수 있다. 이들 제제에 있어서의 유효성분량은, 지시된 범위의 적당한 용량이 얻어지도록 설정된다.
 주사를 위한 무균 조성물은 주사용 증류수와 같은 비히클을 사용해서 통상의 제제 실시에 따라 바람직하게 처방될 수 있다.
 주사용 수용액으로서는, 예를 들면 생리식염수, 포도당이나 기타 보조약(예를 들면 D-소르비톨, D-만노오스, D-만니톨, 염화나트륨)을 포함하는 등장액을 들 수 있다. 적당한 용해보조제, 예를 들면 알코올(에탈올 등), 폴리알코올(프로필렌글리콜, 폴리에틸렌글리콜 등), 비이온성 계면활성제(폴리소르베이트 80(TM), HCO-50 등)가 바람직하게 병용될 수 있다.
 유성액으로서는 참기름, 대두유를 들 수 있고, 용해보조제로서 안식향산 벤질 및/또는 벤질알코올이 바람직하게 병용될 수 있다. 또한, 완충제(예를 들면, 인산염 완충액 및 초산나트륨 완충액), 무통화제(예를 들면, 염산 프로카인), 안정제(예를 들면, 벤질알코올 및 페놀), 산화방지제가 바람직하게 배합될 수 있다. 상기와 같이 조제된 주사액은 통상, 적절한 앰플에 충전된다.
 본 발명의 의약 조성물은, 바람직하게는 비경구투여에 의해 투여될 수 있다. 예를 들면, 주사제형, 경비투여제형, 경폐투여제형, 경피투여형의 조성물로서 적절히 조제될 수 있다. 예를 들면, 정맥 내 주사, 근육 내 주사, 복강 내 주사, 피하 주사 등에 의해 전신 또는 국부적으로 적절히 투여될 수 있다.
 투여방법은, 환자의 연령, 증상에 따라 적절히 선택될 수 있다. 항체 또는 항체를 코드하는 폴리뉴클레오티드를 함유하는 의약 조성물의 투여량은, 예를 들면, 1회에 체중 1 ㎏당 0.0001 ㎎~1000 ㎎의 범위로 적절히 설정될 수 있다. 또는, 예를 들면, 환자당 0.001~100000 ㎎의 투여량으로 설정 또는 조제될 수 있으나, 본 발명은 이들의 수치에 반드시 제한되는 것은 아니다. 투여량 및 투여방법은, 환자의 체중, 연령, 증상 등에 따라 변동하지만, 당업자라면 그들의 조건을 고려하여 적당한 투여량 및 투여방법을 설정하는 것이 가능하다.
 또한 본 발명은, 본 발명의 방법에 따라 혈장 중 약물동태가 제어된 항체(예를 들면, 인간화 글리피칸3 항체 등)를 코드하는 핵산을 제공한다. 또한 당해 핵산을 담지하는 벡터도 또한, 본 발명에 포함된다.
 또한 본 발명은, 상기 핵산을 포함하는 숙주세포를 제공한다. 당해 숙주세포의 종류는, 특별히 제한되지 않고, 예를 들면, 대장균 등의 세균세포나 각종 동물세포 등을 들 수 있다. 당해 숙주세포는, 본 발명의 항체의 제조나 발현을 위한 생산계로서 바람직하게 사용될 수 있다. 즉 본 발명은 당해 숙주세포를 사용한 항체의 제조를 위해 사용되는 생산계를 제공한다. 당해 생산계로서는, 인 비트로(in vitro) 및 인 비보(in vivo)의 생산계가 바람직하게 사용될 수 있다. in vitro의 생산계에 있어서 사용되는 숙주세포로서는, 진핵세포 및 원핵세포가 바람직하게 사용된다.
 숙주세포로서 사용되는 진핵세포로서, 예를 들면, 동물세포, 식물세포, 진균세포를 들 수 있다. 동물세포로서는, 포유류세포, 예를 들면, CHO(J. Exp. Med. (1995) 108, 945), COS, HEK293, 3T3, 골수종, BHK(baby hamster kidney), HeLa, Vero 등, 양서류세포, 예를 들면 아프리카발톱개구리 난모세포(Valle et al., Nature (1981) 291, 338-340) 및 곤충세포, 예를 들면, Sf9, Sf21, Tn5가 바람직하게 예시된다. 본 발명의 항체의 발현에 있어서는, CHO-DG44, CHO-DX11B, COS7세포, HEK293세포, BHK세포가 바람직하게 사용된다. 동물세포에 의한 대량 발현을 목적으로 하는 경우에는 특히 CHO세포가 숙주세포로서 바람직하다. 예를 들면, 인산칼슘법, DEAE 덱스트란법, 양이온 리포솜 DOTAP(Boehringer Mannheim)를 사용한 방법, 전기천공법(electroporation), 리포펙션 등의 방법을 사용함으로써, 숙주세포로의 재조합백터 등의 도입이 바람직하게 실시된다.
 식물세포로서는, 예를 들면, 니코티아나·타바쿰(Nicotiana tabacum) 유래의 세포 및 개구리밥(Lemna minor)이 단백질 생산계로서 알려져 있어, 이 세포를 캘러스 배양하는 방법에 의해 본 발명의 항체가 생산될 수 있다. 진균세포로서는, 효모, 예를 들면, 사카로마이세스(Saccharomyces)속의 세포(사카로마이세스·세레비시에(Saccharomyces cerevisiae), 사카로마이세스·폼베(Schizosaccharomyces pombe) 등) 및 사상균, 예를 들면 아스페르길루스(Aspergillus)속의 세포(아스페르길루스·니거(Aspergillus niger) 등)를 사용한 단백질 발현계가 공지로, 본 발명의 항체를 생산하는 숙주세포로서 이용될 수 있다.
 원핵세포가 사용되는 경우, 세균세포를 사용하는 생산계가 바람직하게 사용된다. 세균세포로서는, 상기의 대장균(E. coli)에 더하여, 고초균(B.subtilis)을 사용한 생산계가 알려져 있고, 이들의 세균세포는 모두 본 발명의 항체의 생산에 바람직하게 이용될 수 있다.
 본 발명의 숙주세포를 사용해서 항체를 생산하기 위해, 본 발명의 항체를 코드하는 폴리뉴클레오티드를 포함하는 발현벡터에 의해 형질전환된 숙주세포의 배양이 행해지고, 당해 배양에 있어서 항체를 코드하는 폴리뉴클레오티드가 발현된다. 배양은, 공지의 방법에 따라 바람직하게 행해질 수 있다. 예를 들면, 동물세포가 숙주로서 사용된 경우, 배양액으로서, 예를 들면, DMEM, MEM, RPMI1640, IMDM이 바람직하게 사용될 수 있다. 그때, FBS, 소 태아 혈청(FCS) 등의 혈청 보액이 바람직하게 병용된다. 또한, 무혈청 배양에 의해 세포가 배양될 수 있다. 숙주세포에 의존하나, 배양시에는 pH 약 6~8의 조건하에서 바람직하게 배양될 수 있다. 배양은, 통상, 약 30~40℃에서 약 15~200시간 행해지고, 필요에 따라 배지의 교환, 통기, 교반이 더해진다.
 한편, in vivo에서 본 발명의 항체가 생산되는 계로서는, 예를 들면, 동물을 사용하는 생산계나 식물을 사용하는 생산계가 바람직하게 사용될 수 있다. 즉, 이들의 동물 또는 식물에 본 발명의 항체를 코드하는 폴리뉴클레오티드가 도입되고, 동물 또는 식물의 체내에서 글리피칸3 항체가 생산되어, 회수된다. 본 발명에 있어서의 「숙주」에는, 이들의 동물, 식물이 포함된다.
 숙주로서 동물이 사용되는 경우에는, 포유류동물, 곤충을 사용하는 생산계가 이용 가능하다. 포유류동물로서는, 염소, 돼지, 양, 마우스, 소 등이 바람직하게 사용된다(Vicki Glaser, SPECTRUM Biotechnology Applications (1993)). 또한, 포유류동물이 사용되는 경우, 형질전환 동물이 사용된다.
 예를 들면, 본 발명의 항체를 코드하는 폴리뉴클레오티드는, 염소β카제인과 같은, 유즙 중에 특이적으로 생산되는 폴리펩티드를 코드하는 유전자와의 융합 유전자로서 조제된다. 이어서, 이 융합 유전자를 포함하는 폴리뉴클레오티드 단편이 염소의 배(胚)로 주입되고, 당해 배가 암컷의 염소로 이식된다. 배를 수용한 염소로부터 태어나는 형질전환 염소 또는 그 자손이 생산하는 유즙으로부터, 목적의 항체가 얻어진다. 당해 형질전환 염소로부터 생산되는 항체를 포함하는 유즙량을 증가시키기 위해서, 적절히 호르몬이 당해 형질전환 염소에 바람직하게 투여된다(Ebert et al., Bio/Technology (1994) 12, 699-702).
 또한, 본 발명의 항체를 생산하는 곤충으로서는, 예를 들면 누에가 사용될 수 있다. 누에가 사용되는 경우, 목적의 항체를 코드하는 폴리뉴클레오티드를 그 바이러스 게놈 상에 삽입한 바큘로바이러스가 누에에 대한 감염에 있어서 사용된다. 당해 감염된 누에의 체액으로부터 목적의 글리피칸3 항체가 얻어진다(Susumu et al., Nature (1985) 315, 592-4).
 또한, 식물이 본 발명의 항체의 생산에 사용되는 경우에는, 식물로서는 예를 들면 담배가 사용될 수 있다. 담배가 사용되는 경우에는, 목적으로 하는 항체를 코드하는 폴리뉴클레오티드를 식물 발현용 벡터, 예를 들면 pMON 530에 삽입한 결과 얻어지는 재조합 벡터가 아그로박테리움·투메파시엔스(Agrobacterium tumefaciens)와 같은 박테리아에 도입될 수 있다. 당해 박테리아가 담배, 예를 들면 니코티아나·타바쿰(Nicotiana tabacum)에 대한 감염에 사용되고(Ma et al., Eur. J. Immunol. (1994) 24, 131-8), 감염된 담배잎으로부터 목적하는 글리피칸3 항체가 얻어진다. 또한, 동일한 박테리아는 개구리밥(Lemna minor)에 대한 감염에 사용되어, 클론화된 감염 개구리밥의 세포로부터 목적하는 글리피칸3 항체가 얻어진다(Cox KM et al. Nat. Biotechnol. (2006) 24(12), 1591-7).
 이와 같이 하여 얻어진 본 발명의 항체는, 숙주세포 내 또는 세포외(배지, 유즙 등)로부터 단리되어, 실질적으로 순수하고 균일한 항체로서 정제될 수 있다. 항체의 분리, 정제는, 통상의 폴리펩티드의 정제에서 사용되고 있는 분리, 정제방법이 바람직하게 사용될 수 있으나, 이들에 한정되지 않는다. 예를 들면, 크로마토그래피 칼럼, 필터, 한외여과, 염석, 용매침전, 용매추출, 증류, 면역침강, SDS-폴리아크릴아미드겔 전기영동, 등전점 전기영동법, 투석, 재결정 등이 적절히 선택, 조합되어 항체가 바람직하게 분리 및 정제될 수 있다.
 크로마토그래피로서는, 예를 들면 친화성 크로마토그래피, 이온 교환 크로마토그래피, 소수성 크로마토그래피, 겔 여과 크로마토그래피, 역상 크로마토그래피, 흡착 크로마토그래피 등을 들 수 있다(Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshaket al.(1996) Cold Spring Harbor Laboratory Press). 이들 크로마토그래피는, 액상 크로마토그래피, 예를 들면 HPLC, FPLC 등의 액상 크로마토그래피를 사용해서 얻어지는 것이 가능하다. 친화성 크로마토그래피에 사용하는 칼럼으로서는, 프로테인 A 칼럼, 프로테인 G 칼럼을 들 수 있다. 예를 들면, 프로테인 A를 사용한 칼럼으로서, Hyper D, POROS, Sepharose F. F.(Pharmacia제) 등을 들 수 있다.
 전술한 바와 같이 본 발명의 숙주세포를 배양하고, 당해 세포의 배양물로부터 글리피칸3 항체를 회수하는 공정을 포함하는, 혈장 중 약물동태가 제어된 본 발명의 항체의 제조방법도 또한, 본 발명의 바람직한 태양의 하나이다.
 본 발명은, 인간화 항IL-6 수용체 IgG1 항체인 TOCILIZUMAB의 가변영역 및 정상영역의 아미노산 서열을 개변함으로써, 약효를 증강시키면서, 혈장 중 체류성을 향상시킴으로써 투여빈도를 적게 하여 지속적으로 치료효과를 발휘하고, 또한, 면역원성, 안전성, 물성을 개선시켜, TOCILIZUMAB보다 우수한 제2세대 분자로 되는 의약 조성물 및 그들의 의약 조성물의 제조방법을 제공한다. 또한 본 발명은, 의약품으로서 사용하기에 적합한 항체 정상영역을 제공한다.
 본 발명은 우수한 항원 결합활성, 중화활성, 혈장 중 체류성, 안정성 및/또는 균일성을 갖고, 면역원성 리스크를 저감시킨 항IL-6 수용체 항체에 관한 것이다.
 바람직하게는, 항IL-6 수용체 항체는 인간화 PM-1 항체(TOCILIZUMAB)이다. 보다 구체적으로는 본 발명은, 아미노산 치환에 의해 항원 결합활성이 증강된 인간화 PM-1 항체, 중화활성이 증강된 인간화 PM-1 항체, 혈장 중 체류성이 향상된 인간화 PM-1 항체, 면역원성 리스크가 저하된 인간화 PM-1 항체, 안정성이 향상된 인간화 PM-1 항체 및 균일성이 향상된 인간화 PM-1 항체를 제공한다.
 인간화 PM-1 항체는 인간 IL-6 수용체에 결합하고, 인간 IL-6와 인간 IL-6 수용체의 결합을 저해한다. 본 명세서에 있어서, 인간화 PM-1 항체의 아미노산 서열과 서열표의 서열번호의 대응은 이하와 같다.
 중쇄  아미노산  서열                서열번호:15
 경쇄  아미노산  서열                서열번호:16
 중쇄  가변영역의  아미노산  서열                                서열번호:17
 경쇄  가변영역의  아미노산  서열                                서열번호:18
 중쇄  CDR1(HCDR1)의  아미노산  서열                서열번호:1
 중쇄  CDR2(HCDR2)의  아미노산  서열                서열번호:2
 중쇄  CDR3(HCDR3)의  아미노산  서열                서열번호:3
 중쇄  FR1(HFR1)의  아미노산  서열                서열번호:7
 중쇄  FR2(HFR2)의  아미노산  서열                서열번호:8
 중쇄  FR3(HFR3)의  아미노산  서열                서열번호:9
 중쇄  FR4(HFR4)의  아미노산  서열                서열번호:10
 경쇄 CDR1(LCDR1)의 아미노산 서열을 서열번호:4
 경쇄 CDR2(LCDR2)의 아미노산 서열을 서열번호:5
 경쇄 CDR3(LCDR3)의 아미노산 서열을 서열번호:6
 경쇄 FR1(LFR1)의 아미노산 서열을 서열번호:11
 경쇄 FR2(LFR2)의 아미노산 서열을 서열번호:12
 경쇄 FR3(LFR3)의 아미노산 서열을 서열번호:13
 경쇄 FR4(LFR4)의 아미노산 서열을 서열번호:14
 〈친화성·중화활성 증강항체〉
 본 발명은 인간 IL-6 수용체에 대한 결합활성 및/또는 중화활성이 높은 항인간 IL-6 수용체 항체를 제공한다. 보다 구체적으로는, 본 발명은 이하 (a)~(y)에 기재된 항체 및 그 항체의 제조방법을 제공한다.
 (a) 서열번호:1에 기재된 아미노산 서열(HCDR1)에 있어서 1번째의 Ser이 다른 아미노산으로 치환된 중쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Trp(RD_68), Thr(RD_37), Asp(RD_8), Asn(RD_11), Arg(RD_31), Val(RD_32), Phe(RD_33), Ala(RD_34), Gln(RD_35), Tyr(RD_36), Leu(RD_38), His(RD_42), Glu(RD_45) 또는 Cys(RD_46)로의 치환이 바람직하다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Trp로 치환된 서열을 서열번호:26에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Thr로 치환된 서열을 서열번호:27에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Asp로 치환된 서열을 서열번호:28에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Asn으로 치환된 서열을 서열번호:29에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Arg로 치환된 서열을 서열번호:30에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Val로 치환된 서열을 서열번호:31에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Phe로 치환된 서열을 서열번호:32에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Ala로 치환된 서열을 서열번호:33에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Gln으로 치환된 서열을 서열번호:34에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Tyr로 치환된 서열을 서열번호:35에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Leu로 치환된 서열을 서열번호:36에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 His로 치환된 서열을 서열번호:37에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Glu로 치환된 서열을 서열번호:38에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Cys로 치환된 서열을 서열번호:39로 나타낸다.
 (b) 서열번호:1에 기재된 아미노산 서열(HCDR1)에 있어서 5번째의 Trp가 다른 아미노산으로 치환된 중쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ile(RD_9) 또는 Val(RD_30)으로의 치환이 바람직하다.
 서열번호:1에 기재된 아미노산 서열에 있어서 5번째의 Trp가 Ile로 치환된 서열을 서열번호:40에 나타낸다.
 서열번호:1에 기재된 아미노산 서열에 있어서 5번째의 Trp가 Val로 치환된 서열을 서열번호:41에 나타낸다.
 (c) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 1번째의 Tyr이 다른 아미노산으로 치환된 중쇄 CDR2를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Phe(RD_82)로의 치환이 바람직하다.
 서열번호:2에 기재의 아미노산 서열에 있어서 1번째의 Tyr이 Phe로 치환된 서열을 서열번호:42에 나타낸다.
 (d) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 8번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR2를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Arg(RD_79)로의 치환이 바람직하다.
 서열번호:2에 기재된 아미노산 서열에 있어서 8번째의 Thr이 Arg로 치환된 서열을 서열번호:43에 나타낸다.
 (e) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 9번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR2를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ser(RD_12) 또는 Asn(RD_61)로의 치환이 바람직하다.
 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 Ser로 치환된 서열을 서열번호:44에 나타낸다.
 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 Asn으로 치환된 서열을 서열번호:45에 나타낸다.
 (f) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser이 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ile(RD_2), Val(RD_4), Thr(RD_80) 또는 Leu(RD_5)로의 치환이 바람직하다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Ile로 치환된 서열을 서열번호:46에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Val로 치환된 서열을 서열번호:47에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Thr로 치환된 서열을 서열번호:48에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Leu로 치환된 서열을 서열번호:49에 나타낸다.
 (g) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 2번째의 Leu가 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Thr(RD_84)로의 치환이 바람직하다.
 서열번호:3에 기재된 아미노산 서열에 있어서 2번째의 Leu가 Thr로 치환된 서열을 서열번호:50에 나타낸다.
 (h) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 5번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ala(RD_3) 또는 Ile(RD_83)으로의 치환이 바람직하다. 다른 바람직한 치환으로서는 5번째의 Thr의 Ser(RDC_14H)로의 치환을 들 수 있다.
 서열번호:3에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Ala로 치환된 서열을 서열번호:51에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Ile로 치환된 서열을 서열번호:52에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Ser로 치환된 서열을 서열번호:53에 나타낸다.
 (i) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 7번째의 Ala가 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ser(RD_81) 또는 Val(PF_3H)로의 치환이 바람직하다.
 서열번호:3에 기재된 아미노산 서열에 있어서 7번째의 Ala가 Ser로 치환된 서열을 서열번호:54에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 7번째의 Ala가 Val로 치환된 서열을 서열번호:55에 나타낸다.
 (j) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 8번째의 Met가 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Leu(PF_4H)로의 치환이 바람직하다.
 서열번호:3에 기재된 아미노산 서열에 있어서 8번째의 Met가 Leu로 치환된 서열을 서열번호:56에 나타낸다.
 (k) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser 및 5번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 1번째의 Ser을 Leu로, 5번째의 Thr을 Ala로 치환하는 것이 바람직하다(RD_6). 또한, 다른 바람직한 치환으로서, 1번째의 Ser의 Val로의 치환 및 5번째의 Thr의 Ala로의 치환(RDC_2H), 1번째의 Ser의 Ile로의 치환 및 5번째의 Thr의 Ala로의 치환(RDC_3H), 1번째의 Ser의 Thr로의 치환 및 5번째의 Thr의 Ala로의 치환(RDC_4H), 1번째의 Ser의 Val로의 치환 및 5번째의 Thr의 Ile로의 치환(RDC_5H), 1번째의 Ser의 Ile로의 치환 및 5번째의 Thr의 Ile로의 치환(RDC_6H), 1번째의 Ser의 Thr로의 치환 및 5번째의 Thr의 Ile로의 치환(RDC_7H) 또는 1번째의 Ser의 Leu로의 치환 및 5번째의 Thr의 Ile로의 치환(RDC_8H)를 들 수 있다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Leu로, 5번째의 Thr이 Ala로 치환된 서열을 서열번호:57에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Val로, 5번째의 Thr이 Ala로 치환된 서열을 서열번호:58에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Ile로, 5번째의 Thr이 Ala로 치환된 서열을 서열번호:59에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Thr로, 5번째의 Thr이 Ala로 치환된 서열을 서열번호:60에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Val로, 5번째의 Thr이 Ile로 치환된 서열을 서열번호:61에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Ile로, 5번째의 Thr이 Ile로 치환된 서열을 서열번호:62에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Thr로, 5번째의 Thr이 Ile로 치환된 서열을 서열번호:63에 나타낸다.
 서열번호:3에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Leu로, 5번째의 Thr이 Ile로 치환된 서열을 서열번호:64에 나타낸다.
 (l) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 2번째의 Leu, 7번째의 Ala 및 8번째의 Met가 다른 아미노산으로 치환된 중쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 2번째의 Leu를 Thr로, 7번째의 Ala를 Val로, 8번째의 Met를 Leu로 치환하는 것이 바람직하다(RD_78).
 서열번호:3에 기재된 아미노산 서열에 있어서 2번째의 Leu가 Thr로, 7번째의 Ala가 Val로, 8번째의 Met가 Leu로 치환된 서열을 서열번호:65에 나타낸다.
 (m) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 1번째의 Arg가 다른 아미노산으로 치환된 경쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Phe(RD-18)로의 치환이 바람직하다.
 서열번호:4에 기재된 아미노산 서열에 있어서 1번째의 Arg가 Phe로 치환된 서열을 서열번호:66에 나타낸다.
 (n) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 4번째의 Gln이 다른 아미노산으로 치환된 경쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Arg(RD_26) 또는 Thr(RD_20)로의 치환이 바람직하다.
 서열번호:4에 기재된 아미노산 서열에 있어서 4번째의 Gln이 Arg로 치환된 서열을 서열번호:67에 나타낸다.
 서열번호:4에 기재된 아미노산 서열에 있어서 4번째의 Gln이 Thr로 치환된 서열을 서열번호:68에 나타낸다.
 (o) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 9번째의 Tyr이 다른 아미노산으로 치환된 경쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나 Phe(RD_73)로의 치환이 바람직하다.
 서열번호:4에 기재된 아미노산 서열에 있어서 9번째의 Tyr이 Phe로 치환된 서열을 서열번호:69에 나타낸다.
 (p) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 11번째의 Asn이 다른 아미노산으로 치환된 경쇄 CDR1을 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ser(RD_27)로의 치환이 바람직하다.
 서열번호:4에 기재된 아미노산 서열에 있어서 11번째의 Asn이 Ser로 치환된 서열을 서열번호:70에 나타낸다.
 (q) 서열번호:5에 기재된 아미노산 서열(LCDR2)에 있어서 2번째의 Thr이 다른 아미노산으로 치환된 경쇄 CDR2를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Gly로의 치환이 바람직하다.
 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr이 Gly로 치환된 서열을 서열번호:71에 나타낸다.
 (r) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 1번째의 Gln이 다른 아미노산으로 치환된 경쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Gly(RD_28), Asn(RD_29) 또는 Ser(RDC_15L)로의 치환이 바람직하다.
 서열번호;6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 Gly로 치환된 서열을 서열번호:72에 나타낸다.
 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 Asn으로 치환된 서열을 서열번호:73에 나타낸다.
 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 Ser로 치환된 서열을 서열번호:74에 나타낸다.
 (s) 서열번호:6에 기재된 아미노산 서열에 있어서 3번째의 Gly가 다른 아미노산으로 치환된 경쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ser로의 치환이 바람직하다.
 서열번호:6에 기재된 아미노산 서열에 있어서 3번째의 Gly가 Ser로 치환된 서열을 서열번호:75에 나타낸다.
 (t) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 9번째의 Tyr이 다른 아미노산으로 치환된 경쇄 CDR1, 또한 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 3번째의 Gly가 다른 아미노산으로 치환된 경쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서의 9번째의 Tyr은 Phe로 치환되는 것이 바람직하고, 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서의 3번째의 Gly는 Ser로 치환되는 것이 바람직하다(RD_72).
 (u) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 5번째의 Thr이 다른 아미노산으로 치환된 경쇄 CDR3를 갖는 항인간 IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나 Arg(RD_23) 또는 Ser로의 치환이 바람직하다.
 서열번호:6에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Arg로 치환된 서열을 서열번호:76에 나타낸다.
 서열번호:6에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Ser로 치환된 서열을 서열번호:77에 나타낸다.
 (v) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 1번째의 Gln 및 5번째의 Thr이 다른 아미노산으로 치환된 경쇄 CDR3를 갖는 항IL-6 수용체 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나 1번째의 Gln을 Gly로, 5번째의 Thr을 Ser로 치환하는 것이 바람직하다(RD_22). 또한, 다른 바람직한 치환으로서 1번째의 Gln의 Gly로의 치환 및 5번째의 Thr의 Arg로의 치환을 들 수 있다(RDC_11L).
 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 Gly로, 5번째의 Thr이 Ser로 치환된 서열을 서열번호:78에 나타낸다.
 서열번호:6에 기재된 아미노산 서열에 있어서 1번째의 Gln이 Gly로, 5번째의 Thr이 Arg로 치환된 서열을 서열번호:79에 나타낸다.
 (w) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 9번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR2, 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser 및 5번째의 Thr이 다른 아미노산으로 치환된 중쇄 CDR3를 포함하는 항IL-6 수용체 항체.
 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서의 9번째의 Thr은 Asn으로 치환되어 있는 것이 바람직하다. 또한, 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서의 1번째의 Ser 및 5번째의 Thr의 치환 후의 아미노산의 바람직한 조합으로서, Leu 및 Ala(RDC_27H), Val 및 Ala(RDC_28H), Ile 및 Ala(RDC_30H), Thr 및 Ala(RDC_4H), Val 및 Ile(RDC_29H), Ile 및 Ile(RDC_32H), Thr 및 Ile(RDC_7H), Leu 및 Ile(RDC_8H)를 들 수 있다.
 (x) (k)에 기재된 중쇄 CDR3를 갖는 가변영역 및 (v)에 기재된 경쇄 CDR3를 갖는 가변영역을 포함하는 항체.
 (y) (e)에 기재된 중쇄 CDR2를 추가적으로 포함하는 (x)에 기재된 항체.
 본 발명은 적어도 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환을 포함하는 항체 및 그 항체의 제조방법을 제공한다. 따라서 본 발명의 항체에는, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환에 더하여, 전술한 (a)~(y)에 기재된 아미노산 치환 이외의 아미노산 치환을 포함하는 항체도 포함된다. 또한 본 발명의 항체에는, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환이 복수 조합된 항체도 포함된다. 전술한 (a)~(y)에 기재된 아미노산 치환으로서는, 전술한 CDR 아미노산 서열 외에 아미노산으로의 치환을 들 수 있다. 전술한 (a)~(y)에 기재된 아미노산 치환 이외의 아미노산 치환으로서는, 예를 들면, 다른 CDR부분의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다. 또한, FR의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다. 또한, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다.
 또한 본 발명의 항체에는, 본 발명에서 발견된 고 친화성 CDR을, 인간화 PM-1 항체 이외의 어떠한 프레임워크에 이식한 항체도 포함된다. 또한 본 발명의 항체에는, 본 발명에서 발견된 고 친화성 CDR을 인간화 PM-1 항체 이외의 프레임워크에 이식한 결과 친화성이 저하된 항체에 있어서, 원래의 친화성의 항체를 얻기 위해 프레임워크부분에 변이가 도입(예를 들면, Curr Opin Biotechnol. 1994 Aug;5(4):428-33 참조)된 항체 및 원래의 친화성의 항체를 얻기 위해 CDR부분에 변이가 도입(예를 들면, US2006/0122377 참조)된 항체가 포함된다.
 본 발명에 있어서는, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환은, 인간화 PM-1 항체에 대해 행하는 것이 바람직하다. 인간화 PM-1 항체에 있어서, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환이 행해진 항체는, IL-6 수용체에 대한 높은 중화활성을 갖는다. 인간화 PM-1 항체에 있어서, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환이 행해진 항체는, IL-6가 관련하는 관절 류머티즘 등의 염증성 질환 등의 치료제로서 유효하다.
 또한, 전술한 (a)~(y) 중 어느 하나에 기재된 아미노산 치환을 포함하는 항체는, 예를 들면 하기 (1) 또는 (2)와 같이 표현하는 것도 가능하다. 여기서는 (a)의 항체를 예로 기재하나, (b)~(y)의 항체에 대해서도 동일하게 표현할 수 있다.
 (1) 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환되어 있는 아미노산 서열을 갖는 CDR1을 갖는 중쇄 가변영역을 포함하는 항체
 (2) CDR1으로서, 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환되어 있는 아미노산 서열을 갖는 H사슬을 포함하는 항체
 〈결합활성이 증강된 항체〉
 본 발명은 추가적으로 IL-6 수용체로의 결합활성이 높은 항IL-6 수용체 항체를 제공한다. 본 발명에 있어서 IL-6 수용체로의 결합활성이 높은 항IL-6 수용체 항체란, 통상, 생리조건하, 37℃에 있어서 측정되는 친화성이 1 nM 이하인 항체이고, 바람직하게는 친화성이 0.1 nM 이하인 항체이며, 더욱 바람직하게는 친화성이 0.04 nM 이하인 항체이다. 이와 같은 IL-6 수용체로의 결합활성이 높은 항IL-6 수용체 항체는, 항원의 생물적 작용의 중화능이 향상되어 있다고 생각된다.
 본 발명의 IL-6 수용체로의 결합활성이 높은 항IL-6 수용체 항체에 있어서, 도입되는 아미노산 치환은 특별히 한정되지 않으나, 예를 들면 전술한 아미노산 치환을 들 수 있다.
 IL-6 수용체는 특별히 한정되지 않으나, 인간 IL-6 수용체가 바람직하다.
 결합활성의 측정은 당업자에게 공지의 방법에 의해 행하는 것이 가능하고, 예를 들면 SPR을 사용한 Biacore(BIACORE) 등에 의해 측정하는 것이 가능하다.
 〈CDR 서열의 면역원성 리스크를 저하시킨 항체〉
 또한 본 발명은, 면역원성이 저하된 항IL-6 수용체 항체, 특히 인간화 PM-1 항체를 제공한다. 항체 서열 중에 HLA에 결합하는 T-cell 에피토프가 존재하면 항체의 면역원성이 높아진다고 생각되고 있다. 따라서, 항체의 서열을 치환하여 항체 서열 중에 존재하는 T-cell 에피토프를 제거함으로써 항체의 면역원성 리스크를 저하시킬 수 있다.
 본 발명은 항체의 아미노산 서열, 특히 CDR 서열 중의 아미노산을 다른 아미노산으로 치환함으로써 T-cell 에피토프가 제거되고, 면역원성이 저하된 인간화 항인간 IL-6 수용체 항체, 특히 인간화 PM-1 경쇄 가변영역을 제공한다. 또한 본 발명은, 그 경쇄 가변영역을 포함하는 항체를 제공한다.
 보다  구체적으로는  본  발명은,  서열번호:5에  기재된  아미노산  서열(LCDR2)에  있어서  2                번째의  Thr이  다른  아미노산으로  치환된  경쇄  CDR2를  제공한다.  또한,  본  발명은  그  경쇄  CDR2를  포함하는  경쇄  가변영역을  제공한다.  또한  본  발명은,  그  경쇄  가변영역을  포함하는  항IL-6  수용체  항체를  제공한다.  치환  후의  아미노산  서열은  특별히  한정되지  않으나,  Gly로의  치환이  바람직하다.  서열번호:5에  기재된  아미노산  서열에  있어서  2번째의  Thr이  Gly로  치환된  서열을  서열번호:71에  나타낸다.  그  아미노산  치환은  인간화  PM-1  항체의  경쇄  가변영역에  있어서  행해지는  것이  바람직하다.
 〈H53/L28의 FR 및 CDR〉
 본 발명은 또한, 혈장 중 약물동태성, 안정성 및/또는 면역원성이 개선된 항인간 IL-6 수용체 항체를 제공한다. IgG에 있어서는, 동일한 Fc영역을 갖는 IgG의 혈장 중 반감기가 pI와 높은 상관계수로 상관하는 것이 발견되어 있다. 이에, 상이한 항원에 대한 2종류의 항체에 있어서 가변영역의 pI를 개변하는 것을 시도한 바, 항원의 종류에 관계없이 Fc영역을 개변하지 않고 혈장 중 반감기를 제어하는 것에 성공하였다. 항체의 내피세포로의 비특이적인 삽입의 속도는, 음전하를 띤 세포 표면과 IgG의 물리화학적인 클론 상호작용에 의존한다고 생각된다. IgG의 pI를 저하시킴으로써 클론 상호작용이 저감되고, 내피세포로의 비특이적인 삽입이 감소하여, 결과적으로 내피세포에 있어서의 대사를 감소시킴으로써 혈장 중 체류성을 증가시키는 것이 가능해진다.
 즉 본 발명은, 항IL-6 수용체 항체, 특히 인간화 PM-1 항체의 아미노산 서열을 치환함으로써, 등전점을 저하시키고, 혈장 중 체류성을 증가시킨 항인간 IL-6 수용체 항체를 제공한다. 구체적으로는, Kabat 넘버링(Kabat EA et al., 1991 Sequences of Proteins of Immunological Interest. NIH)에 있어서, 인간화 PM-1의 H13(서열번호:7의 13번째의 아미노산), H16(서열번호:7의 16번째의 아미노산), H43(서열번호:8의 8번째의 아미노산), H81(서열번호:9의 16번째의 아미노산), H105(서열번호:10의 3번째의 아미노산), L18(서열번호:11의 18번째의 아미노산), L45(서열번호:12의 11번째의 아미노산), L79(서열번호:13의 23번째의 아미노산), L107(서열번호:14의 10번째의 아미노산), H31(서열번호:1의 1번째의 아미노산), L24(서열번호:4의 1번째의 아미노산) 및/또는 L53(서열번호:5의 4번째의 아미노산)을 등전점이 저하되는 다른 아미노산으로 치환한다. 이것에 의해, 인간화 PM-1의 결합활성이나 안정성에 영향을 미치지 않고 등전점을 저하시키는 것이 가능하다. 또한 인간화 PM-1 항체에서는, 마우스 서열을 인간화할 때, 결합활성 유지를 위해 몇 개의 아미노산 잔기가 마우스 서열 그대로 남겨져 있다. 구체적으로는, 전술한 Kabat 넘버링에 있어서, 인간화 PM-1 항체 중의 H27(서열번호:7의 27번째의 아미노산), H28(서열번호:7의 28번째의 아미노산), H29(서열번호:7의 29번째의 아미노산), H30(서열번호:7의 30번째의 아미노산) 및 H71은 마우스 서열이 그대로 이용되고 있다. HFR1에 관해서는 H13, H16, H23, H30을 치환함으로써 HFR1으로서 인간 서열로 변환하는 것이 가능하여, 인간화 항체 PM-1보다 더욱 면역원성 리스크가 저하된 항체를 제작하는 것이 가능하다고 생각된다. 또한, 인간화 PM-1은, CDR 그래프팅에 의해 인간화된 항체인 것으로부터, 안정성에 관해서는 개선의 여지가 있다고 생각된다. 예를 들면, 항체의 가변영역에 있어서 표면에 노출되어 있는 아미노산 잔기를 친수성의 아미노산으로 치환함으로써, 항체를 안정화하는 것이 가능하다고 생각된다. 또한 CDR 서열을 콘센서스 서열로 개변하는 것으로도, 항체를 안정화하는 것이 가능하다. 인간화 PM-1 항체에 있어서는, 전술한 Kabat 넘버링에 있어서, H69(서열번호:9의 4번째의 아미노산)의 Met로부터 Ile로의 치환(소수 코어구조의 안정화), H70(서열번호:9의 5번째의 아미노산)의 Leu로부터 Ser로의 치환(표면 노출 잔기의 친수화), H58(서열번호:2의 9번째의 아미노산)의 Thr로부터 Asn으로의 치환(중쇄 CDR2의 콘센서스 서열로의 개변), H65(서열번호:2의 16번째의 아미노산)의 Ser로부터 Gly로의 치환(β턴부분으로의 Gly로의 치환, 중쇄 CDR2의 콘센서스 서열로의 개변), 또는 L93(서열번호:6의 5번째의 아미노산)의 Thr로부터 Ser로의 치환(표면 노출 잔기의 친수화)에 의해 항체를 안정화하는 것이 가능하다. 또한, 전술한 LCDR2(서열번호:5)의 2번째인 L51의 Thr을 Gly로 치환함으로써, 결합활성이나 안정성에 영향을 주지 않고 인 실리코(in silico)로 예측된 T-cell 에피토프를 제거함으로써 면역원성 리스크를 저하시키는 것이 가능하다. 이들의 아미노산 치환을 조합시켜서, 항체의 혈장 중 약물동태성, 면역원성, 안정성이 개선된 항IL-6 수용체 항체를 얻는 것이 가능하다.
 이와 같은 항체의 예로서, 하기 (1)~(37) 중 어느 하나에 기재된 항체를 들 수 있다.
 (1) 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg가 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Lys로의 치환이 바람직하다.
 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg가 Lys로 치환된 서열을 서열번호:80에 나타낸다.
 (2) 서열번호:7에 기재된 아미노산 서열에 있어서 16번째의 Gln이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Glu로의 치환이 바람직하다.
 서열번호:7에 기재된 아미노산 서열에 있어서 16번째의 Gln이 Glu로 치환된 서열을 서열번호:81에 나타낸다.
 (3) 서열번호:7에 기재된 아미노산 서열에 있어서 23번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ala로의 치환이 바람직하다.
 서열번호:7에 기재된 아미노산 서열에 있어서 23번째의 Thr이 Ala로 치환된 서열을 서열번호:82에 나타낸다.
 (4) 서열번호:7에 기재된 아미노산 서열에 있어서 30번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ser로의 치환이 바람직하다.
 서열번호:7에 기재된 아미노산 서열에 있어서 30번째의 Thr이 Ser로 치화된 서열을 서열번호:83에 나타낸다.
 (5) 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg, 16번째의 Gln, 23번째의 Thr 및 30번째의 Thr이 다른 아미노산으로 치환된 FR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 13번째의 Arg는 Lys, 16번째의 Gln은 Glu, 23번째의 Thr은 Ala, 30번째의 Thr은 Ser로의 치환이 바람직하다.
 서열번호:7에 기재된 아미노산 서열에 있어서 13번째의 Arg가 Lys, 16번째의 Gln이 Glu, 23번째의 Thr이 Ala, 30번째의 Thr이 Ser로 치환된 서열을 서열번호:84에 나타낸다.
 (6) 서열번호:8에 기재된 아미노산 서열에 있어서 8번째의 Arg가 다른 아미노산으로 치환된 FR2를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:8에 기재된 아미노산 서열에 있어서 8번째의 Arg가 Glu로 치환된 서열을 서열번호:85에 나타낸다.
 (7) 서열번호:9에 기재된 아미노산 서열에 있어서 4번째의 Met가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ile로의 치환이 바람직하다.
 서열번호:9에 기재된 아미노산 서열에 있어서 4번째의 Met가 Ile로 치환된 서열을 서열번호:86에 나타낸다.
 (8) 서열번호:9에 기재된 아미노산 서열에 있어서 5번째의 Leu가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 서열번호:9에 기재된 아미노산 서열에 있어서 5번째의 Leu가 Ser로 치환된 서열을 서열번호:87에 나타낸다.
 (9) 서열번호:9에 기재된 아미노산 서열에 있어서 16번째의 Arg가 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나 Lys로의 치환이 바람직하다.
 서열번호:9에 기재된 아미노산 서열에 있어서 16번째의 Arg가 Lys로 치환된 서열을 서열번호:88에 나타낸다.
 (10) 서열번호:9에 기재된 아미노산 서열에 있어서 27번째의 Val이 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ala로의 치환이 바람직하다.
 서열번호:9에 기재된 아미노산 서열에 있어서 27번째의 Val이 Ala로 치환된 서열을 서열번호:89에 나타낸다.
 (11) 서열번호:9에 기재(HFR3)의 아미노산 서열에 있어서 4번째의 Met, 5번째의 Leu, 16번째의 Arg 및 27번째의 Val이 다른 아미노산으로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 4번째의 Met는 Ile, 5번째의 Leu는 Ser, 16번째의 Arg는 Lys, 27번째의 Val은 Ala로의 치환이 바람직하다.
 서열번호:9에 기재된 아미노산 서열에 있어서 4번째의 Met가 Ile, 5번째의 Leu가 Ser, 16번째의 Arg가 Lys, 27번째의 Val이 Ala로 치환된 서열을 서열번호:90에 나타낸다.
 (12) 서열번호:10에 기재(HFR4)의 아미노산 서열에 있어서 3번째의 Gln이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:10에 기재된 아미노산 서열에 있어서 3번째의 Gln이 Glu로 치환된 서열을 서열번호:91에 나타낸다.
 (13) 서열번호:11에 기재(LFR1)의 아미노산 서열에 있어서 18번째의 Arg가 다른 아미노산으로 치환된 FR1을 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 서열번호:11에 기재된 아미노산 서열에 있어서 18번째의 Arg가 Ser로 치환된 서열을 서열번호:92에 나타낸다.
 (14) 서열번호:12에 기재(LFR2)의 아미노산 서열에 있어서 11번째의 Lys가 다른 아미노산으로 치환된 FR2를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:12에 기재된 아미노산 서열에 있어서 11번째의 Lys가 Glu로 치환된 서열을 서열번호:93에 나타낸다.
 (15) 서열번호:13에 기재된 아미노산 서열에 있어서 23번째의 Gln이 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:13에 기재된 아미노산 서열에 있어서 23번째의 Gln이 Glu로 치환된 서열을 서열번호:94에 나타낸다.
 (16) 서열번호:13에 기재된 아미노산 서열에 있어서 24번째의 Pro가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ala로의 치환이 바람직하다.
 서열번호:13에 기재된 아미노산 서열에 있어서 24번째의 Pro가 Ala로 치환된 서열을 서열번호:95에 나타낸다.
 (17) 서열번호:13에 기재된 아미노산 서열에 있어서 27번째의 Ile가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산 서열은 특별히 한정되지 않으나 Ala로의 치환이 바람직하다.
 서열번호:13에 기재된 아미노산 서열에 있어서 27번째의 Ile가 Ala로 치환된 서열을 서열번호:96에 나타낸다.
 (18) 서열번호:13에 기재(LFR3)의 아미노산 서열에 있어서 23번째의 Gln, 24번째의 Pro 및 27번째의 Ile가 다른 아미노산으로 치환된 FR3를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 23번째의 Gln은 Glu, 24번째의 Pro는 Ala, 27번째의 Ile는 Ala로의 치환이 바람직하다.
 서열번호:13에 기재된 아미노산 서열에 있어서 23번째의 Gln이 Glu, 24번째의 Pro가 Ala, 27번째의 Ile가 Ala로 치환된 서열을 서열번호:97에 나타낸다.
 (19) 서열번호:14에 기재(LFR4)의 아미노산 서열에 있어서 10번째의 Lys가 다른 아미노산으로 치환된 FR4를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:14에 기재된 아미노산 서열에 있어서 10번째의 Lys가 Glu로 치환된 서열을 서열번호:98에 나타낸다.
 (20) 서열번호:10에 기재(HFR4)의 아미노산 서열에 있어서 5번째의 Ser이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Thr로의 치환이 바람직하다.
 서열번호:10에 기재된 아미노산 서열에 있어서 5번째의 Ser이 Thr로 치환된 서열을 서열번호:132에 나타낸다.
 (21) 서열번호:10에 기재(HFR4)의 아미노산 서열에 있어서 3번째의 Gln 및 5번째의 Ser이 다른 아미노산으로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 3번째의 Gln은 Glu, 5번째의 Ser은 Thr로의 치환이 바람직하다.
 서열번호:10에 기재된 아미노산 서열에 있어서 3번째의 Gln이 Glu로, 5번째의 Ser이 Thr로 치환된 서열을 서열번호:133에 나타낸다.
 (22) (5), (6), (11) 및 (21)에 기재된 아미노산 치환이 행해진 인간화 PM-1 중쇄 가변영역을 포함하는 항체.
 (23) (13), (14), (18) 및 (19)에 기재된 아미노산 치환이 행해진 인간화 PM-1 경쇄 가변영역을 포함하는 항체.
 (24) (22)에 기재된 중쇄 가변영역 및 (23)에 기재된 경쇄 가변영역을 포함하는 항체.
 (25) 서열번호:1에 기재(HCDR1)의 아미노산 서열에 있어서 1번째의 Ser이 다른 아미노산으로 치환된 CDR1을 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Asp로의 치환이 바람직하다.
 서열번호:1에 기재된 아미노산 서열에 있어서 1번째의 Ser이 Asp로 치환된 서열을 서열번호:28에 나타낸다.
 (26) 서열번호:2에 기재된 아미노산 서열에 있어서 16번째의 Ser이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Gly로의 치환이 바람직하다.
 서열번호:2에 기재된 아미노산 서열에 있어서 16번째의 Ser이 Gly로 치환된 서열을 서열번호:99에 나타낸다.
 (27) 서열번호:2에 기재(HCDR2)의 아미노산 서열에 있어서 9번째의 Thr 및 16번째의 Ser이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 9번째의 Thr은 Asn, 16번째의 Ser은 Gly로의 치환이 바람직하다.
 서열번호:2에 기재된 아미노산 서열에 있어서 9번째의 Thr이 Asn, 16번째의 Ser이 Gly로 치환된 서열을 서열번호:100에 나타낸다.
 (28) 서열번호:4에 기재(LCDR1)의 아미노산 서열에 있어서 1번째의 Arg가 다른 아미노산으로 치환된 CDR1을 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Gln으로의 치환이 바람직하다.
 서열번호:4에 기재된 아미노산 서열에 있어서 1번째의 Arg가 Gln으로 치환된 서열을 서열번호:101에 나타낸다.
 (29) 서열번호:5에 기재된 아미노산 서열에 있어서 4번째의 Arg가 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 서열번호:5에 기재된 아미노산 서열에 있어서 4번째의 Arg가 Glu로 치환된 서열을 서열번호:102에 나타낸다.
 (30) 서열번호:5에 기재(LCDR2)의 아미노산 서열에 있어서 2번째의 Thr 및 4번째의 Arg가 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 2번째의 Thr은 Gly, 4번째의 Arg는 Glu로의 치환이 바람직하다.
 서열번호:5에 기재된 아미노산 서열에 있어서 2번째의 Thr이 Gly, 4번째의 Arg가 Glu로 치환된 서열을 서열번호:103에 나타낸다.
 (31) 서열번호:6에 기재(LCDR3)의 아미노산 서열에 있어서 5번째의 Thr이 다른 아미노산으로 치환된 CDR3를 갖는 경쇄 가변영역을 포함하는 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 서열번호:6에 기재된 아미노산 서열에 있어서 5번째의 Thr이 Ser로 치환된 서열을 서열번호:77에 나타낸다.
 (32) (25) 및 (27)에 기재된 아미노산 치환이 행해진 중쇄 가변영역을 포함하는 항체.
 (33) (28), (30) 및 (31)에 기재된 아미노산 치환이 행해진 경쇄 가변영역을 포함하는 항체.
 (34) (32)에 기재된 중쇄 가변영역과 (33)에 기재된 경쇄 가변영역을 포함하는 항체.
 (35) 서열번호:104에 기재(H53/L28의 VH)의 아미노산 서열을 갖는 중쇄 가변영역을 포함하는 항체.
 (36) 서열번호:105에 기재(H53/L28의 VL)의 아미노산 서열을 갖는 경쇄 가변영역을 포함하는 항체.
 (37) (35)에 기재된 중쇄 가변영역 및 (36)에 기재된 경쇄 가변영역을 갖는 항체.
 전술한 (1)~(37) 중 어느 하나에 기재된 아미노산 치환은 인간화 PM-1 항체에 대해 행해지는 것이 바람직하다. 본 발명은 적어도 전술한 (1)~(37) 중 어느 하나에 기재된 아미노산 치환을 포함하는 항체 및 그 항체의 제조방법을 제공한다. 따라서 본 발명의 항체에는, 전술한 (1)~(37) 중 어느 하나에 기재된 아미노산 치환에 더하여, 전술한 (1)~(37)에 기재된 아미노산 치환 이외의 아미노산 치환을 포함하는 항체도 포함된다. 또한 본 발명의 항체에는, 전술한 (1)~(37) 중 어느 하나에 기재된 아미노산 치환이 복수 조합된 항체도 포함된다. 전술한 (1)~(37)에 기재된 아미노산 치환으로서는, 예를 들면, 전술한 FR 및 CDR의 아미노산 서열의 치환을 들 수 있다. 전술한 (1)~(37)에 기재된 아미노산 치환 이외의 아미노산 치환으로서는, 전술 이외의 FR 및 CDR 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다. 또한, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다.
 또한, 전술한 아미노산 개변 이외의, 항IL-6 수용체 항체의 활성을 저하시키지 않고 등전점을 저하시키는 개변으로서는, 예를 들면, 서열번호:2에 기재된 아미노산 서열에 있어서 15번째의 Lys 및/또는 16번째의 Ser을 다른 아미노산으로 치환하는 개변을 들 수 있다. 치환 후의 아미노산은 특별히 한정되지 않으나, 15번째의 Lys는 Gln으로, 16번째의 Ser은 Asp로 치환하는 것이 바람직하다. 서열번호:2의 아미노산 서열에 있어서 15번째의 Lys가 Gln으로, 16번째의 Ser이 Asp로 치환된 서열을 서열번호:121에 나타낸다. 또한, 이와 같은 아미노산 치환은 서열번호:100에 기재된 아미노산 서열에 대해 행해져도 된다. 서열번호:100의 아미노산 서열에 있어서, 15번째의 Lys가 Gln으로, 16번째의 Gly가 Asp로 치환된 서열을 서열번호:122에 나타낸다. 따라서, 본 발명은 서열번호:2 또는 서열번호:100의 아미노산 서열에 있어서 15번째의 Lys 및/또는 16번째의 Ser이 다른 아미노산으로 치환된 CDR2를 갖는 중쇄 가변영역을 포함하는 항체를 제공한다.
 또한, 등전점을 저하시키는 다른 개변으로서는, 서열번호:4에 기재된 아미노산 서열에 있어서 4번째의 Gln을 다른 아미노산으로 치환하는 개변을 들 수 있다. 치환 후의 아미노산은 특별히 한정되지 않으나 Glu로의 치환이 바람직하다. 서열번호:4의 아미노산 서열에 있어서, 4번째의 Gln이 Glu로 치환된 아미노산 서열을 서열번호:123에 나타낸다. 또한, 이 아미노산 치환은 서열번호:101의 아미노산 서열에 대해 행해져도 된다. 서열번호:101의 아미노산 서열에 있어서 4번째의 Gln이 Glu로 치환된 아미노산 서열을 서열번호:124에 나타낸다. 따라서, 본 발명은 서열번호:4 또는 서열번호:101의 아미노산 서열에 있어서 4번째의 Gln이 다른 아미노산으로 치환된 CDR1을 갖는 경쇄 가변영역을 포함하는 항체를 제공한다.
 또한, 등전점을 저하시키는 다른 개변으로서, 서열번호:5에 기재된 아미노산 서열에 있어서 6번째의 His를 다른 아미노산으로 치환하는 개변을 들 수 있다. 치환 후의 아미노산은 특별히 한정되지 않으나 Glu로의 치환이 바람직하다. 서열번호:5에 기재된 아미노산 서열에 있어서 6번째의 His가 Glu로 치환된 아미노산 서열을 서열번호:125에 나타낸다. 또한, 이 아미노산 치환은 서열번호:103의 아미노산 서열에 대해 행해져도 된다. 서열번호:103의 아미노산 서열에 있어서 6번째의 His가 Glu로 치환된 아미노산 서열을 서열번호:126에 나타낸다. 따라서, 본 발명은 서열번호:5 또는 서열번호:103의 아미노산 서열에 있어서 6번째의 His가 다른 아미노산으로 치환된 CDR2를 갖는 경쇄 가변영역을 포함하는 항체를 제공한다.
 또한, 서열번호:90에 기재된 중쇄 FR3의 아미노산 서열에 있어서, 면역원성 리스크를 저감시키는 개변으로서, 27번째(Kabat 넘버링 H89)의 Ala를 Val로 치환하는 개변을 들 수 있다. 서열번호:90에 기재된 아미노산 서열에 있어서 27번째의 Ala가 Val로 치환된 아미노산 서열을 서열번호:127에 나타낸다. 따라서, 본 발명은 서열번호:90의 아미노산 서열에 있어서 27번째의 Ala가 Val로 치환된 FR3를 갖는 중쇄 가변영역을 포함하는 항체를 제공한다.
 또한, 서열번호:9 또는 서열번호:90에 기재된 중쇄 FR3의 아미노산 서열에 있어서 유일하게 잔존하는 마우스 서열인 6번째(Kabat 넘버링 H71)의 Arg에 관해, H71이 Arg로 보존되어 있는 인간 VH1 서브클래스(서열번호:128), 또는, 인간 VH3 서브클래스(서열번호:129)의 인간 서열을 FR3 서열로서 사용함으로써, 프레임워크로서는 완전히 인간 서열인 항인간 IL-6 수용체 항체를 제작 가능하다고 생각된다. 따라서, 본 발명은 서열번호:128 또는 서열번호:129에 기재된 FR3를 갖는 중쇄 가변영역을 포함하는 항체를 제공한다.
 또한, 서열번호:10에 기재된 중쇄 FR4의 아미노산 서열에 있어서, 안정성을 향상시키는 개변으로서, 5번째(Kabat 넘버링 H107)의 Ser을 Ile로 치환하는 개변을 들 수 있다. 서열번호:10에 기재된 아미노산 서열에 있어서 5번째의 Ser이 Ile로 치환된 아미노산 서열을 서열번호:130에 나타낸다. 또한, 이 아미노산 서열은 서열번호:91의 아미노산 서열에 대해 행해져도 된다. 서열번호:91에 기재된 아미노산 서열에 있어서 5번째의 Ser이 Ile로 치환된 아미노산 서열을 서열번호:131에 나타낸다. 따라서, 본 발명은 서열번호:10 또는 서열번호:91의 아미노산 서열에 있어서 5번째의 Ser이 Ile로 치환된 FR4를 갖는 중쇄 가변영역을 포함하는 항체를 제공한다.
 이와 같은 아미노산 치환은 인간화 PM-1 항체, H53/L28(서열번호:104의 중쇄 가변영역, 서열번호:105의 경쇄 가변영역을 포함하는 항체) 또는 PF1 항체(서열번호:22의 중쇄 가변영역, 서열번호:23의 경쇄 가변영역을 포함하는 항체)에 대해 행해지는 것이 바람직하다. 본 발명은 적어도 이와 같은 아미노산 치환을 포함하는 항체 및 그 항체의 제조방법을 제공한다. 따라서 본 발명의 항체에는, 이와 같은 아미노산 치환에 더하여, 전술한 (1)~(37)에 기재된 아미노산 치환 및/또는 전술한 (1)~(37) 이외의 아미노산 치환을 포함하는 항체도 포함된다. 전술한 (1)~(37)에 기재된 아미노산 치환 이외의 아미노산 치환으로서는, 전술 이외의 FR 및 CDR 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다. 또한, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등을 들 수 있다.
 〈등전점이 낮은 항인간 IL-6 수용체 항체〉
 본 발명은 또한 등전점이 낮은 항IL-6 수용체 항체를 제공한다. 본 발명의 등전점이 낮은 항체에는 전장 항체의 실측등전점이 낮은 항체 및 가변영역(VH/VL)의 이론등전점이 낮은 항체가 포함된다.
 본 발명에 있어서 전장 항체의 실측등전점이 낮은 항IL-6 수용체 항체란, 통상, 실측등전점이 7.5 이하인 항체이고, 바람직하게는 실측등전점이 7.0 이하인 항체이며, 더욱 바람직하게는 실측등전점이 6.0 이하인 항체이다. 실측등전점은 당업자에게 공지의 방법으로 측정하는 것이 가능하여, 예를 들면, 비변성 겔 등전점 전기영동이나 캐필러리 등전점 전기영동 등의 방법에 의해 측정하는 것이 가능하다.
 본 발명에 있어서 가변영역의 이론등전점이 낮은 항IL-6 수용체 항체란, 통상, 이론등전점이 5.5 이하인 항체이고, 바람직하게는 이론등전점이 5.0 이하인 항체이며, 더욱 바람직하게는 이론등전점이 4.0 이하인 항체이다. 이론등전점은 당업자에게 공지의 방법에 의해 산출하는 것이 가능하여, 예를 들면, GENETYX(GENETYX CORPORATION) 등의 소프트를 사용함으로써 가변영역의 VH 및 VL의 이론등전점을 산출하는 것이 가능하다.
 본 발명의 등전점이 낮은 항IL-6 수용체 항체에 있어서, 도입되는 아미노산 치환은 특별히 한정되지 않으나, 예를 들면, 전술한 아미노산 치환을 들 수 있다. 이와 같은 등전점이 낮은 항IL-6 수용체 항체는 혈장 중에서의 체류성이 향상되어 있다고 생각된다.
 IL-6 수용체는 특별히 한정되지 않으나, 인간 IL-6 수용체가 바람직하다.
 〈고농도에 있어서 안정한 항인간 IL-6 수용체 항체〉
 또한 본 발명은 고농도에 있어서 안정한 항IL-6 수용체 항체를 제공한다.
 본 발명에 있어서 "고농도에 있어서 안정"이란, 피하투여에 적합한 pH 6.5~7.0 범위 내의 적절하게 선택된 완충액 조건(예를 들면, 20 mM histidine-HCl, 150 mM NaCl)에 있어서, 항IL-6 수용체 항체 100 ㎎/mL의 고농도 항체용액의 25℃에서의 1개월당의 회합체 비율(겔 여과 크로마토그래피 상의 회합체 피크영역/총 피크영역×100)의 증가가 0.3% 이하, 바람직하게는 0.2% 이하, 더욱 바람직하게는 0.1% 이하인 것을 의미한다. 또한, 항IL-6 수용체 항체의 농도는 100 ㎎/mL 이상이면 되고, 예를 들면, 200 ㎎/mL나 300 ㎎/mL 등이어도 된다.
 본 발명의 고농도에 있어서 안정한 항IL-6 수용체 항체는, 특별히 한정되지 않으나, 예를 들면 전술한 아미노산 치환 등에 의해 제작하는 것이 가능하다.
 IL-6 수용체는 특별히 한정되지 않으나, 인간 IL-6 수용체가 바람직하다.
 본 발명은 또한, 전술한 (1)~(37) 중 어느 하나에 기재된 아미노산 치환이 행해진 인간화 PM-1 항체에, 추가적으로 전술한 (a)~(y) 중 어느 하나에 기재된 결합활성 및/또는 중화활성을 향상시키는 아미노산 치환을 행한 항체를 제공한다. 이와 같은 항체의 일태양으로서는, 서열번호:22에 기재(PF1_H)의 아미노산 서열을 갖는 중쇄 가변영역 및 서열번호:23에 기재(PF1_L)의 아미노산 서열을 갖는 경쇄 가변영역을 갖는 항체(PF1)를 들 수 있으나, 이들에 한정되지 않는다.
 또한 본 발명은 이하의 항체의 (A)~(I) 중 어느 하나에 기재된 항IL-6 수용체 항체를 제공한다.
 (A) 서열번호:165에 기재된 아미노산 서열(VH5-M83의 CDR1)을 갖는 CDR1, 서열번호:166에 기재된 아미노산 서열(VH5-M83의 CDR2)을 갖는 CDR2, 서열번호:167에 기재된 아미노산 서열(VH5-M83의 CDR3)을 갖는 CDR3를 갖는 중쇄 가변영역,
 (B) 서열번호:101에 기재된 아미노산 서열(VL5의 CDR1)을 갖는 CDR1, 서열번호:168에 기재된 아미노산 서열(VL5의 CDR2)을 갖는 CDR2, 서열번호:79에 기재된 아미노산 서열(VL5의 CDR3)을 갖는 CDR3를 갖는 경쇄 가변영역,
 (C) (A)의 중쇄 가변영역 및 (B)의 경쇄 가변영역을 포함하는 항체,
 (D) 서열번호:169에 기재된 아미노산 서열(VH3-M73의 CDR1)을 갖는 CDR1, 서열번호:170에 기재된 아미노산 서열(VH3-M73의 CDR2)을 갖는 CDR2, 서열번호:171에 기재된 아미노산 서열(VH3-M73의 CDR3)을 갖는 CDR3를 갖는 중쇄 가변영역,
 (E) 서열번호:172에 기재된 아미노산 서열(VL3의 CDR1)을 갖는 CDR1, 서열번호:173에 기재된 아미노산 서열(VL3의 CDR2)을 갖는 CDR2, 서열번호:79에 기재된 아미노산 서열(VL3의 CDR3)을 갖는 CDR3를 갖는 경쇄 가변영역,
 (F) (D)의 중쇄 가변영역 및 (E)의 경쇄 가변영역을 포함하는 항체,
 (G) 서열번호:169에 기재된 아미노산 서열(VH4-M73의 CDR1)을 갖는 CDR1, 서열번호:174에 기재된 아미노산 서열(VH4-M73의 CDR2)을 갖는 CDR2, 서열번호:171에 기재된 아미노산 서열(VH4-M73의 CDR3)을 갖는 CDR3를 갖는 중쇄 가변영역,
 (H) 서열번호:175에 기재된 아미노산 서열(VL1의 CDR1)을 갖는 CDR1, 서열번호:173에 기재된 아미노산 서열(VL1의 CDR2)을 갖는 CDR2, 서열번호:79에 기재된 아미노산 서열(VL1의 CDR3)을 갖는 CDR3를 갖는 경쇄 가변영역,
 (I) (G)의 중쇄 가변영역 및 (H)의 경쇄 가변영역을 포함하는 항체.
 또한 본 발명은 이하의 (a)~(q) 중 어느 하나에 기재된 항IL-6 수용체 항체를 제공한다.
 (a) 서열번호:159에 기재된 아미노산 서열(H96-IgG1 가변영역)을 갖는 중쇄 가변영역을 포함하는 항체,
 (b) 서열번호:159에 기재된 아미노산 서열(H96-IgG1 가변영역)에 있어서, 35번째의 Trp, 51번째의 Tyr, 63번째의 Ser, 65번째의 Lys, 66번째의 Gly, 99번째의 Val, 103번째의 Ile, 108번째의 Tyr, 111번째의 Glu, 113번째의 Thr 중 하나 이상의 아미노산이 다른 아미노산으로 치환된 아미노산 서열을 갖는 중쇄 가변영역을 포함하는 항체,
 (c) 서열번호:159에 기재된 아미노산 서열(H96-IgG1 가변영역)에 있어서, 65번째의 Lys, 66번째의 Gly, 99번째의 Val, 103번째의 Ile, 111번째의 Glu, 113번째의 Thr이 다른 아미노산으로 치환된 아미노산 서열을 갖는 중쇄 가변영역을 포함하는 항체,
 (d) 서열번호:159에 기재된 아미노산 서열(H96-IgG1 가변영역)에 있어서, 35번째의 Trp, 51번째의 Tyr, 63번째의 Ser, 65번째의 Lys, 66번째의 Gly, 99번째의 Val, 103번째의 Ile, 108번째의 Tyr이 다른 아미노산으로 치환된 아미노산 서열을 갖는 중쇄 가변영역을 포함하는 항체,
 (e) 서열번호:160에 기재된 아미노산 서열(F2H-IgG1 가변영역)을 갖는 중쇄 가변영역을 포함하는 항체,
 (f) 서열번호:161에 기재된 아미노산 서열(VH5-M83 가변영역)을 갖는 중쇄 가변영역을 포함하는 항체.
 (g) 서열번호:23에 기재된 아미노산 서열(PF1L)에 있어서 27번째의 Gln 및/또는 55번째의 His가 다른 아미노산으로 치환된 아미노산 서열을 갖는 경쇄 가변영역을 갖는 항체,
 (h) 서열번호:162에 기재된 아미노산 서열(L39 가변영역)을 갖는 경쇄 가변영역을 포함하는 항체,
 (i) 서열번호:163에 기재된 아미노산 서열(VL5-kappa 가변영역)을 갖는 경쇄 가변영역을 포함하는 항체,
 (j) 서열번호:176에 기재된 아미노산 서열(VH3-M73 가변영역)을 갖는 중쇄 가변영역을 포함하는 항체,
 (k) 서열번호:178에 기재된 아미노산 서열(VH4-M73 가변영역)을 갖는 중쇄 가변영역을 포함하는 항체,
 (l) 서열번호:177에 기재된 아미노산 서열(VL3-kappa 가변영역)을 갖는 경쇄 가변영역을 포함하는 항체,
 (m) 서열번호:179에 기재된 아미노산 서열(VL1-kappa 가변영역)을 갖는 경쇄 가변영역을 포함하는 항체,
 (n) (e)의 중쇄 가변영역과 (h)의 경쇄 가변영역을 포함하는 항체,
 (o) (f)의 중쇄 가변영역과 (i)의 경쇄 가변영역을 포함하는 항체(FV5-M83의 가변영역 조합)
 (p) (j)의 중쇄 가변영역과 (l)의 경쇄 가변영역을 포함하는 항체(FV4-M73의 가변영역 조합)
 (q) (k)의 중쇄 가변영역과 (m)의 경쇄 가변영역을 포함하는 항체(FV3-M73의 가변영역 조합).
 전술한 (a)~(d)의 중쇄 가변영역의 아미노산 치환에 있어서, 치환 후의 아미노산은 특별히 한정되지 않으나, 35번째의 Trp는 Val, 51번째의 Tyr은 Phe, 63번째의 Ser은 Thr, 65번째의 Lys는 Gln, 66번째의 Gly는 Asp, 99번째의 Val은 Leu, 103번째의 Ile는 Ala, 108번째의 Tyr은 Val, 111번째의 Glu는 Gln, 113번째의 Thr은 Ile로 치환되는 것이 바람직하다. 또한, 전술한 (g)의 경쇄 가변영역의 아미노산 치환에 있어서, 치환 후의 아미노산은 특별히 한정되지 않으나, 27번째의 Gln은 Glu로, 55번째의 His는 Glu로 치환되는 것이 바람직하다. 또한, 전술한 아미노산 치환 이외의 아미노산의 치환, 결실, 삽입 및/또는 부가 등이 행해져도 된다.
 본 발명의 항체의 정상영역은 특별히 한정되지 않고, 어떠한 정상영역이 사용되어도 된다. 예를 들면, IgG1, IgG2, IgG4 등의 천연서열을 갖는 정상영역이나, 천연서열을 갖는 정상영역 중의 아미노산의 치환, 결실, 부가 및/또는 삽입 등을 행함으로써 제작된 개변형의 정상영역 등을 사용할 수 있다. 개변형의 정상영역의 예로서는, 후술하는 정상영역을 들 수 있다.
 또한, 전술한 본 발명의 가변영역을 사용한 항체의 예로서, 이하의 항체를 들 수 있다.
 (1) 서열번호:134에 기재된 아미노산 서열(H96-IgG1)을 갖는 중쇄를 포함하는 항체,
 (2) 서열번호:135에 기재된 아미노산 서열(F2H-IgG1)을 갖는 중쇄를 포함하는 항체,
 (3) 서열번호:137에 기재된 아미노산 서열(VH5-IgG1)을 갖는 중쇄를 포함하는 항체,
 (4) 서열번호:139에 기재된 아미노산 서열(VH5-M83)을 갖는 중쇄를 포함하는 항체,
 (5) 서열번호:136에 기재된 아미노산 서열(L39)을 갖는 경쇄를 포함하는 항체,
 (6) 서열번호:138에 기재된 아미노산 서열(VL5-kappa)을 갖는 경쇄를 포함하는 항체,
 (7) 서열번호:180에 기재된 아미노산 서열(VH3-M73)을 갖는 중쇄를 포함하는 항체,
 (8) 서열번호:182에 기재된 아미노산 서열(VH4-M73)을 갖는 중쇄를 포함하는 항체,
 (9) 서열번호:181에 기재된 아미노산 서열(VL3-kappa)을 갖는 경쇄를 포함하는 항체,
 (10) 서열번호:183에 기재된 아미노산 서열(VL1-kappa)을 갖는 경쇄를 포함하는 항체,
 (11) (2)의 중쇄와 (5)의 경쇄를 포함하는 항체,
 (12) (3)의 중쇄와 (6)의 경쇄를 포함하는 항체,
 (13) (4)의 중쇄와 (6)의 경쇄를 포함하는 항체(FV5-M83),
 (14) (7)의 중쇄와 (9)의 경쇄를 포함하는 항체(FV4-M73),
 (15) (8)의 중쇄와 (10)의 경쇄를 포함하는 항체(FV3-M73),
 (16) (1) 내지 (15) 중 어느 하나에 기재된 항체와 동등한 활성을 갖는 항체.
 여기서, 「동등한 활성을 갖는」이란 항원으로의 결합활성 및/또는 중화활성이 동등한 것을 말한다. 본 발명에 있어서 동등한 활성이란 반드시 동일한 활성일 필요는 없고, 예를 들면 50% 이상의 활성, 바람직하게는 70% 이상의 활성, 더욱 바람직하게는 90% 이상의 활성을 가지고 있는 것을 말한다.
 또한, 본 발명은 이하의 (i)~(xxii) 중 어느 하나에 기재된 CDR 또는 FR을 제공한다.
 (i) 서열번호:84에 기재된 아미노산 서열을 갖는 중쇄 FR1(VH5의 중쇄 FR1)
 (ii) 서열번호:186에 기재된 아미노산 서열을 갖는 중쇄 FR1(VH3, VH4의 중쇄 FR1)
 (iii) 서열번호:85에 기재된 아미노산 서열을 갖는 중쇄 FR2(VH3, VH4, VH5의 중쇄 FR2)
 (iv) 서열번호:184에 기재된 아미노산 서열을 갖는 중쇄 FR3(VH3, VH4, VH5의 중쇄 FR3)
 (v) 서열번호:133에 기재된 아미노산 서열을 갖는 중쇄 FR4(VH3, VH4, VH5의 중쇄 FR4)
 (vi) 서열번호:92에 기재된 아미노산 서열을 갖는 경쇄 FR1(VL1, VL3, VL5의 경쇄 FR1)
 (vii) 서열번호:93에 기재된 아미노산 서열을 갖는 경쇄 FR2(VL1, VL3, VL5의 경쇄 FR2)
 (viii) 서열번호:97에 기재된 아미노산 서열을 갖는 경쇄 FR3(VL1, VL3, VL5의 경쇄 FR3)
 (ix) 서열번호:98에 기재된 아미노산 서열을 갖는 경쇄 FR4(VL1, VL3, VL5의 경쇄 FR4)
 (x) 서열번호:169에 기재된 아미노산 서열을 갖는 중쇄 CDR1(VH3, VH4의 중쇄 CDR1)
 (xi) 서열번호:165에 기재된 아미노산 서열을 갖는 중쇄 CDR1(VH5의 중쇄 CDR1),
 (xii) 서열번호:170에 기재된 아미노산 서열을 갖는 중쇄 CDR2(VH3의 중쇄 CDR2),
 (xiii) 서열번호:174에 기재된 아미노산 서열을 갖는 중쇄 CDR2(VH4의 중쇄 CDR2),
 (xiv) 서열번호:166에 기재된 아미노산 서열을 갖는 중쇄 CDR2(VH5의 중쇄 CDR2),
 (xv) 서열번호:171에 기재된 아미노산 서열을 갖는 중쇄 CDR3(VH3, VH4의 중쇄 CDR3),
 (xvi) 서열번호:167에 기재된 아미노산 서열을 갖는 중쇄 CDR3(VH5의 중쇄 CDR3),
 (xvii) 서열번호:175에 기재된 아미노산 서열을 갖는 경쇄 CDR1(VL1의 경쇄 CDR1),
 (xviii) 서열번호:172에 기재된 아미노산 서열을 갖는 경쇄 CDR1(VL3의 경쇄 CDR1),
 (xix) 서열번호:101에 기재된 아미노산 서열을 갖는 경쇄 CDR1(VL5의 경쇄 CDR1),
 (xx) 서열번호:173에 기재된 아미노산 서열을 갖는 경쇄 CDR2(VL1, VL3의 경쇄 CDR2),
 (xxi) 서열번호:168에 기재된 아미노산 서열을 갖는 경쇄 CDR2(VL5의 경쇄 CDR2),
 (xxii) 서열번호:79에 기재된 아미노산 서열을 갖는 경쇄 CDR3(VL1, VL3, VL5의 경쇄 CDR3)
 또한 본 발명의 항체에는, 전술한 것 중 어느 하나에 기재된 아미노산 치환을 포함하는 항체의 단편이나 그의 수식물도 포함된다. 예를 들면, 항체의 단편으로서는, Fab, F(ab')2, Fv 또는 H사슬과 L사슬의 Fv를 적당한 링커로 연결시킨 단일 사슬 Fv(scFv), H사슬 단독 도메인이나 L사슬 단독 도메인(예를 들면, Nat Biotechnol. 2005 Sep;23(9):1126-36.), Unibody(WO2007059782 A1), SMIP(WO2007014278 A2)를 들 수 있다. 또한 항체의 유래로서는, 특별히 한정되지 않으나, 인간 항체, 마우스 항체, 랫트 항체, 토끼 항체 등을 들 수 있다. 또한, 본 발명의 항체는 키메라 항체, 인간화 항체, 완전 인간화 항체 등이어도 된다.
 구체적으로는, 항체를 효소, 예를 들면, 파파인, 펩신으로 처리하여 항체 단편을 생성시키거나, 또는, 이들 항체 단편을 코드하는 유전자를 구축하여, 이것을 발현벡터에 도입한 후, 적당한 숙주세포에서 발현시킨다(예를 들면, Co, M.S. et al., J. Immunol. (1994) 152, 2968-2976, Better, M. & Horwitz, A. H. Methods in Enzymology (1989) 178, 476-496, Pluckthun, A. & Skerra, A. Methods in Enzymology (1989) 178, 497-515, Lamoyi, E., Methods in Enzymology (1989) 121, 652-663, Rousseaux, J. et al., Methods in Enzymology (1989) 121, 663-66, Bird, R. E. et al., TIBTECH (1991) 9, 132-137 참조).
 scFv는, 항체의 H사슬 V영역과 L사슬 V영역을 연결함으로써 얻어진다. 이 scFv에 있어서, H사슬 V영역과 L사슬 V영역은 링커, 바람직하게는 펩티드 링커를 매개로 하여 연결된다(Huston, J. S. et al., Proc. Natl. Acad. Sci. U.S.A. (1988) 85, 5879-5883). scFv에 있어서의 H사슬 V영역 및 L사슬 V영역은, 상기 항체로서 기재된 것 중 어느 유래여도 된다. V영역을 연결하는 펩티드 링커로서는, 예를 들면 아미노산 12-19 잔기로 되는 임의의 단일 사슬 펩티드가 사용된다.
 〈항체 정상영역〉
 본 발명은 또한, 이하 (i)~(xxi) 중 어느 하나에 기재된 아미노산이 치환되어 개량된 항체 정상영역을 제공한다. 정상영역이란 IgG1, IgG2, IgG4 타입의 정상영역을 의미한다. 인간 IgG1 정상영역, 인간 IgG2 정상영역 및 인간 IgG4 정상영역의 아미노산 서열은 공지이다(인간 IgG1 정상영역: 서열번호:19, 인간 IgG2 정상영역: 서열번호:20, 인간 IgG4 정상영역: 서열번호:21). 또한, 인간 IgG4 정상영역은, 힌지부분의 안정성을 개선하기 위한 개변(Mol Immunol. 1993 Jan;30(1):105-8.)을 도입한 서열이다. 또한 본 발명은, 그 아미노산이 치환된 항체 정상영역을 포함하는 항체를 제공한다. 항체 정상영역은 바람직하게는 인간 항체 정상영역이다.
 또한 본 발명의 아미노산이 치환된 항체 정상영역은, 하기 (i)~(xxi) 중 어느 하나에 기재된 아미노산 치환을 포함하는 것인 한, 다른 아미노산 치환이나 수식을 포함해도 된다. 따라서, 본 발명에 있어서는, 서열번호:20에 기재된 아미노산 서열로부터 이미 1 또는 복수의 아미노산이 치환 및/또는 수식된 IgG2 정상영역에 대해 본 발명의 아미노산 치환을 행하는 경우, 또는 본 발명의 아미노산 치환을 행한 후에 1 또는 복수의 아미노산을 치환 및/또는 수식하는 경우도, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 본 발명의 아미노산 치환이 행해진 IgG2 정상영역에 해당한다. 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역, 서열번호:21에 기재된 IgG4 정상영역에 대해서도 동일하다.
 또한, EU 넘버링(Sequences of proteins of immunological interest, NIH Publication No.91-3242를 참조)의 297번째의 당사슬은 어떠한 당사슬 구조여도 되고, 또한 당사슬이 결합하고 있지 않아도 된다(예를 들면 대장균 등, 당사슬이 부가되지 않는 숙주세포에서 생산된 정상영역 등).
 (i) IgG2 정상영역의 산성에서의 안정성 개선
 본 발명의 아미노산이 치환된 IgG2 정상영역의 일태양으로서는, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 276번째(EU 넘버링 397번째)의 Met가 다른 아미노산으로 치환된 IgG2 정상영역을 들 수 있다. 치환 후의 아미노산은 특별히 한정되지 않으나, Val로의 치환인 것이 바람직하다. 서열번호:20에 기재된 아미노산 서열에 있어서 276번째(EU 넘버링 397번째)의 Met를 다른 아미노산으로 치환함으로써, 항체의 산성조건하에서의 안정성을 향상시키는 것이 가능하다.
 (ii) IgG2 정상영역의 이질성의 개선
 또한 본 발명의 아미노산이 치환된 IgG2 정상영역의 일태양으로서는, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg 및 102번째(EU 넘버링 219번째)의 Cys가 다른 아미노산으로 치환된 IgG2 정상영역을 들 수 있다. 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째(EU 넘버링 131번째)의 Cys는 Ser로 치환되는 것이 바람직하고, 16번째(EU 넘버링 133번째)의 Arg는 Lys로 치환되는 것이 바람직하며, 102번째(EU 넘버링 219번째)의 Cys는 Ser로 치환되는 것이 바람직하다(IgG2-SKSC).
 이들의 치환을 행함으로써, IgG2의 힌지영역에 유래하는 이질성을 저감시키는 것이 가능하다. 본 발명의 아미노산이 치환된 IgG2 정상영역에는, 상기 3종류의 아미노산 치환 중 1종류 이상의 아미노산이 치환된 IgG2 정상영역이 포함되나, 14번째의 Cys와 102번째의 Cys가 아미노산으로 치환되어 있는 것, 또는 상기 3종류 모든 아미노산이 치환되어 있는 것이 바람직하다.
 (iii) IgG 정상영역의 FcγR로의 결합 저감
 또한 본 발명의 아미노산이 치환된 IgG2 정상영역의 일태양으로서, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 209번째(EU 330)의 Ala가 Ser로, 210번째(EU 331)의 Pro가 Ser로, 및/또는 218번째(EU 339)의 Thr이 Ala로 치환된 IgG2 정상영역을 제공한다. 209번째(EU 330)의 Ala, 210번째(EU 331)의 Pro의 치환에 의해 Fcγ 수용체로의 결합을 저하시키는 것이 가능한 것은 이미 보고되어 있으나(Eur J Immunol. 1999 Aug;29(8):2613-24.), 이 개변에서는 T-cell 에피토프가 될 수 있는 비인간 유래의 펩티드가 출현하기 때문에, 면역원성 리스크의 측면에서는 바람직하지 않다. 이에, 218번째(EU 339)의 Thr의 Ala로의 치환을 동시에 행함으로써, T-cell 에피토프가 될 수 있는 9~12 아미노산으로서는 인간 유래의 펩티드만을 사용한 상태로 IgG2의 Fcγ 수용체로의 결합을 저하시키는 것이 가능하다.
 본 발명의 아미노산이 치환된 IgG2 정상영역은, 전술한 3개소의 아미노산 치환 중 1개소 이상의 아미노산이 치환되어 있으면 되나, 바람직하게는 전술한 3개소 모든 아미노산이 치환되어 있는 것이 바람직하다. 따라서, 본 발명의 아미노산이 치환된 IgG2 정상영역의 바람직한 태양으로서, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 209번째(EU 330)의 Ala가 Ser로 치환되고, 210번째(EU 331)의 Pro가 Ser로 치환되며, 또한 218번째(EU 339)의 Thr이 Ala로 치환된 IgG2 정상영역을 들 수 있다.
 (iv) IgG2 정상영역의 C 말단 이질성의 개선
 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 IgG2 정상영역을 제공한다. 이들의 아미노산을 양쪽 결손시킴으로써, 비로소 항체의 H사슬 C말단에 유래하는 이질성을 저감하는 것이 가능하다.
 (v) IgG2 정상영역의 개변에 의한 혈장 중 체류성의 향상
 또한 본 발명의 아미노산이 치환된 IgG2 정상영역의 일태양으로서, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg, 298번째(EU 넘버링 419번째)의 Gln을 다른 아미노산으로 치환한 IgG2 정상영역을 들 수 있다. 이들 아미노산 치환에 의해 항체의 혈장 중 체류성을 향상시키는 것이 가능하다. 치환 후의 아미노산은 특별히 한정되지 않으나, 147번째(EU 넘버링 268번째)의 His는 Gln으로 치환되는 것이 바람직하고, 234번째(EU 넘버링 355번째)의 Arg는 Gln으로 치환되는 것이 바람직하며, 298번째(EU 넘버링 419번째)의 Gln은 Glu로 치환되는 것이 바람직하다. 본 발명의 아미노산이 치환된 IgG2 정상영역에는, 상기 3종류의 아미노산 치환 중 1종류 이상의 아미노산이 치환된 IgG2 정상영역이 포함되나, 상기 3종류 모든 아미노산이 치환되어 있는 것이 바람직하다.
 (vi) IgG4 정상영역의 산성에서의 안정성 개선
 본 발명은, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역에 있어서, 289번째(EU 넘버링 409번째)의 Arg가 다른 아미노산으로 치환된 IgG4 정상영역을 제공한다. 치환 후의 아미노산은 특별히 한정되지 않으나, Lys로의 치환인 것이 바람직하다. 서열번호:21에 기재된 아미노산 서열에 있어서 289번째(EU 넘버링 409번째)의 Arg를 다른 아미노산으로 치환함으로써, 항체의 산성조건하에서의 안정성을 향상시키는 것이 가능하다.
 (vii) IgG4 정상영역의 C말단 이질성의 개선
 본 발명은, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역에 있어서, 326번째(EU 넘버링 446번째)의 Gly 및 327번째(EU 넘버링 447번째)의 Lys가 결손된 IgG4 정상영역을 제공한다. 이들의 아미노산을 양쪽 결손시킴으로써, 비로소 항체의 H사슬 C말단에 유래하는 이질성을 저감하는 것이 가능하다.
 (viii) IgG1 정상영역의 C말단 이질성의 개선
 본 발명은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 329번째(EU 넘버링 446번째)의 Gly 및 330번째(EU 넘버링 447번째)의 Lys가 결손된 IgG1 정상영역을 제공한다. 이들 아미노산을 양쪽 결손시킴으로써, 비로소 항체의 H사슬 C말단에 유래하는 이질성을 저감하는 것이 가능하다.
 (ix)
 본 발명은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 317번째(EU 넘버링 434번째)의 Asn이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG1 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, Ala로의 치환이 바람직하다.
 (x)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 209번째(EU 넘버링 330번째)의 Ala, 210번째(EU 넘버링 331번째)의 Pro, 218번째(EU 넘버링 339번째)의 Thr, 276번째(EU 넘버링 397번째)의 Met, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu 및 21번째(EU 넘버링 138번째)의 Ser이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 209번째의 Ala는 Ser로, 210번째의 Pro는 Ser로, 218번째의 Thr은 Ala로, 276번째의 Met는 Val로, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로 치환하는 것이 바람직하다.
 (xi)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 209번째(EU 넘버링 330번째)의 Ala, 210번째(EU 넘버링 331번째)의 Pro, 218번째(EU 넘버링 339번째)의 Thr, 276번째(EU 넘버링 397번째)의 Met, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu 및 21번째(EU 넘버링 138번째)의 Ser이 다른 아미노산으로 치환되고, 또한 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 209번째의 Ala는 Ser로, 210번째의 Pro는 Ser로, 218번째의 Thr은 Ala로, 276번째의 Met는 Val로, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로 치환하는 것이 바람직하다.
 (xii)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 276번째(EU 넘버링 397번째)의 Met, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu 및 21번째(EU 넘버링 138번째)의 Ser이 다른 아미노산으로 치환된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 276번째의 Met는 Val로, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로 치환하는 것이 바람직하다.
 (xiii)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 276번째(EU 넘버링 397번째)의 Met, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu 및 21번째(EU 넘버링 138번째)의 Ser이 다른 아미노산으로 치환되고, 또한 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 276번째의 Met는 Val로, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로 치환하는 것이 바람직하다.
 (xiv)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu, 21번째(EU 넘버링 138번째)의 Ser, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg 및 298번째(EU 넘버링 419번째)의 Gln이 다른 아미노산으로 치환되고, 또한, 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로, 147번째의 His는 Gln으로, 234번째의 Arg는 Gln으로, 298번째의 Gln은 Glu로 치환하는 것이 바람직하다.
 (xv)
 본 발명은, 서열번호:20에 기재된 아미노산 서열에 있어서, 14번째(EU 넘버링 131번째)의 Cys, 16번째(EU 넘버링 133번째)의 Arg, 102번째(EU 넘버링 219번째)의 Cys, 20번째(EU 넘버링 137번째)의 Glu, 21번째(EU 넘버링 138번째)의 Ser, 147번째(EU 넘버링 268번째)의 His, 234번째(EU 넘버링 355번째)의 Arg, 298번째(EU 넘버링 419번째)의 Gln 및 313번째(EU 넘버링 434번째)의 Asn이 다른 아미노산으로 치환되고, 또한 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG2 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로, 20번째의 Glu는 Gly로, 21번째의 Ser은 Gly로, 147번째의 His는 Gln으로, 234번째의 Arg는 Gln으로, 298번째의 Gln은 Glu로, 313번째의 Asn은 Ala로 치환되는 것이 바람직하다.
 (xvi)
 본 발명은, 서열번호:21에 기재된 아미노산 서열에 있어서, 289번째(EU 넘버링 409번째)의 Arg, 14번째의 Cys, 16번째의 Arg, 20번째의 Glu, 21번째의 Ser, 97번째의 Arg, 100번째의 Ser, 102번째의 Tyr, 103번째의 Gly, 104번째의 Pro 및 105번째의 Pro(EU 넘버링 131, 133, 137, 138, 214, 217, 219, 220, 221, 222번째), 113번째의 Glu, 114번째의 Phe 및 115번째(EU 넘버링 233, 234, 235번째)의 Leu가 다른 아미노산으로 치환되고, 또한 116번째(EU 넘버링 236번째)의 Gly가 결손된 아미노산 서열을 갖는 IgG4 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째(EU 넘버링 131)의 Cys는 Ser로, 16번째(EU 넘버링 133)의 Arg는 Lys로, 20번째(EU 넘버링 137)의 Glu는 Gly로, 21번째(EU 넘버링 138)의 Ser은 Gly로, 97번째(EU 넘버링 214)의 Arg는 Thr로, 100번째(EU 넘버링 217)의 Ser은 Arg로, 102번째(EU 넘버링 219)의 Tyr은 Ser로, 103번째(EU 넘버링 220)의 Gly는 Cys로, 104번째(EU 넘버링 221)의 Pro는 Val로, 105번째(EU 넘버링 222)의 Pro는 Glu로, 113번째(EU 넘버링 233)의 Glu는 Pro로, 114번째(EU 넘버링 234)의 Phe는 Val로, 115번째(EU 넘버링 235)의 Leu는 Ala로, 289번째(EU 넘버링 409)의 Arg는 Lys로의 치환이 바람직하다.
 (xvii)
 본 발명은, 서열번호:21에 기재된 아미노산 서열에 있어서, 289번째(EU 넘버링 409번째)의 Arg, 14번째의 Cys, 16번째의 Arg, 20번째의 Glu, 21번째의 Ser, 97번째의 Arg, 100번째의 Ser, 102번째의 Tyr, 103번째의 Gly, 104번째의 Pro 및 105번째의 Pro(EU 넘버링 131, 133, 137, 138, 214, 217, 219, 220, 221, 222번째), 113번째의 Glu, 114번째의 Phe 및 115번째의 Leu(EU 넘버링 233, 234, 235번째)가 다른 아미노산으로 치환되고, 또한 116번째(EU 넘버링 236번째)의 Gly, 326번째(EU 넘버링 446번째)의 Gly 및 327번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG4 정상영역을 제공한다.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째(EU 넘버링 131)의 Cys는 Ser로, 16번째(EU 넘버링 133)의 Arg는 Lys로, 20번째(EU 넘버링 137)의 Glu는 Gly로, 21번째(EU 넘버링 138)의 Ser은 Gly로, 97번째(EU 넘버링 214)의 Arg는 Thr로, 100번째(EU 넘버링 217)의 Ser은 Arg로, 102번째(EU 넘버링 219)의 Tyr은 Ser로, 103번째(EU 넘버링 220)의 Gly는 Cys로, 104번째(EU 넘버링 221)의 Pro는 Val로, 105번째(EU 넘버링 222)의 Pro는 Glu로, 113번째(EU 넘버링 233)의 Glu는 Pro로, 114번째(EU 넘버링 234)의 Phe는 Val로, 115번째(EU 넘버링 235)의 Leu는 Ala로, 289번째(EU 넘버링 409)의 Arg는 Lys로의 치환이 바람직하다.
 (xviii)
 본 발명은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 317번째(EU 넘버링 434번째)의 Asn이 다른 아미노산으로 치환되고, 또한 329번째(EU 넘버링 446번째)의 Gly 및 330번째(EU 넘버링 447번째)의 Lys가 결손된 아미노산 서열을 갖는 IgG1 정상영역을 제공한다.
 317번째(EU 넘버링 434번째)의 Asn의 치환 후의 아미노산은 특별히 한정되지 않으나, Ala로의 치환이 바람직하다.
 (xix)
 추가적으로 본 발명은 힌지영역의 이질성이 개선되고 및/또는 Fcγ 수용체로의 결합활성이 저감한 IgG2의 바람직한 태양으로서 이하의 IgG2를 들 수 있다.
 서열번호:20에 기재된 아미노산 서열로 되는 정상영역을 갖는 IgG2에 있어서, 209번째의 Ala, 210번째의 Pro, 218번째의 Thr, 14번째의 Cys, 16번째의 Arg, 102번째의 Cys, 20번째의 Glu, 21번째의 Ser이 다른 아미노산으로 치환된 항체.
 치환 후의 아미노산은 특별히 한정되지 않으나, 209번째(EU 넘버링 330)의 Ala를 Ser, 210번째(EU 넘버링 331)의 Pro를 Ser, 218번째(EU 넘버링 339)의 Thr을 Ala, 14번째(EU 넘버링 131)의 Cys를 Ser, 16번째(EU 넘버링 133)의 Arg를 Lys, 102번째(EU 넘버링 219)의 Cys를 Ser, 20번째(EU 넘버링 137)의 Glu를 Gly, 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 것이 바람직하다.
 이와 같은 IgG2 정상영역의 예로서, 서열번호:191(M86)의 아미노산 서열을 갖는 IgG2 정상영역을 들 수 있다.
 또한, 본 발명의 IgG2 정상영역의 다른 바람직한 태양으로서, 전술한 IgG2 정상영역에 있어서, C말단의 이질성을 저감시키기 위해 추가적으로 325번째의 Gly 및 326번째의 Lys가 결손된 IgG2 정상영역을 들 수 있다. 이와 같은 항체의 예로서, 서열번호:192(M86△GK)의 아미노산 서열로 되는 정상영역을 갖는 IgG2를 들 수 있다.
 (xx)
 또한 본 발명은 힌지영역의 이질성이 개선된 IgG2 정상영역의 바람직한 태양으로서 이하의 IgG2 정상영역을 들 수 있다.
 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 14번째의 Cys, 16번째의 Arg, 102번째의 Cys, 20번째의 Glu, 21번째의 Ser이 다른 아미노산으로 치환된 IgG2 정상영역.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째(EU 넘버링 131)의 Cys를 Ser, 16번째(EU 넘버링 133)의 Arg를 Lys, 102번째(EU 넘버링 219)의 Cys를 Ser, 20번째(EU 넘버링 137)의 Glu를 Gly, 21번째의 (EU 넘버링 138)의 Ser을 Gly로 치환하는 것이 바람직하다.
 이와 같은 IgG2 정상영역의 예로서, 서열번호:193(M40)의 아미노산 서열을 갖는 IgG2 정상영역을 들 수 있다.
 또한, 본 발명의 IgG2 정상영역의 다른 바람직한 태양으로서, 전술한 IgG2 정상영역에 있어서, 추가적으로 325번째의 Gly 및 326번째의 Lys가 결손된 IgG2 정상영역을 들 수 있다. 이와 같은 항체의 예로서, 서열번호:194(M40△GK)의 아미노산 서열을 갖는 IgG2 정상영역을 들 수 있다.
 (xxi) M14△GK, M17△GK, M11△GK, M31△GK, M58, M73, M83, M86△GK, M40△GK
 본 발명은 또한, 서열번호:24에 기재된 아미노산 서열을 갖는 항체 정상영역(M14△GK)을 제공한다. 또한 본 발명은 서열번호:116에 기재된 아미노산 서열을 갖는 항체 정상영역(M17△GK)을 제공한다. 또한 본 발명은 서열번호:25에 기재된 아미노산 서열을 갖는 항체 정상영역(M11△GK)을 제공한다. 또한 본 발명은 서열번호:118에 기재된 아미노산 서열을 갖는 정상영역(M31△GK)을 제공한다. 또한 본 발명은 서열번호:151에 기재된 아미노산 서열을 갖는 정상영역(M58)을 제공한다. 또한 본 발명은 서열번호:153에 기재된 아미노산 서열을 갖는 정상영역을 제공한다(M73). 또한 본 발명은 서열번호:164에 기재된 아미노산 서열을 갖는 정상영역을 제공한다(M83). 또한 본 발명은 서열번호:192에 기재된 아미노산 서열을 갖는 정상영역을 제공한다(M86△GK). 또한 본 발명은 서열번호:194에 기재된 아미노산 서열을 갖는 정상영역을 제공한다(M40△GK). 이들의 항체 정상영역은, Fcγ 수용체로의 결합활성의 저하, 면역원성 리스크의 저감, 산성조건하에서의 안정성의 향상, 이질성의 저감, 혈장 중 체류성의 향상 및/또는, IgG1 정상영역과 비교한 제제 중에서의 높은 안정성이라는 성질을 갖는, 최적화된 항체 정상영역이다.
 본 발명은 상기 (i)~(xxi) 중 어느 하나에 기재된 항체 정상영역을 포함하는 항체를 제공한다. 전술한 항체 정상영역을 갖는 한, 항원의 종류, 항체의 유래 등은 한정되지 않고, 어떠한 항체여도 된다. 바람직한 항체의 예로서는, IL-6 수용체에 결합하는 항체를 들 수 있다. 또한, 다른 바람직한 항체의 예로서 인간화 항체를 들 수 있다. 이와 같은 항체의 예로서, 인간화 PM1 항체의 가변영역을 갖는 항체를 들 수 있다. 인간화 PM1 항체의 가변영역은 전술한 아미노산 치환이 행해져 있어도 되고, 기타 아미노산의 치환, 결실, 부가 및/또는 삽입이 행해져 있어도 된다. 구체적인 치환예로서는, 전술한 (a)~(y)의 친화성을 향상시키는 개변, (i)~(viii)의 등전점을 저하시키는 개변, 후술하는 (α)~(ζ)의 안정성을 향상시키는 개변, 면역원성을 저하시키는 개변을 들 수 있으나, 이들에 한정되지 않는다.
 이와 같은 항체의 일태양으로서는, 서열번호:113에 기재(PF_1+M14△GK)의 아미노산 서열을 갖는 중쇄 가변영역 및 서열번호:23에 기재(PF1_L)의 아미노산 서열을 갖는 경쇄 가변영역을 갖는 항체(PF1)를 들 수 있으나(경쇄 정상영역은 kappa여도 되고 lamda여도 되며 그들의 개변체여도 된다), 이들에 한정되지 않는다.
 또한, 전술한 항체 정상영역 및/또는 전술한 항체 정상영역을 포함하는 항체분자는, 항체 유사 결합분자(scaffold 분자), 생리활성 펩티드, 결합 펩티드 등을 Fc 융합분자로서 결합시키는 것도 가능하다.
 본 발명의 항체는, 실시예에 기재된 방법에 더하여, 예를 들면 이하와 같이 하여 취득하는 것도 가능하다. 본 발명의 항체를 취득하는 일태양에 있어서는, 먼저, 당업자에게 공지의 항IL-6 수용체 항체의 CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역에 있어서, 1 또는 복수의 아미노산 잔기를, 목적의 다른 아미노산으로 치환한다. 당업자에게 공지의 항IL-6 수용체 항체의 취득방법에 제한은 없다. CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 1개 이상의 영역에 있어서, 1 또는 복수의 아미노산 잔기를 목적의 다른 아미노산으로 치환하는 방법으로서는, 예를 들면, 부위 특이적 변이 유발법(Hashimoto-Gotoh, T, Mizuno, T, Ogasahara, Y, and Nakagawa, M. (1995) An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis. Gene 152, 271-275, Zoller, MJ, and Smith, M.(1983) Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors. Methods Enzymol. 100, 468-500, Kramer,W, Drutsa,V, Jansen,HW, Kramer,B, Pflugfelder,M, and Fritz,HJ(1984) The gapped duplex DNA approach to oligonucleotide-directed mutation construction. Nucleic Acids Res. 12, 9441-9456, Kramer W, and Fritz HJ(1987) Oligonucleotide-directed construction of mutations via gapped duplex DNA Methods. Enzymol. 154, 350-367, Kunkel,TA(1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci U S A. 82, 488-492)을 들 수 있다. 그 방법을 사용하여, 항체의 목적하는 아미노산을 목적의 다른 아미노산으로 치환할 수 있다. 다른 아미노산으로 치환하는 방법으로서는, 프레임워크 셔플링(Mol Immunol. 2007 Apr;44(11):3049-60) 및 CDR repair(US2006/0122377) 등의 라이브러리 기술을 사용함으로써, 적절한 프레임워크 및 CDR에 아미노산 치환할 수 있다.
 항체를 취득하기 위한 다른 태양으로서는, 먼저, 당업자에게 주지의 방법에 의해, IL-6 수용체에 결합하는 항체를 얻는다. 취득된 항체가 비인간 동물 항체이면, 인간화하는 것도 가능하다. 이어서, 취득된 항체가 중화활성을 갖는지 여부를 당업자에게 주지의 방법에 의해 판정한다. 항체의 결합활성 또는 중화활성은, 예를 들면 실시예에 기재된 방법으로 측정할 수 있으나, 이 방법에 한정되지 않는다. 이어서, 항체의 CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기를, 목적의 다른 아미노산으로 치환한다.
 보다 구체적으로는, 본 발명은, 이하의 (a) 및 (b)의 공정을 포함하는, 중화활성이 증강된, 결합활성이 증강된, 안정성이 향상된, 또는 면역원성이 저하된 항체의 제조방법에 관한 것이다.
 (a) CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 H사슬을 코드하는 DNA, 및 CDR영역 및 FR영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 L사슬을 코드하는 DNA를 발현시키는 공정
 (b) 공정(a)의 발현산물을 회수하는 공정
 본 발명의 제조방법에 있어서는, 먼저, 항IL-6 수용체 항체의 변이체의 H사슬을 코드하는 DNA로서, CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 H사슬을 코드하는 DNA, 및 항IL-6 수용체 항체의 L사슬을 코드하는 DNA로서, CDR영역 및 FR영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 L사슬을 코드하는 DNA를 발현시킨다. CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 H사슬을 코드하는 DNA는, 예를 들면, 야생형의 H사슬을 코드하는 DNA의 CDR영역, FR영역 또는 정상영역부분을 취득하고, 그 CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 특정 아미노산을 코드하는 코돈이 목적의 다른 아미노산을 코드하도록, 적절히 치환을 도입함으로써 얻을 수 있다. 또한, CDR영역 및 FR영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 L사슬을 코드하는 DNA는, 예를 들면, 야생형의 L사슬을 코드하는 DNA의 CDR영역 및/또는 FR영역을 취득하고, 그 CDR영역, FR영역 중의 특정 아미노산을 코드하는 코돈이 목적의 다른 아미노산을 코드하도록, 적절히 치환을 도입함으로써 얻을 수 있다.
 또한, 사전에, 야생형 H사슬의 CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 단백질을 코드하는 DNA를 설계하고, 그 DNA를 화학적으로 합성함으로써, CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 H사슬을 코드하는 DNA를 얻는 것도 가능하다. 또한 L사슬에 대해서도, 야생형 L사슬의 CDR영역 및/또는 FR영역의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 단백질을 코드하는 DNA를 설계하고, 그 DNA를 화학적으로 합성함으로써, CDR영역 및/또는 FR영역의 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 L사슬을 코드하는 DNA를 얻는 것도 가능하다.
 아미노산 치환의 종류로서는, 이것에 한정되는 것은 아니나, 본 명세서에 기재된 치환을 들 수 있다.
 또한, CDR영역, FR영역 및 정상영역으로 이루어진 군으로부터 선택되는 하나 이상의 영역 중에 있어서, 1 또는 복수의 아미노산 잔기가 목적의 다른 아미노산으로 치환된 H사슬을 코드하는 DNA는, 부분 DNA로 나누어 제조할 수 있다. 부분 DNA의 조합으로서는, 예를 들면, 가변영역을 코드하는 DNA와 정상영역을 코드하는 DNA, 또는 Fab영역을 코드하는 DNA와 Fc영역을 코드하는 DNA 등을 들 수 있으나, 이들 조합에 한정되지 않는다. L사슬을 코드하는 DNA도 또한, 마찬가지로 부분 DNA로 나누어 제조할 수 있다.
 상기 DNA를 발현시키는 방법으로서는, 이하의 방법을 들 수 있다. 예를 들면, H사슬 가변영역을 코드하는 DNA를, H사슬 정상영역을 코드하는 DNA와 함께 발현벡터에 삽입하여 H사슬 발현벡터를 구축한다. 마찬가지로, L사슬 가변영역을 코드하는 DNA를, L사슬 정상영역을 코드하는 DNA와 함께 발현벡터에 삽입하여 L사슬 발현벡터를 구축한다. 이들의 H사슬, L사슬의 유전자를 단일 벡터에 삽입하는 것도 가능하다. 발현벡터로서는 예를 들면 SV40 virus based 벡터, EB virus based 벡터, BPV(파필로마바이러스) based 벡터 등을 사용할 수 있으나, 이들에 한정되지 않는다.
 이상의 방법으로 제작된 항체 발현벡터에 의해 숙주세포를 공형질전환한다. 숙주세포로서는 CHO세포(차이니즈 햄스터 난소) 등 전술한 세포 외에도 대장균, 효모나 고초균 등의 미생물이나 동식물의 개체가 사용된다(Nature Biotechnology 25, 563-565 (2007), Nature Biotechnology 16, 773-777 (1998), Biochemical and Biophysical Research Communications 255, 444-450 (1999), Nature Biotechnology 23, 1159-1169 (2005), Journal of Virology 75, 2803-2809 (2001), Biochemical and Biophysical Research Communications 308, 94-100 (2003)). 또한, 형질전환에는 리포펙틴법((R.W.Malone et al., Proc. Natl. Acad. Sci. USA 86, 6077(1989), P.L.Felgner et al., Proc. Natl. Acad. Sci. USA 84, 7413(1987), 전기천공법, 인산칼슘법(F.L.Graham & A.J.van der Eb, Virology 52, 456-467(1973)), DEAE-Dextran법 등이 바람직하게 사용된다.
 항체의 제조에 있어서는, 다음으로, 공정(a)에서 얻어진 발현산물을 회수한다. 발현산물의 회수는, 예를 들면, 형질전환체를 배양한 후, 형질전환체의 세포 내 또는 배양액으로부터 분리함으로써 행할 수 있다. 항체의 분리, 정제에는, 원심분리, 유안분획, 염석, 한외여과, 1q, FcRn, 프로테인 A, 프로테인 G 칼럼, 친화성 크로마토그래피, 이온 교환 크로마토그래피, 겔 여과 크로마토그래피 등의 방법을 적절히 조합시켜서 행할 수 있다.
 또한, 본 발명의 정상영역은, 당업자라면 항체의 취득방법에 준하여 적절히 행할 수 있다.
 또한 본 발명은, 이하의 (A)~(X)로 이루어진 군으로부터 선택되는 하나 이상의 공정을 포함하는, 항IL-6 수용체 항체의 IL-6 수용체로의 결합활성 또는 중화활성을 증강하는 방법에 관한 것이다.
 (A) 서열번호:1에 기재된 아미노산 서열(HCDR1)에 있어서 1번째의 Ser을 다른 아미노산으로 치환하는 공정
 (B) 서열번호:1에 기재된 아미노산 서열(HCDR1)에 있어서 5번째의 Trp를 다른 아미노산으로 치환하는 공정
 (C) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 1번째의 Tyr을 다른 아미노산으로 치환하는 공정
 (D) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 8번째의 Thr을 다른 아미노산으로 치환하는 공정
 (E) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 9번째의 Thr을 다른 아미노산으로 치환하는 공정
 (F) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser을 다른 아미노산으로 치환하는 공정
 (G) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 2번째의 Leu를 다른 아미노산으로 치환하는 공정
 (H) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 5번째의 Thr을 다른 아미노산으로 치환하는 공정
 (I) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 7번째의 Ala를 다른 아미노산으로 치환하는 공정
 (J) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 8번째의 Met를 다른 아미노산으로 치환하는 공정
 (K) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser 및 5번째의 Thr을 다른 아미노산으로 치환하는 공정
 (L) 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 2번째의 Leu, 7번째의 Ala 및 8번째의 Met를 다른 아미노산으로 치환하는 공정
 (M) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 1번째의 Arg를 다른 아미노산으로 치환하는 공정
 (N) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 4번째의 Gln을 다른 아미노산으로 치환하는 공정
 (O) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 9번째의 Tyr을 다른 아미노산으로 치환하는 공정
 (P) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 11번째의 Asn을 다른 아미노산으로 치환하는 공정
 (Q) 서열번호:5에 기재된 아미노산 서열(LCDR2)에 있어서 2번째의 Thr을 다른 아미노산으로 치환하는 공정
 (R) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 1번째의 Gln을 다른 아미노산으로 치환하는 공정
 (S) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 3번째의 Gly를 다른 아미노산으로 치환하는 공정
 (T) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 9번째의 Tyr을 다른 아미노산으로 치환하는 공정 및 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 3번째의 Gly를 다른 아미노산으로 치환하는 공정
 (U) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 5번째의 Thr을 다른 아미노산으로 치환하는 공정
 (V) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 1번째의 Gln 및 5번째의 Thr을 다른 아미노산으로 치환하는 공정
 (W) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 9번째의 Thr을 다른 아미노산으로 치환하는 공정 및 서열번호:3에 기재된 아미노산 서열(HCDR3)에 있어서 1번째의 Ser 및 5번째의 Thr을 다른 아미노산으로 치환하는 공정
 (X) (V) 및 (W)에 기재된 공정.
 상기 (A)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Trp, Thr, 또는 Asp, Asn, Arg, Val, Phe, Ala, Gln, Tyr, Leu, His, Glu 또는 Cys로의 치환이 바람직하다.
 상기 (B)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ile 또는 Val로의 치환이 바람직하다.
 상기 (C)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Phe로의 치환이 바람직하다.
 상기 (D)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Arg로의 치환이 바람직하다.
 상기 (E)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ser 또는 Asn으로의 치환이 바람직하다.
 상기 (F)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ile, Val, Thr 또는 Leu로의 치환이 바람직하다.
 상기 (G)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Thr로의 치환이 바람직하다.
 상기 (H)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ala, Ile 또는 Ser로의 치환이 바람직하다. 다른 바람직한 치환으로서는 5번째의 Thr의 Ser로의 치환을 들 수 있다.
 상기 (I)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ser 또는 Val로의 치환이 바람직하다.
 상기 (J)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Leu로의 치환이 바람직하다.
 상기 (K)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, 1번째의 Ser을 Leu로, 5번째의 Thr을 Ala로 치환하는 것이 바람직하다. 또한, 다른 바람직한 치환으로서, 1번째의 Ser의 Val로의 치환 및 5번째의 Thr의 Ala로의 치환, 1번째의 Ser의 Ile로의 치환 및 5번째의 Thr의 Ala로의 치환, 1번째의 Ser의 Thr로의 치환 및 5번째의 Thr의 Ala로의 치환, 1번째의 Ser의 Val로의 치환 및 5번째의 Thr의 Ile로의 치환, 1번째의 Ser의 Ile로의 치환 및 5번째의 Thr의 Ile로의 치환, 1번째의 Ser의 Thr로의 치환 및 5번째의 Thr의 Ile로의 치환, 또는 1번째의 Ser의 Leu로의 치환 및 5번째의 Thr의 Ile로의 치환을 들 수 있다.
 상기 (L)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, 2번째의 Leu를 Thr로, 7번째의 Ala를 Val로, 8번째의 Met를 Leu로 치환하는 것이 바람직하다.
 상기 (M)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Phe로의 치환이 바람직하다.
 상기 (N)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Arg 또는 Thr로의 치환이 바람직하다.
 상기 (O)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Phe로의 치환이 바람직하다.
 상기 (P)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 상기 (Q)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Gly로의 치환이 바람직하다.
 상기 (R)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Gly, Asn 또는 Ser로의 치환이 바람직하다.
 상기 (S)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 상기 (T)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, 서열번호:4에 기재된 아미노산 서열(LCDR1)의 Tyr은 Phe로 치환되는 것이 바람직하고, 서열번호:6에 기재된 아미노산 서열(LCDR3)의 Gly는 Ser로 치환되는 것이 바람직하다.
 상기 (U)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, Arg 또는 Ser로의 치환이 바람직하다.
 상기 (V)에 있어서, 치환 후의 아미노산은 친화성이 향상되는 한 특별히 한정되지 않으나, 1번째의 Gln을 Gly로, 5번째의 Thr을 Ser로 치환하는 것이 바람직하다. 또한, 다른 바람직한 치환으로서 1번째의 Gln의 Gly로의 치환 및 5번째의 Thr의 Arg로의 치환을 들 수 있다.
 상기 (W)에 있어서, 서열번호:2에 기재된 아미노산 서열(HCDR2)의 9번째의 Thr은 Asn으로 치환되어 있는 것이 바람직하다. 또한, 서열번호:3에 기재된 아미노산 서열(HCDR3)의 1번째의 Ser 및 5번째의 Thr의 치환 후의 아미노산의 바람직한 조합으로서, Leu 및 Ala, Val 및 Ala, Ile 및 Ala, Thr 및 Ala, Val 및 Ile, Ile 및 Ile, Thr 및 Ile, 또는 Leu 및 Ile를 들 수 있다.
 전술한 (A)~(X)의 공정에 있어서, 아미노산의 치환을 행하는 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다. 아미노산 치환이 중쇄 가변영역에 대해 행해지는 경우에는 치환 전의 기초가 되는 중쇄 가변영역의 아미노산 서열은 인간화 PM-1의 중쇄 가변영역의 아미노산 서열인 것이 바람직하고, 아미노산 치환이 경쇄 가변영역에 대해 행해지는 경우에는 치환 전의 기초가 되는 경쇄 가변영역의 아미노산 서열은 인간화 PM-1 경쇄 가변영역의 아미노산 서열인 것이 바람직하다. 또한, 전술한 (A)~(X)의 공정에 기재된 아미노산 치환은 인간화 PM-1 항체에 대해 행해지는 것이 바람직하다.
 본 발명의 항IL-6 수용체 항체의 결합활성 또는 중화활성을 증강하는 방법은, 적어도, 전술한 (A)~(X) 중 어느 하나에 기재된 공정을 포함하는 것이면 된다. 즉 본 발명의 방법은, 전술한 (A)~(X) 중 어느 하나에 기재된 공정 중, 2 이상의 공정을 포함해도 된다. 또한, 전술한 (A)~(X) 중 어느 하나에 기재된 공정이 포함되는 한, 다른 공정(예를 들면, 전술한 (A)~(X) 이외의 아미노산의 치환, 결실, 부가 및/또는 삽입 등)이 포함되어 있어도 된다. 또한 예를 들면, FR의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등이 행해져 있어도 되고, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등이 행해져 있어도 된다. 전술한 아미노산 치환은 인간화 PM-1 항체에 대해 행해지는 것이 바람직하다.
 〈항IL-6 수용체 항체 면역원성 리스크를 저감시키는 방법〉
 또한 본 발명은, 서열번호:5에 기재된 아미노산 서열(LCDR2)에 있어서 2번째의 Thr을 Gly로 치환하는 공정을 포함하는, 항IL-6 수용체 항체의 면역원성을 저하시키는 방법에 관한 것이다. 본 발명의 항IL-6 수용체 항체의 면역원성을 저하시키는 방법은, 서열번호:5에 기재된 아미노산 서열(LCDR2)에 있어서 2번째의 Thr을 Gly로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예의 기재의 방법에 의해 행할 수 있다.
 전술한 아미노산 치환은 인간화 PM-1 항체, 또는 그의 개변(치환, 결실, 삽입)체에 대해 행해지는 것이 바람직하다.
 〈항IL-6 수용체 항체의 등전점을 저하시키는 방법〉
 또한 본 발명은, 이하의 (i)~(xv)로 이루어진 군으로부터 선택되는 하나 이상의 공정을 포함하는, 항IL-6 수용체 항체의 등전점을 저하시키는 방법에 관한 것이다.
 (i) 서열번호:7에 기재된 아미노산 서열(HFR1)에 있어서 16번째의 Gln을 다른 아미노산으로 치환하는 공정
 (ii) 서열번호:8에 기재된 아미노산 서열(HFR2)에 있어서 8번째의 Arg를 다른 아미노산으로 치환하는 공정
 (iii) 서열번호:9에 기재된 아미노산 서열(HFR3)에 있어서 16번째의 Arg를 다른 아미노산으로 치환하는 공정
 (iv) 서열번호:10에 기재된 아미노산 서열(HFR4)에 있어서 3번째의 Gln을 다른 아미노산으로 치환하는 공정
 (v) 서열번호:11에 기재된 아미노산 서열(LFR1)에 있어서 18번째의 Arg를 다른 아미노산으로 치환하는 공정
 (vi) 서열번호:12에 기재된 아미노산 서열(LFR2)에 있어서 11번째의 Lys를 다른 아미노산으로 치환하는 공정
 (vii) 서열번호:13에 기재된 아미노산 서열(LFR3)에 있어서 23번째의 Gln을 다른 아미노산으로 치환하는 공정
 (viii) 서열번호:14에 기재된 아미노산 서열(LFR4)에 있어서 10번째의 Lys를 다른 아미노산으로 치환하는 공정
 (ix) 서열번호:1에 기재된 아미노산 서열(HCDR1)에 있어서 1번째의 Ser을 다른 아미노산으로 치환하는 공정
 (x) 서열번호:4에 기재된 아미노산 서열(LCDR1)에 있어서 1번째의 Arg를 다른 아미노산으로 치환하는 공정
 (xi) 서열번호:5에 기재된 아미노산 서열(LCDR2)에 있어서 4번째의 Arg를 다른 아미노산으로 치환하는 공정
 (xii) 서열번호:7에 기재된 아미노산 서열(HFR1)에 있어서 13번째의 Arg를 다른 아미노산으로 치환하는 공정
 (xiii) 서열번호:2에 기재된 아미노산 서열(HFR1) 또는 서열번호:100에 기재된 아미노산 서열에 있어서 15번째의 Lys 및/또는 16번째의 Ser을 다른 아미노산으로 치환하는 공정
 (xiv) 서열번호:4에 기재된 아미노산 서열(LCDR1) 또는 서열번호:101에 기재된 아미노산 서열에 있어서 4번째의 Gln을 다른 아미노산으로 치환하는 공정
 (xv) 서열번호:5에 기재된 아미노산 서열(LCDR2) 또는 서열번호:103에 기재된 아미노산 서열에 있어서 6번째의 His를 다른 아미노산으로 치환하는 공정
 상기 (i)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (ii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (iii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Lys로의 치환이 바람직하다.
 상기 (iv)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (v)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 상기 (vi)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (vii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (viii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (ix)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Asp로의 치환이 바람직하다.
 상기 (x)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Gln으로의 치환이 바람직하다.
 상기 (xi)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (xii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Lys로의 치환이 바람직하다.
 상기 (xiii)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, 15번째의 Lys는 Gln으로, 16번째의 Ser은 Asp로의 치환이 바람직하다.
 상기 (xiv)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 상기 (xv)에 있어서, 치환 후의 아미노산은 등전점이 저하되는 한 특별히 한정되지 않으나, Glu로의 치환이 바람직하다.
 전술한 (i)~(xv)의 공정에 있어서, 아미노산의 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다. 아미노산 치환이 중쇄 가변영역에 대해 행해지는 경우에는 치환 전의 기초가 되는 중쇄 가변영역의 아미노산 서열은 인간화 PM-1의 중쇄 가변영역의 아미노산 서열인 것이 바람직하고, 아미노산 치환이 경쇄 가변영역에 대해 행해지는 경우에는 치환 전의 기초가 되는 경쇄 가변영역의 아미노산 서열은 인간화 PM-1의 경쇄 가변영역의 아미노산 서열인 것이 바람직하다. 또한, 전술한 (i)~(xv)의 공정에 기재된 아미노산 치환은 인간화 PM-1 항체에 대해 행해지는 것이 바람직하다.
 본 발명의 항IL-6 수용체 항체의 등전점을 저하하는 방법은, 적어도, 전술한 (i)~(xv) 중 어느 하나에 기재된 공정을 포함하는 것이면 된다. 즉 본 발명의 방법은, 전술한 (i)~(xv)에 기재된 공정 중, 2 이상의 공정을 포함해도 된다. 또한, 전술한 (i)~(xv) 중 어느 하나에 기재된 공정이 포함되는 한, 다른 공정(예를 들면, 전술한 (i)~(xv) 이외의 아미노산의 치환, 결실, 부가 및/또는 삽입 등)이 포함되어 있어도 된다. 또한 예를 들면, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입 등이 행해져 있어도 된다.
 〈항IL-6 수용체 항체 안정성을 향상시키는 방법〉
 또한 본 발명은, 이하의 (α)~(ζ)로 이루어진 군으로부터 선택되는 하나 이상의 공정을 포함하는, 항IL-6 수용체 항체의 안정성을 증가시키는 방법에 관한 것이다.
 (α) 서열번호:9에 기재된 아미노산 서열(HFR3)에 있어서 4번째의 Met를 다른 아미노산으로 치환하는 공정.
 (β) 서열번호:9에 기재된 아미노산 서열(HFR3)에 있어서 5번째의 Leu를 다른 아미노산으로 치환하는 공정.
 (γ) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 9번째의 Thr을 다른 아미노산으로 치환하는 공정.
 (δ) 서열번호:6에 기재된 아미노산 서열(LCDR3)에 있어서 5번째의 Thr을 다른 아미노산으로 치환하는 공정.
 (ε) 서열번호:2에 기재된 아미노산 서열(HCDR2)에 있어서 16번째의 Ser을 다른 아미노산으로 치환하는 공정.
 (ζ) 서열번호:10에 기재된 아미노산 서열(FR4)에 있어서 5번째의 Ser을 다른 아미노산으로 치환하는 공정.
 상기 (α)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Ile로의 치환이 바람직하다.
 상기 (β)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 상기 (γ)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Asn으로의 치환이 바람직하다.
 상기 (δ)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Ser로의 치환이 바람직하다.
 상기 (ε)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Gly로의 치환이 바람직하다.
 상기 (ζ)에 있어서, 치환 후의 아미노산은 안정성이 증가하는 한 특별히 한정되지 않으나, Ile로의 치환이 바람직하다.
 전술한 (α)~(ζ)의 공정에 있어서, 아미노산의 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법은 실시예에 기재된 방법에 의해 행할 수 있다. 아미노산 치환이 중쇄 가변영역에 대해서 행해지는 경우에는 치환 전의 기초가 되는 중쇄 가변영역의 아미노산 서열은 인간화 PM-1 중쇄 가변영역의 아미노산 서열인 것이 바람직하고, 아미노산 치환이 경쇄 가변영역에 대해서 행해지는 경우에는 치환 전의 기초가 되는 경쇄 가변영역의 아미노산 서열은 인간화 PM-1의 경쇄 가변영역의 아미노산 서열인 것이 바람직하다. 또한, 전술한 (α)~(ζ)의 아미노산 치환은 인간화 PM-1 항체에 대해서 행해지는 것이 바람직하다.
 본 발명의 항IL-6 수용체 항체의 안정성을 증가하는 방법은, 적어도, 전술한 (α)~(ζ) 중 어느 하나에 기재된 공정을 포함하는 것이면 된다. 즉 본 발명의 방법은, 전술한 (α)~(ζ)에 기재된 공정 중, 2 이상의 공정을 포함해도 된다. 또한, 전술한 (α)~(ζ) 중 어느 하나에 기재된 공정이 포함되는 한, 다른 공정(예를 들면, 전술한 (α)~(ζ) 이외의 아미노산의 치환, 결실, 부가 및/또는 삽입 등)이 포함되어 있어도 된다. 또한 예를 들면, 정상영역의 아미노산 서열의 치환, 결실, 부가 및/또는 삽입이 행해져 있어도 된다.
 〈항IL-6 수용체 항체의 면역원성을 저하시키는 방법〉
 또한 본 발명은 서열번호:7에 기재된 아미노산 서열(HFR1)에 있어서 13번째의 Arg를 Lys로, 16번째의 Gln을 Glu로, 23번째의 Thr을 Ala로, 및/또는 30번째의 Thr을 Ser로 치환하는 공정을 포함하는, 항IL-6 수용체 항체, 특히 인간화 PM-1 항체의 면역원성을 저하시키는 방법에 관한 것이다. 본 발명의 항IL-6 수용체 항체의 면역원성을 저하시키는 방법은, 서열번호:7에 기재된 아미노산 서열(HFR1)에 있어서 30번째의 Thr을 Ser로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다.
 또한 본 발명은 서열번호:90에 기재된 아미노산 서열(HFR3)에 있어서 27번째의 Ala를 Val로 치환하는 공정을 포함하는, 항IL-6 수용체 항체, 특히 인간화 PM-1 항체의 면역원성을 저하시키는 방법에 관한 것이다. 본 발명의 항IL-6 수용체 항체의 면역원성을 저하시키는 방법은, 서열번호:90에 기재된 아미노산 서열(HFR3)에 있어서 27번째의 Ala를 Val로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다.
 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 또한 본 발명은 항IL-6 수용체 항체, 특히 인간화 PM-1 항체, H53/L28, 또는 PF1 항체의 FR3를 서열번호:128 또는 서열번호:129의 아미노산 서열을 갖는 FR3로 함으로써 항체의 면역원성을 저하시키는 방법에 관한 것이다.
 〈항체의 산성조건하에 있어서의 안정성을 향상시키는 방법〉
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열(IgG2)에 있어서, 276번째(EU 넘버링 397번째)의 Met를 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 산성조건하에 있어서의 안정성을 향상시키는 방법에 관한 것이다. 본 발명의 항체의 산성조건하에 있어서의 안정성을 향상시키는 방법은, 서열번호:20에 기재된 아미노산 서열(IgG2)에 있어서 276번째(EU 넘버링 397번째)의 Met를 다른 아미노산으로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다. 치환 후의 아미노산은 특별히 한정되지 않으나 Val로의 치환이 바람직하다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG2 정상영역의 힌지부분에 유래하는 이질성을 개선하는 방법〉
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열(IgG2)에 있어서, 14번째(EU 넘버링 131번째)의 Cys를 다른 아미노산으로 치환하는 공정, 16번째(EU 넘버링 133번째)의 Arg를 다른 아미노산으로 치환하는 공정, 및/또는 102번째(EU 넘버링 219번째)의 Cys를 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 이질성을 개선하는 방법에 관한 것이다. 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째의 Cys는 Ser로, 16번째의 Arg는 Lys로, 102번째의 Cys는 Ser로 치환되는 것이 바람직하다. 본 발명의 항체의 이질성을 개선하는 방법은, 서열번호:20에 기재된 아미노산 서열(IgG2)에 있어서, 14번째(EU 넘버링 131번째)의 Cys를 치환하는 공정, 16번째(EU 넘버링 133번째)의 Arg를 치환하는 공정, 및/또는 102번째(EU 넘버링 219번째)의 Cys를 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예의 기재의 방법에 의해 행할 수 있다. 치환되는 아미노산은 전술한 3개의 아미노산 모두가 치환되어도 되고, 1 또는 2(예를 들면 14번째와 102번째 등)의 아미노산이 치환되어도 된다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG2 정상영역의 C말단 아미노산 결손에 유래하는 이질성을 저감시키는 방법〉
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정을 포함하는, 항체의 이질성을 개선하는 방법에 관한 것이다. 본 발명의 항체의 이질성을 개선하는 방법은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정을 포함하는 한, 다른 아미노산 치환을 포함해도 된다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG2 정상영역의 인간 서열을 유지한 상태로 FcγR로의 결합을 저감시키는 방법〉
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 209번째(EU 330)의 Ala를 Ser로 치환하는 공정, 210번째(EU 331)의 Pro를 Ser로 치환하는 공정, 및 218번째(EU 339)의 Thr을 Ala로 치환하는 공정을 포함하는, 항체의 FcγR로의 결합을 저감시키는 방법에 관한 것이다. 본 발명의 항체의 FcγR로의 결합을 저감시키는 방법은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 209번째(EU 330)의 Ala를 Ser로 치환하는 공정, 210번째(EU 331)의 Pro를 Ser로 치환하는 공정, 및 218번째(EU 339)의 Thr을 Ala로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 〈IgG2 정상영역의 아미노산을 치환함으로써 혈장 중 체류성을 향상시키는 방법〉
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 147번째(EU 268)의 His, 234번째(EU 355)의 Arg 및/또는 298번째(EU 419)의 Gln을 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 혈장 중 체류성을 향상시키는 방법에 관한 것이다. 본 발명의 혈장 중 체류성을 향상시키는 방법은, 전술한 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다. 치환 후의 아미노산은 특별히 한정되지 않으나, 147번째(EU 268)의 His는 Gln으로, 234번째(EU 355)의 Arg는 Gln으로, 298번째(EU 419)의 Gln은 Glu로 치환되는 것이 바람직하다.
 또한 본 발명은, 서열번호:20 또는 서열번호:151(M58)의 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 313번째(EU 434)의 Asn을 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 혈장 중 체류성을 향상시키는 방법에 관한 것이다. 치환 후의 아미노산은 특별히 한정되지 않으나, Ala로의 치환이 바람직하다. 본 발명의 혈장 중 체류성을 향상시키는 방법은, 전술한 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법, 산성조건하에서의 안정성을 향상시키는 방법, C말단에 유래하는 이질성을 저감시키는 방법, 및/또는 항체의 FcγR로의 결합을 저감시키는 방법에 관한 것이다(M14△GK).
 (a) 서열번호:20의 209번째(EU 넘버링 330)의 Ala를 Ser로 치환하는 공정,
 (b) 서열번호:20의 210번째(EU 넘버링 331)의 Pro를 Ser로 치환하는 공정,
 (c) 서열번호:20의 218번째(EU 넘버링 339)의 Thr을 Ala로 치환하는 공정,
 (d) 서열번호:20의 276번째(EU 넘버링 397)의 Met를 Val로 치환하는 공정,
 (e) 서열번호:20의 14번째(EU 넘버링 131)의 Cys를 Ser로 치환하는 공정,
 (f) 서열번호:20의 16번째(EU 넘버링 133)의 Arg를 Lys로 치환하는 공정,
 (g) 서열번호:20의 102번째(EU 넘버링 219)의 Cys를 Ser로 치환하는 공정,
 (h) 서열번호:20의 20번째(EU 넘버링 137)의 Glu를 Gly로 치환하는 공정,
 (i) 서열번호:20의 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 공정,
 
 (j) 서열번호:20의 325번째의 Gly 및 326번째의 Lys(EU 넘버링 446 및 447)를 결손시키는 공정.
 본 발명의 방법은, 상기 공정을 포함하는 한, 다른 아미노산 치환이나 결손, 기타 공정을 포함하는 것이어도 된다. 아미노산의 치환이나 결손의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법, 산성조건하에서의 안정성을 향상시키는 방법 및/또는 C말단에 유래하는 이질성을 저감시키는 방법에 관한 것이다(M31△GK)
 (a) 서열번호:20의 276번째(EU 넘버링 397)의 Met를 Val로 치환하는 공정,
 (b) 서열번호:20의 14번째(EU 넘버링 131)의 Cys를 Ser로 치환하는 공정,
 (c) 서열번호:20의 16번째(EU 넘버링 133)의 Arg를 Lys로 치환하는 공정,
 (d) 서열번호:20의 102번째(EU 넘버링 219)의 Cys를 Ser로 치환하는 공정,
 (e) 서열번호:20의 20번째(EU 넘버링 137)의 Glu를 Gly로 치환하는 공정,
 (f) 서열번호:20의 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 공정,
 
 (g) 서열번호:20의 325번째의 Gly 및 326번째의 Lys(EU 넘버링 446 및 447)를 결손시키는 공정.
 또한 본 발명은 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법, 혈장 중 체류성을 향상시키는 방법 및/또는 C말단에 유래하는 이질성을 저감시키는 방법에 관한 것이다(M58).
 (a) 서열번호:20의 14번째(EU 넘버링 131번째)의 Cys를 Ser로 치환하는 공정,
 (b) 서열번호:20의 16번째(EU 넘버링 133번째)의 Arg를 Lys로 치환하는 공정,
 (c) 서열번호:20의 102번째(EU 넘버링 219번째)의 Cys를 Ser로 치환하는 공정,
 (d) 서열번호:20의 20번째(EU 넘버링 137번째)의 Glu를 Gly로 치환하는 공정,
 (e) 서열번호:20의 21번째(EU 넘버링 138번째)의 Ser을 Gly로 치환하는 공정,
 (f) 서열번호:20의 147번째(EU 넘버링 268번째)의 His를 Gln으로 치환하는 공정,
 (g) 서열번호:20의 234번째(EU 넘버링 355번째)의 Arg를 Gln으로 치환하는 공정,
 (h) 서열번호:20의 298번째(EU 넘버링 419번째)의 Gln을 Glu로 치환하는 공정,
 (i) 서열번호:20의 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정.
 또한 본 발명은 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법, 혈장 중 체류성을 향상시키는 방법 및/또는 C말단에 유래하는 이질성을 저감시키는 방법에 관한 것이다(M73).
 (a) 서열번호:20의 14번째(EU 넘버링 131번째)의 Cys를 Ser로 치환하는 공정,
 (b) 서열번호:20의 16번째(EU 넘버링 133번째)의 Arg를 Lys로 치환하는 공정,
 (c) 서열번호:20의 102번째(EU 넘버링 219번째)의 Cys를 Ser로 치환하는 공정,
 (d) 서열번호:20의 20번째(EU 넘버링 137번째)의 Glu를 Gly로 치환하는 공정,
 (e) 서열번호:20의 21번째(EU 넘버링 138번째)의 Ser을 Gly로 치환하는 공정,
 (f) 서열번호:20의 147번째(EU 넘버링 268번째)의 His를 Gln으로 치환하는 공정,
 (g) 서열번호:20의 234번째(EU 넘버링 355번째)의 Arg를 Gln으로 치환하는 공정,
 (h) 서열번호:20의 298번째(EU 넘버링 419번째)의 Gln을 Glu로 치환하는 공정,
 (i) 서열번호:20의 313번째(EU 넘버링 434번째)의 Asn을 Ala로 치환하는 공정,
 (j) 서열번호:20의 325번째(EU 넘버링 446번째)의 Gly 및 326번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정.
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법, C말단에 유래하는 이질성을 저감시키는 방법 및/또는 항체의 FcγR로의 결합을 저감시키는 방법에 관한 것이다(M86△GK).
 (a) 서열번호:20의 209번째(EU 넘버링 330)의 Ala를 다른 아미노산으로 치환하는 공정,
 (b) 서열번호:20의 210번째(EU 넘버링 331)의 Pro를 다른 아미노산으로 치환하는 공정,
 (c) 서열번호:20의 218번째(EU 넘버링 339)의 Thr을 다른 아미노산으로 치환하는 공정,
 (d) 서열번호:20의 14번째(EU 넘버링 131)의 Cys를 다른 아미노산으로 치환하는 공정,
 (e) 서열번호:20의 16번째(EU 넘버링 133)의 Arg를 다른 아미노산으로 치환하는 공정,
 (f) 서열번호:20의 102번째(EU 넘버링 219)의 Cys를 다른 아미노산으로 치환하는 공정,
 (g) 서열번호:20의 20번째(EU 넘버링 137)의 Glu를 다른 아미노산으로 치환하는 공정,
 (h) 서열번호:20의 21번째(EU 넘버링 138)의 Ser을 다른 아미노산으로 치환하는 공정,
 
 (i) 서열번호:20의 325번째의 Gly 및 326번째의 Lys(EU 넘버링 446 및 447)를 결손시키는 공정.
 치환 후의 아미노산은 특별히 한정되지 않으나, 209번째(EU 넘버링 330)의 Ala를 Ser, 210번째(EU 넘버링 331)의 Pro를 Ser, 218번째(EU 넘버링 339)의 Thr을 Ala, 14번째(EU 넘버링 131)의 Cys를 Ser, 16번째(EU 넘버링 133)의 Arg를 Lys, 102번째(EU 넘버링 219)의 Cys를 Ser, 20번째(EU 넘버링 137)의 Glu를 Gly, 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 것이 바람직하다.
 또한 본 발명은, 서열번호:20에 기재된 아미노산 서열을 갖는 IgG2 정상영역에 있어서, 하기에 기재된 공정을 포함하는, IgG2의 힌지부분에 유래하는 이질성을 저감시키는 방법 및/또는 C말단에 유래하는 이질성을 저감시키는 방법에 관한 것이다(M40△GK).
 (a) 서열번호:20의 14번째(EU 넘버링 131)의 Cys를 다른 아미노산으로 치환하는 공정,
 (b) 서열번호:20의 16번째(EU 넘버링 133)의 Arg를 다른 아미노산으로 치환하는 공정,
 (c) 서열번호:20의 102번째(EU 넘버링 219)의 Cys를 다른 아미노산으로 치환하는 공정,
 (d) 서열번호:20의 20번째(EU 넘버링 137)의 Glu를 다른 아미노산으로 치환하는 공정,
 (e) 서열번호:20의 21번째(EU 넘버링 138)의 Ser을 다른 아미노산으로 치환하는 공정,
 
 (f) 서열번호:20의 325번째의 Gly 및 326번째의 Lys(EU 넘버링 446 및 447)를 결손시키는 공정.
 치환 후의 아미노산은 특별히 한정되지 않으나, 14번째(EU 넘버링 131)의 Cys를 Ser, 16번째(EU 넘버링 133)의 Arg를 Lys, 102번째(EU 넘버링 219)의 Cys를 Ser, 20번째(EU 넘버링 137)의 Glu를 Gly, 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 것이 바람직하다.
 본 발명의 방법은, 상기 공정을 포함하는 한, 다른 아미노산 치환이나 결손, 기타 공정을 포함하는 것이어도 된다. 아미노산의 치환이나 결손의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG4 정상영역의 산성조건하에 있어서의 안정성을 향상시키는 방법〉
 본 발명은 또한, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역(Mol Immunol. 1993 Jan;30(1):105-8.)에 있어서, 289번째(EU 넘버링 409번째)의 Arg를 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 산성조건하에 있어서의 안정성을 향상시키는 방법에 관한 것이다. 본 발명의 항체의 산성조건하에 있어서의 안정성을 향상시키는 방법은, 서열번호:21에 기재된 아미노산 서열(인간 IgG4 정상영역)에 있어서 289번째(EU 넘버링 409번째)의 Arg를 다른 아미노산으로 치환하는 공정을 포함하는 한, 다른 아미노산 치환을 포함해도 된다. 치환 후의 아미노산은 특별히 한정되지 않으나, Lys로의 치환이 바람직하다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG4 정상영역의 C말단 아미노산 결손에 유래하는 이질성을 저감시키는 방법〉
 또한 본 발명은, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역(Mol Immunol. 1993 Jan;30(1):105-8.)에 있어서, 326번째(EU 넘버링 446번째)의 Gly 및 327번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정을 포함하는, 항체의 이질성을 개선하는 방법에 관한 것이다. 본 발명의 이질성을 개선하는 방법은, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역(Mol Immunol. 1993 Jan;30(1):105-8.)에 있어서, 327번째(EU 넘버링 447번째)의 Lys 및/또는 326번째(EU 넘버링 446번째)의 Gly를 결손시키는 공정을 포함하는 한, 다른 아미노산 치환을 포함해도 된다.아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 또한 본 발명은, 서열번호:21에 기재된 아미노산 서열을 갖는 IgG4 정상영역(Mol Immunol. 1993 Jan;30(1):105-8.)에 있어서, 하기에 기재된 공정을 포함하는, IgG4의 산성조건하에서의 안정성을 향상시키는 방법, C말단에 유래하는 이질성을 저감시키는 방법, 항체의 FcγR로의 결합을 저감시키는 방법에 관한 것이다(M11△GK).
 (a) 서열번호:21의 14번째(EU 넘버링 131)의 Cys를 Ser로 치환하는 공정,
 (b) 서열번호:21의 16번째(EU 넘버링 133)의 Arg를 Lys로 치환하는 공정,
 (c) 서열번호:21의 20번째(EU 넘버링 137)의 Glu를 Gly로 치환하는 공정,
 (d) 서열번호:21의 21번째(EU 넘버링 138)의 Ser을 Gly로 치환하는 공정,
 (e) 서열번호:21의 97번째(EU 넘버링 214)의 Arg를 Thr로 치환하는 공정,
 (f) 서열번호:21의 100번째(EU 넘버링 217)의 Ser을 Arg로 치환하는 공정,
 (g) 서열번호:21의 102번째(EU 넘버링 219)의 Tyr을 Ser로 치환하는 공정,
 (h) 서열번호:21의 103번째(EU 넘버링 220)의 Gly를 Cys로 치환하는 공정,
 (i) 서열번호:21의 104번째(EU 넘버링 221)의 Pro를 Val로 치환하는 공정,
 (j) 서열번호:21의 105번째(EU 넘버링 222)의 Pro를 Glu로 치환하는 공정,
 (k) 서열번호:21의 113번째(EU 넘버링 233)의 Glu를 Pro로 치환하는 공정,
 (l) 서열번호:21의 114번째(EU 넘버링 234)의 Phe를 Val로 치환하는 공정,
 (m) 서열번호:21의 115번째(EU 넘버링 235)의 Leu를 Ala로 치환하는 공정,
 (n) 서열번호:21의 116번째(EU 넘버링 236)의 Gly를 결손하는 공정,
 (o) 서열번호:21의 289번째(EU 넘버링 409)의 Arg를 Lys로 치환하는 공정, 및
 (p) 서열번호:21의 326번째(EU 넘버링 446)의 Gly 및 327번째(EU 넘버링 447)의 Lys를 결손시키는 공정.
 본 발명의 방법은, 상기 공정을 포함하는 한, 다른 아미노산 치환이나 결손, 기타 공정을 포함하는 것이어도 된다. 아미노산의 치환이나 결손의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 〈IgG1 정상영역의 C말단 아미노산 결손에 유래하는 이질성을 저감시키는 방법〉
 또한 본 발명은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 329번째(EU 넘버링 446번째)의 Gly 및 330번째(EU 넘버링 447번째)의 Lys를 결손시키는 공정을 포함하는, 항체의 이질성을 개선하는 방법에 관한 것이다. 본 발명의 항체의 이질성을 개선하는 방법은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 330번째(EU 넘버링 447번째)의 Lys 및 329번째(EU 넘버링 446번째)의 Gly를 결손시키는 공정을 포함하는 한, 다른 아미노산을 포함해도 된다. 아미노산 치환의 방법은 특별히 한정되지 않으나, 예를 들면 전술한 부위특이적 변이유발법이나 실시예에 기재된 방법에 의해 행할 수 있다.
 〈IgG1 정상영역의 아미노산을 치환함으로써 혈장 중 체류성을 향상시키는 방법〉
 또한 본 발명은, 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 317번째(EU 434)의 Asn을 다른 아미노산으로 치환하는 공정을 포함하는, 항체의 혈장 중 체류성을 향상시키는 방법에 관한 것이다. 치환 후의 아미노산은 특별히 한정되지 않으나, Ala로의 치환이 바람직하다. 본 발명의 혈장 중 체류성을 향상시키는 방법은, 전술한 공정을 포함하는 한, 다른 아미노산 치환을 포함하는 것이어도 된다.
 또한 본 발명은 서열번호:19에 기재된 아미노산 서열을 갖는 IgG1 정상영역에 있어서, 하기에 기재된 공정을 포함하는 혈장 중 체류성을 향상시키는 방법 및/또는 C말단에 유래하는 이질성을 저감시키는 방법에 관한 것이다(M83).
 (a) 서열번호:19의 317번째(EU 434)의 Asn을 다른 Ala로 치환하는 공정,
 (b) 서열번호:19의 330번째(EU 넘버링 447번째)의 Lys 및 329번째(EU 넘버링 446번째)의 Gly를 결손시키는 공정.
 대상이 되는 항체는 특별히 한정되지 않으나, 항인간 IL-6 수용체 항체인 것이 바람직하고, 또한 인간화 PM-1 항체, 또는 그의 개변(치환, 결손, 삽입)체인 것이 바람직하다.
 전술한 본 발명의 정상영역은 어떠한 항체 유래의 가변영역도 조합시키는 것이 가능하나, 바람직하게는 인간 IL-6 수용체에 대한 항체 유래의 가변영역과 조합된다. 인간 IL-6 수용체에 대한 항체의 가변영역의 예로서는, 인간화 PM-1 항체의 가변영역을 들 수 있다. 인간화 PM-1 항체의 가변영역은 아미노산 치환 등이 행해져 있지 않은 가변영역이어도 되고, 전술한 아미노산 치환 등이 행해진 가변영역이어도 된다.
 본 발명은, 본 발명의 항체를 포함하는 의약 조성물을 제공한다. 본 발명의 의약 조성물은, 관절 류머티즘 등의 IL-6가 관련하는 질환의 치료에 있어서 유용하다.
 본 발명의 의약 조성물은, 항체에 더하여 의약적으로 허용 가능한 담체를 도입하고, 공지의 방법으로 제제화할 수 있다. 예를 들면, 물 또는 그 이외의 약학적으로 허용 가능한 용액과의 무균성 용액 또는 현탁액제의 주사제의 형태로 비경구적으로 사용할 수 있다. 예를 들면, 약리학상 허용되는 담체 또는 매체, 구체적으로는, 멸균수나 생리식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 향미제, 부형제, 비히클, 방부제, 결합제 등과 적절히 조합시켜서, 일반적으로 인정된 제약 실시에 요구되는 단위용량형태로 혼화함으로써 제제화하는 것을 생각할 수 있다. 이들 제제에 있어서의 유효성분량은 지시된 범위의 적당한 용량이 얻어지도록 하는 것이다.
 주사를 위한 무균조성물은 주사용 증류수와 같은 비히클을 사용하여 통상의 제제 실시에 따라 처방할 수 있다.
 주사용 수용액으로서는, 예를 들면 생리식염수, 포도당이나 기타 보조약을 포함하는 등장액, 예를 들면 D-소르비톨, D-만노오스, D-만니톨, 염화나트륨을 들 수 있고, 적당한 용해보조제, 예를 들면 알코올, 구체적으로는 에탄올, 폴리알코올, 예를 들면 프로필렌글리콜, 폴리에틸렌글리콜, 비이온성 계면활성제, 예를 들면 폴리소르베이트 80(TM), HCO-50과 병용해도 된다.
 유성액으로서는 참기름, 대두유를 들 수 있고, 용해보조제로서 안식향산 벤질, 벤질알코올과 병용해도 된다. 또한 완충제, 예를 들면 인산염 완충액, 초산나트륨 완충액, 무통화제, 예를 들면, 염산프로카인, 안정제, 예를 들면 벤질알코올, 페놀, 산화방지제와 배합해도 된다. 조제된 주사액은 통상, 적당한 앰플에 충전시킨다.
 투여는 바람직하게는 비경구투여이고, 구체적으로는, 주사제형, 경비투여제형, 경폐투여제형, 경피투여형 등을 들 수 있다. 주사제형의 예로서는, 예를 들면, 정맥 내 주사, 근육 내 주사, 복강 내 주사, 피하 주사 등에 의해 전신 또는 국부적으로 투여할 수 있다.
 또한, 환자의 연령, 증상에 따라 적절히 투여방법을 선택할 수 있다. 항체 또는 항체를 코드하는 폴리뉴클레오티드를 함유하는 의약 조성물의 투여량으로서는, 예를 들면, 1회에 대해 체중 1 ㎏당 0.0001 ㎎~1000 ㎎의 범위에서 선택하는 것이 가능하다. 또는, 예를 들면, 환자당 0.001~100000 ㎎/body의 범위에서 투여량을 선택할 수 있으나, 이들의 수치에 반드시 제한되지는 않는다. 투여량, 투여방법은, 환자의 체중이나 연령, 증상 등에 따라 변동하나, 당업자라면 적절히 선택하는 것이 가능하다.
 본 명세서에서 사용되고 있는 아미노산의 세글자 표기와 한글자 표기의 대응은 이하와 같다.
 알라닌:Ala:A
 아르기닌:Arg:R
 아스파라긴:Asn:N
 아스파라긴산:Asp:D
 시스테인:Cys:C
 글루타민:Gln:Q
 글루타민산:Glu:E
 글리신:Gly:G
 히스티딘:His:H
 이소류신:Ile:I
 류신:Leu:L
 리신:Lys:K
 메티오닌:Met:M
 페닐알라닌:Phe:F
 프롤린:Pro:P
 세린:Ser:S
 트레오닌:Thr:T
 트립토판:Trp:W
 티로신:Tyr:Y
 발린:Val:V
 또한 본 명세서에 있어서 인용된 모든 선행기술문헌은, 참조로서 본 명세서에 포함된다.
  실시예
 이하, 본 발명을 실시예에 의해 구체적으로 설명하나, 본 발명은 이들 실시예에 제한되지 않는다.
  [ 실시예 1] 친화성 성숙 기술(affinity maturation technology)을 사용한 CDR 개변에 의한 항원 결합능의 향상
  SR344 의 조제
 J.Biochem. 108, 673-676 (1990)에서 보고되어 있는 N말단측 1번째~344번째의 아미노산 서열로 되는 가용성 인간 IL-6R(이하, SR344))(Yamasaki등, Science 1988;241:825-828 (GenBank # X12830))의 CHO세포 정상발현주를 제작하였다.
 SR344 발현 CHO세포로부터 얻어진 배양상청으로부터, Blue Sepharose 6 FF 칼럼 크로마토그래피, SR344에 대한 특이 항체를 고정한 칼럼에 의한 친화성 크로마토그래피, 겔 여과 크로마토그래피의 3개의 칼럼 크로마토그래피에 의해, SR344를 정제하였다.
 20 mM 트리스 염산완충액, pH 8.0으로 평형화한 Blue Sepharose 6 FF column(GE 헬스케어 바이오사이언스)에 배양상청을 그 상태로 첨가하고, 동일 완충액으로 비흡착의 분획을 완전히 씻어 없앴다. 그 후, 칼럼은 300 mM의 KCl을 포함하는 동일 완충액으로 세정하였다. 추가적으로, 300 mM KCl 존재 하의 동일 완충액 중에서, 0 M~0.5 M의 KSCN의 직선농도구배에 의해, 흡착된 단백을 용출하였다. KSCN의 농도구배로 용출된 분획을, SR344에 특이적인 항체를 사용한 웨스턴 블로팅(Western Blotting)으로 분석하여, SR344를 포함하는 분획을 모았다.
 SR344에 대한 특이 항체를 고정한 칼럼은, 사전에 TBS(Tris-Buffered-Saline)로 평형화해 두었다. 이것에 제1 공정에서 얻어진 SR344 분획을, Amicon Ultra-15(MILLIPORE, 분자량 커트오프 10 kDa)에 의한 한외여과로 농축하고, TBS로 2배 희석한 후에 첨가하였다. TBS로 칼럼을 세정 후, 100 mM 글리신-염산 완충액, pH 2.5에서, 흡착된 단백을 용출하였다. 용출된 분획은, 1 M Tris, pH 8.1을 첨가하여 pH를 중성으로 되돌렸다. 얻어진 분획을 SDS-PAGE로 분석하여, SR344가 포함되는 분획을 모았다.
 제2 공정에서 얻어진 분획은, Amicon Ultra-15(분자량 커트오프 10 kDa)로 농축하여, PBS로 평형화한 Superdex 200 칼럼(GE 헬스케어 바이오사이언스)에 첨가하였다. 메인 피크로서 용출된 분획을, SR344의 최종 정제품으로 하였다.
  인간 gp130 발현 BaF3 세포주의 수립
 IL-6 의존증식성을 나타내는 세포주를 얻기 위해서, 이하에 나타내는 바와 같이, 인간 gp130을 발현한 BaF3 세포주의 수립을 행하였다.
 전장 인간 gp130 cDNA(Hibi등, Cell 1990;63:1149-1157(GenBank # NM_002184))를 PCR에 의해 증폭하고, pCHOI(Hirata등, FEBS Letter 1994;356:244-248)의 DHFR 유전자 발현부위를 제거하고, Zeocin 내성유전자 발현부위를 삽입한 발현벡터 pCOS2Zeo에 클로닝하여, pCOS2Zeo/gp130을 구축하였다. 전장 인간 IL-6R cDNA를 PCR에 의해 증폭하고, pcDNA3.1(+)(Invitrogen)에 의해 클로닝하여, hIL-6R/pcDNA3.1(+)을 구축하였다.
 10 ㎍의 pCOS2Zeo/gp130을 PBS에 현탁한 BaF3세포(0.8×10 7 cells)에 혼합하고, Gene Pulser(Bio-Rad)를 사용하여 0.33 kV, 950 μFD의 용량으로 펄스를 가하였다. 전기천공법처리에 의해 유전자 도입한 BaF3세포를 0.2 ng/mL의 mouse interleukin-3(Peprotech), 10% Fetal Bovine Serum(이하 FBS, HyClone)을 포함하는 RPMI1640배지(Invitrogen)에서 하루 배양하고, 100 ng/mL의 human interleukin-6(R&D systems), 100 ng/mL의 human interleukin-6 soluble receptor(R&D systems) 및 10% FBS를 포함하는 RPMI1640배지를 첨가하여 선발해서, 인간 gp130 발현 BaF3 세포주(이하, BaF3/gp130)를 수립하였다. 이 BaF/gp130은, human interleukin-6(R&D systems) 및 SR344 존재하에서 증식하는 것으로부터, 항IL-6 수용체 항체의 증식저해활성(즉 IL-6 수용체 중화활성)의 평가에 사용하는 것이 가능하다.
  CDR 개변 라이브러리의 구축
 맨먼저, 인간화 PM1 항체(Cancer Res. 1993 Feb 15;53(4):851-6)의 scFv화를 행하였다. VH, VL영역을 PCR에 의해 증폭하고, 링커 서열 GGGGSGGGGSGGGGS(서열번호:106)를 VH, VL 사이에 갖는 인간화 PM1 HL scFv를 제작하였다.
 제작한 인간화 PM1 HL scFv DNA를 주형으로 한 PCR에 의해, 각 CDR 아미노산 중 하나의 아미노산이 X가 되는 타겟 라이브러리, 및 CDR 중의 Hot Spot 서열만을 랜덤 서열로 한 라이브러리를 제작하였다. 각 CDR 아미노산 중 하나의 아미노산이 X가 되는 타겟 라이브러리에 대해서는, 라이브러리화하고자 하는 아미노산을 NNS로 한 프라이머를 사용한 PCR 반응에 의해 라이브러리부분을 구축하고, 그 이외의 부분을 통상의 PCR에 의해 제작하고, assembly PCR법에 의해 연결하여 구축하였다. 이때, 하나의 CDR만이 라이브러리화되도록 하였다(J.Mol.Biol 1996 ; 256 : 77-88 참조). 또한, Hot Spot 서열만을 랜덤 서열로 한 라이브러리에 대해서는, Hot Spot 아미노산 모두를 NNS로 한 프라이머를 사용한 PCR에 의해 동일하게 구축하였다. 이때, VH의 Hot Spot만이 라이브러리화된 라이브러리, VL의 Hot Spot만이 라이브러리화된 라이브러리를 구축하였다(Nature Biotechnology 1999 June;17:568-572 참조).
 이들의 라이브러리를 사용하여, J. Immunological Methods 1999;231:119-135에 따라, ribosome display용 라이브러리를 구축하였다. 대장균 무세포계 in vitro translation을 행하기 위해, SDA 서열(ribosome binding site), T7 promoter를 5'측에 부가하여, ribosome display용의 링커로서 3'측에 gene3 부분서열을 Sfi I을 사용해서 ligation하였다.
  Ribosome display 에 의한 고친화성 scFv 의 취득
 Nature Biotechnology 2000 Dec;18:1287-1292에 따라, ribosome display에 의한 패닝을 행하였다. 조제된 SR344를 NHS-PEO4-Biotin(Pierce)을 사용해서 비오틴화하여 항원으로 하였다. 친화성이 높은 scFv를 효율적으로 취득하기 위해, JBC 2004;279(18):18870-18877을 참고로 하여, off-rate selection을 행하였다. 비오틴화 항원량을 1 nM, 경합 항원량을 1 μM, 4 th round에서의 경합시간을 10 O/N으로 하였다.
  scFv phagemide 로의 삽 입과 항원 결합활성, 서열 해석
 4 th round에서 얻어진 DNA pool을 주형으로 하고, 특이적 프라이머를 사용하여 PCR함으로써 HL scFv를 복원하였다. Sfi I으로 소화하고, 마찬가지로 Sfi I으로 소화한 phagemide 벡터 pELBG lacI 벡터에 삽입하여, XL1-Blue(stratagene)로 transform하였다. 얻어진 콜로니를 사용하여, phage ELISA에 의한 항원 결합활성 평가와 HL scFv 서열 해석을 행하였다. J.Mol.Biol 1992;227:381-388에 따라, SR344를 1 ㎍/mL로 coating한 플레이트를 사용한 phage-ELISA를 행하였다. SR344로의 결합활성이 확인된 클론에 대해서, 특이적 프라이머를 사용하여, 서열 해석을 행하였다.
  scFv 로부터의 IgG 화와 IgG 발현 및 정제
 동물세포 발현용 벡터를 사용하여 IgG의 발현을 행하였다. 변이개소의 농축이 확인된 클론에 대해서, VH 및 VL을 각각 PCR에 의해 증폭하고, XhoI/NheI 소화 및 EcoRI 소화에 의해 동물세포 발현용 벡터에 삽입하였다. 각 DNA 단편의 염기서열은, BigDye Terminator Cycle Sequencing Kit(Applied Biosystems)를 사용하여, DNA 시퀀서 ABI PRISM 3730xL DNA Sequencer 또는 ABI PRISM 3700 DNA Sequencer(Applied Biosystems)로, 첨부설명서 기재의 방법에 따라 결정하였다.
  IgG 화한 항체의 발현
 항체의 발현은 이하의 방법을 사용해서 행하였다. 인간 태아 신장암 세포 유래 HEK 293H주(Invitrogen)를10% Fetal Bovine Serum(Invitrogen)을 포함하는 DMEM배지(Invitrogen)로 현탁하고, 5~6×10 5 개/mL의 세포밀도로 접착세포용 디쉬(직경 10 cm, CORNING)의 각 디쉬에 10 mL씩 파종하여 CO 2 인큐베이터(37℃, 5% CO 2) 내에서 하루 배양한 후에, 배지를 흡인 제거하고, CHO-S-SFM-II(Invitrogen)배지 6.9 mL를 첨가하였다. 조제한 플라스미드 DNA 혼합액(합계 13.8 ㎍)을 1 ㎍/mL Polyethylenimine(Polysciences Inc.) 20.7 μL와 CHO-S-SFMII배지 690 μL를 혼합하여 실온에서 10분간 정치한 것을 각 디쉬의 세포로 투입하고, 4~5시간, CO 2 인큐베이터(37℃에서 5% CO 2) 내에서 인큐베이트하였다. 그 후, CHO-S-SFM-II(Invitrogen)배지 6.9 mL를 첨가하고, 3일간 CO 2 인큐베이터 내에서 배양하였다. 배양상청을 회수한 후, 원심분리(약 2000 g, 5분간, 실온)하여 세포를 제거하고, 추가적으로 0.22 ㎛ 필터 MILLEX (R)-GV(Millipore)를 통과시켜 멸균하였다. 그 샘플은 사용할 때까지 4℃에서 보존하였다.
  IgG 화한 항체의 정제
 얻어진 배양상청에 TBS 중에 현탁시킨 50 μL의 rProtein A Sepharose TM Fast Flow(Amersham Biosciences)를 첨가하여, 4℃에서 4시간 이상 전도혼화(轉倒混和)하였다. 그 용액을 0.22 ㎛의 필터컵 Ultrafree (R)-MC(Millipore)로 옮기고, TBS 500 μL로 3회 세정 후, rProtein A Sepharose TM 수지에 100 μL의 50 mM 초산나트륨수용액, pH 3.3으로 현탁하여 2분간 정치한 후, 항체를 용출시켰다. 즉, 6.7 μL의 1.5 M Tris-HCl, pH 7.8을 첨가하여 중화하였다. 용출은 2회 행하여, 200 μL의 정제 항체를 얻었다. 항체를 포함하는 용액 2 ㎕를 ND-1000 Spectrophotometer(NanoDrop) 또는 50 ㎕를 분광광도계 DU-600(BECKMAN)에 제공하여, 280 ㎚에서의 흡광도를 측정하였다. 얻어진 값으로부터 이하의 식을 사용하여 항체농도를 산출하였다.
 
  IgG 화한 클론의 인간 IL -6 수용체 중화활성 평가
 IL-6/IL-6 수용체 의존성 증식을 나타내는 BaF3/gp130을 사용하여, IL-6 수용체 중화활성을 평가하였다. BaF3/gp130을 10% FBS를 포함하는 RPMI1640배지에서 3회 세정한 후에, 5×10 4 cells/mL가 되도록 60 ng/mL의 human interleukin-6(TORAY), 60 ng/mL의 재조합 가용성 인간 IL-6 수용체(SR344) 및 10% FBS를 포함하는 RPMI1640배지에 현탁하고, 96웰 플레이트(CORNING)의 각 웰에 50 μL씩 분주(分注)하였다. 다음으로, 정제한 항체를 10% FBS를 포함하는 RPMI1640에 희석하고, 각 웰에 50 μL씩 혼합하였다. 37℃, 5% CO 2 조건하에서, 3일간 배양하고, PBS로 2배로 희석한 WST-8 시약(Cell Counting Kit-8, 가부시키가이샤 도진화학연구소)을 20 μL/well로 첨가하고, 직후에 SUNRISE CLASSIC(TECAN)을 사용하여 450 ㎚의 흡광도(참조파장 620 ㎚)를 측정하였다. 2시간 배양한 후에, 재차 450 ㎚의 흡광도(참조파장 620 ㎚)를 측정하여, 2시간의 흡광도 변화를 지표로 IL-6 수용체 중화활성을 평가하였다.
 그 결과, 인간화 PM1 항체(야생형:WT)과 비교하여 활성이 높은 항체가 복수 얻어졌다. WT보다도 높은 활성을 나타내는 항체의 변이개소를 도 4에 나타내었다. 예를 들면 도 1에 나타내는 바와 같이, RD_6는 WT보다 100% 저해농도로서 약 50배 정도 높은 중화활성을 나타내는 것을 알 수 있었다.
  IgG 화한 클론의 Biacore 에 의한 친화성 해석
 활성이 야생형보다도 높았던 것에 대해 Biacore T100(BIACORE)을 사용하여, 항원 항체반응의 속도론적 해석을 행하였다. 센서칩 상에 rec-Protein A(ZYMED)(이하, Protein A)를 1800 RU~2600 RU 고정화하여, 거기에 각종 항체를 결합시키고, 그것에 항원을 애널라이트로서 흘려, 항체와 항원의 상호작용을 측정하였다. 항원에는 각종 농도로 조정한 recombinant human IL-6R sR(R&D systems)(이하 rhIL-6sR)을 사용하였다. 측정은 모두 25℃에서 행하였다. 측정으로 얻어진 센서그램으로부터, 키네틱스 파라미터인 결합속도상수 k a(1/Ms) 및 해리속도상수 k d(1/s)를 산출하고, 그 값을 토대로 하여 K D(M)를 산출하였다. 각 파라미터의 산출에는 Biacore T100 Evaluation Software(BIACORE)를 사용하였다.
 그 결과, 인간화 PM1 항체(야생형:WT)와 비교하여 친화성이 높은 항체가 복수 얻어졌다. 예를 들면, 야생형(WT)과 RD_6의 센서그램을 도 2 및 3에 나타내었다. 키네틱스 파라미터 해석결과로부터, RD_6는 WT보다 약 50배 높은 친화성을 나타내는 것을 알 수 있었다(표 1). 그 외에도 수십배 높은 친화성을 갖는 항체가 얻어졌다. WT보다도 높은 친화성을 나타내는 변이개소를 도 4에 나타내었다.
 
표 1
  [ 실시예 2] 각 CDR 개변의 조합에 의한 항원 결합능의 향상
 활성 및 친화성이 높은 변이개소에 대해서는, 변이개소의 융합을 행하여, 보다 고활성, 고친화성의 항체 제작을 행하였다.
  개변 항체의 제작·발현·정제
 선정된 개소에 대해서 개변 항체를 제작하기 위한 아미노산 개변을 행하였다. 구체적으로는, QuikChange Site-Directed Mutagenesis Kit(Stratagene)를 사용해서, 첨부 설명서 기재의 방법으로, 제작한 H(WT) 가변영역(H(WT), 염기서열번호:107) 및 L(WT)쇄 가변영역(L(WT), 염기서열번호:108)에 변이를 도입하였다. 목적의 인간화 항체 가변영역 유전자 서열인 것이 확인된 H사슬 항체유전자 단편 삽입 플라스미드를 XhoI 및 NotI로 소화한 후에, L사슬 항체유전자 단편 삽입 플라스미드를 EcoRI로 소화한 후에, 반응액을 1% 아가로스 겔 전기영동에 제공하였다. 목적의 사이즈(약 400 bp)의 DNA 단편을 QIAquick Gel Extraction Kit(QIAGEN)를 사용하여 첨부 설명서 기재의 방법으로 정제하고, 멸균수 30 ㎕로 용출하였다. 그 후, 동물세포 발현용 벡터에 H사슬 항체유전자 단편을 삽입하고, 목적의 H사슬 발현벡터를 제작하였다. 또한, 동일하게 하여 L사슬 발현벡터를 제작하였다. 연결반응은 Rapid DNA Ligation Kit(Roche Diagnostics)를 사용하여, 대장균 DH5α주(도요보세키)를 형질전환하였다. 각 DNA 단편의 염기서열은, BigDye Terminator Cycle Sequencing Kit(Applied Biosystems)를 사용하여, DNA 시퀀서 ABI PRISM 3730xL DNA Sequencer 또는 ABI PRISM 3700 DNA Sequencer(Applied Biosystems)로, 첨부 설명서 기재의 발명에 따라 결정하였다. 제작한 발현벡터를 사용하여 실시예 1에 기재한 방법으로 발현, 정제를 행하였다.
  인간 IL -6 수용체 중화활성 평가
 정제한 항체의 중화활성의 평가를 실시예 1에 나타내는 방법으로 행하였다. 단, human interleukin-6(TORAY) 농도를 600 ng/mL로 하여 중화활성의 평가를 행하였다. WT와 비교해서 높은 활성을 나타내는 신규 항체가 복수 얻어져, 그들의 CDR 서열을 도 5에 나타내었다. 그 중에서도 높은 활성을 나타낸 항체로서 H사슬에 RDC_5H, L사슬에 RDC_11L을 사용한 항체(RDC_23으로 함)의 중화활성을 도 6에 나타내었다. RDC_23은 WT와 비교하여 100% 저해농도로서 약 100배 높은 활성을 갖는 것이 명백해졌다. H사슬에 RDC_5H, L사슬에 RDC_11L을 사용한 항체인 RDC_23뿐 아니라, H사슬에 RDC_2H, RDC_3H, RDC_4H, RDC_5H, RDC_6H, RDC_7H, RDC_8H, RDC_27H, RDC_28H, RDC_29H, RDC_30H, RDC_32H, L사슬에 L(WT)을 사용한 항체(각각, RDC_2, RDC_3, RDC_4, RDC_5, RDC_6, RDC_7, RDC_8, RDC_27, RDC_28, RDC_29, RDC_30, RDC_32로 함), 및 H사슬에 H(WT), L사슬에 RDC_11L을 사용한 항체(RDC_11로 함)에 있어서도 중화활성의 향상이 확인되어, 친화성 성숙으로 발견된 변이개소를 조합시킴으로써, 보다 높은 중화활성을 갖는 항체가 취득 가능한 것이 명백해졌다. 또한, 이들 변이개소를 조합시킨 항체는 중화활성이 향상되어 있는 것으로부터, 친화성도 향상되어 있다고 생각되었다.
  Protein A를 사용한 Bicore 에 의한 친화성 해석
 이에, 중화활성이 향상된 항체 중 RDC_2, RDC_3, RDC_4, RDC_5, RDC_6, RDC_7, RDC_8, RDC_11, RDC_23에 대해서 Biacore T100(BIACORE)을 사용하여, 항원 항체반응의 속도론적 해석을 행하였다. 센서칩 상에 아민 커플링법으로 rec-Protein A(ZYMED)를4400 RU~5000 RU 고정화하여, 거기에 각종 항체를 결합시키고, 거기에 항원을 애널라이트로서 흘려, 항체와 항원의 상호작용을 측정하였다. 항원에는 각종 농도로 조정한 rhIL-6sR을 사용하였다. 측정은 모두 25℃에서 행하였다. 측정에서 얻어진 센서그램으로부터, 키네틱스 파라미터인 결합속도상수 k a(1/Ms) 및 해리속도상수 k d(1/s)를 산출하고, 그 값을 토대로 하여 K D(M)를 산출하였다. 각 파라미터의 산출에는 Biacore T100 Evaluation Software(BIACORE)를 사용하였다. 그 결과, 변이개소를 조합시킨 RDC_2, RDC_3, RDC_4, RDC_5, RDC_6, RDC_7, RDC_8, RDC_11, RDC_23은 동시에 측정한 변이개소가 1개소인 RD_28보다도 작은 K D값을 가지고 있었다(표 2). 그 중에서도 높은 친화성을 나타낸 RDC_23에 관해 도 7에 센서그램을 나타내었다.
  TIFF 112010026138634-pct00003.png 79 123
 이 사실로부터, 이들 항체의 친화성은 변이개소 조합 전의 항체보다도 강하다고 생각되었다. 중화활성과 마찬가지로, 친화성 성숙으로 발견된 변이개소를 조합시킴으로써, 보다 높은 친화성을 갖는 항체가 취득 가능한 것이 명백해졌다. WT와 비교하여 높은 활성 또는 친화성을 나타내는 변이체의 아미노산 서열은 이하와 같다(WT로부터의 변이개소에는 밑줄).
 (HCDR2)
 서열번호:45 YISYSGIT NYNPSLKS
 (HCDR3)
 서열번호:57 LLAR ATAMDY
 서열번호:58 VLAR ATAMDY
 서열번호:59 ILAR ATAMDY
 서열번호:60 TLAR ATAMDY
 서열번호:61 VLAR ITAMDY
 서열번호:62 ILAR ITAMDY
 서열번호:63 TLAR ITAMDY
 서열번호:64 LLAR ITAMDY
 (LCDR3)
 서열번호:79 GQGN RLPYT
 즉, HCDR2의 9번째의 아미노산이 Asn이고, HCDR3의 1번째의 아미노산이 Leu, Val, Ile, Thr 중 어느 하나로부터 선택되며, HCDR3의 5번째의 아미노산이 Ala, Ile 중 어느 하나로부터 선택되고, LCDR3의 1번째의 아미노산이 Gly이며, LCDR3의 5번째의 아미노산이 Arg인 항체를 제작함으로써, WT보다도 중화활성 및 친화성이 현저히 향상된 항IL-6 수용체 항체를 제작하는 것이 가능하다.
  Protein A/G를 사용한 Biacore 에 의한 친화성 해석
 Biacore T100(BIACORE)을 사용해서, WT 및 RDC_23의 항원 항체반응의 속도론적 해석을 행하였다. 센서칩 상에 Purified Recomb Protein A/G(Pierce)(이하, Protein A/G)를 고정화하여, 거기에 각종 항체를 결합시키고, 거기에 항원을 애널라이트로서 흘려, 항체와 항원의 상호작용을 측정하였다. 항원에는 각종 농도로 조정한 rhIL-6sR(R&D systems) 및 재조합 가용형 IL-6 수용체(실시예 1에 있어서 조제한 SR344)를 사용하였다. 바큘로바이러스 감염 곤충세포로부터 생산된 rhIL-6sR은 당사슬 구조가 하이만노오스형인 것에 대해, CHO세포로부터 생산된 SR344는 당사슬구조가 복합형 당사슬로 말단에 시알산이 결합되어 있다고 생각된다. 실제의 인간 생체 내의 가용형 IL-6 수용체의 당사슬구조가 복합형 당사슬로 말단에 시알산이 결합되어 있다고 생각되는 것으로부터, SR344가 인간 생체 내의 가용형 IL-6 수용체의 구조에 가깝다고 생각하여, 본 실험에서는 rhIL-6sR과 SR344의 비교시험을 실시하였다.
 측정으로 얻어진 센서그램으로부터, 키네틱스 파라미터인 결합속도상수 k a(1/Ms) 및 해리속도상수 k d(1/s)를 산출하고, 그 값을 토대로 하여 K D(M)를 산출하였다. 각 파라미터의 산출에는 Biacore T100 Evaluation Software(BIACORE)를 사용하였다.
 센서칩은, 아민 커플링법에 의해 Protein A/G를 CM5(BIACORE)에 약 3000 RU 고정화함으로써 제작하였다. 제작한 센서칩을 사용하여, Protein A/G에 결합시킨 항체(WT와 RDC_23)와 rhIL-6sR 및 SR344의 2종류의 가용형 IL-6 수용체와의 상호작용의 속도론적 해석을 행하였다. 러닝 버퍼에는 HBS-EP+를 사용하고, 속도는 20 μL/min로 하였다. 각 항체는 Protein A/G에 약 100 RU 결합하도록 조제하였다. 애널라이트로서 사용한 rhIL-6sR은 HBS-EP+를 사용하여, 0, 0.156, 0.313, 0.625 ㎍/mL로 조제하고, SR344는 0, 0.0654, 0.131, 0.261 ㎍/mL로 조정하였다. 측정은 먼저 목적의 항체인 WT와 RDC_23을 Protein A/G에 결합시키고, 거기에 애널라이트용액을 3분간 상호작용시키고, 그 후 HBS-EP+(BIACORE)로 전환하여 10분간 해리상을 측정하였다. 해리상의 측정 종료 후, 10 μL의 10 mM glycine-HCl(pH 1.5)로 세정하여, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하였다. 실험은 모두 37℃에서 행하였다.
 WT와 RDC_23 각각에 대해서 이 사이클을 따라 측정을 행하고, rhIL-6sR 및 SR344의 2종류의 가용형 IL-6 수용체에 대해 얻어진 센서그램을 도 8, 도 9, 도 10 및 도 11에 나타내었다. 얻어진 센서그램에 대해서, Biacore 전용 데이터 해석 소프트웨어인 Biacore T100 Evaluation Software를 사용하여 속도론적인 해석을 행하였다(표 3). 그 결과, rhIL-6sR와 SR344의 비교에 있어서, WT 및 RDC_23 모두 SR344를 사용한 쪽이 얻어지는 친화성이 2~3배 약해지는 것이 명확해졌다. RDC_23은 rhIL-6sR과 SR344의 양쪽에 대해서, WT와 비교하여 40~60배 정도 친화성이 향상되어 있어, 친화성 성숙에 의해 얻어진 각 CDR 개변의 조합에 의해, 인간 생체 내의 가용형 IL-6 수용체의 구조에 가깝다고 생각되는 SR344에 대해서도, WT와 비교하여 매우 강한 친화성을 나타내는 것이 명백해졌다. 이후의 실시예에 있어서는, 측정은 모두 37℃에 있어서, SR344 및 protein A/G를 사용한 항원 항체반응의 속도론적 해석을 행하는 것으로 한다.
  TIFF 112010026138634-pct00004.png 35 158
  [ 실시예 3] CDR 프레임워크 개변에 의한 혈장 중 체류성의 향상과 면역원성 리스크를 저감시킨 H53 / L28 의 창제
 Cancer Res. 1993 Feb 15;53(4):851-6에 있어서 인간화된 마우스 PM1 항체(이후 Wild type, WT로 약칭, H사슬 WT를 H(WT)로 하고, L사슬 WT를 L(WT)로 함)의 혈장 중 체류성 향상, 면역원성 리스크의 저감 및 안정성의 향상을 목표로 하여 이하와 같이 개변을 실시하였다. 혈장 중 체류성을 향상시키기 위해서, WT의 H사슬 가변영역 및 L사슬 가변영역 서열에 등전점을 저하시키는 개변의 도입을 행하였다.
  인간화 PM1 항체의 입체구조 모델의 제작
 먼저 인간화 PM1 항체(H(WT)/L(WT))의 가변영역 표면에 노출되는 아미노산 잔기를 확인하기 위해, MOE 소프트웨어(Chemical Computing Group Inc.)를 사용하여, 호몰로지 모델링에 의해 인간화된 마우스 PM1 항체의 Fv영역 모델을 제작하였다.
  인간화 PM1 항체의 등전점 저하를 위한 개변 개소의 선정
 제작한 모델의 상세한 해석에 의해, 등전점을 저하시키는 개변 도입 개소로서 FR 서열에 있어서는 표면에 노출되는 아미노산 중에서, H16, H43, H81, H105, L18, L45, L79, L107(Kabat 넘버링, Kabat EA et al. 1991. Sequences of Proteins of Immunological Interest. NIH)이, CDR 서열로서는 H31, H64, H65, L24, L27, L53, L55가, 활성이나 안정성을 저하시키지 않고, 등전점을 저하시킬 수 있는 후보가 된다고 생각되었다.
  인간화 PM1 항체에 잔존하는 마우스 서열의 제거
 인간화 PM1 항체는 마우스 PM1 항체를 인간화한 항체 서열이다(Cancer Res. 1993 Feb 15;53(4):851-6). 인간화 PM1 항체의 H사슬은, 인간 항체 가변영역인 NEW의 프레임워크에 CDR 그래프팅하고 있으나, H사슬의 H27, H28, H29, H30, H71은 활성 유지를 위해 마우스 서열을 그대로 이용하고 있다. 면역원성의 리스크를 생각하면 마우스 서열은 적으면 적을수록 좋다고 생각되기 때문에, H27, H28, H29, H30을 인간 서열로 하기 위한 서열을 탐색하였다.
  인간화 PM1 항체의 안정성 향상을 목적으로 한 개변 개소의 선정
 인간화 PM1 항체(H(WT)/L(WT))의 가변영역에 있어서, H65의 세린으로부터 글리신으로의 치환(턴 구조의 안정화, HCDR2의 콘센서스 서열로 개변함으로써 안정화), H69의 메티오닌으로부터 이소류신으로의 치환(소수 코어구조를 안정화) 및 H70의 류신으로부터 세린으로의 치환(표면 노출 잔기를 친수화함으로써 안정화), H58의 트레오닌으로부터 아스파라긴으로의 치환(HCDR2의 콘센서스 서열로 개변함으로써의 안정화), L93의 트레오닌으로부터 세린으로의 치환(표면 노출 잔기를 친수화함으로써 안정화), H107의 세린으로부터 이소류신으로의 치환(β시트의 안정화)을 행함으로써 안정화를 향상시키는 것이 가능하다고 생각하여, 이들 개변은 안정성을 향상시키는 후보가 된다고 생각되었다.
  인간화 PM1 항체의 In silico로 예측된 T- cell 에피토프의 제거
 먼저 인간화 PM1 항체(H(WT)/L(WT))의 가변영역을 TEPITOPE(Methods. 2004 Dec;34(4):468-75)를 사용하여 해석을 행하였다. 그 결과, L사슬 CDR2에, 많은 HLA에 결합하는 T-cell 에피토프가 존재하는 것이 나타내어졌다. 이에, TEPITOPE 해석에 있어서, L사슬 CDR2의 면역원성 리스크를 저감시키면서, 안정성, 결합활성, 중화활성을 저하시키지 않는 개변을 검토하였다. 그 결과, L사슬 CDR2의 L51의 트레오닌을 글리신으로 치환함으로써, 안정성, 결합활성, 중화활성을 저하시키지 않고 HLA로 결합하는 T-cell 에피토프를 제거할 수 있는 것이 명확해졌다.
  프레임워크 서열의 선정
 일반 공개되어 있는 Kabat Database (ftp://ftp. ebi. ac. uk/pub/databases/kabat/) 및 I㎎T Database (http://i㎎t. cines. fr/)로부터 인간 항체 아미노산 서열 데이터를 입수하여, 구축한 데이터베이스를 사용함으로써, 각 프레임으로 나누어 호몰로지 검색이 가능하다. 인간 프레임워크의 선정에 있어서, 등전점의 저하, 잔존하는 마우스 서열의 제거, 안정성의 향상의 관점에서 전술한 각 항목의 개변을 갖는 인간 프레임워크 서열을 데이터베이스에서 검토를 행하였다. 그 결과, 이하에 나타내는 바와 같이 개변 항체 H53/L28의 각 프레임워크를 이하의 서열로 함으로써 결합활성, 중화활성을 저하시키지 않고, 전술한 항목을 만족시키는 것이 명백해졌다. Source는 그 인간 서열의 유래이고, 서열 중 밑줄친 부분의 아미노산 잔기가 WT와 비교하여 개변을 도입한 아미노산이다.
  TIFF 112010026138634-pct00005.png 80 176
 또한, 전술한 H53의 FR3는 비인간 서열이 존재하고 있기 때문에, 추가적으로 면역원성 리스크를 저감하는 것이 바람직하다. 면역원성 리스크를 저감하는 개변으로서, H89의 Ala를 Val로 치환한 서열(서열번호:127)로 하는 것이 가능하다고 생각된다. 또한 H53의 FR3의 H71의 Arg는 결합활성에 중요하기 때문에(Cancer Res. 1993 Feb 15;53(4):851-6), H71이 Arg에서 보존되어 있는 인간 VH1 서브클래스의 FR3 서열(서열번호:128), 또는, 인간 VH3 서브클래스의 FR3 서열(서열번호:129)을 사용함으로써, H사슬, L사슬 모두 프레임워크로서는 완전히 인간 서열인 항인간 IL-6 수용체 항체를 제작 가능하다고 생각된다.
  CDR 서열의 선정
 CDR 서열에 있어서, 첫째로 결합활성, 중화활성을 저하시키지 않고, 등전점의 저하, 안정성의 향상, T-cell 에피토프의 제거의 관점에서 H53/L28의 각 CDR 서열을 이하와 같이 선정하였다.
  TIFF 112010026138634-pct00006.png 89 86
  개변 항체의 발현벡터 제작·발현·정제
 개변한 항체의 발현벡터 제작·발현·정제는, 실시예 1에 기재한 방법으로 행하였다. 인간화된 마우스 PM1 항체의 H(WT) 변이 도입용 벡터, L(WT) 변이 도입용 벡터로 선정된 프레임워크 서열, CDR 서열이 되도록 순차 개변을 도입하였다. 최종적으로 얻어진 선정된 프레임워크 서열, CDR 서열을 갖는 H53/L28(항체 아미노산 서열 H53 서열번호:104, L28 서열번호:105)을 코드하는 동물세포 발현용 벡터를 사용하여, H53/L28의 발현·정제를 행하고, 이하의 평가에 사용하였다.
  개변 항체 H53 / L28 등전점 전기영동에 의한 등전점 평가
 가변영역의 아미노산 개변에 의한 전장 항체의 등전점의 변화에 대해 평가하기 위해, WT와 개변 항체 H53/L28의 등전점 전기영동에 의한 분석을 실시하였다. 등전점 전기영동은 이하와 같이 행하였다. Phastsystem Cassette(Amersham Biosciences사제)를 사용하여 이하의 팽윤액으로 30 min 정도 Phast-Gel Dry IEF (Amersham Biosciences사제) 겔을 팽윤시켰다.
 밀리Q워터                                                                                                                1.5  mL
 Pharmalyte 5-8 for IEF (Amersham Biosciences사제) 50 μL
 Pharmalyte 8-10.5 for IEF (Amersham Biosciences사제) 50 μL
 팽윤된 겔을 사용하여 PhastSystem(Amersham Biosciences사제)에 의해 이하의 프로그램으로 전기영동을 행하였다. 샘플은 Step 2에서 겔에 첨가하였다. pI 마커로서, Calibration Kit for pI(Amersham Biosciences사제)를 사용하였다.
 Step  1:  2000  V                  2.5  mA                  3.5  W                  15℃                  75  Vh
 Step  2:  200  V                  2.5  mA                  3.5  W                  15℃                  15  Vh
 Step  3:  2000  V                  2.5  mA                  3.5  W                  15℃                  410  Vh
 영동 후의 겔은 20% TCA로 고정한 후, Silver staining Kit, protein(Amersham Biosciences사제)을 사용하여, 키트에 첨부되어 있는 프로토콜에 따라 은 염색을 행하였다. 염색 후, pI 마커의 기지의 등전점으로부터 샘플(전장 항체)의 등전점을 산출하였다. 그 결과, WT의 등전점은 약 9.3이고, 개변 항체 H53/L28의 등전점은 약 6.5~6.7로, WT로부터 아미노산 치환에 의해 등전점을 약 2.7 저하한 H53/L28이 얻어졌다. 또한, 이 H53/L28의 가변영역(VH, VL 서열)의 이론등전점을 GENETYX(GENETYX CORPORATION)에 의해 산출한 바, 이론등전점은 4.52였다. WT의 이론등전점이 9.20인 것으로부터, WT로부터 아미노산 치환에 의해 가변영역의 이론등전점을 약 4.7 저하한 H53/L28이 얻어졌다.
  H53 / L28 의 인간 IL -6 수용체 중화활성 평가
 WT와 H53/L28을 실시예 1에 나타내는 방법으로 실시하였다. 결과를 도 12에 나타내었다. 그 결과, 개변 항체 H53/L28은 WT와 비교하여, BaF/gp130의 중화활성이 수 배 향상되어 있는 것이 명백해졌다. 즉, H53/L28은 WT와 비교하여, 등전점을 저하시키면서, 중화활성을 향상시킬 수 있었다.
  Bicore 에 의한 H53 / L28 의 인간 IL -6 수용체에 대한 친화성 해석
 WT와 H53/L28의 인간 IL-6 수용체로의 친화성 평가는, Biacore T100(BIACORE)을 사용해서 속도론적 해석을 행하였다. 센서칩 상에 Purified Recomb Protein A/G(Pierce)(이하, Protein A/G)를 고정화하여, 거기에 각종 항체를 결합시키고, 거기에 항원을 애널라이트로서 흘려, 항체와 항원의 상호작용을 측정하였다. 항원에는 각종 농도로 조정한 재조합 가용형 IL-6 수용체(SR344)를 사용하였다. 측정조건은 실시예 2와 동일한 조건으로 실시하였다.
 얻어진 WT와 H53/L28의 센서그램을 도 13에 나타내었다. Biacore 전용 데이터 해석 소프트웨어인 Biacore T100 Evaluation Software를 사용하여 속도론적 해석을 행한 결과를 표 6에 나타내었다. 그 결과, H53/L28은 WT와 비교하여 K D가 6배 정도 저하되어 있고, 친화성이 6배 정도 향상되어 있는 것이 발견되었다. 즉 H53/L28은 WT와 비교하여, 등전점을 저하시키면서, 6배 정도 친화성을 향상시킬 수 있었다. 상세한 검토의 결과, 친화성의 향상에 기여하고 있는 아미노산 변이는 L51의 트레오닌을 글리신으로 치환한 변이인 것이 생각되었다. 즉, L51의 트레오닌을 글리신으로 치환함으로써 친화성을 향상시키는 것이 가능하다고 생각되었다.
  TIFF 112010026138634-pct00007.png 26 123
  H53 / L28 TEPITOPE 에 의한 T- cell 에피토프 예측
 H53/L28의 TEPITOPE 해석(Methods. 2004 Dec;34(4):468-75)을 실시하였다. 그 결과, WT에 비해, HLA에 결합할 가능성이 있는 펩티드 수가 대폭 감소해 있는 것을 알 수 있어, 인간에 있어서의 면역원성 리스크가 저감되었다고 생각되었다.
  [ 실시예 4] H53 / L28 의 혈장 중 체류성 평가
  개변 항체 H53 / L28 의 정상 마우스 혈장 중 동태 평가
 등전점을 저하시킨 개변 항체 H53/L28의 혈장 중 체류성을 평가하기 위해, WT와 개변 항체 H53/L28의 정상 마우스에 있어서의 혈장 중 동태의 비교를 행하였다.
 WT 및 H53/L28을 마우스(C57BL/6J, 일본 찰스리버)에 1 ㎎/㎏으로 정맥 내 및 피하에 단회 투여하여 투여 전 및 투여 후 15분간, 2시간, 8시간, 1일간, 2일간, 5일간, 7일간, 14일간, 21일간, 28일간에서 채혈을 행하였다. 단 투여 후 15분간은 정맥 내 투여군에서만 채혈하였다. 채취한 혈액은 바로 4℃, 15,000 rpm으로 15분간 원심분리하여, 혈장을 얻었다. 분리한 혈장은, 측정을 실시할 때까지 -20℃ 이하로 설정된 냉동고에 보존하였다.
 마우스 혈장 중 농도 측정은 ELISA법으로 측정하였다. 먼저 Recombinant Human IL-6 sR(R&D Systems사제)을 EZ-LinkTM Sulfo-NFS-Biotinylation Kit(PIERCE사제)를 사용하여 비오틴화 하였다. 이 비오틴화 human-sIL-6R을 Reacti-Bind Streptavidin High Binding Capacity(HBC) Coated Plates(PIERCE사제)에 분주하고, 실온에서 1시간 이상 정치하여 human-sIL-6R 고상화 플레이트를 제작하였다. 혈장 중 농도로서 3.2, 1.6, 0.8, 0.4, 0.2, 0.1, 0.05 ㎍/㎖의 검량선 시료와 마우스 혈장 측정시료를 조제하고, human-sIL-6R 고상화 플레이트에 분주하여 실온에서 1시간 정치하였다. 그 후 Anti-human IgG-AP(SIGMA사제)를 반응시키고, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 마우스 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용하여 산출하였다. WT 및 H53/L28의 정맥 내 투여 후의 혈장 중 농도추이를 도 14에, 피하투여 후의 혈장 중 농도추이를 도 15에 나타내었다.
 얻어진 혈장 중 농도추이의 데이터를 약물동태 해석 소프트WinNonlin(Pharsight사제)으로 비모델 의존적 해석을 행하여 약물동태학적 파라미터(AUC, 클리어런스(CL), 반감기(T1/2))를 산출하였다. T1/2은 최종의 3점 또는 WinNonlin이 자동 설정한 최종상의 혈장 중 농도로부터 산출하였다. BA는 정맥 내 투여 후의 AUC에 대한 피하투여 후의 AUC의 비로부터 산출하였다. 얻어진 약물동태적 파라미터를 표 7에 나타내었다.
  TIFF 112010026138634-pct00008.png 29 123
 H53/L28의 정맥 내 투여 후의 혈장 중 반감기(T1/2)는 WT의 약 1.3배로 연장되고, 클리어런스가 약 1.7배 저하되었다. H53/L28의 피하투여 후의 T1/2은 WT의 약 2배로 연장되고, 클리어런스가 약 2.1배 저하되었다. 이와 같이 WT의 등전점을 저하시킴으로써, H53/L28의 혈장 중 체류성을 대폭 향상시킬 수 있었다.
 H53/L28은, 인간화 PM-1 항체(WT)와 비교하여, 결합활성, 중화활성을 향상시키고, 면역원성 리스크를 저감시키면서, 혈장 중 체류성을 대폭 향상시킨 인간화 항IL-6 수용체 항체인 것으로부터, 의약품으로서 개발하는데 있어서 H53/L28에서 적용한 개변은 매우 유용할 것으로 생각되었다.
  [ 실시예 5] PF1 항체의 제작
  인간화 PM1 항체의 발현벡터 및 변이도입 벡터의 제작
 실시예 4에서 제작한 H53/L28에 실시예 2에서 발견된 RDC_23의 친화성을 향상시키는 H사슬 2개소, L사슬 2개소, 합계 4개소의 CDR의 변이를 도입하였다. H53/L28에 RDC_23의 변이를 도입한 H사슬을 PF1_H로 하고, H53/L28에 RDC_23의 변이를 도입한 L사슬을 PF1_L로 하여, 개변 항체의 제작·발현·정제는 실시예 1에 기재한 방법으로 실시하였다. PF1_H의 아미노산 서열을 서열번호:22에, PF1_L의 아미노산 서열을 서열번호:23에 나타낸다.
  인간 IL -6 수용체 중화활성 평가
 정제한 PF1 항체의 중화활성의 평가를 실시예 1에 나타내는 방법으로 행하였다. 단, human interleukin-6(TORAY) 농도를 600 ng/mL로 하여 중화활성의 평가를 행하였다. WT와 PF1의 중화활성을 도 16에 나타내었다. PF1은 WT와 비교하여 100% 저해농도로서 약 100~1000배의 활성을 갖는 것이 명백해졌다.
  Biacore 에 의한 PF1 항체의 인간 IL -6 수용체에 대한 친화성 해석
 본 측정은 실시예 2와 동일한 조건에서 행하였다. 러닝 버퍼에는 HBS-EP+를 사용하고, 속도는 20 μL/min로 하였다. 각 항체는 Protein A/G에 약 100 RU 결합하도록 조제하였다. 애널라이트로서 사용한 SR344는 HBS-EP+를 사용하여 0, 0.065, 0.131, 0.261 ㎍/㎖로 조제하였다. 측정은 먼저 항체용액을 Protein A/G에 결합시키고, 거기에 애널라이트용액을 3분간 상호작용시키고, 그 후 HBS-EP+로 전환하여 10 또는 15분간 해리상을 측정하였다. 해리상의 측정 종료 후, 10 μL의 10 mM glycine-HCl(pH 1.5)로 세정하여, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하였다. 각종 항체에 대해서 이 사이클을 따라 측정을 행하였다.
 얻어진 PF1의 센서그램을 도 17에 나타내었다. 얻어진 센서그램에 대해서, Biacore 전용 데이터 해석 소프트웨어인 Biacore T100 Evaluation Software를 사용하여 속도론적인 해석을 행한 결과를 WT와 H53/L28의 결과와 합하여 표 8에 나타내었다. 그 결과, PF1의 친화성은 WT와 비교하여, 약 150배 향상되어 있는 것이 명백해졌다. 친화성 성숙의 조합에 의해 얻어진 고친화성의 RDC_23 및 혈장 중 체류성을 향상시키고 또한 친화성이 향상된 H53/L28을 조합시킴으로써, PF1의 친화성은 상가(相加)효과에 의해 이들보다도 높은 것이 얻어졌다.
  TIFF 112010026138634-pct00009.png 36 141
  PF1 항체의 시차주사형 열량 측정( DSC )에 의한 열안정성 평가
 PF1 항체의 열안정성의 평가를 실시하기 위해 시차주사형 열량 측정(DSC)에 의한 열변성 중간온도(Tm값)의 평가를 행하였다. WT와 PF1의 정제 항체를 20 mM sodium acetate, 150 mM NaCl, pH 6.0의 용액에 대해 투석(EasySEP, TOMY)을 행하고, 약 0.1 ㎎/mL의 단백질 농도에서, 40℃에서 100℃까지 1℃/min의 승온속도로 DSC측정을 행하였다. 그 결과, WT의 Fab부분의 Tm값은 약 94℃이고, PF1의 Fab부분의 Tm값은 91℃인 것을 알 수 있었다. 일반적인 IgG1 타입의 항체분자의 Fab부분의 Tm값은 약 60℃~85℃의 범위에 있는 것으로부터(Biochem Biophys Res Commun. 2007 Apr 13;355(3):751-7., Mol Immunol. 2007 Apr;44(11):3049-60), 얻어진 PF1 항체의 열안정성은 일반적인 IgG1 분자와 비교하여 매우 높은 것이 나타내어졌다.
  PF1 항체의 고농도 안정성 평가
 PF1 항체의 고농도 제제에 있어서의 안정성의 평가를 행하였다. WT와 PF1의 정제 항체를 20 mM histidine chloride, 150 mM NaCl, pH 6.5의 용액에 대해 투석(EasySEP, TOMY)을 행하고, 그 후 한외여과막에 의해 농축하여, 고농도 안정성 시험을 행하였다. 조건은 이하와 같다.
 항체: WT 및 PF1
 완충액: 20 mM histidine chloride, 150 mM NaCl, pH 6.0
 농도: 145 ㎎/mL
 보존온도와 기간: 25℃-2주, 25℃-4주, 25℃-7주
 회합체 평가법: 시스템 Waters Alliance
                                 칼럼  G3000SWxl(TOSOH)
                                 이동상  50  mM  sodium  phosphate,  300  mM  KCl,  pH  7.0
                                 유속·파장  0.5  ㎖/min,  220  ㎚
                                 샘플을  1/100로  희석해서  분석
 Initial(제제 조제 직후) 및 각 조건에서 보존 후의 제제의 회합체 함유량을 전술한 겔 여과 크로마토그래피법에 의해 평가하여, initial로부터 회합체 함량의 변화량(증가량)에 대해 도 18에 나타내었다. 그 결과, WT 및 PF1은 모두 매우 높은 안정성을 나타내고, 25℃-7주의 회합체량 증가량은 WT에서 약 0.7% 정도, PF1에서 약 0.3%인 것을 알 수 있고, 각각 25℃-1개월당의 회합체 증가량은 각각 약 0.4%와 약 0.17%로, PF1은 특히 고농도에 있어서 매우 높은 안정성을 나타내는 것을 알 수 있었다. WO 2003/039485에 있어서, IgG의 고농도 제제로서 이미 시판되고 있는 Daclizumab의 100 ㎎/mL 제제의 25℃에 있어서의 안정성 데이터가 나타내어져 있으나, Daclizumab의 100 ㎎/mL 제제는 25℃-1개월당의 회합체 증가량은 약 0.3%이고, PF1은 Daclizumab과 비교해도 고농도에 있어서의 안정성이 매우 우수하여, 의약품으로서 고농도의 용액 제제를 개발하는 데 있어서는, 회합체의 증가는 커다란 과제이나, PF1 항체는 고농도에 있어서의 회합체의 증가가 매우 적은 것이 나타내어졌다.
 PF1은 WT에 대해서, 항원 결합능의 향상, 등전점의 저하에 의한 혈장 중 체류성의 향상, 잔존하는 마우스 서열의 제거와 T-cell 에피토프의 제거에 의한 면역원성 리스크의 저감, 안정성의 향상을 목적으로 개변을 가한 분자이나, 실제로 100 ㎎/mL 이상의 고농도 제제에 있어서의 안정성도 WT와 비교해도 매우 높은 것이 명백해져, 이와 같은 분자를 사용함으로써 안정하고 또한 편리성이 높은 고농도 피하투여 제제를 제공하는 것이 가능하다.
  [ 실시예 6] PF1 항체의 인간 IL -6 수용체 형질전환 마우스에 의한 PK/PD시험
  인간 IL -6 수용체 형질전환 마우스를 사용한 체내 동태시험
 WT 및 실시예 5에서 제작한 PF1에 대해서, 인간 IL-6 수용체 형질전환 마우스(hIL-6R tg 마우스, Proc Natl Acad Sci U S A. 1995 May 23;92(11):4862-6)에 있어서의 체내 동태 및 인간 가용형 IL-6 수용체의 in vivo에서의 중화능을 평가하였다. WT 및 PF1을 hIL-6R tg 마우스에 10 ㎎/㎏으로 정맥 내에 단회 투여하여 투여 전 및 투여 후 15분간, 2시간, 4시간, 8시간, 1일간, 2일간, 4일간, 7일간에서 채혈을 행하였다. 채취한 혈액은 바로 4℃, 15,000 rpm으로 15분간 원심분리하여, 혈장을 얻었다. 분리한 혈장은, 측정을 실시할 때까지 -20℃ 이하로 설정된 냉동고에 보존하였다.
 마우스 혈장 중 농도 측정은 ELISA법으로 측정하였다. 혈장 중 농도로서 6.4, 3.2, 1.6, 0.8, 0.4, 0.2, 0.1 ㎍/mL의 검량선 시료를 조제하였다. 검량선 시료 및 마우스 혈장 측정시료를 Anti-human IgG(γ-chain specific) F(ab')2(Sigma사제)로 고상화한 이뮤노플레이트(Nunc-Immuno Plate, MaxiSorp(Nalge nunc International사제))에 분주하고, 실온에서 1시간 정치 후, Goat Anti-Human IgG-BIOT(Southern Biotechnology Associates사제) 및 Streptavidin-alkaline phosphatase conjugate(Roche Diagnostics사제)를 순차 반응시키고, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 마우스 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용해서 산출하였다. WT 및 PF1의 혈장 중 농도추이를 도 19에 나타내었다. PF1의 투여 4일간 후의 혈장 중 농도는 WT와 비교하여 약 5배 높은 값이었던 것으로부터, PF1은 WT와 비교하여 인간 IL-6 수용체 형질전환 마우스에 있어서 혈장 중 체류성이 향상되어 있는 것이 명백해졌다.
 인간 IL-6 수용체 형질전환 마우스는, 혈장 중에 인간 가용형 IL-6 수용체를 생산하는 것을 알 수 있다. 그 때문에, 인간 IL-6 수용체 형질전환 마우스에 항인간 IL-6 수용체 항체를 투여함으로써, 혈장 중에 존재하는 인간 가용형 IL-6 수용체의 중화효과를 평가하는 것이 가능하다.
 WT 또는 PF1의 투여에 의해, 인간 가용형 IL-6 수용체가 어느 정도 중화되어 있는지를 평가하기 위해, 마우스 혈장 중의 비결합형 인간 가용형 IL-6 수용체 농도의 측정을 측정하였다. 마우스의 혈장 6 μL를 BSA를 함유하는 희석 버퍼로 2배로 희석하고, 0.22 ㎛의 필터컵(Millipore)에 있어서 건조시킨 적량의 rProtein A Sepharose Fast Flow(GE Healthcare) 수지에 첨가함으로써 혈장 중에 존재하는 모든 IgG형 항체(마우스 IgG, 항인간 IL-6 수용체 항체 및 항인간 IL-6 수용체 항체-인간 가용형 IL-6 수용체 복합체)를 protein A에 흡착시켰다. 그 후, 고속원심기로 스핀 다운하여, 패스용액을 회수하였다. 패스용액에는 protein A에 결합한 항인간 IL-6 수용체 항체-인간 가용형 IL-6 수용체 복합체는 포함되지 않기 때문에, 패스용액 중의 인간 가용형 IL-6 수용체 농도를 측정함으로써, 비결합형 가용형 IL-6 수용체 농도를 측정 가능하다. 가용형 IL-6 수용체 농도는, Quantikine Human IL-6 sR(R&D Systems)을 사용하였다. WT 및 PF1 투여 마우스의 4시간 후, 8시간 후, 24시간 후, 48시간 후, 96시간 후, 168시간 후의 비결합형 가용형 IL-6 수용체 농도의 측정을 첨부 설명서에 따라 실시하였다.
 결과를 도 20에 나타내었다. WT 및 PF1을 10 ㎎/㎏으로 정맥 내에 단회 투여한 4시간 후, 8시간 후까지는 WT 및 PF1 모두 비결합형 가용형 IL-6 수용체 농도는 10 ng/mL 이하로, 인간 가용형 IL-6 수용체가 중화되어 있는 것이 확인되었다. 그러나, 24시간 후의 WT 비결합형 가용형 IL-6 수용체 농도는 500 ng/mL 정도였던 것에 대해, PF1의 비결합형 가용형 IL-6 수용체 농도는 10 ng/mL 이하였던 것으로부터, PF1은 WT보다도 지속적으로 인간 가용형 IL-6 수용체가 중화되고 있는 것이 발견되었다.
 PF1은, 친화성 성숙을 통해 발견된 RDC_23과 혈장 중 체류성 등을 개선시킨 H53/L28을 조합시킨 것으로, in vivo에서 긴 혈장 중 체류성과 높은 중화활성을 발휘하는 것이 가능할 것으로 생각되었다. 실제로, 인간 가용형 IL-6 수용체를 생산하는 인간 IL-6 수용체 형질전환 마우스에 있어서, PF1은 중화효과와 혈장 중 농도가 WT보다도 지속되는 것이 나타내어졌다.
 PF1은 고농도 제제에 있어서의 안정성 및 면역원성 리스크에 있어서도 WT(인간화 PM-1 항체)보다도 우수하고, 또한 인간 IL-6 수용체 형질전환 마우스에 있어서도 IL-6 수용체 중화효과와 혈장 중 체류성이 우수한 것으로부터, 의약품으로서 개발하는 데 있어서 PF1에서 적용한 개변은 매우 유용할 것으로 생각되었다.
  [ 실시예 7] IgG2 IgG4 의 산성조건하에 있어서의 안정성의 향상
  IgG2 , IgG4 화 인간화 IL -6 수용체 항체 발현벡터의 제작·발현
 Fcγ 수용체로의 결합활성을 저하시키기 위해 인간화 PM1 항체(Cancer Res. 1993 Feb 15;53(4):851-6)의 정상영역은 IgG1 아이소타입이나, 정상영역을 IgG2로 치환한 분자(WT-IgG2, 서열번호:109) 및 IgG4(Mol Immunol. 1993 Jan;30(1):105-8.)로 치환한 분자(WT-IgG4, 서열번호:110)를 제작하였다. IgG의 발현에는 동물세포 발현용 벡터를 사용하였다. 실시예 1에서 사용하고 있는 인간화 PM1 항체(IgG1)의 정상영역부분의 NheI/NotI 소화와 ligation에 의해 정상영역을 IgG2 또는 IgG4로 치환한 발현벡터를 구축하였다. 각 DNA 단편의 염기서열은, BigDye Terminator Cycle Sequencing Kit(Applied Biosystems)를 사용하여, DNA 시퀀서 ABI PRISM 3730xL DNA Sequencer 또는 ABI PRISM 3700 DNA Sequencer(Applied Biosystems)로, 첨부 설명서 기재의 방법에 따라 결정하였다. L사슬로서 WT를 사용하고, WT-IgG1, WT-IgG2, WT-IgG4의 발현은 실시예 1에 기재한 방법으로 실시하였다.
 (1) 인간화 PM1 항체(WT-IgG1) H사슬: 서열번호:15(아미노산 서열)
 (2) WT-IgG2 H사슬: 서열번호:109(아미노산 서열)
 (3) WT-IgG4 H사슬: 서열번호:110(아미노산 서열)
  WT - IgG1 , WT - IgG2 , WT - IgG4 프로테인 A 염산 용출에 의한 정제
 얻어진 배양상청에 TBS 중에 현탁시킨 50 μL의 rProtein A Sepharose TM Fast Flow(Amersham Biosciences)를 첨가하고, 4℃에서 4시간 이상 전도혼화하였다. 그 용액을 0.22 ㎛의 필터컵 Ultrafree (R)-MC(Millipore)에 옮기고, TBS 500 μL로 3회 세정 후, rProtein A Sepharose TM 수지에 100 μL의 10 mM HCl, 150 mM NaCl, pH 2.0으로 현탁하여 2분간 정치한 후, 항체를 용출시켰다(염산 용출법). 바로, 6.7 μL의 1.5 M Tris-HCl, pH 7.8을 첨가하여 중화하였다. 용출은 2회 행하여, 200 μL의 정제 항체를 얻었다.
 염산 용출 법에 의해 정제한 WT - IgG1 , WT - IgG2 , WT - IgG4 의 겔 여과 크로마토그래피 분석
 염산 용출법에 의해 얻어진 정제품의 회합체 함량을 평가하기 위해 겔 여과 크로마토그래피 분석을 행하였다.
 회합체 평가법: 시스템 Waters Alliance
                                 칼럼  G3000SWxl(TOSOH)
                                 이동상  50  mM  sodium  phosphate,  300  mM  KCl,  pH  7.0
                                 유속·파장  0.5  ㎖/min,  220  ㎚
 결과를 도 21에 나타내었다. WT-IgG1의 정제 후의 회합체 함량은 2% 정도였던 것에 대해, WT-IgG2 및 WT-IgG4의 정제 후의 회합체 함량은 25% 정도였다. 이 사실로부터, IgG1은 염산 용출시의 산에 대해 안정하나, IgG2 및 IgG4는 염산 용출시의 산에 대해 불안정하여 변형·회합화가 진행된 것으로 생각되어, IgG2 및 IgG4는 IgG1과 비교하여 산성조건하에 있어서의 안정성이 낮은 것이 명백해졌다. IgG 분자의 정제에 있어서는, 프로테인 A가 다용되나, IgG 분자의 프로테인 A로부터의 용출은 산성조건하에서 행해진다. 또한 IgG 분자를 의약품으로서 개발하는 데 있어서 필요한 바이러스 불활성화는, 일반적으로 산성조건하에 있어서 행해진다. 이들 사실로부터, IgG 분자의 산성조건하에 있어서의 안정성은 높은 쪽이 바람직하나, IgG2 및 IgG4 분자는 산성조건하에 있어서의 안정성이 IgG1보다도 떨어지는 것을 알 수 있어, 의약품으로서 개발하는 데 있어서는 산성조건하에서의 변성·회합화라는 과제가 존재하는 것이 처음으로 명백해졌다. 의약품으로서 개발하는 데 있어서는 변성·회합화라는 과제가 해결되는 것이 바람직하다고 생각되나, 지금까지 아미노산 치환에 의해 이것을 해결하는 방법은 보고되어 있지 않다.
  WT - IgG2 , WT - IgG4 CH3 도메인 개변체의 제작과 평가
 IgG2 및 IgG4 분자는 산성조건하에 있어서의 안정성이 IgG1보다도 떨어지는 것이 나타났기 때문에, IgG2 및 IgG4 분자의 산성조건하에서의 안정성을 개선시키는 개변체를 검토하였다. IgG2 및 IgG4 분자의 정상영역의 모델로부터, 산성조건하에 있어서의 불안정 요인으로서, CH3 도메인에 있어서의 CH3/CH3 계면의 불안정성이 생각되어, 다양한 검토를 행한 결과, IgG2에 있어서는 EU 넘버링 397번째의 메티오닌, IgG4에 있어서는 EU 넘버링 409번째의 아르기닌이 각각 IgG2 및 IgG4의 CH3/CH3 계면을 불안정화하고 있다고 생각되었다. 이에, IgG2의 EU 넘버링 397번째의 메티오닌을 발린으로 개변한 항체(IgG2-M397V 서열번호:111(아미노산 서열)) 및 IgG4의 EU 넘버링 409번째의 아르기닌을 리신으로 개변한 항체(IgG4-R409K 서열번호:112(아미노산 서열))를 제작하였다.
 목적의 항체의 발현벡터의 제작·발현·정제는, 전술한 염산 용출의 방법을 사용하여 행하였다. Protein A로부터의 염산 용출법에 의해 얻어진 정제품의 회합체 함량을 평가하기 위해 겔 여과 크로마토그래피 분석을 행하였다.
 회합체 평가법: 시스템 Waters Alliance
                                 칼럼  G3000SWxl(TOSOH)
                                 이동상  50  mM  sodium  phosphate,  300  mM  KCl,  pH  7.0
                                 유속·파장  0.5  ㎖/min,  220  ㎚
 결과를 도 21에 나타내었다. WT-IgG1의 정제 후의 회합체 함량은 2% 정도였던 것에 대해, WT-IgG2 및 WT-IgG4의 정제 후의 회합체 함량은 25% 정도였다. 그것에 대해, CH3 도메인 개변체인 IgG2-M397V 및 IgG4-R409K의 회합체 함량이 IgG1과 동등 레벨인 2% 정도였다. IgG2의 EU 넘버링 397번째인 메티오닌을 발린으로 개변함으로써, 또는, IgG4의 EU 넘버링 409번째의 아르기닌을 리신으로 개변함으로써, IgG2 항체 및 IgG4 항체의 산성조건하에 있어서의 안정성을 향상시키는 것이 가능한 것이 명백해졌다. 또한, 실시예 5와 동일한 방법으로, WT-IgG2, WT-IgG4, IgG2-M397V 및 IgG4-R409K의 열변성 중간온도를 측정한 결과, WT-IgG2, WT-IgG4에 비해 IgG2-M397V, IgG4-R409K는 각각 개변을 도입한 CH3 도메인의 Tm값이 높은 것을 알 수 있었다. 이 사실로부터, IgG2-M397V, IgG4-R409K는 각각 WT-IgG2, WT-IgG4에 비해 열안정성에 있어서도 우수한 것을 알 수 있었다.
 IgG2 및 IgG4는 프로테인 A를 사용한 정제공정 및 바이러스 불활성화공정에 있어서 산성조건하에 폭로되는 것으로부터, 동일 공정에 있어서의 변성·회합화가 과제였으나, IgG2 및 IgG4의 정상영역 서열로서, IgG2-M397V 및 IgG4-R409K를 사용함으로써, 그 과제를 해결하는 것이 가능한 것이 명백해져, 동일 개변은 IgG2 및 IgG4 항체를 의약품으로서 개발하는 데 있어서 매우 유용한 것을 알 수 있었다. 또한 IgG2-M397V 및 IgG4-R409K는 열안정성도 우수하다는 점으로부터도 유용한 것을 알 수 있었다.
  [ 실시예 8] IgG2 디설피드 결합 유래 이질성 개선
  WT - IgG1 , WT - IgG2 , WT - IgG4 프로테인 A 초산용출에 의한 정제
 실시예 7에서 얻어진 배양상청에 TBS 중에 현탁시킨 50 μL의 rProtein A Sepharose TM Fast Flow(Amersham Biosciences)를 첨가하고, 4℃에서 4시간 이상 전도혼화하였다. 그 용액을 0.22 ㎛의 필터컵 Ultrafree (R)-MC(Millipore)로 옮기고, TBS 500 μL로 3회 세정 후, rProtein A Sepharose TM 수지에 100 μL의 50 mM 초산나트륨 수용액, pH 3.3으로 현탁하여 2분간 정치한 후, 항체를 용출시켰다. 바로, 6.7 μL의 1.5 M Tris-HCl, pH 7.8을 첨가하여 중화하였다. 용출은 2회 행하여, 200 μL의 정제 항체를 얻었다.
  WT - IgG1 , WT - IgG2 , WT - IgG4 의 양이온 교환 크로마토그래피( IEC ) 분석
 정제된 WT-IgG1, WT-IgG2, WT-IgG4의 균일성을 평가하기 위해 양이온 교환 크로마토그래피에 의한 분석을 행하였다.
 IEC 평가법: 시스템 Waters Alliance
                 칼럼  ProPac  WCX-10(Dionex)
 이동상 A : 25 mM MES-NaOH, pH 6.1
               B  :  25  mM  MES-NaOH,  250  mM  Na-Acetate,  pH  6.1
 유속·파장 0.5 ㎖/min, 280 ㎚
 그라디언트 B: 50%-75% (75min) WT-IgG1 분석시
                       B:  30%-55%  (75min)  WT-IgG2,  WT-IgG4  분석시
 결과를 도 22에 나타내었다. WT-IgG1, WT-IgG4는 이온 교환 분석에서 싱글 피크였으나, WT-IgG2는 복수의 피크가 존재하고 있는 것을 알 수 있어, IgG2 분자는, IgG1이나 IgG4와 비교하여 이질성이 많은 것을 알 수 있었다. 실제로, IgG2의 아이소타입은, 힌지영역의 디설피드 결합에 유래하는 이질성(불균일성)이 보고되어 있어(Chu GC, Chelius D, Xiao G, Khor HK, Coulibaly S, Bondarenko PV. Accumulation of Succinimide in a Recombinant Monoclonal Antibody in Mildly Acidic Buffers Under Elevated Temperatures. Pharm Res. 2007 Mar 24;24(6):1145-56), 도 22에 나타내어진 IgG2의 헤테로 피크도 이것에 유래하는 목적물질/관련물질이라고 생각된다. 목적물질/관련물질의 이질성의 제조간 차를 유지하면서 의약품으로서 대량으로 제조하는 것은 어려워, 의약품으로서 개발하는 항체분자는 바람직하게는 가능한 한 균일한(이질성이 적은) 물질인 편이 좋다. 따라서 야생형 IgG2는, 항체를 의약품으로서 개발하는 데 있어서 중요한 균일성에 과제가 있다고 생각된다. 실제로, US20060194280(A1)에 있어서, 천연형 IgG2는 이온 교환 크로마토그래피 분석에 있어서 디설피드 결합에 유래하는 다양한 헤테로 피크가 관찰되고 있어, 이들의 피크간에는 생물활성이 상이한 것도 보고되어 있다. 이 헤테로 피크를 단일화하는 방법으로서, US20060194280(A1)에 있어서는 정제공정에 있어서의 리폴딩이 보고되어 있으나, 제조에 있어서 이들의 공정을 사용하는 것은 비용이 들고 번잡하기 때문에, 바람직하게는 아미노산 치환에 의해 헤테로 피크를 단일화하는 방법이 바람직하다. 의약품으로서 개발하기 위해서는 힌지영역의 디설피드 결합에 유래하는 이질성이 해결되는 것이 바람직하다고 생각되었으나, 지금가지 아미노산 치환에 의해 이것을 해결하는 방법은 보고되어 있지 않다.
  WT - IgG2 CH1 도메인, 힌지영역의 개변체의 제작과 평가
 도 23에 나타내는 바와 같이 IgG2 분자에 관해서는 다양한 디설피드 결합패턴이 생각된다. IgG2의 힌지영역에 유래하는 이질성의 원인으로서, 디설피드 결합의 어긋남 및 프리 시스테인의 존재가 생각되었다. IgG2는 upper hinge영역에 2개의 시스테인을 갖고(EU 넘버링 219번째와 220번째, 이 upper hinge의 2개의 시스테인에 인접하는 시스테인으로서, H사슬의 CH1 도메인에 존재하는 EU 넘버링 131번째의 시스테인과 L사슬의 C말단의 시스테인 및 이량화하는 상대 H사슬의 동일한 upper hinge의 2개의 시스테인을 들 수 있다. 즉, IgG2의 upper hinge 주변에는 H2L2가 회합한 상태에서는 합계 8개의 시스테인이 인접해 있고, 이것에 의해, 디설피드 결합의 어긋남 및 프리 시스테인에 의한 다양한 이질성이 존재하는 것이 생각된다.
 IgG2의 힌지영역에 유래하는 이질성을 저감하는 것을 목적으로 IgG2의 힌지영역 서열과 CH1 도메인의 개변을 행하였다. IgG2에 있어서 디설피드 결합의 어긋남 및 프리 시스테인에 의한 이질성을 회피하기 위한 검토를 행하였다. 각종 개변체의 검토 결과, 야생형 IgG2 정상영역 서열 중, H사슬의 CH1 도메인에 존재하는 EU 넘버링 131번째의 시스테인과 133번째의 아르기닌을 각각 세린과 리신으로 개변하고, H사슬의 upper hinge에 존재하는 EU 넘버링 219번째의 시스테인을 세린으로 개변(이하, IgG2-SKSC)(IgG2-SKSC: 서열번호:120)함으로써, 열안정성을 저하시키지 않고 이질성을 회피하는 것이 가능할 것으로 생각되었다. 이것에 의해, IgG2-SKSC의 H사슬과 L사슬의 공유결합은, EU 넘버링 220번째의 시스테인과 L사슬 C말단의 시스테인으로 디설피드 결합에 의해 균일하게 형성된다고 생각된다(도 24).
 IgG2-SKSC의 발현벡터의 제작, 발현, 정제는 실시예 1에 기재한 방법으로 실시하였다. 정제된 IgG2-SKSC 및 야생형 IgG2(WT-IgG2)의 균일성을 평가하기 위해 양이온 교환 크로마토그래피에 의한 분석을 행하였다.
 IEC 평가법: 시스템 Waters Alliance
                                 칼럼  ProPac  WCX-10(Dionex)
                                 이동상  A  :  25  mM  MES-NaOH,  pH  5.6
                             B  :  25  mM  MES-NaOH,  250  mM  Na-Acetate,  pH  5.6
                                 유속·파장  0.5  ㎖/min,  280  ㎚
                                 그라디언트  B  :  50%-100%  (75min)
 결과를 도 25에 나타내었다. 전술한 바와 같이, WT-IgG2는 복수의 피크가 존재하고 있으나, IgG2-SKSC는 싱글 피크로서 용출되는 것을 알 수 있었다. IgG2의 힌지영역의 디설피드 결합에 유래하는 이질성은, EU 넘버링 220번째의 시스테인과 L사슬 C말단의 시스테인으로 단일한 디설피드 결합을 형성하는 IgG2-SKSC의 개변을 도입함으로써 회피할 수 있는 것이 나타내어졌다. 또한, 실시예 5와 동일한 방법으로, WT-IgG1, WT-IgG2 및 IgG2-SKSC의 열변성 중간온도를 측정한 결과, WT-IgG2는 WT-IgG1에 비해 낮은 Tm값을 나타내는 Fab 도메인의 피크가 관찰되었으나, IgG2-SKSC에 있어서는 그 피크가 확인되지 않았다. 이 사실로부터, IgG2-SKSC는 WT-IgG2와 비교하여 열안정성에 있어서도 우수한 것을 알 수 있었다.
 야생형 IgG2는, 항체를 의약품으로서 개발하는 데 있어서 중요한 균일성에 과제가 있다고 생각되었으나, IgG2-SKSC를 IgG2의 정상영역 서열로서 사용함으로써, 이 과제를 해결하는 것이 가능한 것이 명백해져, IgG2를 의약품으로서 개발하는 데 있어서 매우 유용한 것을 알 수 있었다. 또한 IgG2-SKSC는 열안정성도 우수하다는 점으로부터도 유용한 것을 알 수 있었다.
  [ 실시예 9] IgG 분자의 C말단 이질성의 개선
  WT - IgG1 의 H사슬 C말단 △ GK 항체의 발현벡터 구축
 항체의 C말단 서열의 이질성으로서, C말단 아미노산의 리신 잔기의 결손 및 C말단의 2아미노산인 글리신, 리신의 결손에 의한 C말단 아미노기의 아미드화가 보고되어 있어(Johnson KA, Paisley-Flango K, Tangarone BS, Porter TJ, Rouse JC. Cation exchange-HPLC and mass spectrometry reveal C-terminal amidation of an IgG1 heavy chain. Anal Biochem. 2007 Jan 1;360(1):75-83.), 의약품으로서 개발하는 데는 이들의 이질성은 존재하지 않는 것이 바람직하다. 실제로, 인간화 PM-1 항체인 TOCILIZUMAB에 있어서도, 그 주성분은 염기서열상 존재하는 C말단 아미노산의 리신이 번역 후 수식에 의해 결손된 서열이나, 리신이 잔존해 있는 부성분도 이질성으로서 존재한다. 이에, C말단 아미노산의 이질성을 저감시키는 것을 목적으로 C말단 아미노산의 개변을 행하였다. 구체적으로는, 야생형 IgG1의 H사슬 정상영역의 C말단의 리신 및 글리신을 염기서열상 사전에 결손시킴으로써, C말단의 2아미노산인 글리신, 리신의 결손에 의한 C말단 아미노기의 아미드화를 억제하는 것이 가능한지 여부를 검토하였다.
 실시예 1에서 얻은 인간화 PM1 항체(WT)의 pB-CH벡터를 사용해서 H사슬 C말단 서열에 변이를 도입하였다. QuikChange Site-Directed Mutagenesis Kit (Stratagene)를 사용해서, 첨부 설명서 기재의 방법으로 EU 넘버링 447번째의 Lys 및/또는 EU 넘버링 446번째의 Gly를 코드하는 염기서열에 대해서, 이것을 종지(終止) 코돈으로 하는 변이를 도입하였다. 이것에 의해, C말단의 1아미노산인 리신(EU 넘버링 447)을 사전에 결손시킨 항체, C말단의 2아미노산인 글리신(EU 넘버링 446), 리신(EU 넘버링 447)을 사전에 결손시킨 항체의 발현벡터를 제작하였다. 인간화 PM1 항체의 L사슬과 발현시킴으로써 H사슬 C말단 △K 항체 및 H사슬 C말단 △GK 항체를 얻었다. 발현·정제는 실시예 1에 기재한 방법으로 실시하였다.
 정제한 H사슬 C말단 △GK 항체의 양이온 교환 크로마토그래피 분석을 이하와 같이 행하였다. 정제한 H사슬 C말단 △GK 항체를 사용해서 이하의 방법으로 양이온 교환 크로마토그래피에 의한 분석을 행하고, C말단 결손이 이질성에 미치는 영향을 평가하였다. 양이온 교환 크로마토그래피 분석조건은 이하와 같고, 인간화 PM1 항체, H사슬 C말단 △K 항체, H사슬 C말단 △GK 항체의 크로마토그램을 비교하였다.
 칼럼: ProPac WCX-10, 4×250 ㎚(Dionex)
 이동상: A: 25 mmol/L MES/NaOH, pH 6.1
                 B:  25  mmol/L  MES/NaOH,  250  mmol/L  NaCl,  pH  6.1
 유속: 0.5 mL/min
 그라디언트: 25% B(5 min)→(105 min)→67% B→(1 min)→100% B(5 min)
 검출: 280 ㎚
 미개변 인간화 PM-1 항체, H사슬 C말단 △K 및 H사슬 C말단 △GK 항체의 분석결과를 도 26에 나타낸다. 비특허문헌(Chu GC, Chelius D, Xiao G, Khor HK, Coulibaly S, Bondarenko PV. Accumulation of Succinimide in a Recombinant Monoclonal Antibody in Mildly Acidic Buffers Under Elevated Temperatures. Pharm Res. 2007 Mar 24;24(6):1145-56)으로부터, 주 피크보다도 오래 유지되는 염기성 피크에 H사슬 C말단 449번째의 Lys 잔존체, 447번째의 Pro 아미드체가 포함되나, H사슬 C말단 △K에서는 확인되지 않았던 염기성 피크의 대폭 감소가 H사슬 C말단 △GK 항체에서는 확인되었던 것으로부터, H사슬 C말단의 2아미노산을 결손시킴으로써 비로소 H사슬 C말단 이질성을 경감시키는 것이 가능한 것을 알 수 있었다.
 H사슬 C말단의 2잔기의 결손이 미치는 열안정성으로의 영향을 평가하기 위해, DSC에 의한 H사슬 C말단 △GK 항체의 열변성 온도측정을 행하였다. DSC 측정용으로서 150 mM NaCl을 포함하는 20 mM 초산완충액, pH 6.0에 투석함으로써 완충액을 치환하였다. 인간화 PM1 항체, H사슬 C말단 △GK 항체 및 레퍼런스용액(투석외액)을 충분히 탈기한 후, 이들을 각각 열량계 셀에 봉입하여 40℃에서의 열평형화를 충분히 행하였다. 다음으로 DSC 주사를 40℃~100℃에서 약 1 K/분 주사속도로 행하였다. 얻어진 변성 피크에 대해서, 비특허문헌(Rodolfo등, Immunology Letters, 1999년, p47-52)을 참고로 피크 어사인을 행한 바, C말단 결손은 CH3 도메인의 열변성온도에 영향을 미치지 않는 것을 확인하였다.
 이것에 의해, H사슬 정상영역 C말단의 리신 및 글리신을 염기서열상 사전에 결손시킴으로써, 항체의 열안정성에 영향을 미치지 않고, C말단 아미노산의 이질성을 저감시키는 것이 가능해졌다. 인간 항체 정상영역 IgG1, IgG2, IgG4에 있어서, C말단 서열은 모두 EU 넘버링 447번째가 Lys, EU 넘버링 446번째가 Gly가 되어 있는 것으로부터, 본건 등에서 발견된 C말단 아미노산의 이질성을 저감시키는 방법은 IgG2 정상영역과 IgG4 정상영역, 또는 그들의 개변체에도 적영 가능하다고 생각된다.
  [ 실시예 10] 신규 최적화 정상영역 M14 GK 서열의 제작
 항원을 중화하는 것이 목적인 항체 의약에 있어서는 Fc영역이 갖는 ADCC 등의 이펙터기능은 필요하지 않아, 따라서, Fcγ 수용체로의 결합은 불필요하다. 면역원성이나 부작용의 측면에서 Fcγ 수용체로의 결합은 바람직하지 않다고 생각된다(Strand V, Kimberly R, Isaacs JD. Biologic therapies in rheumatology: lessons learned, future directions. Nat Rev Drug Discov. 2007 Jan;6(1):75-92., Gessner JE, Heiken H, Tamm A, Schmidt RE. The IgG Fc receptor family. Ann Hematol. 1998 Jun;76(6):231-48.). 인간화 항IL-6 수용체 IgG1 항체인 TOCILIZUMAB은 IL-6 수용체에 특이적으로 결합하고, 그 생물학적 작용을 중화함으로써, 관절 류머티즘 등의 IL-6가 관련하는 질환의 치료제로서 이용 가능하여, Fcγ 수용체로의 결합은 불필요하다.
  Fc γ 수용체 비결합의 최적화 정상영역 M14 GK 의 제작과 평가
 Fcγ 수용체로의 결합을 저하시키는 방법으로서는, IgG 항체의 아이소타입을 IgG1에서 IgG2 또는 IgG4 아이소타입으로 바꾸는 방법을 생각할 수 있다(Ann Hematol. 1998 Jun;76(6):231-48.). Fcγ 수용체로의 결합을 완전히 없애는 방법으로서는, 인공적인 개변을 Fc영역에 도입하는 방법이 보고되어 있다. 예를 들면, 항CD3 항체나 항CD4 항체는 항체의 이펙터기능이 부작용을 야기하기 때문에, Fc영역의 Fcγ 수용체 결합부분에 야생형 서열에는 존재하지 않는 아미노산 변이(Cole MS, Anasetti C, Tso JY. Human IgG2 variants of chimeric anti-CD3 are no㎚itogenic to T cells. J Immunol. 1997 Oct 1;159(7):3613-21., Reddy MP, Kinney CA, Chaikin MA, Payne A, Fishman-Lobell J, Tsui P, Dal Monte PR, Doyle ML, Brigham-Burke MR, Anderson D, Reff M, Newman R, Hanna N, Sweet RW, Truneh A. Elimination of Fc receptor-dependent effector functions of a modified IgG4 monoclonal antibody to human CD4. J Immunol. 2000 Feb 15;164(4):1925-33.)를 도입한 Fcγ 수용체 비결합형의 항CD3 항체나 항CD4 항체의 임상시험이 행해지고 있다(Strand V, Kimberly R, Isaacs JD. Biologic therapies in rheumatology: lessons learned, future directions. Nat Rev Drug Discov. 2007 Jan;6(1):75-92., Chau LA, Tso JY, Melrose J, Madrenas J. HuM291(Nuvion), a humanized Fc receptor-nonbinding antibody against CD3, anergizes peripheral blood T cells as partial agonist of the T cell receptor.Transplantation. 2001 Apr 15;71(7):941-50.). 또한, IgG1의 FcγR 결합부위(EU 넘버링:233, 234, 235, 236, 327, 330, 331번째)를 IgG2(EU 넘버링:233, 234, 235, 236) 및 IgG4(EU 넘버링:327, 330, 331번째)의 서열로 함으로써 Fcγ 수용체 비결합 항체를 제작하는 것이 가능하다고 보고되어 있다(Kim SJ, Park Y, Hong HJ., Antibody engineering for the development of therapeutic antibodies., Mol Cells. 2005 Aug 31;20(1):17-29. Review.). 그러나, IgG1에 이들 변이를 모두 도입하면, 천연에는 존재하지 않는 T-cell 에피토프 펩티드가 될 수 있는 9아미노산의 새로운 펩티드 서열이 출현하여 면역원성의 리스크가 상승한다. 의약품으로서 개발하는 데 있어서는, 면역원성 리스크는 최대한 낮은 것이 바람직하다.
 전술한 과제를 해결하기 위해, IgG2의 정상영역으로의 개변을 검토하였다. IgG2의 정상영역은 FcγR 결합부위 중 EU 넘버링:233, 234, 235, 236이 비결합형이나, FcγR 결합부위 중 EU 넘버링:327, 330, 331번째는 비결합형 IgG4와는 상이한 서열이기 때문에, EU 넘버링:327, 330, 331번째의 아미노산을 IgG4의 서열로 개변할 필요가 있다(Eur J Immunol. 1999 Aug;29(8):2613-24에 있어서의 G2△a). 그러나, IgG4는 EU 넘버링:339번째의 아미노산이 알라닌인 것에 대해, IgG2는 트레오닌이기 때문에, EU 넘버링:327, 330, 331번째의 아미노산을 IgG4의 서열로 개변한 것 만으로는 천연에는 존재하지 않는 T-cell 에피토프 펩티드가 될 수 있는 9아미노산의 새로운 펩티드 서열이 출현해버려, 면역원성 리스크가 상승하기 때문에 바람직하지 않다. 이에, 전술한 개변에 더하여 새롭게 IgG2의 EU 넘버링:339번째의 트레오닌을 알라닌으로 개변함으로써, 새로운 펩티드 서열의 출현을 방지하는 것이 가능한 것을 발견하였다.
 이들 변이에 더하여, 실시예 7에서 발견한 IgG2 산성조건하에서의 안정성을 향상시키는 IgG2의 EU 넘버링 397번째의 메티오닌으로부터 발린으로의 변이, 실시예 8에서 발견된 힌지영역의 디설피드 결합에 유래하는 이질성을 개선시키는 EU 넘버링 131번째의 시스테인으로부터 세린으로의 변이, 133번째의 아르기닌으로부터 리신으로의 변이, 219번째의 시스테인으로부터 세린으로의 변이를 도입하였다. 또한 131번째와 133번째의 변이 도입에 수반하여 천연에는 존재하지 않는 T-cell 에피토프 펩티드가 될 수 있는 9아미노산의 새로운 펩티드 서열이 출현해버려 면역원성 리스크가 발생하는 것으로부터, EU 넘버링 137번째의 글루타민산으로부터 글리신으로의 변이, 138번째의 세린으로부터 글리신으로의 변이를 도입함으로써, 131번째부터 139번째 부근의 펩티드 서열을 천연에 존재하는 인간 서열과 동일한 것으로 하였다. 또한, C말단에 유래하는 이질성을 저감시키기 위해 H사슬 C말단의 EU 넘버링 446, 447번째의 글리신 및 리신을 결손시켰다. 이들 변이를 모두 도입한 정상영역 서열을 M14△GK로 하였다(M14△GK: 서열번호:24). M14△GK는 T-cell 에피토프 펩티드가 될 수 있는 9아미노산의 새로운 펩티드 서열로서 219번째의 시스테인으로부터 세린으로의 변이를 도입한 1개소가 존재하나, 시스테인과 세린은 아미노산 서열로서의 성질이 비슷한 것으로부터 면역원성 리스크는 매우 작다고 생각되어, TEPITOPE에 의한 면역원성 예측에 있어서도 면역원성의 변화는 확인되지 않았다.
 가변영역 서열로서 WT를 갖고, 정상영역 서열로서 M14△GK를 갖는 H사슬 항체 서열(M14△GK: 서열번호:24, WT-M14△GK: 서열번호:113)의 발현벡터를 실시예 1에 기재된 방법으로 제작하고, H사슬로서 WT-M14△GK, L사슬로서 WT를 사용하여 실시예 1에 기재한 방법으로 발현·정제하였다.
 또한, 동일한 방법으로, IgG1 정상영역에 Fcγ 수용체로의 결합을 저하시키기 위해 EU 넘버링:233, 234, 235, 236, 327, 330, 331, 339번째에 변이를 도입하고(Eur J Immunol. 1999 Aug;29(8):2613-24에 있어서의 G1△ab), 또한 C말단의 이질성을 저하시키기 위해 EU 넘버링 446번째와 447번째를 결손시킨(실시예 9) WT-M17△GK(M17△GK: 서열번호:116, WT-M17△GK: 서열번호:115)를 제작하였다. IgG4 정상영역에 Fcγ 수용체로의 결합을 저하시키기 위해 EU 넘버링: 233, 234, 235, 236번째에 변이를 도입하고(Eur J Immunol. 1999 Aug;29(8):2613-24에 있어서의 G4△b, 이 개변에 있어서는 새로운 비인간 서열이 발생하기 때문에 면역원성 리스크가 상승함), 면역원성 리스크를 저감시키기 위해 전술한 개변에 더하여 힌지영역의 디설피드 결합양식을 M14△GK와 동일하게 하기 위해 EU 넘버링:131, 133, 137, 138, 214, 217, 219, 220, 221, 222번째에 변이를 도입하고, 추가적으로 산성조건하에서의 안정성을 향상시키기 위해 EU 넘버링 409번째에 변이를 도입하고(실시예 7), C말단의 이질성을 저하시키기 위해 EU 넘버링 446번째와 447번째를 결손시킨(실시예 9) WT-M11△GK(M11△GK: 서열번호:25, WT-M11△GK: 서열번호:114)의 발현벡터를 제작하였다. H사슬로서 WT-M17△GK 또는 WT-M11△GK, L사슬로서 WT를 사용하여 실시예 1에 기재한 방법으로 발현·정제하였다.
  WT - M14 GK , WT - M17 GK , WT - M11 GK Fc γ 수용체 결합활성의 평가
 FcγRI으로의 결합 평가는 이하와 같이 행하였다. Biacore T100을 사용하여, 센서칩에 고정화한 인간 유래 Fcγ receptorI(이하, FcγRI)과, 애널라이트로서 사용한 IgG1, IgG2, IgG4, M11△GK, M14△GK, M1△GK 7을 상호작용시켜서, 그 결합량을 비교하였다. 인간 유래의 FcγRI으로서는 Recombinant Human FcRIA/CD64(R&D systems)를 사용하고, 샘플로서 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 사용하여 측정을 행하였다. 아민 커플링법에 의해 센서칩 CM5(BIACORE)에 FcγRI을 고정화하였다. 최종적인 FcγRI의 고정량은, 약 13000 RU(resonance units)였다. 러닝 버퍼로서 HBS-EP+를 사용하고, 유속은 20 μL/min로 하였다. 샘플을 HBS-EP+를 사용하여 100 ㎍/mL의 농도로 조정하였다. 분석은, 항체용액의 10 μL를 인젝션하는 2분간을 결합상으로 하고, 그 후 HBS-EP+로 전환하여, 4분간의 해리상으로 하였다. 해리상 종료 후, 2 μL의 5 mM 수산화나트륨을 인젝션함으로써, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하고, 각종 항체용액을 인젝션하여, 센서그램을 얻었다. 애널라이트는 각각 IgG4, IgG2, IgG1, M11, M14, M17의 순서로 흘리고, 그것을 2회 반복하였다. 측정한 결합량 데이터를 비교한 결과를 도 27에 나타내었다. 그 결과, 결합량은 IgG1>IgG4>>IgG2=M11△GK=M14△GK=M17△GK의 순서로 감소하고 있어, 야생형의 IgG2, M11△GK, M14△GK, M17△GK는 야생형의 IgG1, IgG4보다도 FcγRI에 대해 결합이 약한 것이 명백해졌다.
 FcγRIIa로의 결합 평가는 이하와 같이 행하였다. Biacore T100을 사용하여, 센서칩에 고정화한 인간 유래 Fcγ receptor IIa(이하, FcγRIIa)와, 애널라이트로서 사용한 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 상호작용시켜, 그 결합량을 비교하였다. 인간 유래의 FcγRIIa로서는 Recombinant Human FcRIIA/CD32a(R&D systems)를 사용하고, 샘플로서 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 사용하여 측정을 행하였다. 아민 커플링법에 의해 센서칩 CM5(BIACORE)에 FcγRIIa를 고정화하였다. 최종적으로 약 3300 RU의 FcγRIIa를 고정화하였다. 러닝 버퍼로서 HBS-EP+를 사용하고, 유속은 20 μL/min로 하였다. 그 후, 베이스라인이 안정해질 때까지 러닝 버퍼를 흘리고, 측정은 베이스라인이 안정된 후에 행하였다. 고정화한 FcγRIIa에 대해, 애널라이트로서 각 IgG 아이소타입(IgG1, IgG2, IgG4) 및 변이를 도입한 항체(M11△GK, M14△GK, M17△GK)를 상호작용시켜, 그 결합량을 관찰하였다. 러닝 버퍼에는 HBS-EP+를 사용하고, 유속은 20 μL/min, 측정온도는 25℃로 하였다. 각 IgG 및 개변체는 100 ㎍/mL로 조정하고, 애널라이트로서 20 μL 흘려, 고정화한 FcγRIIa와 상호작용시켰다. 상호작용 후에는 200 μL의 러닝 버퍼를 흘림으로써 FcγRIIa로부터 애널라이트를 해리시키고, 센서칩을 재생시켰다. 애널라이트는 각각 IgG4, IgG2, IgG1, M11△GK, M14△GK, M17△GK의 순서로 흘리고, 그것을 2회 반복하였다. 측정한 결합량 데이터를 비교한 결과를 도 28에 나타내었다. 그 결과, 결합량은 IgG1>IgG2=IgG4>M11△GK=M14△GK=M17△GK의 순서로 감소하고 있어, M11△GK, M14△GK, M17△GK는 야생형의 IgG1, IgG2, IgG4의 어느 것보다도 FcγRIIa에 대해 결합이 약한 것이 명백해졌다.
 FcγRIIb로의 결합 평가는 이하와 같이 행하였다. Bicore T100을 사용하여, 센서칩에 고정화한 인간 유래 Fcγ receptor IIb(이하, FcγRIIb)와, 애널라이트로서 사용한 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 상호작용시켜서, 그 결합량을 비교하였다. 인간 유래의 FcγRIIb로서는 Recombinant Human FcRIIB/C(R&D systems)를 사용하고, 샘플로서 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 사용하여 측정을 행하였다. 아민 커플링법에 의해 센서칩 CM5(BIACORE)에 FcγRIIb를 고정화하였다. 최종적으로 약 4300 RU의 FcγRIIb를 고정화하였다. 그 후, 베이스라인이 안정해질 때까지 러닝 버퍼를 흘리고, 측정은 베이스라인이 안정된 후에 행하였다. 고정화한 FcγRIIb에 대해, 애널라이트로서 각 IgG 아이소타입(IgG1, IgG2, IgG4) 및 변이를 도입한 항체(M11△GK, M14△GK, M17△GK)를 상호작용시켜, 그 결합량을 관찰하였다. 러닝 버퍼에는 HBS-EP+(10 mM HEPES, 0.15 M NaCl, 3 mM EDTA, 0.05% v/v Surfactant P20)를 사용하고, 유속은 20 μL/min, 측정온도는 25℃로 하였다. 각 IgG 및 개변체는 200 ㎍/mL로 조정하고, 애널라이트로서 20 μL 흘려, 고정화한 FcγRIIb와 상호작용시켰다. 상호작용 후에는 200 μL 러닝 버퍼를 흘림으로써 FcγRIIb로부터 애널라이트를 해리시키고, 센서칩을 재생시켰다. 애널라이트는 각각 IgG4, IgG2, IgG1, M11△GK, M14△GK, M17△GK의 순서로 흘리고, 그것을 2회 반복하였다. 측정한 결합량 데이터를 비교한 결과를 도 29에 나타내었다. 그 결과, 결합량은 IgG4>IgG1>IgG2>M11△GK=M14△GK=M17△GK의 순서로 감소하고 있어, M11△GK, M14△GK, M17△GK는 야생형의 IgG1, IgG2, IgG4의 어느 것보다도 FcγRIIb에 대해 결합이 약한 것이 명백해졌다.
 FcγRIIIa로의 결합 평가는 이하와 같이 행하였다. Biacore T100을 사용하여, 센서칩에 고정화한 인간 유래 Fcγ receptor IIIa(이하, FcγRIIIa)와, 애널라이트로서 사용한 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 상호작용시켜, 그 결합량을 비교하였다. 인간 유래의 FcγRIIIa로서는 hFcγRIIIaV-His6(재조합 hFcγRIIIaV-His6: 사내 조제품)를 사용하고, 샘플로서 IgG1, IgG2, IgG4, M11△GK, M14△GK, M17△GK를 사용하여 측정을 행하였다. 아민 커플링법에 의해 센서칩 CM5(BIACORE)에 FcγRIIIa를 고정화하였다. 최종적인 hFcγRIIIaV-His6의 고정량은, 약 8200 RU(resonance units)였다. 러닝 버퍼로서 HBS-EP+를 사용하고, 유속은 5 μL/min로 하였다. 샘플을, HBS-EP+를 사용하여 250 ㎍/mL의 농도로 조제하였다. 분석은, 항체용액의 10 μL를 인젝션하는 2분간을 결합상으로 하고, 그 후 HBS-EP+로 전환하여, 4분간의 해리상으로 하였다. 해리상 종료 후, 20 μL의 5 mM 염산을 인젝션함으로써, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하고, 각종 항체용액을 인젝션하여, 센서그램을 얻었다. 애널라이트는 각각 IgG4, IgG2, IgG1, M11△GK, M14△GK, M17△GK의 순서로 흘렸다. 측정한 결합량 데이터를 비교한 결과를 도 30에 나타내었다. 그 결과, 결합량은 IgG1>>IgG4>IgG2>M17△GK>M11△GK=M14△GK의 순서로 감소하고 있어, M11△GK, M14△GK, M17△GK는 야생형의 IgG1, IgG2, IgG4보다도 FcγRIIIa에 대해 결합이 약한 것이 명백해졌다. 또한, Eur J Immunol. 1999 Aug;29(8):2613-24에 보고되어 있는 G1△ab의 변이를 포함하는 M17△GK와 비교하여, M11△GK, M14△GK가 더욱 약한 결합인 것이 명백해졌다.
 이상으로부터, WT-M14△GK, WT-M17△GK, WT-M11△GK의 각종 Fcγ 수용체로의 결합은 야생형의 IgG1과 비교하여 현저히 저하되어 있는 것이 확인되었다. WT-M14△GK, WT-M17△GK, WT-M11△GK를 정상영역으로서 사용함으로써, Fcγ 수용체를 매개로 한 APC로의 삽입에 유래하는 면역원성 리스크나 ADCC 등의 이펙터기능에 유래하는 부작용을 회피하는 것이 가능하여, 항원을 중화하는 것이 목적인 항체 의약의 정상영역 서열로서 유용하다.
  WT - M14 GK , WT - M17 GK , WT - M11 GK 의 고농도 안정성 시험
 WT-M14△GK, WT-M17△GK, WT-M11△GK의 고농도 제제에 있어서의 안정성의 평가를 행하였다. WT-IgG1, WT-M14△GK, WT-M17△GK, WT-M11△GK의 정제 항체를 20 mM histidine chloride, 150 mM NaCl, pH 6.5의 용액에 대해 투석(EasySEP, TOMY)을 행하고, 그 후 한외여과막에 의해 농축하여, 고농도 안정성 시험을 행하였다. 조건은 이하와 같다.
 항체: WT-IgG1, WT-M14△GK, WT-M17△GK, WT-M11△GK
 완충액: 20 mM histidine chloride, 150 mM NaCl, pH 6.5
 농도: 61 ㎎/mL
 보존온도와 기간: 40℃-2W, 40℃-1M, 40℃-2M
 회합체 평가법: 시스템 Waters Alliance
                     칼럼  G3000SWxl(TOSOH)
                     이동상  50  mM  sodium  phosphate,  300  mM  KCl,  pH  7.0
                     유속·파장  0.5  ㎖/min,  220  ㎚
                     샘플을  1/100로  희석하여  분석
 Initial(제제 조제 직후) 및 각 조건에서 보존 후의 제제의 회합체 함유량을 전술한 겔 여과 크로마토그래피법에 의해 평가하고, initial로부터 회합체 함량의 변화량에 대해 도 31에 나타내었다. 그 결과, WT-IgG1과 비교하여 WT-M14△GK, WT-M17△GK, WT-M11△GK의 회합체 증가량은 낮고, WT의 회합체 증가량의 약 1/2이었다. 또한, 도 32에 나타내는 바와 같이 Fab 단편의 증가량에 관해서는, WT-IgG1과 WT-M17△GK는 동일 정도였으나, WT-M14△GK와 WT-M11△GK는 WT의 Fab 단편 증가량의 약 1/4이었다. IgG 타입의 항체 제제의 열화(劣化)경로로서, WO 2003/039485에 기재되어 있는 바와 같이, 회합체의 생성과 Fab 분해물의 생성을 주로 들 수 있다. WT-M14△GK와 WT-M11△GK는, WT-IgG1과 비교하여 회합체와 Fab 단편의 생성의 2가지 측면에서 제제적 안정성이 우수한 것이 발견되었다. 이것에 의해, IgG1 정상영역에서는 안정성이 충분하지 않아, 의약품으로서 개발 가능한 고농도 용액 제제를 만들어내지 못했던 항체에 있어서도, 정상영역으로서 WT-M14△GK, WT-M17△GK, WT-M11△GK를 사용하는 것이 보다 높은 안정성을 갖는 고농도 용액 제제가 제작 가능해진다고 생각되었다.
 특히 M14△GK는, 본래 IgG2 분자가 갖는 산성조건하에서의 불안정성을 향상시키고, 힌지영역의 디설피드 결합에 유래하는 이질성을 개선하여, Fcγ 수용체에 결합하지 않고, T-cell 에피토프 펩티드가 될 수 있는 9아미노산의 새로운 펩티드 서열을 최소한으로 억제하며, 또한, 고농도 제제에 있어서의 안정성이 IgG1보다도 우수한 신규한 정상영역 서열로서 매우 유용할 것으로 생각되었다.
  [ 실시예 11] PF1 - M14 GK 항체의 제작
 실시예 5에서 제작한 PF1(정상영역은 IgG1)의 가변영역부분을 XhoI/NheI로 잘라내고, 실시예 7에서 제작한 M14△GK(가변영역은 WT)의 정상영역부분을 NheI/NotI로 잘라내서, 동물세포 발현용 벡터에 2개의 H사슬 항체 유전자 단편을 삽입하여, 목적의 PF1-M14△GK의 H사슬 발현벡터를 제작하였다(PF1_H-M14△GK: 서열번호:117). L사슬은 PF1_L을 사용하여, 실시예 1에 기재된 방법으로 PF1-M14△GK 항체의 발현·정제를 실시하였다.
 PF1-M14△GK 항체는, 항IL-6 수용체 항체의 의약품으로서 다양한 측면에서 WT(인간화 PM-1 항체)보다도 우수하여, 매우 유용할 것으로 생각되었다.
  [ 실시예 12] M31 GK 의 제작과 평가
 실시예 10에서 제작한 M14△GK에 대해, EU 넘버링: 330, 331, 339번째를 IgG2의 서열로 개변한 M31△GK를 제작하였다(M31△GK: 서열번호:118). 가변영역 서열로서 WT를 갖고, 정상영역 서열로서 M31△GK를 갖는 H사슬 항체 서열(WT-M31△GK: 서열번호:119)의 발현벡터를 실시예 1에 기재된 방법으로 제작하고, H사슬로서 WT-M31△GK, L사슬로서 WT를 사용하여, WT-M31을 실시예 1에 기재한 방법으로 발현·정제하였다.
 WT-M31에 더하여, 동시에 발현·정제한 WT-IgG2 및 WT-M14△GK의 양이온 교환 크로마토그래피 분석을 이하와 같이 행하였다. 양이온 교환 크로마토그래피 분석조건은 이하와 같고, WT-IgG2, WT-M14△GK, WT-M31△GK의 크로마토그램을 비교하였다.
 칼럼: ProPac WCX-10, 4×250 ㎜ (Dionex)
 이동상: A: 25 mmol/L MES/NaOH, pH 6.1
                 B:  25  mmol/L  MES/NaOH,  250  mmol/L  NaCl,  pH  6.1
 유속: 0.5 mL/min
 그라디언트:0% B(5 min)→(65 min)→100% B→(1 min)
 검출: 280 ㎚
 WT-IgG2, WT-M14△GK, WT-M31△GK의 분석결과를 도 33에 나타낸다. WT-IgG2는 복수의 피크가 존재하고 있으나, WT-M31△GK는 WT-M14△GK와 마찬가지로 싱글 피크로서 용출되는 것을 알 수 있었다. WT-M31△GK에 있어서도 IgG2의 힌지영역의 디설피드 결합에 유래하는 이질성은 회피할 수 있는 것이 나타내어졌다.
  [ 실시예 13] 완전 인간화 항체 F2H/ L39 - IgG1 의 제작
  PF1 항체의 프레임워크 서열의 완전 인간화
 실시예 5에서 제작한 PF1_H는, 71번(Kabat 넘버링, Kabat EA et al. 1991. Sequences of Proteins of Immunological Interest. NIH))의 아르기닌만이, 마우스 서열인 그대로 잔존하고 있기 때문에 면역원성의 관점에서는 바람직하지 않다. 일반적으로 H사슬의 71번째의 잔기는 HCDR2의 구조를 결정하는 중요한 서열로, 실제 인간화 PM1 항체를 제작할 때 마우스 PM1 항체의 결합활성에 중요한 것이 보고되어 있고, 71번째를 아르기닌으로부터 발린으로 치환하면 결합활성이 대폭 저하되는 것이 명확해져 있다(Cancer Research 53, 851-856, 1993). 마찬가지로 PF1_H는 인간 생식계열 유전자의 VH4 패밀리로 분류되나, VH4 패밀리에 있어서의 71번은 발린으로서 고도로 보존되어 있어, 71번의 아르기닌을 발린으로 치환하자 중화활성의 대폭 저하가 확인되었다.
 이에, 71번을 아르기닌 잔기인 그대로 마우스 서열을 완전히 제거하기 위해, 인간 생식계열 유전자 및 보고되어 있는 인간 항체의 서열을 조사하여, 71번이 아르기닌이고, 또한, 항체의 입체구조의 유지에 중요한 잔기가 보존되어 있는 서열을 탐색하였다. 그 결과, 표 9에 나타내는 PF1_H와는 호몰로지는 낮으나 중요한 잔기가 보존되어 있는 후보서열을 발견하였다.
  TIFF 112010026138634-pct00010.png 21 176
 PF1_H-IgG1에 대해, Kabat 넘버링 66번~94번을 상기 후보서열로 치환함으로써, H96-IgG1(서열번호:134 아미노산 서열)을 설계하였다. 항체 가변영역에 대해서는, 합성 올리고 DNA를 조합한 PCR법(assembly PCR)에 의해 제작하였다. 정상영역에 대해서는, IgG1의 발현벡터로부터 PCR법에 의해 증폭하였다. Assembly PCR법에 의해 항체 가변영역과 정상영역을 결합시키고, 동물세포 발현용 벡터에 삽입하였다. H96/PF1L-IgG1의 발현, 정제를 실시예 1에 기재한 방법에 의해 행하였다.
  프레임워크 완전 인간화 항체 H96 / PF1L - IgG1 의 평가
 정제한 H96/PF1L-IgG1을 사용하여, 실시예 5에 기재된 방법으로 Tm값의 측정을 행하였다. 친화성의 측정은 원칙으로서 실시예 5와 동일한 조건에서 측정을 행하였다. 단, SR344의 농도는 0, 0.36, 1.4 ㎍/mL로 조정하고, 또한 15분간 해리상을 측정하였다. 그 결과, H96/PF1L-IgG1은, PF1-IgG1과 거의 동등한 Tm값 및 친화성을 나타내었다(표 10).
  TIFF 112010026138634-pct00011.png 26 176
 이상으로부터, PF1 항체의 H사슬을 H96으로 함으로써, Tm값 및 친화성을 유지한 상태로, PF1 항체에 남아 있던 마우스 서열을 완전히 제거하고, PF1 항체의 프레임워크를 완전 인간화한 항체가 얻어졌다. H96/PF1L-IgG1은, 프레임워크 서열에 마우스 유래 서열이 존재하지 않는 것으로부터, 면역원성의 관점에서 특히 우수하다고 생각되었다.
  pI 저하 및 면역원성 리스크를 저감시킨 F2H/ L39 - IgG1 의 제작
 실시예 4에서 나타내어진 바와 같이, 항체의 가변영역의 아미노산을 개변하여 pI를 저하시킴으로써 혈장 중 체류성을 향상시킬 수 있는 것이 명백해져 있다. 이에 상기에서 제작한 H96/IgG1에 대해, 추가적으로 이하의 아미노산 치환을 도입하였다. pI를 저하시키는 것을 목적으로 64번의 리신의 글루타민으로의 차환 및 65번의 글리신의 아스파라긴산으로의 치환을 도입하였다. 또한, 면역원성 리스크의 저감을 위해, 105번의 글루타민산의 글루타민으로의 치환, 107번의 트레오닌의 이소류신으로의 치환을 도입하였다. 또한, 실시예 2에서 얻어진 친화성 증강의 개변인, 95번의 발린의 류신으로의 치환, 99번의 이소류신의 알라닌으로의 치환을 도입하였다. 이들의 아미노산 치환을 H96-IgG1에 대해 도입한 F2H-IgG1(서열번호:135(아미노산 서열))을 실시예 1 기재의 방법으로 제작하였다.
 또한 PF1L에 대해 이하의 아미노산 치환을 도입하였다. pI를 저하시키는 것을 목적으로 27번의 글루타민의 글루타민산으로의 치환 및 55번의 류신의 글루타민산으로의 치환을 도입하였다. 이들의 아미노산 치환을 PF1L에 대해 도입한 L39(서열번호:136(아미노산 서열))를 실시예 1 기재의 방법으로 제작하였다. F2H/L39-IGg1의 발현, 정제를 실시예 1에 기재한 방법에 의해 행하였다.
  Biacore 에 의한 F2H/ L39 - IgG1 의 인간 IL -6 수용체에 대한 친화성 해석
 인간화 PM1 항체(야생형, WT), PF1 항체(실시예 5에서 제작) 및 F2H/L39-IgG1의 친화성 측정을 행하였다. 본 측정은 원칙으로서 실시예 4와 동일한 조건에서 측정을 행하였다. 단, SR344의 농도는 0, 0.36, 1.4 ㎍/mL로 조정하고, 또한 15분간 해리상을 측정하였다(표 11).
  TIFF 112010026138634-pct00012.png 23 176
 그 결과, F2H/L39-IgG1은, KD값으로서는 10 -11 오더를 유지하고 있어, 매우 강한 친화성을 갖고 있으나, k a가 PF1-IgG1과 비교하여 1/2 정도로 저하되어 있는 것을 알 수 있었다.
  F2H/ L39 - IgG1 의 인간 IL -6 수용체 중화활성 평가
 인간화 PM1 항체(야생형, WT) 및 F2H/L39-IgG1의 중화활성의 평가를 실시예 1에 나타내는 방법으로 행하였다. 단, human interleukin-6(TORAY) 농도를 600 ng/mL로 하여 중화활성의 평가를 행하였다. 도 34에 나타내는 바와 같이, WT와 비교하여 F2H/L39-IgG1은 100% 저해농도로서 100배 이상의 매우 강한 활성을 갖는 것이 명확해졌다.
  F2H/ L39 - IgG1 등전점 전기영동에 의한 등전점 평가
 F2H/L39-IgG1의 등전점을 실시예 3에 기재한 방법으로 측정하였다. F2H/L39-IgG1의 등전점은 5.5로, 실시예 5에서 제작한 PF1 항체와 비교하여 추가적으로 등전점이 저하됨으로써 혈장 중 체류성이 더욱 개선되어 있다고 생각되었다.
 또한, 이 F2H/L39의 가변영역(VH, VL 서열)의 이론등전점을 GENETYX(GENETYX CORPORATION)에 의해 계산한 바, 이론등전점은 4.3이었다. WT의 이론등전점이 9.20인 것으로부터, WT에서 아미노산 치환에 의해 가변영역의 이론등전점을 약 4.9 저하된 F2H/L39가 얻어졌다.
  F2H/ L39 - IgG1 게잡이원숭이에 의한 PK / PD 시험
 인간화 PM1 항체(야생형, WT), PF1 항체 및 F2H/L39-IgG1의 게잡이원숭이에 있어서의 약물동태(PK) 및 약효(PD)를 평가하였다. WT, PF1 및 F2H/L39-IgG1을 1.0 ㎎/㎏으로 피하에 단회 투여하고, 투여 전 및 경시적으로 채혈하였다. 실시예 6과 마찬가지로 각 항체의 혈장 중 농도의 측정을 행하였다. WT, PF1 및 F2H/L39-IgG1의 혈장 중 농도추이를 도 35에 나타내었다. 게잡이원숭이 막형 IL-6 수용체가 어느 정도 중화되어 있는지의 약효를 평가하기 위해, 항체 투여 후 3일째(day 3)에서 10일째(day 10)까지 게잡이원숭이 IL-6 5 ㎍/㎏을 요배부(腰背部)에 연일 피하투여하고, 24시간 후의 각 개체의 CRP 농도를 측정하였다. WT 및 F2H/L39 투여시의 CRP 농도추이를 도 36에 나타내었다. 게잡이원숭이 가용형 IL-6 수용체가 어느 정도 중화되어 있는지의 약효를 평가하기 위해, 게잡이원숭이 혈장 중의 비결합형 게잡이원숭이 가용형 IL-6 수용체 농도를 측정하였다. WT 및 F2H/L39 투여시의 비결합형 게잡이원숭이 가용형 IL-6 수용체 농도추이를 도 37에 나타내었다.
 이들의 결과로부터, WT와 PF1은 거의 동등한 혈장 중 농도추이를 나타낸 것에 대해, 보다 pI를 저하시킨 F2H/L39-IgG1은 이들보다 항체 혈장 중 농도가 높게 유지되었다. 또한, IL-6 수용체에 대한 친화성이 강한 F2H/L39-IgG1은, WT와 비교하여 CRP 농도 및 비결합형 게잡이원숭이 가용형 IL-6 수용체 농도가 보다 낮게 유지되어 있는 것이 발견되었다.
  [ 실시예 14] WT - M14 의 혈장 중 체류성 평가
  인간에 있어서의 혈장 중 체류성의 예측방법
 IgG 분자의 혈장 중 체류성이 긴(소실이 느린) 것은, IgG 분자의 샐비지 수용체(salvage receptor)로서 알려져 있는 FcRn이 기능하고 있기 때문이다(Nat Rev Immunol. 2007 Sep;7(9):715-25). 음세포작용(pinocytosis)에 의해 삽입된 IgG 분자는, 엔도솜 내의 산성조건하(pH 6.0 부근)에 있어서 엔도솜 내에 발현하고 있는 FcRn에 결합한다. FcRn에 결합할 수 없었던 IgG 분자는 리소좀으로 진행되어 리소좀에 분해되나, FcRn으로 결합한 IgG 분자는 세포 표면으로 이행하여 혈장 중의 중성조건하(pH 7.4 부근)에 있어서 FcRn으로부터 해리됨으로써 다시 혈장 중으로 되돌아간다.
 IgG 타입의 항체로서, IgG1, IgG2, IgG3, IgG4의 아이소타입이 알려져 있으나, 이들의 인간에서의 혈장 중 반감기는, IgG1, IgG2가 약 36일, IgG3가 약 29일, IgG4가 16일인 것이 보고되어 있어(Nat Biotechnol. 2007 Dec;25(12):1369-72.), IgG1 및 IgG2의 혈장 중 체류성이 가장 길다고 생각되고 있다. 일반적으로 항체 의약의 아이소타입은 IgG1, IgG2, IgG4이나, 이들의 IgG 항체의 혈장 중 체류성을 더욱 향상시키는 방법으로서, IgG의 정상영역의 서열을 개변함으로써 전술한 인간 FcRn으로의 결합활성을 향상시키는 방법이 보고되어 있다(J Biol Chem. 2007 Jan 19;282(3):1709-17, J Immunol. 2006 Jan 1;176(1):346-56).
 마우스 FcRn과 인간 FcRn에서는 종차(種差)가 존재하는 것으로부터(Proc Natl Acad Sci U S A. 2006 Dec 5;103(49):18709-14), 정상영역의 서열을 개변한 IgG 항체의 인간에 있어서의 혈장 중 체류성을 예측하기 위해서는, 인간 FcRn으로의 결합 평가 및 인간 FcRn 형질전환 마우스에 있어서 혈장 중 체류성을 평가하는 것이 바람직하다고 생각되었다(Int Immunol. 2006 Dec;18(12):1759-69).
  인간 FcRn 으로의 결합 평가
 FcRn은 FcRn과 β2-microglobulin의 복합체이다. 공개되어 있는 인간 FcRn 유전자 서열(J. Exp. Med. 180 (6), 2377-2381 (1994))을 토대로 하여, 올리고 DNA 프라이머를 제작하였다. 인간 cDNA(Human Placenta Marathon-Ready cDNA, Clontech)를 주형으로 하고, 제작한 프라이머를 사용하여 PCR법에 의해 유전자 전장을 코드하는 DNA 단편을 조제하였다. 얻어진 DNA 단편을 주형으로, PCR법에 의해 시그널영역을 포함하는 세포외영역(Met1-Leu290)을 코드하는 DNA 단편을 증폭하고, 동물세포 발현벡터에 삽입하였다(인간 FcRn 아미노산 서열 서열번호:140). 마찬가지로, 공개되어 있는 인간 β2-microglobulin 유전자 서열(Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002))을 토대로 하여, 올리고 DNA 프라이머를 제작하였다. 인간 cDNA(Hu-Placenta Marathon-Ready cDNA, CLONTECH)를 주형으로 하고, 제작한 프라이머를 사용하여 PCR법에 의해 유전자 전장을 코드하는 DNA 단편을 조제하였다. 얻어진 DNA 단편을 주형으로, PCR법에 의해 시그널영역을 포함하는 β2-microglobulin 전장(Met1-Met119)을 코드하는 DNA 단편을 증폭하여, 동물세포 발현벡터에 삽입하였다(인간 β2-microglobulin 아미노산 서열 서열번호:141).
 가용형 인간 FcRn의 발현은 이하의 순서로 행하였다. 조제한 인간 FcRn 및 인간 β2-microglobulin의 플라스미드를, 10% Fetal Bovine Serum(Invitrogen)을 사용한 lipofection법에 의해, 인간 태아 신장암 세포 유래 HEK293H주(Invitrogen)의 세포로 도입하였다. 얻어진 배양상청을 회수한 후, IgG Sepharose 6 Fast Flow(Amersham Biosciences)를 사용하여, (J Immunol. 2002 Nov 1;169(9):5171-80.)의 방법에 따라 정제를 행하였다. 그 후, HiTrap Q HP(GE Healthcare)에 의해 정제를 행하였다.
 인간 FcRn으로의 결합평가에는 Biacore 3000을 사용하고, 센서칩에 고정화한 Protein L 또는 토끼 항인간 IgG Kappa chain 항체로 결합시킨 항체에, 애널라이트로서 인간 FcRn을 상호작용시켰을 때의 인간 FcRn의 결합량으로부터 친화성(KD)을 산출하였다. 구체적으로는, 러닝 버퍼로서 150 mM NaCl을 포함하는 50 mM Na-phosphate buffer, pH 6.0을 사용하여, 아민 커플링법에 의해 센서칩 CM5(BIACORE)에 Protein L 또는 토끼 항인간 IgG Kappa chain 항체를 고정화하였다. 그 후, 항체를 0.02% Tween20을 포함하는 러닝 버퍼로 희석하여 인젝션하고 칩에 항체를 결합시킨 후, 인간 FcRn을 인젝션하고, 인간 FcRn의 항체로의 결합활성[0]을 평가하였다.
 친화성의 산출에는 소프트웨어, BIAevaluation을 사용하였다. 얻어진 센서그램으로부터, 인간 FcRn 인젝션 종료 직전의 항체로의 hFcRn 결합량을 구하고, 이것을 steady state affinity법으로 피팅(fitting)하여 인간 FcRn에 대한 항체의 친화성을 산출하였다.
  인간 FcRn 형질전환 마우스에 있어서의 혈장 중 체류성의 평가
 인간 FcRn 형질전환 마우스(B6.mFcRn-/-.hFcRn Tg line 276 +/+ 마우스, Jackson Laboratories)에 있어서의 체내 동태의 평가는 이하와 같이 행하였다. 항체를 마우스에 1 ㎎/㎏의 투여량으로 정맥 내에 단회 투여하여 적시 채혈을 행하였다. 채취한 혈액은 바로 4℃, 15,000 rpm으로 15분간 원심분리하여, 혈장을 얻었다. 분리한 혈장은, 측정을 실시할 때까지 -20℃ 이하로 설정된 냉동고에 보존하였다. 혈장 중 농도는 ELISA법을 사용하여 측정하였다.
  WT - M14 의 인간에 있어서의 혈장 중 체류성의 예측 평가
 WT-IgG1과 WT-M14의 인간 FcRn으로의 결합활성의 평가를 BIAcore에 의해 행한 결과, 표 12에 나타내는 바와 같이, WT-M14의 결합활성이 약간 WT-IgG1보다도 우수하였다.
  TIFF 112010026138634-pct00013.png 22 55
 그러나, WT-IgG1과 WT-M14의 인간 FcRn 형질전환 마우스에 있어서의 혈장 중 체류성의 평가를 행한 결과, 도 38에 나타내는 바와 같이, WT-IgG1과 WT-M14는 동등한 혈장 중 체류성을 나타낸 것으로부터, M14의 정상영역은 인간에 있어서도 IgG1의 정상영역과 동등한 혈장 중 체류성을 나타낸다고 생각되었다.
  [ 실시예 15] 혈장 중 체류성을 향상시킨 WT - M44 , WT - M58 , WT - M73 의 제작
  WT - M58 분자의 제작
 실시예 14에 나타낸 바와 같이, WT-M14의 인간 FcRn 형질전환 마우스에 있어서의 혈장 중 체류성은 WT-IgG1과 동등하였다. 혈장 중 체류성을 향상시키는 방법으로서, 항체의 등전점을 저하시키는 방법과 FcRn으로의 결합활성을 증강하는 방법이 알려져 있으나, WT-M14의 혈장 중 체류성을 향상시키는 것을 목적으로 이하의 개변을 도입하였다. 구체적으로는, 실시예 4에 있어서 WT-M14로 제작한 WT-M31△GK의 EU 넘버링 397번째의 발린을 메티오닌으로 개변하고, 268번 히스티딘을 글루타민으로 개변하며, 355번 아르기닌을 글루타민으로 개변하고, 419번 글루타민을 글루타민산으로 개변하였다. 이들 4개소의 개변을 WT-M31△GK에 도입하여, WT-M58(서열번호:142(아미노산 서열))을 제작하였다. 발현벡터의 제작은, 실시예 1의 방법으로 제작하고, H사슬로서 WT-M58을 사용하며, L사슬로서 L(WT)을 사용한 WT-M58의 발현·정제는 실시예 1에 기재한 방법으로 행하였다.
  WT - M73 분자의 제작
 한편, IgG1에 대해, EU 넘버링:434번째를 알라닌으로 치환한 WT-M44(서열번호:143(아미노산 서열))를 제작하였다. 또한 M44에 대해 H사슬 C말단의 이질성을 저감하기 위해 446번째의 글리신 및 447번째의 리신을 결손시킨 WT-M83(서열번호:185(아미노산 서열))을 제작하였다. 또한, WT-M58에 대해 EU 넘버링:434번째를 알라닌으로 치환한 WT-M73(서열번호:144(아미노산 서열))을 제작하였다.
 이들 발현벡터의 제작은, 실시예 1의 방법으로 제작하고, H사슬로서 WT-M44 또는 WT-M58 또는 WT-M73을 사용하며, L사슬로서 L(WT)을 사용한 WT-M44 및 WT-M58 및 WT-M73의 발현·정제는 실시예 1에 기재된 방법으로 행하였다.
  WT - M44 , WT - M58 , WT - M73 의 인간에 있어서의 혈장 중 체류성의 예측 평가
 WT-IgG1, WT-M44, WT-M58 및 WT-M73의 인간 FcRn으로의 결합활성의 평가를 BIAcore에 의해 행한 결과, 표 13에 나타내는 바와 같이, WT-M44, WT-M58 및 WT-M73의 결합활성은 WT-IgG1보다도 각각 2.7배, 약 1.4배 및 약 3.8배 정도 우수하였다.
  TIFF 112010026138634-pct00014.png 36 55
 WT-IgG1, WT-M44 및 WT-M58의 인간 FcRn 형질전환 마우스에 있어서의 혈장 중 체류성의 평가를 행한 결과, 도 39에 나타내는 바와 같이, WT-M58은 WT-IgG1 및 WT-M44와 비교하여 혈장 중 체류성의 향상이 확인되었다. 또한, WT-IgG1, WT-M44, WT-M58 및 WT-M73의 인간 FcRn 형질전환 마우스에 있어서의 혈장 중 체류성의 평가를 행한 결과, 도 40에 나타내는 바와 같이, WT-M44, WT-M58 및 WT-M73은 모두 WT-IgG1과 비교하여 혈장 중 체류성의 개선이 확인되고, 그 혈장 중 체류성의 개선효과는 인간 FcRn으로의 결합능과 상관관계가 있었다. 그 중에서도 WT-M73에 관해서는, WT-IgG1과 비교하여 28일 후의 혈장 중 농도가 약 16배 개선되어 있었던 것으로부터, 인간에 있어서도 M73의 정상영역을 갖는 항체는 IgG1의 정상영역을 갖는 항체와 비교하여 혈장 중 체류성이 대폭 향상되는 것으로 생각되었다.
  [ 실시예 16] 다양한 항체에 있어서의 신규 정상영역 M14 M58 에 의한 이질성 저감효과
 실시예 8에 나타내는 바와 같이, 항IL-6 수용체 항체인 인간화 PM1 항체(WT)에 있어서, 정상영역을 IgG2로부터 M14로 변환함으로써, IgG2의 힌지영역에 유래하는 이질성을 저감할 수 있는 것이 확인되었다. 이에, 인간화 PM1 항체 이외 IgG2 타입의 항체에 대해서도, 정상영역을 M14 또는 M58로 변환함으로써 이질성을 저감할 수 있는지 여부를 검토하였다.
 인간화 PM1 항체 이외의 항체로서, 항IL-6 수용체 항체인 F2H/L39(F2H/L39_VH 아미노산 서열 서열번호:145, F2H/L39 VL 아미노산 서열 서열번호:146), 항IL-31 수용체 항체인 H0L0(H0L0_VH 아미노산 서열 서열번호:147, H0L0_VL 아미노산 서열 서열번호:148), 항RANKL 항체인 DNS(DNS_VH 아미노산 서열 서열번호:149, DNS_VL 아미노산 서열 서열번호:150)를 사용하였다. 각각의 항체에 대해, 정상영역을 IgG1(서열번호:19), IgG2(서열번호:20) 및, M14(서열번호:24) 또는 M58(서열번호:151)로 한 것을 제작하였다.
 이질성의 평가방법으로서, 양이온 교환 크로마토그래피에 의한 평가를 행하였다. 제작한 항체의 이질성의 평가는, 칼럼으로서 ProPac WCX-10(Dionex)을 사용하고, 이동상 A로서 20 mM Sodium Acetate, pH 5.0, 이동상 B로서 20 mM Sodium Acetate, 1 M NaCl, pH 5.0을 사용하여, 적절한 유속 및 그라디언트로 실시하였다. 양이온 교환 크로마토그래피(IEC)에 의한 평가를 행한 결과를 도 41에 나타내었다.
 도 41에 나타낸 바와 같이, 항IL-6 수용체 항체인 인간화 PM1 항체(WT)뿐 아니라, 항IL-6 수용체 항체인 F2H/L39, 항IL-31 수용체 항체인 H0L0, 항RANKL 항체인 DNS에 있어서도, 정상영역을 IgG1에서 IgG2으로 변환함으로써 이질성이 증대하고, 정상영역을 M14 또는 M58로 변환함으로써 어느 항체에 있어서도 이질성을 저감할 수 있는 것이 확인되었다. 이것으로부터, H사슬의 CH1 도메인에 존재하는 EU 넘버링 131번째의 시스테인과 H사슬의 upper hinge에 존재하는 EU 넘버링 219번째의 시스테인을 세린으로 개변함으로써, 가변영역의 항체 서열 및 항원의 종류에 관계없이, 천연형 IgG2에 유래하는 이질성을 저감할 수 있는 것이 나타내어졌다.
  [ 실시예 17] 다양한 항체에 있어서의 신규 정상영역 M58 에 의한 혈장 중 체류성 개선효과
 실시예 15에 나타낸 바와 같이, 항IL-6 수용체 항체인 인간화 PM1 항체(WT)에 있어서, 정상영역을 IgG1에서 M58로 변환함으로써, 인간 FcRn으로의 결합활성이 향상되고, 인간 FcRn 형질전환 마우스에 있어서 혈장 중 체류성이 향상되는 것이 발견되었다. 이에, 인간화 PM1 항체 이외의 IgG1 항체에 대해서도, 정상영역을 M58로 변환함으로써 혈장 중 체류성을 향상시킬 수 있는지 여부를 검토하였다.
 인간화 PM1 항체(WT) 이외의 항체로서, 항IL-31 수용체 항체인 H0L0(H0L0_VH 아미노산 서열 서열번호:147, H0L0_VL 아미노산 서열 서열번호:148), 항RANKL 항체인 DNS(DNS_VH 아미노산 서열 서열번호:149, DNS_VL 아미노산 서열 서열번호:150)를 사용하였다. 각각의 항체에 대해, 정상영역을 IgG1(서열번호:19) 및 M58(서열번호:151)로 한 것을 제작하고, 실시예 14에 나타낸 방법으로 인간 FcRn으로의 결합활성을 평가하였다. 그 결과를 표 14에 나타내었다.
  TIFF 112010026138634-pct00015.png 36 88
 표 14에 나타낸 바와 같이, 항IL-31 수용체 항체인 H0L0, 항RANKL 항체인 DNS에 있어서도, 정상영역을 IgG1으로부터 M58로 변환함으로써, 항IL-6 수용체 항체인 WT와 마찬가지로, 인간 FcRn으로의 결합활성이 향상되는 것이 확인되었다. 이것으로부터, 가변영역의 항체 서열 및 항원의 종류에 관계없이, 정상영역을 IgG1으로부터 M58로 변환함으로써 인간에 있어서의 혈장 중 체류성이 향상시킬 가능성이 나타내어졌다.
  [ 실시예 18] CH1 도메인의 시스테인이 미치는 이질성 및 안정성으로의 영향
 실시예 8에 나타낸 바와 같이, 천연형 IgG2의 이질성을 저감하는 것을 목적으로 IgG2의 힌지부분의 시스테인 및 CH1 도메인에 존재하는 시스테인의 개변을 행하였다. 각종 개변체의 겸토 결과, 야생형 IgG2 정상영역 서열 중, H사슬의 CH1 도메인에 존재하는 EU 넘버링 131번째의 시스테인과 133번째의 아르기닌을 각각 세린과 리신으로 개변하고, H사슬의 upper hinge에 존재하는 EU 넘버링 219번째의 시스테인을 세린으로 개변한 정상영역인 SKSC(서열번호:154)에 의해, 안정성을 저하시키지 않고 이질성을 저감하는 것이 가능한 것이 발견되었다.
 한편, 이질성을 저감하는 방법으로서, H사슬의 upper hinge에 존재하는 EU 넘버링 219번째의 시스테인만을 세린으로 개변하는 방법, 및 220번째의 시스테인만을 세린으로 개변하는 방법을 생각할 수 있다. IgG2의 EU 넘버링 219번째의 시스테인을 세린으로 개변한 정상영역인 SC(서열번호:155), 및 IgG2의 EU 넘버링 220번째의 시스테인을 세린으로 개변한 정상영역인 CS(서열번호:156)를 정상영역으로 갖는 WT-SC(서열번호:157) 및 WT-CS(서열번호:158)를 제작하여, WT-IgG1, WT-IgG2, WT-SKSC 및 WT-M58과의 이질성 및 열안정성의 비교를 행하였다. 또한, WT 이외의 항체로서, 상이한 항IL-6 수용체 항체인 F2H/L39(F2H/L39_VH 아미노산 서열 서열번호:145, F2H/L39_VL 아미노산 서열 서열번호:146)에 대해, 정상영역을 각각 IgG1(서열번호:19), IgG2(서열번호:20), SC(서열번호:155), CS(서열번호:156), SKSC(서열번호:154), M14(서열번호:24)로 한 F2H/L39-IgG1, F2H/L39-IgG2, F2H/L39-SC, F2H/L39-CS, F2H/L39-SKSC, F2H/L39-M14를 제작하여, 이질성 및 안정성의 비교를 행하였다.
 WT-IgG1, WT-IgG2, WT-SC, WT-CS, WT-SKSC, WT-M58 및 F2H/L39-IgG1, F2H/L39-IgG2, F2H/L39-SC, F2H/L39-CS, F2H/L39-SKSC, F2H/L39-M14의 이질성의 평가방법으로서, 양이온 교환 크로마토그래피에 의한 평가를 행하였다. 칼럼으로서 ProPac WCX-10(Dionex)을 사용하고, 이동상 A로서 20 mM Sodium Acetate, pH 5.0, 이동상 B로서 20 mM Sodium Acetate, 1 M NaCl, pH 5.0을 사용하여, 적절한 유량 및 그라디언트로 실시하였다. 양이온 교환 크로마토그래피에 의한 평가를 행한 결과를 도 42에 나타내었다.
 그 결과, 도 42에 나타내는 바와 같이, WT와 F2H/L39 어느 것에 있어서도, 정상영역을 IgG1으로부터 IgG2로 변환함으로써 이질성이 증대하였으나, 정상영역을 SKSC 및 M14 또는 M58로 변환함으로써 이질성이 대폭 저감되었다. 한편, 정상영역을 SC로 한 경우는 정상영역을 SKSC로 한 경우와 마찬가지로 이질성이 대폭 저감되었으나, 정상영역을 CS로 한 경우는 충분히 이질성이 개선되지 않았다.
 일반적으로 항체를 의약품으로서 개발하기 위해서는 이질성이 적은 것에 더하여, 안정한 제제를 조제하기 위해 높은 안정성을 갖는 것이 바람직하다. 이에 안정성의 평가방법으로서, 시차주사형 열량 측정(DSC)에 의한 열변성 중간온도(Tm값)의 평가를 행하였다(VP-DSC, Microcal사제). 열변성 중간온도(Tm값)는 안정성의 지표로, 의약품으로서 안정한 제제를 제작하기 위해서는, 열변성 중간온도(Tm값)가 높은 것이 바람직하다(J Pharm Sci. 2008 Apr;97(4):1414-26.). WT-IgG1, WT-IgG2, WT-SC, WT-CS, WT-SKSC, WT-M58을 20 mM sodium acetate, 150 mM NaCl, pH 6.0의 용액에 대해 투석(EasySEP, TOMY)을 행하여, 약 0.1 ㎎/mL의 단백질 농도에서, 40℃에서 100℃까지 1℃/min의 승온속도로 DSC 측정을 행하였다. 얻어진 DSC의 변성 곡선을 도 43에, Fab부분의 Tm값을 이하의 표 15에 나타내었다.
  TIFF 112010026138634-pct00016.png 51 65
 WT-IgG1 및 WT-IgG2의 Tm값은 거의 동등하여 약 94℃ 정도(IgG2가 약 1℃ 낮음)였던 것에 대해, WT-SC 및 WT-CS의 Tm값은 약 86℃로, WT-IgG1 및 WT-IgG2와 비교하여 헌저히 Tm값이 저하되어 있었다. 한편, WT-M58, WT-SKSC의 Tm값은 약 94℃로, 거의 WT-IgG1 및 WT-IgG2와 동등하였다. WT-SC 및 WT-CS는 안정성이 IgG2와 비교하여 현저히 낮은 것으로부터, 의약품으로서 개발하기 위해서는, CH1 도메인의 시스테인도 세린으로 개변한 WT-SKSC 및 WT-M58이 바람직하다고 생각되었다. WT-SC 및 WT-CS의 Tm값이 IgG2와 비교하여 대폭 저하된 이유로서, WT-SC 및 WT-CS는 IgG2의 디설피드 결합 패턴과는 상이한 양식을 취하고 있기 때문이라고 생각되었다.
 또한, DSC 변성 곡선을 비교한 경우, WT-IgG1, WT-SKSC, WT-M58의 Fab부분의 변성 피크는 샤프하고 또한 단일이었던 것에 대해, WT-SC 및 WT-CS는 이들과 비교하여, Fab부분의 변성 피크가 브로드하여, WT-IgG2는 Fab부분의 변성 피크의 저온측에 숄더 피크가 확인되었다. DSC의 변성 피크는 단일성분의 경우에는 통상 샤프한 변성 피크를 나타내나, Tm이 상이한 복수 성분(즉 이질성)이 존재하는 경우, 변성 피크는 브로드해지는 것으로 생각된다. 즉, WT-IgG2, WT-SC 및 WT-CS에는 복수 성분 존재하고, WT-SC 및 WT-CS는, 천연형 IgG2의 이질성이 충분히 저감되어 있지 않을 가능성이 시사되었다. 이 사실로부터, 야생형 IgG2의 이질성은 힌지부분의 시스테인뿐 아니라, CH1 도메인에 존재하는 시스테인의 양쪽이 관여하고 있다고 생각되어, DSC 상의 이질성을 저감하기 위해서는 힌지부분의 시스테인뿐 아니라, CH1 도메인의 시스테인도 개변할 필요가 있다고 생각되었다. 또한, 전술한 바와 같이, 힌지부분의 시스테인뿐 아니라, CH1 도메인의 시스테인을 개변함으로써 비로소 야생형 IgG2와 동등한 안정성을 갖는 것이 가능하다.
 이상으로부터, IgG2의 힌지영역에 유래하는 이질성을 저감한 정상영역으로서, 힌지부분의 시스테인만을 세린으로 치환한 정상영역인 SC와 CS는 이질성 및 안정성의 관점에서 불충분하다고 생각되어, 힌지부분의 시스테인에 더하여 CH1 도메인에 존재하는 EU 넘버링 131번째의 시스테인도 세린으로 치환함으로써 비로소 IgG2와 동등한 안정성을 유지하면서 이질성을 대폭 저감하는 것이 가능한 것이 발견되었다. 그와 같은 정상영역으로서는, 전술한 M14, M31, M58, M73 등을 들 수 있고, 특히 M58 및 M73은 혈장 중 체류성이 향상되고, 안정성이 높으며, 이질성이 저감되어 있는 것으로부터, 항체 의약품의 정상영역으로서 매우 유용할 것으로 생각되었다.
  [ 실시예 19] PK / PD 가 개선된 완전 인간화 IL -6 수용체 항체의 제작
 TOCILIZUMAB(H사슬 WT-IgG1(서열번호:15), L사슬 WT(서열번호:105))에 대해, PK/PD가 개선된 완전 인간화 IL-6 수용체 항체를 제작하기 위해 이하에 나타내는 분자를 제작하였다.
 F2H-IgG1의 ka 향상을 위해, 실시예 2에서 얻어진 친화성 증강의 개변인, 35번의 트립토판의 발린으로의 치환, 및 50번의 티로신의 페닐알라닌으로의 치환, 62번의 세린의 트레오닌으로의 치환을 행하였다. 또한 면역원성 리스크를 상승시키지 않고 pI를 저하시키기 위해, 102번의 티로신을 발린으로 치환, 105번의 글루타민을 글루타민산으로 치환, 107번의 이소류신을 트레오닌으로 치환하고, 정상영역을 IgG1으로부터 M83으로 치환한 것으로서, VH5-M83(서열번호:139(아미노산 서열))을 제작하였다. 또한, L39의 ka 향상을 위해, 27번의 글루타민산을 글루타민으로 치환한 VL5-kappa(서열번호:181(아미노산 서열))를 제작하였다. 또한 상기 실시예에서 발견된 TOCILIZUMAB의 가변영역 및 정상영역의 변이, 및 새롭게 발견된 변이를 복수 조합시킨 TOCILIZUMAB 개변체를 제작하여, 각종 스크리닝을 실시한 결과, 완전 인간화 IL-6 수용체 항체로서, Fv3-M73(H사슬 VH4-M73 서열번호:182, L사슬 VL1-kappa 서열번호:183), Fv4-M73(H사슬 VH3-M73 서열번호:180, L사슬 VL3-kappa 서열번호:181), Fv5-M83(H사슬 VH5-M83 서열번호:139, L사슬 VL5-kappa 서열번호:138)을 발견하였다.
 제작한 Fv3-M73, Fv4-M73 및 Fv5-M83의 IL-6 수용체의 친화성을 TOCILIZUMAB과 비교하였다(방법은 참고예 참조). 이들 항체의 IL-6 수용체로의 친화성을 측정한 결과를 표 16에 나타내었다. 또한, BaF/gp130의 중화활성을 TOCILIZUMAB 및 대조(참고예의 공지의 고친화성 고 IL-6 수용체 항체, US 2007/0280945에 있어서의 VQ8F11-21 hIgG1)와 비교하였다(방법은 참고예 참조). 이들 항체의 BaF/gp130에 의한 생물활성을 측정한 결과를 도 44(IL-6 최종농도 300 ng/mL:TOCILIZUMAB, 대조, Fv5-M83) 및 도 45(IL-6 최종농도 30 ng/mL:TOCILIZUMAB, Fv3-M73, Fv4-M73)에 나타내었다. 표 16에 나타내는 바와 같이, Fv3-M73, Fv4-M73은, TOCILIZUMAB과 비교하여 2~3배 정도 강한 친화성을 갖고, Fv5-M83은 TOCILIZUMAB과 비교하여 100배 정도 강한 친화성을 나타내었다(Fv5-M83에서는 친화성의 측정이 곤란하였기 때문에, 정상영역을 IgG1으로 한 Fv5-IgG1을 사용하여 친화성을 측정하였다. 정상영역은 일반적으로 친화성에 영향을 미치지 않는 것으로 생각됨). 또한, 도 45에 나타내는 바와 같이 Fv3-M73, Fv4-M73은, TOCILIZUMAB과 비교하여 약간 강한 활성을 나타내고, 도 44에 나타내는 바와 같이 Fv5-M83은 TOCILIZUMAB과 비교하여 50% 저해농도로서 100배 이상의 매우 강한 활성을 가지며, 또한, 공지의 고친화성 고 IL-6 수용체 항체인 대조와 비교해도 50% 저해농도로서 약 10배 정도 높은 중화활성을 나타내었다.
  TIFF 112010026138634-pct00017.png 46 167
 TOCILIZUMAB, 대조, Fv3-M73, Fv4-M73 및 Fv5-M83의 등전점을 당업자 공지의 방법에 의해 등전점 전기영동에 의해 측정한 결과, TOCILIZUMAB의 등전점은 약 9.3, 대조는 약 8.4~8.5, Fv3-M73은 약 5.7~5.8, Fv4-M73은 약 5.6~5.7, Fv5-M83은 5.4~5.5로, 어느 항체도 TOCILIZUMAB 및 대조와 비교하여 등전점이 대폭 저하되었다. 또한, 가변영역 VH/VL의 이론등전점을 GENETYX(GENETYX CORPORATION)에 의해 계산한 바, TOCILIZUMAB의 이론등전점은 9.20, 대조는 7.79, Fv3-M73은 5.49, Fv4-M73은 5.01, Fv5-M83은 4.27로, 어느 항체도 TOCILIZUMAB 및 대조와 비교하여 등전점이 대폭 저하되었다. 따라서, Fv3-M73, Fv4-M73 및 Fv5-M83은 TOCILIZUMAB 및 대조와 비교하여 혈장 중 체류성이 향상되어 있다고 생각되었다.
 TOCILIZUMAB, Fv3-M73, Fv4-M73 및 Fv5-M83의 가변영역 서열에 존재하는 T-cell 에피토프를 TEPITOPE(Methods. 2004 Dec;34(4):468-75)를 사용하여 해석을 행하였다. 그 결과, TOCILIZUMAB은 많은 서열이 HLA에 결합하는 T-cell 에피토프가 존재한다고 예측되었으나, Fv3-M73, Fv4-M73 및 Fv5-M83은 T-cell 에피토프에 결합한다고 예측된 서열이 대폭 감소하였다. 또한, Fv3-M73, Fv4-M73 및 Fv5-M83은 프레임워크에 마우스 서열이 잔존하지 않고 완전 인간화되어 있다. 이들 사실로부터, Fv3-M73, Fv4-M73 및 Fv5-M83의 면역원성은 TOCILIZUMAB과 비교하여 면역원성 리스크가 대폭 저감되어 있을 가능성이 시사되었다.
  [ 실시예 20] 완전 인간화 IL -6 수용체 항체의 원숭이 PK / PD 시험
 TOCILIZUMAB, 대조, Fv3-M73, Fv4-M73 및 Fv5-M83을 게잡이원숭이에 1 ㎎/㎏으로 정맥 내에 단회 투여하여 혈장 중 농도추이를 평가하였다(방법은 참고예 참조). TOCILIZUMAB, Fv3-M73, Fv4-M73 및 Fv5-M83의 정맥 내 투여 후의 혈장 중 농도추이를 도 46에 나타내었다. 그 결과, Fv3-M73, Fv4-M73 및 Fv5-M83은 모두 TOCILIZUMAB 및 대조와 비교하여 게잡이원숭이에 있어서 혈장 중 체류성이 대폭 개선되었다. 그 중에서도, Fv3-M73과 Fv4-M73의 혈장 중 체류성은 TOCILIZUMAB과 비교하여 대폭 개선되었다.
 게잡이원숭이 막형 IL-6 수용체가 어느 정도 중화되어 있는지의 약효를 평가하기 위해, 항체 투여 6일째부터 18일째(TOCILIZUMAB에 관해서는 3일째부터 10일째)까지 게잡이원숭이 IL-6 5 ㎍/㎏을 요배부에 연일 피하투여하고, 24시간 후의 각 개체의 CRP 농도를 측정하였다(방법은 참고예 참조). 각 항체 투여시의 CRP 농도추이를 도 47에 나타내었다. 게잡이원숭이 가용형 IL-6 수용체가 어느 정도 중화되어 있는지의 약효를 평가하기 위해, 게잡이원숭이 혈장 중의 비결합형 게잡이원숭이 가용형 IL-6 수용체 농도를 측정하고, 가용형 IL-6 수용체의 중화율을 계산하였다(방법은 참고예 참조). 각 항체 투여시의 가용형 IL-6 수용체의 중화율의 추이를 도 48에 나타내었다.
 Fv3-M73, Fv4-M73 및 Fv5-M83은 모두 TOCILIZUMAB 및 공지의 고친화성 항IL-6 수용체 항체인 대조와 비교하여 게잡이원숭이 막형 IL-6 수용체를 보다 지속적으로 중화하여 CRP의 증가를 장기간 억제하였다. 또한, Fv3-M73, Fv4-M73 및 Fv5-M83은 모두 TOCILIZUMAB 및 대조와 비교하여 게잡이원숭이 가용형 IL-6 수용체를 보다 지속적으로 중화하여 비결합형의 게잡이원숭이 가용형 IL-6 수용체의 증가를 장기간 억제하였다. 이것으로 막형 IL-6 수용체 및 가용형 IL-6 수용체의 중화의 지속성에 관해서는, Fv3-M73, Fv4-M73 및 Fv5-M83은 모두 TOCILIZUMAB 및 대조보다도 우수한 것이 발견되었다. 그 중에서도 Fv3-M73과 Fv4-M73의 중화의 지속성은 매우 우수하였다. 한편, Fv5-M83이 Fv3-M73과 Fv4-M73보다 CRP 및 비결합형 게잡이원숭이 가용형 IL-6 수용체를 낮게 억제하고 있는 것으로부터, Fv5-M83은 막형 IL-6 수용체 및 가용형 IL-6 수용체를 Fv3-M73과 Fv4-M73 및 공지의 고친화성 항IL-6 수용체 항체인 대조보다도 강력하게 중화하고 있다고 생각되었다. 이것은 Fv5-M83이 대조보다도 IL-6 수용체로의 친화성이 강하고, 또한, BaF/gp130에 있어서의 생물활성이 강한 것이 게잡이원숭이의 in vivo에 있어서 반영된 결과라고 생각된다.
 이들 사실로부터, TOCILIZUMAB 및 대조와 비교하여, Fv3-M73과 Fv4-M73은 항IL-6 수용체 중화항체로서 작용의 지속성이 매우 우수하여 투여빈도 및 투여량을 대폭 저감하는 것이 가능하고, 또한, Fv5-M83은 항IL-6 수용체 중화항체로서 작용의 강도가 매우 우수하며, 또한 작용의 지속성도 우수한 것이 발견되었다. 따라서 Fv3-M73, Fv4-M73 및 Fv5-M83은 IL-6 안타고니스트로서의 의약품으로서 유용하다고 생각된다.
 [참고예]
  재조합 게잡이원숭이 가용형 IL -6 수용체( cIL -6R)의 조제
 공개되어 있는 붉은털 원숭이 IL-6 수용체 유전자 서열(Birney et al, Ensembl 2006, Nucleic Acids Res. 2006 Jan 1;34(Database issue):D556-61.)을 토대로 하여 올리고 DNA 프라이머를 제작하여, 게잡이원숭이 췌장으로 조제된 cDNA를 주형으로 하고, 프라이머를 사용하여, PCR법에 의해 게잡이원숭이 IL-6 수용체 유전자 전장을 코드하는 DNA 단편을 조제하였다. 얻어진 DNA 단편을 동물세포 발현벡터에 삽입하고, 이것을 사용하여 CHO 정상발현주(cyno.sIL-6R 생산 CHO세포)를 제작하였다. cyno.sIL-6R 생산 CHO세포의 배양액을 HisTrap 칼럼(GE 헬스케어 바이오사이언스)으로 정제 후, Amicon Ultra-15 Ultracel-10k(Millipore)를 사용하여 농축하고, Superdex200pg16/60 겔 여과 칼럼(GE 헬스케어 바이오사이언스)으로 추가적으로 정제를 행하여, 가용형 게잡이원숭이 IL-6 수용체(이하, cIL-6R)의 최종 정제품으로 하였다.
  재조합 게잡이원숭이 IL -6( cIL -6)의 조제
 게잡이원숭이 IL-6는 이하와 같이 조제하였다. SWISSPROT Accession No.P79341에 등록되어 있는 212 아미노산을 코드하는 염기서열을 제작하고, 동물세포 발현벡터로 클로닝하여, CHO세포에 도입함으로써 정상발현 세포주를 제작하였다(cyno.IL-6 생산 CHO세포). cyno.IL-6 생산 CHO세포의 배양액을 SP-Sepharose/FF 칼럼(GE 헬스케어 바이오사이언스)으로 정제 후, Amicon Ultra-15 Ultracel-5k(Millipore)를 사용하여 농축하여, Superdex75pg26/60 겔 여과 칼럼(GE 헬스케어 바이오사이언스)으로 추가적으로 정제를 행하고, Amicon Ultra-15 Ultracel-5k(Millipore)를 사용하여 농축하여, 게잡이원숭이 IL-6(이하, cIL-6)의 최종 정제품으로 하였다.
  공지 고친화성 항I L -6 수용체 항체의 제작
 공지의 고친화성 항IL-6 수용체 항체로서, US 2007/0280945 A1에 기재되어 있는 고친화성 항IL-6 수용체 항체인 VQ8F11-21 hIgG1(US 2007/0280945 A1, H사슬 아미노산 서열: 서열번호:19, L사슬 아미노산 서열: 서열번호:27)을 발현시키기 위해, 동물세포 발현용 벡터를 구축하였다. 항체 가변영역에 대해서는, 합성 올리고 DNA를 조합시킨 PCR법(assembly PCR)에 의해 제작하고, 정상영역에 대해서는 IgG1을 사용하였다. Assembly PCR법에 의해 항체 가변영역과 정상영역을 결합시키고, 동물발현용 벡터에 삽입하여, 목적의 H사슬 발현벡터 및 L사슬 발현벡터를 제작하였다. 얻어진 발현벡터의 염기서열은 당업자 공지의 방법으로 결정하였다. 제작한 발현벡터를 사용하여, 발현·정제를 행하였다. 발현·정제는 실시예 1에 기재된 방법으로 행하여, 고친화성 항IL-6 수용체 항체(이후, 대조로 기재함)를 얻었다.
  Biacore 에 의한 IL -6 수용체로의 결합 평가
 Biacore T100(GE Healthcare)을 사용하여, 항원 항체반응의 속도론적 해석을 행하였다. 센서칩 상에 아민 커플링법으로 anti-IgG(γ-chain specific)F(ab') 2를 적당량 고정화하고, 다음으로 pH 7.4에 있어서 목적의 항체를 결합시키고, 추가적으로 pH 7.4에 있어서 각종 농도로 조정한 IL-6 수용체인 SR344를 애널라이트로서 흘려, 항체와 SR344의 상호작용을 측정하였다. 측정은 모두 37℃에서 실시하였다. 측정으로 얻어진 센서그램으로부터, 키네틱스 파라미터인 결합속도상수 k a(1/Ms) 및 해리속도상수 k d(1/s)를 산출하고, 그 값을 토대로 하여 K D(M)를 산출하였다. 각 파라미터의 산출에는 Biacore T100 Evaluation Software(GE Healthcare)를 사용하였다.
  원숭이 PK / PD 시험에 의한 항체 혈장 중 농도, CRP 농도, 비결합형 가용형 IL-6 수용체의 측정
 게잡이원숭이 혈장 중 농도 측정은 ELISA법으로 당업자 공지의 방법으로 측정하였다.
 CRP 농도는 사이어스 R CRP(간토 화학 주식회사)로, 자동분석장치(TBA-120FR, 도시바 메디컬 시스템즈 주식회사)를 사용해서 측정하였다.
 게잡이원숭이 혈장 중의 비결합형 게잡이원숭이 가용형 IL-6 수용체 농도를 이하와 같이 측정하였다. 게잡이원숭이의 혈장 30 μL를 0.22 ㎛의 필터컵(Millipore)에 있어서 건조시킨 적량의 rProtein A Sepharose Fast Flow (GE Healthcare) 수지에 첨가함으로써 혈장 중에 존재하는 모든 IgG형 항체(게잡이원숭이 IgG, 항인간 IL-6 수용체 항체 및 항인간 IL-6 수용체 항체-게잡이원숭이 가용형 IL-6 수용체 복합체)를 Protein A에 흡착시켰다. 그 후, 고속원심기로 스핀 다운하고, 패스용액을 회수하였다. 패스용액에는 protein A에 결합한 항인간 IL-6 수용체 항체-게잡이원숭이 가용형 IL-6 수용체 복합체는 포함되지 않기 때문에, protein A 패스용액 중의 게잡이원숭이 가용형 IL-6 수용체 농도를 측정함으로써, 비결합형 가용형 IL-6 수용체 농도를 측정 가능하다. 게잡이원숭이 가용형 IL-6 수용체 농도는, 상기에서 제작한 게잡이원숭이 가용형 IL-6 수용체(cIL-6R)를 스탠다드로 사용하여, 인간 IL-6 수용체 농도를 측정하는 당업자 공지의 방법으로 측정하였다. 가용형 IL-6 수용체의 중화율은 이하의 계산식에 의해 계산하였다.
 
  [ 실시예 21]
  (1) 인간화 H0L0 항체의 점변이 유전자의 제작
 WO2006/046751에 개시되는 인간화 GC33 항체의 CDR을 포함하는 글리피칸3 항체를 코드하는 유전자를 출발재료로 하여, 각종 점변이 유전자를 제작하였다. 개변부위를 포함하는 순사슬 및 역사슬의 서열을 토대로 하여 설계된 올리고 DNA가 합성되었다. 시판의 QuikChange Site-Directed Mutagenesis Kit(Stratagene)를 사용하여 복수의 점변이 유전자가 제작되었다. 점변이 유전자의 제작은 이하의 조건에 따라 PCR법에 의해 실시되었다. 10 ng의 주형 플라스미드와, 10 pmol의 순사슬 및 및 역사슬의 합성 올리고 DNA, 키트에 첨부된 10x Buffer, dNTP mix 및 Pfu turbo DNA polymerase로 되는 반응 혼합물을, 95℃에서 30초간 가열한 후, 95℃에서 30초, 55℃에서 1분, 68℃에서 4분으로 구성되는 PCR 반응 사이클이 18회 실시되었다. 키트에 첨부된 DpnI가 반응 혼합물에 첨가된 후에 37℃에서 1시간의 제한 효소에 의한 제한 소화반응이 계속되었다. 당해 반응액에 의해 DH5α 컴피턴트 세포(TOYOBO)가 형질전환된 결과, 형질전환체가 얻어졌다. 당해 형질전환체로부터 단리된 플라스미드 DNA의 염기서열의 결정을 토대로 하여, 점변이가 도입된 것이 확인된 점변이 유전자는, 동물세포에 있어서 삽입 유전자를 발현 가능하게 하는 발현벡터 중에 클론화되었다. 개변 유전자는 이하에 나타내는 구성을 갖는 개변에 의해 취득되었다.
 인간화 H0L0 항체 및 그 점변이 개변체의 일과성 발현은 Polyethyleneimine(Polysciences Inc.)을 사용한 일과성 발현에 의해 실시되었다. Trypsin EDTA(Invitrogen)로 박리된 HEK293세포가, 10 ㎠ 배양 디쉬에 6×10 6 cells/10 mL가 되도록 파종되었다. 다음날, 4.6 ㎍의 H사슬 발현 플라스미드 DNA 및 9.2 ㎍의 L사슬 발현 플라스미드 DNA에 690 ㎕의 SFMII 배지 및 20.8 ㎍의 Polyetyleneimine을 첨가하여 혼합된 후, 당해 혼합액은 실온에서 10분간 정치되었다. 혼합액의 전량은, HEK293세포가 상기 기재한 바와 같이 파종된 배양 디쉬에 적하되었다. 그 약 72시간 후에 회수된 배양상청으로부터, 발현한 인간화 H0L0 항체 및 그 점변이 개변 항체의 정제가 rProteinA sepharose TM Fast Flow(GE Healthcare)를 사용하여, 그 프로토콜에 따라 실시되었다.
  (1-1) 인간화 H0L0 항체의 Tm 값의 개변
 열변성 중간온도(Tm)는, 일정의 프로그램된 가열속도로 피검시료용액을 가열한 후에 얻어지는 온도기록도(thermogram)(Cp vs T)에 있어서의 변성 피크의 정점으로서 파악된다. DSC 측정용 시료용액의 조제를 이하와 같이 실시함으로써, 인간화 H0L0 항체의 Tm값이 측정되었다. 먼저, 150 mmol/l의 염화나트륨을 포함하는 20 mol/l의 초산나트륨 완충용액(pH 6.0)을 투석외액에 대해, 투석막에 봉입된 50-100 ㎍ 상당량의 항체용액이 하룻동안, 투석에 제공되었다. 그 후, 투석외액을 사용하여 그 항체농도가 50-100 ㎍/㎖로 조제된 시료용액이 DSC 측정용 시료용액으로서 사용되었다.
 적절한 DSC장치, 예를 들면 DSC-II(Calorimetry Sciences Corporation)가, 이 실험을 위해 바람직하게 사용된다. 상기 방법에 의해 조제된 시료용액 및 레퍼런스용액(투석외액)이 충분히 탈기된 후에, 각각의 피험검체가 열량계 셀에 봉입되어 40℃에서 열적으로 평형화가 행해졌다. 다음으로 DSC 주사가 40℃~100℃에서 약 1 K/분의 주사속도로 행해졌다. 당해 측정의 결과는, 온도의 함수로서의 변성 피크의 정점으로서 표시된다. 비특허문헌(Rodolfo등, Immunology Letters(1999), 47-52)을 참고로 한 Fab 도메인의 피크 어사인이 행해져, 인간화 H0L0 항체의 열변성 중간온도가 산출되었다. 구체예로서 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 DSC(시차주사 열량계) 측정으로 얻어진 차트가 도 49에 예시된다.
 상기 기재의 방법에 의한 산출을 토대로 한 서열번호 195로 표시되는 H사슬, 및 서열번호 201로 표시되는 L사슬로 되는 인간화 H0L0 항체의 Tm값은 76.6℃이나, 기존의 항체로서 예시되는 Synagis 및 Herceptin의 Tm값은 각각 85.4℃ 및 81.8℃로 계측된다. 따라서 인간화 H0L0 항체의 Tm값은 기존의 항체의 그것보다도 낮은 것이 나타내어진 것이 된다.
 이에, 그 Tm값의 향상을 목적으로서, 인간화 H0L0 항체의 개변 항체를 제작하였다. 서열번호 195로 표시되는 H0L0 항체의 H사슬의 FR2에 대해, 그 VH1b의 서브클래스를 VH4의 서브클래스로 개변하는 V37I, A40P, M48I, L51I의 개변이 가해진 H15(서열번호 196)가 제작되었다. 그 Tm값은 79.1℃로 개선되었다. 서열번호 201로 표시되는 H0L0 항체의 L사슬의 FR2를 VK2로부터 VK3의 서브클래스로 개변하는 L42Q, S48A, Q50R의 개변 및 FR1의 V2를 생식세포계열의 서열인 I로 치환하는 V2I의 개변이 실시된 L4(서열번호 202)가 제작되었다. 그 Tm값은 77.2℃로 개선되었다. 이 2개의 개변체가 조합된 H15L4 항체의 Tm값은 80.5℃로 개선되었다.
  (1-2) 인간화 H0L0 항체의 pI 값의 개변
 항체가 갖는 pI값이 감소함으로써, 항체의 혈중 반감기가 신장된다. 그것과는 반대로 항체의 pI값이 증대함으로써, 항체의 조직 이행성이 개선된다. 암 치료에 대한 효과를 나타내는 항체의 pI값의 증가 또는 감소 중 어느 하나가, 종양억제효과의 증강을 가져올지는 알려져 있지 않다. 이에, pI값이 감소한 인간화 H0L0 항체의 개변 항체와 pI값이 증가된 인간화 H0L0 항체의 개변 항체를 제작하여, 양자의 항종양효과를 비교 검토함으로써, 어느 개변이 높은 종양억제효과를 가져오는지가 검증되었다.
 각 항체의 pI값은 등전점 전기영동에 의한 분석을 토대로 하여 산출되었다. 당해 전기영동은 이하와 같이 행해졌다. Phastsystem Cassette(AmerchamBioscience사제)를 사용하여 이하의 조성을 갖는 팽윤액에 의해 60분정도 Phast-Gel Dry IEF(AmerchamBioscience) 겔이 팽윤되었다.
 (a) 고pI용 팽윤액의 조성:
 1.5 ㎖의 10% Glycerol
 100 ㎕의 Pharmalyte 8-10.5 for IEF(AmerchamBioscience)
 (b) 저pI용 팽윤액의 조성:
 1.5 ㎖의 정제수
 20 ㎕의 Pharmalyte 8-10.5 for IEF(AmerchamBioscience)
 80 ㎕의 Pharmalyte 5-8 for IEF(AmerchamBioscience)
 약 0.5 ㎍의 항체가 팽윤된 겔에 제공되고, 이하의 프로그램에 의해 제어된 PhastSystem(AmerchamBioscience)을 사용함으로써 등전점 전기영동이 행해졌다. 샘플은 하기 프로그램에 있어서의 Step 2의 단계에서 겔에 첨가되었다. pI 마커로서, Calibration Kit for pI(AmerchamBioscience)가 사용되었다.
 Step 1: 2000 V, 2.5 mA, 3.5 W, 15℃, 75 Vh
 Step 2: 200 V, 2.5 mA, 3.5 W, 15℃, 15 Vh
 Step 3: 2000 V, 2.5 mA, 3.5 W, 15℃, 410 Vh
 영동 후의 겔이 20% TCA에 의해 고정화된 후, Silver staining Kit, protein(AmerchamBioscience)을 사용하여, 키트에 첨부되어 있는 프로토콜에 따라 은 염색이 행해졌다. 염색 후, pI 마커가 갖는 기지의 등전점을 기준으로 하여 피험 시료인 각 항체의 등전점이 산출되었다. 도 50 및 도 51에 각각 고pI 등전점 전기영동의 영동상 및 저pI 등전점 전기영동의 영동상이 나타내어져 있다.
 (a) pI값이 증가된 개변
 H15에 Q43K, D52N, Q107R의 개변이 추가적으로 실시된 Hspu2.2(Hu2.2)(서열번호 200)가 제작되었다. 또한, L4에 E17Q, Q27R, Q105R 및 CDR2의 S25를 생식세포계열에서 많은 A로 치환한 S25A의 개변이 실시된 Lspu2.2(Lu2.2)(서열번호 206)가 제작되었다. Hspu2.2(Hu2.2) 및 Lspu2.2(Lu2.2)로 되는 항체인 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 Tm값은 76.8℃로 계측되고, pI값은 9.6으로 계측되었다. H0L0 항체의 pI값은 8.9인 것으로부터, Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 pI값은 0.7 증대하였다.
 (b) pI값이 감소한 개변
 H15에 K19T, Q43E, K63S, K65Q, G66D의 개변이 추가적으로 실시된 Hspd1.8(Hd1.8)(서열번호 199)이 제작되었다. L4에 Q27E의 개변이 실시되고, L4를 구성하는 FR3의 79-84의 서열인 KISRVE가 TISSLQ로 개변되어, Lspu2.2(Lu2.2)에 대한 개변과 마찬가지로 S25A의 개변이 실시된 Lspd1.6(Ld1.6)(서열번호 205)이 제작되었다. Hspd1.8(Hd1.8) 및 Lspd1.6(Ld1.6)으로 되는 항체인 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 Tm값은 72.6℃로 계측되고, pI값은 7.4로 계측되었다. H0L0 항체의 pI값은 8.9인 것으로부터 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 pI값은 1.5 감소하였다.
  (2) 경합 ELISA 에 의한 H0L0 항체의 점변이 개변 항체 결합활성의 평가
 (1)에서 정제된 H0L0 항체 및 그의 점변이 개변 항체의 경합 ELISA에 의한 평가가 행해졌다. 1 ㎍/㎖가 되도록 조제된 가용형 GPC3 코어 폴리펩티드(서열번호 207)가 96웰 플레이트에 1 웰당 100 ㎕ 첨가되었다. 당해 플레이트는 4℃에서 밤새 정치되어, 가용형 GPC3 코어 폴리펩티드가 당해 플레이트에 고상화되었다. 당해 플레이트에 고상화된 가용형 GPC3 코어 폴리펩티드는 SkanWASHER 400(Molecular Devices)을 사용하여 세정 완충액으로 3회 세정되고 200 ㎕의 블로킹 완충액이 첨가되어 4℃에서 하룻밤 이상 블록되었다. 당 가용형 GPC3 코어 폴리펩티드가 고상화되어 블록된 플레이트는 다음으로 SkanWASHER 400을 사용하여 세정 완충액으로 3회 세정되었다. 그 후, 각종 농도의 H0L0 항체 또는 그의 점변이 개변 항체와 최종농도 0.3 ㎍/㎖의 비오틴화된 H0L0 항체와의 혼합액 100 ㎕가 플레이트 1웰당 첨가되었다. H0L0 항체의 비오틴화는 Biotin Labeling 키트(Roche)를 사용하여 키트의 프로토콜에 따라 실시되었다. 당해 플레이트는 실온에서 1시간 정치된 후, SkanWASHER 400(Molecular Devices)을 사용하여 세정 완충액으로 5회 세정되었다. 그 1 웰당 기질 완충액에 의해 20,000배로 희석된 100 ㎕의 Goat anti streptabidin Alkaline phosphatase(ZYMED)가 첨가된 당해 플레이트는, 실온에서 1시간 정치된 후 SkanWASHER 400을 사용하여 세정 완충액으로 5회 세정되었다. 기질 완충액을 사용하여 1 ㎎/㎖가 되도록 Phosphatase Substrate(Sigma)가 조제되고, 1 웰당 100 ㎕ 첨가되어 1시간 정치되었다. Benchmark Plus(BIO-RAD)를 사용하여 655 ㎚의 대조흡광도를 사용하여, 각 웰 중의 반응액의 405 ㎚에 있어서의 흡광도가 측정되었다.
 도 52에서 나타내어지는 바와 같이, H15L4 항체의 항원에 대한 결합활성은 개변에 제공한 H0L0 항체의 그것과 거의 동등한 것이 나타내어졌다. 또한, 도 53에서 나타내어지는 바와 같이, Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체의 항원에 대한 결합활성은 개변에 제공한 H0L0 항체의 그것과 거의 동등한 것이 나타내어졌다. 또한, 도 54에서 나타내어지는 바와 같이, Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체의 항원에 대한 결합활성은 개변에 제공한 H0L0 항체의 그것과 거의 동등한 것이 나타내어졌다.
  [ 참고 실시예 22] CHO 세포에 있어서의 푸코오스 트랜스포터 유전자의 파괴
  (1) 타겟팅 벡터의 구축
  (1-1) KO1 벡터의 제작
 pcDNA3.1/Hygro(인비트로겐)로부터 Hyg5-BH와 Hyg3-NT의 프라이머로 PCR함으로써, Hygromycin 내성유전자(Hygr)의 개시 코돈의 5'측에 BamH I 사이트와 TGCGC의 서열을 부가함으로써, 푸코오스 트랜스포터 유전자의 개시 코돈의 5'측과 동일한 서열로 하고, SV40 polyA 부가 시그널까지의 영역을 포함하는 3'측에는 Not I 사이트를 부가하고 Hygr을 잘라내었다.
 포워드 프라이머
 Hyg5-BH 5'- GGATCCTGCGCATGAAAAAGCCTGAACTCACC -3'(서열번호 208)
 리버스 프라이머
 Hyg3-NT 5'- GCGGCCGCCTATTCCTTTGCCCTCGGACG -3'(서열번호 209)
 푸코오스 트랜스포터의 타겟팅 벡터 ver.1(이하, KO1 벡터라 칭함)은 pMC1DT-A벡터(Yagi T, Proc. Natl. Acad. Sci. USA(1990) 87, 9918-22)에, 푸코오스 트랜스포터의 5'측(서열번호 210에 나타내는 염기서열 No.2,780의 SmaI에서 No.4,232의 BamH I), 3'측(No.4,284에서 No.10,934의 Sac I까지) 및 Hygr 프래그먼트를 각각 삽입함으로써 구축하였다. 벡터의 특징으로서는, Hygr에 프로모터가 부가되어 있지 않은 것으로부터, 상동 재조합을 일으켰을 때 푸코오스 트랜스포터의 프로모터에 의해, Hygr이 발현하는 것이 된다. 그러나, 상동 재조합에 의해 1 카피만 벡터가 세포에 도입되어도, 하이그로마이신 B에 대한 내성을 획득할만큼 Hygr이 발현한다고는 한정할 수 없다. 또한, KO1 벡터는 Not I로 절단하여 세포에 도입하였다. KO1 벡터에 의해, 푸코오스 트랜스포터는 개시 코돈을 포함하는 엑손 1의 41 염기쌍을 결손하게 되어, 기능을 상실하는 것으로 생각된다.
  (1-2) pBSK - pgk -1- Hygr 의 제작
 pKJ2벡터(Popo H, Biochemical Genetics (1990) 28, 299-308)로부터 마우스 pgk-1 유전자의 프로모터를 EcoR I-Pst I에 의해 잘라내고, pBluescript(스트라타진)의 EcoR I-Pst I 사이트로 클로닝하여 pBSK-pgk-1을 제작하였다. Hygr는 pcDNA3.1/Hygro로부터 Hyg5-AV와 Hyg3-BH의 프라이머로 PCR함으로써, Hygr의 5'측에 EcoT22 I 사이트와 Kozak 서열을 부가하고, SV40 polyA 부가 시그널까지의 영역을 포함하는 3'측에는 BamH I 사이트를 부가하고 Hygr을 잘라내었다.
 포워드 프라이머
 Hyg5-AV 5'- ATGCATGCCACCATGAAAAAGCCTGAACTCACC -3'(서열번호 211)
 리버스 프라이머
 Hyg3-BH 5'- GGATCCCAGGCTTTACACTTTATGCTTC -3'(서열번호 212)
 이 Hygr(EcoT22 I-BamH I)프래그먼트를 pBSK-pgk-1의 Pst I-BamH I 사이트에 삽입하여, pBSK-pgk-1-Hygr을 제작하였다.
  (1-3) KO2 벡터의 제작
 푸코오스 트랜스포터의 타겟팅 벡터 ver.2(이하, KO2 벡터라 칭함)는 pMC1DT-A 벡터에 푸코오스 트랜스포터의 5'측(서열번호 210에 나타내는 염기서열의 No.2,780의 Sma I에서 No.4,232의 BamH I), 3'측(No.4,284에서 No.10,934의 SacI까지) 및 pgk-1-Hygr 프래그먼트를 각각 삽입함으로써 구축하였다. KO1 벡터와 달리, KO2 벡터는 Hygr에 pgk-1 유전자의 프로모터가 부가되어 있는 것으로부터, 상동 재조합에 의해 1 카피만 벡터가 세포에 도입되어도, 하이그로마이신 B에 대한 내성을 획득한다. 또한, KO2 벡터는 Not I으로 절단하여 세포에 도입하였다. KO2 벡터에 의해, 푸코오스 트랜스포터는 개시 코돈을 포함하는 엑손 1의 46 염기쌍을 결손하게 되어, 기능을 상실하는 것으로 생각된다.
  (1-4) pBSK - pgk -1- Puror 의 제작
 pPUR 벡터(BD Biosciences)를 Pst I과 BamH I으로 절단하고, 잘라내어진 프래그먼트(Puror)를 pBSK-pgk-1의 Pst I-BamH I 사이트에 삽입하여, pBSK-pgk-1-Puror을 제작하였다.
  (1-5) KO3 벡터의 제작
 푸코오스 트랜스포터의 타겟팅 벡터 ver.3(이하, KO3 벡터라 칭함)는 pMC1DT-A 벡터에 푸코오스 트랜스포터의 5'측(서열번호 210에 나타내는 염기서열의 No.2,780의 Sma I에서 No.4,232의 BamH I), 3'측(No.4,284에서 No.10,934의 SacI까지) 및 pgk-1-Puror 프래그먼트를 각각 삽입함으로써 구축하였다. 또한, pgk-1-Puror의 3' 말단에는, 이하에 나타내는 스크리닝용 프라이머가 결합하는 서열을 사전에 부가해 두었다. 또한, KO3 벡터는 Not I으로 절단하여 세포에 도입하였다. KO3 벡터에 의해, 푸코오스 트랜스포터는 개시 코돈을 포함하는 엑손 1의 46 염기쌍을 결손하게 되어, 기능을 상실하는 것으로 생각된다.
 리버스 프라이머
 RSGR-A 5'- GCTGTCTGGAGTACTGTGCATCTGC -3'(서열번호 213)
 이상의 3종류의 타겟팅 벡터를 사용하여, 푸코오스 트랜스포터 유전자의 녹아웃을 시도하였다.
  2) CHO 세포로의 벡터의 도입
 CHO-S-SFMII HT-(인비트로겐)에 HT Supplement(100x)(인비트로겐)와 페니실린 스토렙토마이신(인비트로겐)을 CHO-S-SFMII HT-의 용량에 대해, 각각 1/100량을 첨가하였다. 이것을 배양용 배지(이하, SFMII(+)라 칭함)로서 CHO세포의 DXB11주를 계대하고, 추가적으로 유전자 도입 후의 배양도 이 SFMII(+)에서 행하였다. 8×10 6개의 CHO세포를 0.8 ㎖의 둘베코 인산완충액(이하, PBS로 약칭함. 인비트로겐)에 현탁하였다. 세포 현탁액에 30 ㎍의 타겟팅 벡터를 첨가하고, Gene PulserCuvette(4 mm)(바이오래드)에 세포 현탁액을 옮겼다. 빙상에서 10분간 방치한 후, GENE-PULSER II(바이오래드)에서 1.5 kV, 25 μFD의 조건으로, 전기천공법에 의해 벡터를 세포에 도입하였다. 벡터를 도입 후, 세포를 200 ㎖의 SFMII(+) 배지에 현탁하여 20장의 96웰 바닥이 평평한 플레이트(이와키)에 100 ㎕/웰로 세포를 파종하였다. 플레이트를 CO 2 인큐베이터 내에서, 24시간, 37℃로 배양한 후, 약제를 첨가하였다.
  (3) 녹 아웃의 제1단계
 KO1 벡터 또는 KO2 벡터를 각각 CHO세포에 도입하고, 벡터 도입으로부터 24시간 후에 하이그로마이신 B(인비트로겐)에 의한 선발을 행하였다. 하이그로마이신 B는 0.3 ㎎/㎖가 되도록 SFMII(+)에 용해하고, 100 ㎕/웰 첨가하였다.
  (4) PCR 에 의한 상동 재조합체의 스크리닝
  (4-1) PCR 용 샘플의 조제
 상동 재조합체는 PCR법에 의해 스크리닝하였다. 스크리닝에서 사용하는 CHO세포는 96웰 바닥이 평평한 플레이트에서 배양하여, 배양상청 제거 후에 세포 용해용 완충액을 50 ㎕/웰 첨가하여 55℃, 2시간 가온하고, 계속해서 95℃, 15분 가열함으로써, 프로테이나제 K를 불활성화시켜서 PCR의 주형으로 하였다. 세포 용해용 완충액은, 1 웰당 10x LA 완충액 II(다카라 LATaq에 첨부) 5 ㎕, 10% NP-40(로쉐) 2.5 ㎕, 프로테이나제 K(20 ㎎/㎖, 다카라) 4 ㎕ 및 증류수(나칼라이 테스크) 38.5 ㎕로 구성되어 있다.
  (4-2) PCR 의 조건
 PCR 반응 혼합물은 상기의 PCR 샘플 1 ㎕, 10x LA 완충액II 5 ㎕, MGCl2(25 mM) 5 ㎕, dNTP(2.5 mM) 5 ㎕, 프라이머(각 10 μM) 2 ㎕, LA Taq(5 IU/㎕) 0.5 ㎕ 및 증류수 29.5 ㎕(전체 50 ㎕)로 하였다. KO1 벡터를 도입한 세포의 스크리닝에는, TP-F4와 THygro-R1, KO2 벡터를 도입한 세포의 스크리닝에는, TP-F4와 THygro-F1을 PCR 프라이머에 사용하였다.
 KO1  벡터를  도입한  세포의  PCR은,  95℃에서  1분간의  전가열,  95℃에서  30초간,  60℃에서  30초간,  및  72℃에서  2분간의  증폭  사이클  40  사이클,  및  72℃에서  7분의  복가열로  하였다.  KO2  벡터를  도입한  세포의  스크리닝에는  95℃에서  1분간의  전가열,  95℃에서  30초간  및  70℃에서  3분간의  증폭  사이클  40  사이클  및  70℃에서  7분의  복가열로  하였다.    
 프라이머는 이하와 같고, 상동 재조합을 일으킨 세포의 샘플에서는, KO1 벡터에서는, 약 1.6 kb, KO2 벡터에서는 약 2.0 kb의 DNA가 증폭된다. 프라이머는 TP-F4가 벡터의 외측에서, 또한 5'측의 푸코오스 트랜스포터의 게놈영역에 설정하고, THygro-F1 및 THygro-R1은 벡터 내의 Hygr 중에 설정하였다.
 포워드 프라이머(KO1, KO2)
 TP-F4 5'- GGAATGCAGCTTCCTCAAGGGACTCGC -3'(서열번호 214)
 리버스 프라이머(KO1)
 THygro-R1 5'- TGCATCAGGTCGGAGACGCTGTCGAAC -3'(서열번호 215)
 리버스 프라이머(KO2)
 THygro-F1 5'- GCACTCGTCCGAGGGCAAAGGAATAGC -3'(서열번호 216)
  (5) PCR 스크리닝 결과
 KO1  벡터를  도입한  세포는  918개를  해석하여,  그  중  상동  재조합체로  생각되는  세포는  1개였다(상동  재조합  효율은  약  0.1%).  또한,  KO2  벡터를  도입한  세포는  537개를  해석하여,  그  중  상동  재조합체로  생각되는  세포는  17개였다(상동  재조합  효율은  약  3.2%).    
  (6) 서던 블롯 해석
 또한, 서던 블롯법에 의해서도 확인을 행하였다. 배양한 세포로부터 통상의 방법에 따라 게놈 DNA를 10 ㎍ 조제하고, 서던 블롯을 행하였다. 서열번호 210에 나타내는 염기서열의 No.2,113-No.2,500의 영역에서, 이하의 2종류의 프라이머를 사용하여 PCR법에 의해 387 bp의 프로브를 조제하여, 이것을 서던 블롯법에 의한 확인에 사용하였다. 게놈 DNA는 Bgl II로 절단하였다.
 포워드 프라이머
 Bgl-F:5'- TGTGCTGGGAATTGAACCCAGGAC -3'(서열번호 217)
 리버스 프라이머
 Bgl-R:5'- CTACTTGTCTGTGCTTTCTTCC -3'(서열번호 218)
 Bgl II에 의한 절단에 의해, 푸코오스 트랜스포터의 염색체로부터는 약 3.0 kb, KO1 벡터로 상동 재조합을 일으킨 염색체로부터는 약 4.6 kb, KO2 벡터로 상동 재조합을 일으킨 염색체로부터는 약 5.0 kb의 밴드가 각각 출현한다. KO1 벡터 및 KO2 벡터에 의해 상동 재조합을 일으킨 세포의 각각 1, 7종류를 실험에 사용하였다. KO1 벡터로 유일하게 획득된 세포는 5C1으로 명명하였으나, 그 후의 해석에 의해 복수의 세포집단으로 구성되는 것이 명백해졌기 때문에, 한계희석에 의해 클론화하고, 그 후의 실험에 사용하는 것으로 하였다. 또한, KO2 벡터로 획득된 세포의 하나를 6E2로 명명하였다.
  (7) 녹 아웃의 제2단계
 KO1  벡터  및  KO2  벡터에  의해  상동  재조합이  성공한  세포에  대해,  3종류의  벡터를  사용하여,  푸코오스  트랜스포터  유전자가  완전히  결손된  세포주의  수립을  시도하였다.  벡터와  세포의  조합은,  이하와  같다.  방법  1:  KO2  벡터와  5C1세포(KO1),  방법  2:  KO2  벡터와  6E2세포(KO2),  방법  3:  KO3  벡터와  6E2세포(KO2).  벡터를  각각의  세포에  도입하고,  벡터  도입으로부터  24시간  후에  하이그로마이신  B,  퓨로마이신(나칼라이  테스크)에  의한  선발을  개시하였다.  하이그로마이신  B는  방법  1에서는  최종농도가  1  ㎎/㎖,  방법  2에서는  최종농도가  7  ㎎/㎖가  되도록  하였다.  또한  방법  3에서는,  하이그로마이신  B의  최종농도가  0.15  ㎎/㎖,  퓨로마이신의  최종농도가  8  ㎍/㎖가  되도록  첨가하였다.    
  (8) PCR 에 의한 상동 재조합체의 스크리닝
  샘플의 조제는 전술한 바와 같다. 방법 1에 관한 스크리닝은, 전술한 KO1 벡터 및 KO2 벡터로 상동 재조합을 일으킨 세포를 검출하는 PCR을 양쪽 행하였다. 방법 2에 관해서는, 하기의 PCR 프라이머를 설계하였다. 서열번호 210에 나타내는 염기서열의 No.3,924-3,950의 영역에 TPS-F1을, No.4,248-4,274에 SHygro-R1을 설정하였다. 이 PCR 프라이머에 의해, KO2 벡터에 의해 결손되는 푸코오스 트랜스포터의 유전자영역의 350 bp가 증폭된다. 따라서, 방법 2에 있어서의 PCR 스크리닝에 있어서는, 350 bp가 증폭되지 않는 것을, 푸코오스 트랜스포터 유전자가 완전히 결손된 세포로 간주하기로 하였다. PCR의 조건은, 95℃에서 1분간의 전가열, 95℃에서 30초간, 70℃에서 1분간의 증폭 사이클 35 사이클, 및 70℃에서 7분의 복가열로 하였다.
 포워드 프라이머
 TPS-F1:5'- CTCGACTCGTCCCTATTAGGCAACAGC -3'(서열번호 219)
 리버스 프라이머
 SHygro-R1:5'- TCAGAGGCAGTGGAGCCTCCAGTCAGC -3'(서열번호 220)
 방법  3에  관해서는,  포워드  프라이머에  TP-F4,  리버스  프라이머에  RSGR-A를  사용하였다.  PCR의  조건은,  95℃에서  1분간의  전가열,  95℃에서  30초간,  60℃에서  30초간,  72℃에서  2분간의  증폭  사이클  35  사이클,  및  72℃에서  7분의  복가열로  하였다.  KO3  벡터에  의해  상동  재조합을  일으킨  세포의  샘플에서는,  약  1.6  kb의  DNA가  증폭된다.  이  PCR로  KO3  벡터에  의해  상동  재조합을  일으킨  세포를  검출하는  동시에,  KO2  벡터로의  상동  재조합이  남아  있는  것도  확인하였다.    
  (9) PCR 스크리닝 결과
 방법  1에서는  616개를  해석하여,  그  중  상동  재조합체로  생각되는  세포는  18개였다(상동  재조합  효율은  2.9%).  방법  2에서는  524개를  해석하여,  그  중  상동  재조합체로  생각되는  세포는  2개였다(상동  재조합  효율은  약  0.4%).  또한,  방법3에서는  382개를  해석하여,  그  중  상동  재조합체로  생각되는  세포는  7개였다(상동  재조합  효율은  약  1.8%).    
  (10) 서던 블롯 해석
 전술한  방법에  준하여  해석을  행하였다.  그  결과,  해석할  수  있었던  세포  중,  푸코오스  트랜스포터의  유전자가  완전히  결손되어  있는  세포를  1개  발견하였다.  제1  단계의  녹아웃에서는  PCR과  서던  블롯의  해석  결과가  일치하였으나,  이  제2  단계의  녹아웃에서는  일치하지  않았다.    
  (11) 푸코오스의 발현 해석
 또한, PCR로 상동 재조합체로 판단된 26의 세포에 있어서의 푸코오스의 발현을 해석하였다. 5 ㎍/㎖의 Lens culinaris Agglutinin, FITC Conjugate(벡터 래버래터리), 2.5%의 FBS, 0.02%의 아지드화 나트륨을 포함하는 PBS(이하, FACS 용해액이라 칭함) 100 ㎕로 1×10 6개의 세포를 빙냉 중에서 1시간 염색하였다. 그 후, FACS 용해액으로 세포를 3회 세정하여 FACSCalibur(벡톤 디킨슨)로 측정을 행하였다. 그 결과, 서던 블롯 해석에서 푸코오스 트랜스포터의 유전자가 완전히 결손되어 있다고 판단된 세포인 FTP-KO주만, 푸코오스의 발현이 저하되어 있는 것이 명백해졌다.
  [ 참고 실시예 23] FTP - KO 주 유래의 항체생산세포의 수립과 당해 세포에 의해 생산된 항체의 정제
 SFMII(+) 배지에 하이그로마이신 B의 최종농도가 1 ㎎/㎖가 되도록 조제하고, 실시예 21에서 얻어진 푸코오스 트랜스포터 결손주(FT-KO세포, 클론명 3F2)를 계대하였다. 8×10 6개의 3F2를 0.8 ㎖의 둘베코 인산완충액에 현탁하였다. 세포현탁액에 25 ㎍의 인간화 글리피칸3 항체 발현벡터를 첨가하고, Gene Pulser Cuvette로 세포현탁액을 옮겼다. 빙상에서 10분간 방치한 후에, GENE-PULSER II로 1.5 kV, 25 μFD의 조건에서, 전기천공법에 의해 벡터를 세포에 도입하였다. 벡터를 도입 후, 세포를 SFMII(+) 배지 40 ㎖에 현탁하여 96웰 바닥이 평평한 플레이트(이와키사)에 100 ㎕/웰로 세포를 파종하였다. 플레이트를 CO 2 인큐베이터 내에서, 24시간, 37℃에서 배양한 후, Geneticin(인비트로겐)을 최종농도 0.5 ㎎/㎖가 되도록 첨가하였다. 약제에 내성이 된 세포의 항체생산량을 측정하여, 인간화 글리피칸3 항체생산 세포주를 각각 수립하였다.
 항체발현주로부터 배양상청이 회수되고, P-1 펌프(Pharmacia)를 사용하여Hitrap rProtein A(Pharmacia) 칼럼으로 어플라이되었다. 칼럼은 결합 버퍼(20 mM Sodium phosphate(pH 7.0))로 세정 후, 결합한 항체가 용출 버퍼(0.1 M Glycin-HCl(pH 2.7))로 용출되었다. 용출액은 바로 중화 버퍼(1 M Tris-HCl(pH 9.0))로 중화되었다. DC protein assay(BIO-RAD)에 의해 항체의 용출분획이 선택되어 모아진 후, 당해 용출분획은 Centriprep-YM10(Millipore)으로 2 ㎖ 정도까지 농축되었다. 다음으로, 당해 농축액은, 150 mM NaCl을 포함하는 20 mM 초산 버퍼(pH 6.0)로 평형화된 Superdex200 26/60(Pharmacia)을 사용한 겔 여과에 제공되었다. 용출액의 모노머 분획의 피크가 회수되고, 당해 분획이 Centriprep-YM10으로 농축되었다. 당해 농축액은 MILLEX-GW 0.22 ㎛ Filter Unit(Millipore)를 사용하여 여과된 후, 4℃에서 보관되었다. 정제된 항체의 농도는, 280 ㎚의 파장에서 측정된 흡광도를 토대로 하여, 몰 흡광계수로부터 환산하여 결정되었다.
  [ 참고실시예 24] FT - KO 세포에 의해 생산된 인간화 항글리피칸3 항체에 결합하는 당사슬의 해석
  (1) 2- 아미노벤즈아미드 표지 당사슬(2-AB화 당사슬)의 조제
 본 발명의 FT-KO세포 생산항체 및 대조시료로서 CHO세포 생산항체에, N-Glycosidase F(Roche diagnostics)를 작용시킴으로써, 항체에 결합하는 당사슬이 단백질로부터 유리된(Weitzhandler M. et al., Journal of Pharmaceutical Sciences (1994) 83(12),,1670-5). 에탄올을 사용한 단백질 제거 조작 후(Schenk B. et al., The Journal of Clinical Investigation (2001), 108(11), 1687-95), 유리 당사슬이 농축 건고되고, 이어서 2-아미노피리딘에 의해 형광 표지가 실시되었다(Bigge J. C. et al., Analytical Biochemistry (1995) 230(2), 229-238). 얻어진 2-AB화 당사슬이, 셀룰로오스 카트리지를 사용한 고상 추출에 의해 탈시약된 후 원심분리에 의해 농축되고, 정제 2-AB화 당사슬로서 이후의 해석에 제공되었다. 다음으로, β-Galactosidase(세이카가쿠 공업)를 정제 2-AB화 당사슬에 작용시킴으로써, 아갈락토실(agalactosyl) 2-AB화 당사슬이 조제되었다.
  (2) 아갈락토실 2- AB 당사슬의 순상 HPLC 에 의한 분석
 전항의 방법으로, 본 발명의 FT-KO세포 생산항체 및 대조시료로서 CHO세포 생산항체로부터 유리된 당사슬을 출발재료로서 조제된 아갈락토실 2-AB화 당사슬은, 아미드 칼럼 TSKgel Amide-80(도소)에 의한 순상 HPLC에 의해 분석되어, 그 크로마토그램이 비교되었다. CHO세포 생산항체에 있어서는 G(0)가 그 당사슬의 주성분으로서 존재하고 있어, 푸코오스가 부가되어 있지 않은 G(0)-Fuc는 피크 면적비로부터의 산출을 토대로 하여 전체 당사슬 중 4% 정도 존재할 것으로 추정되었다. 한편, FT-KO세포 생산항체에 있어서는, G(0)-Fuc가 주성분이고, 어느 생산주로부터 생산된 항체에 있어서도 피크 면적비로부터의 산출을 토대로 하면 전체 당사슬 중의 90% 이상이 푸코오스가 부가되어 있지 않은 당사슬로서 존재하고 있었다.
  TIFF 112010026138634-pct00019.png 32 176
  [ 실시예 25] 인간화 H0L0 항체 및 그의 점변이 개변 항체 안정성 발현주의 수립
 실시예 21에 기재된 방법으로 제작된 H0L0 항체의 개변 항체인 Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체와 Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체, 또는 그의 개변에 제공한 H0L0 항체를 코드하는 유전자가 발현벡터로 클론화되었다. 클론화시에는, 항체를 구성하는 H사슬 및 L사슬을 코드하는 각 유전자가 발현되도록, H사슬 및 L사슬을 코드하는 각 유전자가 각각 별도의 발현벡터에 삽입되었다. 상기한 바와 같이 H사슬 및 L사슬을 코드하는 각 유전자가 목적하는 조합이 되도록 선발된 2종류의 발현벡터가 PvuI로 절단된 후에, 참고 실시예 22에서 제작된 FTP-KO주 중으로 전기천공법을 사용하여 도입되었다.
 전기천공법에 의한 H0L0 항체 및 그의 개변 항체를 안정적으로 생산하는 형질도입주의 제작은 Gene PulserII(Bio Rad사제)를 사용하여 실시되었다. 목적하는 H사슬 및 L사슬을 구성하는 조합을 가져오는 H사슬, L사슬 발현 플라스미드 DNA 각각 10 ㎍과 PBS에 현탁된 CHO세포(1×10 7 세포/㎖) 0.75 ㎖가 혼합되고, 혼합액이 빙상에서 10분간 정치되었다. 혼합액이 Gene PulserII용 큐벳으로 옮겨진 후에 1.5 kV, 25 μFD의 용량으로 전기 펄스가 부여되었다. 펄스 부여된 혼합액은 실온에서 10분간 정치된 후에, CHO-S-SFMII/1% HT/1% PS 배지에 현탁되었다. 96 웰 배양용 플레이트의 각 웰에 동일 배지에서 조제된 5, 10, 50배로의 각 희석 현탁액 100 ㎕가 분주되었다. 당해 플레이트는 5%의 CO 2 농도로 유지된 CO 2 인큐베이터 중에서 24시간 인큐베이트되었다. 그 후, Geneticin(GIBCO)을 최종농도 500 ㎍/㎖, Zeocin(Invitrogen)을 최종농도 600 ㎍/㎖가 되도록 각 웰에 첨가된 당해 플레이트는 추가적으로 2주간 인큐베이트되었다. Geneticin 및 Zeocin 내성을 나타내는 형질도입세포의 콜로니가, 500 ㎍/㎖ Geneticin(GIBCO) 및 600 ㎍/㎖ Zeocin(Invitrogen)을 포함하는 동일 배지에서 계대됨으로써 추가적으로 선발되었다. 상기와 같이 선발된 당해 형질도입세포의 배양상청 중의 항체농도가 BiacoreQ(BIACORE)를 사용하여 평가됨으로써, 목적하는 항체를 고발현하는 형질도입주가 수립되었다. 배양상청 중의 항체농도의 측정은 BiacoreQ(BIACORE)에 첨부된 프로토콜을 토대로 하여 실시되었다.
  [ 실시예 26] in vivo 모델을 사용한 인간화 H0L0 항체 및 그의 점변이 개변 항체의 약효시험
  (1) in vivo 모델로의 이식에 제공하는 세포주의 유지
 Hep G2세포(ATCC)가 사용되었다. Hep G2세포는 10% FBS, 1 mmol/l MEM Sodium Pyruvate(Invitrogen), 1 mmol/l MEM Non-Essential Amino Acid(Invitrogen)를 포함하는 Minimun Essential Medium Eagle 배지(SIGMA)(이하, 계대용 배지라 한다.) 중에서 계대되어 유지되었다.
  (2) Hep G2 세포이식 마우스 모델의 제작
 Hep G2세포의 세포현탁액이 계대용 배지와 MATRIGEL Matrix(BD Bioscience)를 1:1로 포함하는 용액을 사용하여 5×10 7 세포/㎖가 되도록 조제되었다. 세포의 이식 전날에, 사전에 항아시알로 GM1항체(와코순약, 1 바이알 중의 내용물이 5 ㎖의 당해 용액에 의해 용해되었다.) 100 ㎕가 복강 내에 투여된 SCID 마우스(수컷, 5주령)(닛폰 클레아)의 복부 피하로 당해 세포 현탁액 100 ㎕(5×10 6 세포/마우스)가 이식되었다. 종양체적은, 식: 종양체적=장경×단경×단경/2를 사용하여 산출되고, 종양체적의 평균이 130-330 ㎣가 된 시점에서 모델이 성립된 것으로 판단되었다.
  (3) 각 피험 항체 포함한는 투여시료의 조제
 H0L0 항체, Hu2.2Lu2.2 항체, Hd1.8Ld1.6 항체의 각 항체를 포함하는 투여시료가, 그 투여당일에 생리식염수를 사용하여, 0.5 ㎎/㎖(5 ㎎/㎏ 투여군) 또는 0.1 ㎎/㎖(1 ㎎/㎏ 투여군)가 되도록 조제되었다.
  (4) 항체를 포함하는 투여시료의 투여
 (2)에서 제작된 마우스모델에 대한 Hep G2세포의 이식 후 27일부터 주에 1회씩, 3주간의 기간에서, 상기 (3)에서 조제된 투여시료가 10 ㎖/㎏의 투여량으로 꼬리정맥으로부터 투여되었다. 음성대조로서, 생리식염수를 마찬가지로 주에 1회씩, 3주간의 기간에서, 10 ㎖/㎏의 투여량으로 꼬리정맥으로부터 투여되었다. 어느 군도, 5마리를 1군으로 하고, 각 군에 대해 각 피험 항체를 포함하는 투여시료의 투여가 실시되었다. 투여와 거의 동시에, 각 군 중 3마리의 개체로부터, 각 항체의 마우스 혈중농도를 측정하기 위해 사용하는 피험물질로서, 그 정맥혈이 채취되었다. 구체적으로는, 초회 투여 후 0.5시간, 2회째 투여 직전의 2개의 타임 포인트에 있어서 등 다리정맥(dorsal metatarsal vein)으로부터 채혈이 행해졌다. 20 ㎕ 용량의 채혈이 헤파린처리에 의해 행해지고, 원심분리에 의해 혈장이 조제되었다.
  (5) 각 피험 항체 항종양효과의 평가
 인간 간암이식 마우스모델에 있어서의 각 피험 항체의 항종양효과가, 투여시료의 투여 최종일로부터 1주간 후의 종양체적을 측정함으로써 평가되었다. 그 결과, 도 55에 나타내는 바와 같이, Hspd1.8Lspd1.6(Hd1.8Ld1.6) 항체에서 약효가 강해지는 경향이 있고, Hspu2.2Lspu2.2(Hu2.2Lu2.2) 항체에서 약효가 약해지는 경향이 있었다.
  (6) 각 피험 항체 혈중농도
 마우스 혈장 중의 피험 항체의 농도가 실시예 21에 기재된 ELISA법에 준한 방법에 의해 측정되었다. 혈장 중 농도로서 12.8, 6.4, 3.2, 1.6, 0.8, 0.4, 0.2 ㎍/㎖의 검량선 시료가 조제되었다. 검량선 시료 및 목적하는 농도가 되도록 적절히 희석된 마우스 혈장 피험시료가 soluble Glypican-3 core(추가이 세이야쿠사제)를 고상화한 이뮤노플레이트(Nunc-Immuno Plate, MaxiSoup(Nalge nunc International))에 분주되고, 당해 플레이트가 실온에서 1시간 정치되었다. 그 후, Goat Anti-Human IgG-BIOT(Southern Biotechnology Associates) 및 Streptavidin-alkaline phosphatase conjugate(Roche Diagnostics)가 순차 분주하고, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & PerryLaboratories)을 기질로서 사용한 발색반응이 행해졌다. 각 웰 중의 반응액의 정색(呈色)이 마이크로플레이트 리더를 사용하여 반응액의 650 ㎚의 흡광도를 측정함으로써 산출되었다. 각 검량선 시료의 흡광도로 작성된 검량선을 토대로 하여, 해석 소프트웨어 SOFTmax PRO(Molecular Devices)를 사용하여 마우스 혈장 중의 항체농도가 산출되었다.
 투여 30분 및 7일 후의 마우스 혈장 중 농도가 도 56에 나타내어져 있다. 피험 항체의 어느 투여량에서도, 피험 항체의 pI가 보다 저하되어 있으면, 투여 7일 후의 마우스 혈장 중의 항체농도가 높아지는 것이 나타내어졌다.
  [ 실시예 27] 인간 말초혈 단핵구를 이펙터세포로서 사용한 각 피험 항체 ADCC활성
 인간 말초혈 단핵구(이하, 인간 PBMC로 지칭한다.)를 이펙터세포로서 사용하여 각 피험 항체의 ADCC활성이 이하와 같이 측정되었다.
  (1) 인간 PBMC용액 의 조제
 1000 단위/㎖의 헤파린용액(노보·헤파린 주사 5천단번 위치, 노보·노르디스크)이 사전에 200 ㎕ 주입된 주사기를 사용하여, 추가이 세이야쿠 가부시키가이샤 소속의 신체 건강한 자원봉사자(성인 남성)로부터 말초혈 50 ㎖가 채취되었다. PBS(-)를 사용하여 2배로 희석된 당해 말초혈이 4등분되고, 15 ㎖의 Ficoll-Paque PLUS가 사전에 주입되어 원심조작이 행해진 Leucosep 림프구 분리관(Greiner bio-one)에 첨가되었다. 당해 말초혈이 분주된 분리관이 2150 rpm의 속도에 의해 10분간 실온에서 원심분리의 조작이 행해진 후, 단핵구 분획층이 분취되었다. 10% FBS를 포함하는 Dulbecco's Modified Eagle's Medium(SIGMA)(이하 10% FBS/D-MEM이라 칭한다.)에 의해 1회당 당해 각 분층에 포함되는 세포가 세정된 후, 당해 세포가 10% FBS/D-MEM 중에 그 세포밀도가 5×10 6/㎖가 되도록 현탁되었다. 당해 세포 현탁액이 인간 PBMC용액으로서 이후의 실험에 제공되었다.
  (2) 표적세포의 조제
 Hep G2세포가 디쉬로부터 박리되어, 1×10 4 cells/웰이 되도록 96웰 U자상 바닥 플레이트에 파종되었다. 당해 플레이트는 5% 탄산가스 인큐베이터 중에 있어서 37℃에서 하룻밤 인큐베이트되었다. 다음날, 당해 플레이트의 각 웰 중에 5.55 MBq의 Cr-51이 첨가되고, 당해 플레이트는 5% 탄산가스 인큐베이터 중에 있어서 37℃에서 3시간 인큐베이트되었다. 당해 플레이트의 각 웰 중에 존재하는 Hep G2세포가 표적세포로서, 이후의 ADCC활성의 측정시에 사용되었다.
  (3) 크롬 유리시험(Chrome release assay)( ADCC 활성)
 ADCC활성은 크롬 릴리스법에 의한 특이적 크롬 유리율로 평가된다. (2)에서 조제된 표적세포가 배지로 세정되고, 각 농도(0, 0.004, 0.04, 0.4, 4, 40 ㎍/㎖)로 조제된 H0L0 항체, Hu2.2Lu2.2 항체, Hd1.8Ld1.6 항체의 각 항체 100 ㎕가 각각 첨가되었다. 당해 플레이트는, 실온에서 15분간 반응된 후에 항체용액이 제거되었다. 다음으로, 각 웰 중에 계대용 배지가 각 100 ㎕ 첨가된 당해 플레이트는, 5% 탄산가스 인큐베이터 중에 있어서 37℃에서 1시간 인큐베이트되었다. 각 웰 중에 (1)에서 조제된 PBMC용액 각 100 ㎕(5×10 5 세포/웰)가 첨가된 당해 플레이트는, 5% 탄산가스 인큐베이터 중에 있어서 37℃에서 4시간 정치된 후, 원심분리 조작되었다. 당해 플레이트의 각 웰 중의 100 ㎕의 배양상청의 방사활성이 감마 카운터를 사용하여 측정되었다. 하기 식: 특이적 크롬 유리율(%)=(A-C)×100/(B-C)
 을 토대로 하여 특이적 크롬 유리율이 구해졌다.
 상기 식에 있어서, A는 각 웰 중의 100 ㎕의 배양상청의 방사활성(cpm)의 평균값을 나타낸다. 또한, B는 표적세포에 100 ㎕의 2% NP-40 수용액(Nonidet P-40, 나칼라이 테스크) 및 50 ㎕의 10% FBS/D-MEM배지를 첨가한 웰 중의 100 ㎕의 배양상청의 방사활성(cpm)의 평균값을 나타낸다. 또한, C는 표적세포에 10% FBS/D-MEM배지를 150 ㎕ 첨가한 웰 중의 100 ㎕의 배양상청의 방사활성(cpm)의 평균값을 나타낸다. 시험은 triplicate로 실시되고, 각 피험 항체의 ADCC활성이 반영되는 상기 시험에 있어서의 특이적 크롬 유리율(%)의 평균값 및 표준편차가 산출되었다.
  (4) 각 피험 항체 ADCC 활성의 평가
 각 피험 항체를 매개로 하여 인간 PBMC가 발휘하는 ADCC활성이 평가된 결과, 모든 피험 항체가 ADCC활성을 갖는 것이 확인되었다. 그 결과가 도 57에 나타내어져 있다. 각 농도에서의 각 피험 항체가 나타내는 특이적 크롬 유리율에 대해 유의차 검정이 행해진 결과, 모든 항체농도에 있어서 각 피험 항체가 나타내는 특이적 크롬 유리율의 각 피험 항체 사이에서의 유의한 차가 확인되지 않았다. 통계해석에는 SAS 전임상 패키지(SAS Institute Inc.)가 사용되었다. 이상의 결과를 토대로 하여, 그 pI가 개변된 각 피험 항체의 ADCC활성간에는 차가 없다는 것이 나타내어졌다.
  [ 실시예 28] 항인간 IL -6 수용체 항체, 항인간 GPC3 항체, 항인간 IL -31 수용체 항체의 제작
  1 항인간 IL -6 수용체 항체의 제작
 항인간 IL-6 수용체 항체로서, 2종류의 항체를 제작하였다. H사슬로서 6R_a_H1(서열번호:221) 및 L사슬로서 6R_a_L1(서열번호:224)로 구성되는 6R_a_H1L1, 및 H사슬로서 6R_b_H1(서열번호:227) 및 L사슬로서 6R_b_L1(서열번호:229)로 구성되는 6R_b_H1L1을 제작하였다. 참고예 1, 2에 따라, 각각의 아미노산 서열을 코드하는 동물세포 발현벡터를 제작하여, 발현, 정제를 행하였다.
  2 항인간 GPC3 항체의 제작
 항인간  GPC3  항체를  제작하였다.  H사슬로서  GPC3_H1(서열번호:233)  및  L사슬로서  GPC3_L1(서열번호:236)로  구성되는  GPC3_H1L1을  제작하였다.  참고예  1,  2에  따라,  각각의  아미노산  서열을  코드하는  동물세포  발현벡터를  제작하여,  발현,  정제를  행하였다.    
  3 항인간 IL -31 수용체 항체
 항인간  IL-31  수용체  항체를  제작하였다.  H사슬로서  31R_H1(서열번호:239)  및  L사슬로서  31R_L1(서열번호:242)로  구성되는  31R_H1L1을  제작하였다.  참고예  1,  2에  따라,  각각의  아미노산  서열을  코드하는  동물세포  발현벡터를  제작하여,  발현,  정제를  행하였다.    
  [ 실시예 29] 항인간 IL -6 수용체 항체, 항인간 GPC3 항체, 항인간 IL -31 수용체 항체의 아미노산 치환에 의한 등전점의 저하
  1 항원으로의 결합활성을 감약하지 않고 등전점을 저하시키는 CDR 서열의 탐색
 WO/2007/114319에 있어서, CDR에 있어서의 아미노산 치환에 의한 등전점의 제어예가 나타내어져 있으나, H사슬 CDR3에 아미노산 치환을 행하고 있고, H사슬 CDR3는 항체의 항원으로의 결합활성에 크게 관여하고 있는 것으로부터, 항체의 종류에 따라서는 동일한 개소의 아미노산 치환으로 항원으로의 결합활성을 감약하지 않고, 등전점을 저하시킬 수 없는 것이 예상되었다. 이에, 항체의 종류에 관계없이, 항원으로의 결합활성을 감약하지 않고 등전점을 저하시키는 것이 가능한 후보 CDR 서열을 탐색하였다. 그 결과, H사슬 가변영역에 있어서는, H31, H52, H61, H62, H64, H65가, L사슬 가변영역에 있어서는 L24, L27, L27a, L53, L54, L55, L56(Kabat 넘버링)이, 항원으로의 결합활성을 감약하지 않고 등전점을 저하시키는 것이 가능한 후보 CDR 서열로서 예시되었다. 이에, 이하에 나타내는 항인간 IL-6 수용체 항체, 항인간 GPC3 항체 및 항인간 IL-31 수용체 항체에 있어서, 각각 이들의 후보 CDR 서열 중 몇 개에 대해, 아미노산 치환을 행하여, 항원으로의 결합활성을 감약하지 않고 등전점을 저하시키는 것이 가능한지 여부를 검토하였다.
  2 등전점을 저하시킨 항인간 IL -6 수용체 항체의 제작, 결합활성 평가 및 등전점 측정
 항인간 IL-6 수용체 항체인 6R_a_H1L1을 구성하는 6R_a_H1(서열번호:221) 및 6R_a_L1(서열번호:224)에 대해, 각각 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 6R_a_H2(서열번호:222) 및 6R_a_L2(서열번호:225)를, 참고예 1, 2의 방법에 따라 벡터를 제작하고, 6R_a_H2L2의 발현, 정제를 행하였다. 6R_a_H2L2에 대해, 추가적으로 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 6R_a_H3(서열번호:223) 및 6R_a_L3(서열번호:226)를, 참고예 1의 방법에 따라 벡터를 제작하고, 6R_a_H3L3의 발현, 정제를 행하였다.
 6R_a_H1L1, 6R_a_H2L2, 6R_a_H3L3의 항원인 인간 IL-6 수용체에 대한 해리상수(KD)를 참고예 3에 기재된 Biacore T100에 의한 방법을 사용하여 측정하였다. 6R_a_H1L1, 6R_a_H2L2, 6R_a_H3L3의 IL-6 수용체에 대한 해리상수(KD)는 이하의 표 18에 나타내는 바와 같이 동등하여, 아미노산 치환의 도입에 의해 항원으로의 결합활성의 대폭 저하는 확인되지 않았다.
  TIFF 112010026138634-pct00020.png 32 88
 당업자 공지의 등전점 전기영동에 의해 등전점을 측정한 결과, 6R_a_H1L1의 등전점은 약 9.2였던 것에 대해, 등전점을 저하시키는 아미노산 치환을 행한 6R_a_H2L2의 등전점은 약 6.1이고, 6R_a_H3L3의 등전점은 약 5.4로, 각각 6R_a_H1L1과 비교하여 등전점이 약 3.1 및 약 3.8 저하되었다. 또한, 가변영역 VH/VL의 이론등전점을 GENETYX(GENETYX CORPORATION)에 의해 계산한 바, 6R_a_H1L1의 이론등전점은 9.37이었던 것에 대해, 6R_a_H2L2의 이론등전점은 4.63이고, 6R_a_H3L3의 이론등전점은 약 4.27으로, 각각 6R_a_H1L1과 비교하여 이론등전점이 4.74 및 5.10 저하되었다. 이들의 결과를 표 19에 정리하였다.
  TIFF 112010026138634-pct00021.png 28 114
 이하의 표 20에 6R_a_H1L1에 대해 도입한 CDR 서열의 아미노산 치환을 정리하였다. 이들 CDR의 아미노산 치환은, 항인간 IL-6 수용체 항체인 6R_a_H1L1에 대해, 항원에 대한 결합활성을 대폭 저하시키지 않고, 항체분자의 등전점을 저하시키는 것이 가능한 것을 발견하였다.
  TIFF 112010026138634-pct00022.png 77 105
 계속해서, 별도의 항인간 IL-6 수용체 항체인 6R_b_H1L1을 구성하는 6R_b_H1(서열번호:227) 및 6R_b_L1(서열번호:229)에 대해, 각각 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 6R_b_H2(서열번호:228) 및 6R_b_L2(서열번호:230)를, 참고예 1, 2의 방법에 따라 벡터를 제작하고, 6R_b_H2L2의 발현, 정제를 행하였다. 6R_b_H2L2에 대해, 추가적으로 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 6R_b_L3(서열번호:231) 및 6R_b_L4(서열번호:232)를, 참고예 1의 방법에 따라 벡터를 제작하고, 6R_b_H2L3, 6R_b_H2L4의 발현, 정제를 행하였다.
 6R_b_H1L1, 6R_b_H2L2, 6R_b_H2L3, 6R_b_H2L4의 항원인 인간 IL-6 수용체에 대한 중화활성의 측정을 참고예 4에 나타내는 방법으로 행하였다. 6R_b_H1L1, 6R_b_H2L2, 6R_b_H2L3, 6R_b_H2L4의 중화활성은 도 58에 나타내는 바와 같이 거의 동등하여, 아미노산 치환의 도입에 의해 항원으로의 결합활성의 대폭 저하는 확인되지 않았다.
 당업자 공지의 등전점 전기영동에 의해 등전점을 측정한 결과, 6R_b_H1L1의 등전점은 약 9.3이었던 것에 대해, 등전점을 저하시키는 아미노산 치환을 행한 6R_b_H2L2의 등전점은 약 5.9이고, 6R_b_H1L1과 비교하여 등전점이 약 3.4 저하되었다. 또한, 가변영역 VH/VL의 이론등전점을 GENETYX(GENETYX CORPORATION)에 의해 계산한 바, 6R_b_H1L1의 이론등전점은 9.20이었던 것에 대해, 6R_b_H2L2의 이론등전점은 4.52이고, 6R_b_H2L3의 이론등전점은 약 4.46이며, 6R_b_H2L4의 이론등전점은 약 4.37로, 각각 6R_b_H1L1과 비교하여 이론등전점이 4.68, 4.74 및 4.83 저하되었다. 이들의 결과를 표 21에 정리하였다.
  TIFF 112010026138634-pct00023.png 39 158
 이하의 표 22에 6R_b_H1L1에 대해 도입한 CDR 서열의 아미노산 치환을 정리하였다. 이들 CDR의 아미노산 치환은, 항인간 IL-6 수용체 항체인 6R_b_H1L1에 대해, 항원에 대한 결합활성을 대폭 저하시키지 않고, 항체분자의 등전점을 저하시키는 것이 가능한 것을 발견하였다.
  TIFF 112010026138634-pct00024.png 62 105
  3 등전점을 저하시킨 항인간 GPC3 항체의 제작, 결합활성 평가 및 등전점 측정
 항인간 GPC3 항체인 GPC3_H1L1을 구성하는 GPC3_H1(서열번호:233) 및 GPC3_L1(서열번호:236)에 대해, 각각 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 GPC3_H2(서열번호:234) 및 GPC3_L2(서열번호:237)를, 참고예 1, 2의 방법에 따라 벡터를 제작하고, GPC3_H2L2의 발현, 정제를 행하였다. GPC3_H2L2에 대해, 추가적으로 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 GPC3_H3(서열번호:235) 및 GPC3_L3(서열번호:238)를, 참고예 1의 방법에 따라 벡터를 제작하고, GPC3_H3L3의 발현, 정제를 행하였다.
 GPC3_H1L1, GPC3_H2L2, GPC3_H3L3의 항원인 인간 GPC3에 대한 결합활성을 참고예 5에 기재한 경합 ELISA에 의한 방법을 사용하여 평가하고, 그 결과를 도 59 및 도 60에 나타내었다. GPC3-H1L1과 GPC3-H2L2 및 GPC3-H2L2와 GPC3-H3L3의 글리피칸3에 대한 결합활성은 거의 동일하여, 아미노산 치환의 도입에 의한 항원으로의 결합활성의 대폭 저하는 확인되지 않았다.
 당업자 공지의 등전점 전기영동에 의해 등전점을 측정한 결과, GPC3_H1L1의 등전점은 약 9.6이었던 것에 대해, 등전점을 저하시키는 아미노산 치환을 행한 GPC3_H2L2의 등전점은 약 8.9로, GPC3_H2L2의 등전점은 GPC3_H1L1의 등전점과 비교하여, 0.7 저하되었다. 마찬가지로 GPC3_H2L2의 등전점은 약 8.7이었던 것에 대해, 등전점을 저하시키는 아미노산 치환을 행한 GPC3_H3L3의 등전점은 약 6.5로, GPC3_H3L3의 등전점은 GPC3_H2L2의 등전점과 비교하여, 2.2 저하되었다. 또한, GPC3_H1L1의 이론등전점은 9.65였던 것에 대해, GPC3_H2L2의 이론등전점은 8.47로, GPC3_H2L2의 이론등전점은 GPC3_H1L1과 비교하여, 1.18 저하되었다. 마찬가지로 GPC3_H2L2의 이론등전점은 8.47이었던 것에 대해, GPC3_H3L3의 이론등전점은 4.93으로, GPC3_H3L3의 이론등전점은 GPC3_H2L2와 비교하여, 3.54 저하되었다. 이들의 결과를 표 23에 정리하였다.
  TIFF 112010026138634-pct00025.png 74 105
 이하의 표 24에 GPC3_H1L1에 대해 도입한 CDR 서열의 아미노산 치환을 정리하였다. 이들 CDR의 아미노산 치환은, 항인간 GPC3 항체인 GPC3_H1L1에 대해, 항원에 대한 결합활성을 대폭 저하시키지 않고, 항체분자의 등전점을 저하시키는 것이 가능한 것을 발견하였다.
  TIFF 112010026138634-pct00026.png 76 105
  4 등전점을 저하시킨 항인간 IL -31 수용체 항체, 결합활성 평가 및 등전점 측정
 31R_H1L1을 구성하는 31R_H1(서열번호:239) 및 31R_L1(서열번호:242)에 대해, 각각 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 31R_H2(서열번호:240) 및 31R_L2(서열번호:243)를, 참고예 1, 2의 방법에 따라 벡터를 제작하고, 31R_H2L2의 발현, 정제를 행하였다. 31R_H2L2에 대해, 추가적으로 등전점을 저하시키는 아미노산 치환 및 기타 아미노산 치환을 도입한 31R_H3(서열번호:241)를, 참고예 1의 방법에 따라 벡터를 제작하고, 31R_H3L2의 발현, 정제를 행하였다.
 31R_H2L2, 31R_H3L2의 IL-31에 대한 결합활성을 참고예 6에 기재한 Biacore에 의한 방법을 사용하여 친화성을 평가하고, 그 결과를 표 25에 정리하였다. 표 25에 나타내는 바와 같이 31R_H2L2, 31R_H3L2는 31R_H1L1의 NR10에 대한 결합활성은 거의 동일하여, 아미노산 치환의 도입에 의한 항원으로의 결합활성의 대폭 저하는 확인되지 않았다.
  TIFF 112010026138634-pct00027.png 27 116
 당업자 공지의 등전점 전기영동에 의해 등전점을 측정한 결과, 31R_H1L1의 등전점은 약 7.76이었던 것에 대해, 등전점을 저하시키는 아미노산 치환을 행한 31R_H2L2의 등전점은 약 5.49이고, 31R_H3L2의 등전점은 약 5.43으로, 각각 31R_H1L1과 비교하여 등전점이 약 2.27 및 약 2.33 저하되었다. 또한, 31R_H1L1의 이론등전점은 7.76이었던 것에 대해, 31R_H2L2의 이론등전점은 4.63이고, 31R_H3L2의 이론등전점은 약 4.54로, 각각 31R_H1L1과 비교하여 이론등전점이 약 3.13 및 3.22 저하되었다. 이들의 결과를 표 26에 정리하였다.
  TIFF 112010026138634-pct00028.png 32 149
 이하의 표 27에 31R_H1L1에 대해 도입한 CDR 서열의 아미노산 치환을 정리하였다. 이들 CDR의 아미노산 치환은, 항인간 IL-31 수용체 항체인 31R_H1L1에 대해, 항원에 대한 결합활성을 대폭 저하시키지 않고, 항체분자의 등전점을 저하시키는 것이 가능한 것을 발견하였다.
  TIFF 112010026138634-pct00029.png 86 114
  5 항원에 대한 결합활성을 감약하지 않고 항인간 IL -6 수용체 항체, 항인 GPC3 항체, 항인간 IL -31 수용체 항체의 등전점을 저하시킬 수 있었던 CDR 서열
 상기 검토에 있어서 제작한 2종류의 항인간 IL-6 수용체 항체(6R_a 및 6R_b), 항인간 GPC3 항체(GPC3), 항인간 IL-31 수용체 항체(31R)의 H사슬 CDR 서열을 표 28에, L사슬 CDR 서열을 표 29에 정리하였다. 항원에 대한 결합활성을 감약하지 않고 등전점을 저하시킬 수 있었던 아미노산 치환을 색칠하여 표시하였다.
  TIFF 112010026138634-pct00030.png 109 176
  TIFF 112010026138634-pct00031.png 59 176
 이것으로부터, H사슬 가변영역에 있어서 H31, H61, H62, H64, H65, L사슬 가변영역에 있어서는 L24, L27, L53, L54, L55(Kabat 넘버링)는, 항체의 종류에 의존하지 않고, 복수의 항체에 있어서 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 아미노산 치환을 도입하는 것이 가능한 공통의 CDR개소인 것이 발견되었다.
 WO/2007/114319에 있어서, 항체의 등전점을 저하시킴으로써 IgG의 약물동태를 향상시키는 것이 가능한 것이 나타내어져 있다. WO/2007/114319에 있어서는, 항원으로의 결합활성을 감약시키지 않기 위해, 주로 항체 가변영역의 프레임워크에 대한 아미노산 치환을 행하고 있어, 항FactorIXa 항체에 대해서는 실측등전점으로서 약 0.9의 변화, 이론등전점으로서는 약 1.0의 변화이고, 항FactorX 항체에 대해서는 실측등전점으로서 약 0.5의 변화, 이론등전점으로서는 약 0.1의 변화로, 등전점의 변화 정도는 작았다.
 본 발명에 있어서, 항원으로의 결합활성을 감약시키지 않는 CDR 서열을 발견하여, 항체 가변영역의 프레임워크뿐 아니라 CDR에도 등전점을 저하시키는 아미노산 치환을 도입하는 것이 가능해졌다. 그것에 의해, 전술한 항인간 IL-6 수용체 항체에 있어서는, 실측등전점으로서 약 3.8의 저하, 이론등전점으로서는 약 5.1의 저하를 달성하고, 항인간 GPC3 항체에 있어서는, 실측등전점으로서 약 3.1의 저하, 이론등전점으로서는 약 4.7의 저하를 달성하며, 항인간 IL-31 수용체 항체에 있어서는, 실측등전점으로서 약 3.2의 저하, 이론등전점으로서는 약 2.3의 저하를 달성하고, 프레임워크만에 대한 아미노산 치환과 비교하여 등전점의 대폭 저하를 달성 가능한 것을 발견하였다.
  [ 실시예 30] 등전점을 저하시킨 항인간 IL -6 수용체 항체, 항인간 GPC3 항체, 항인간 IL -31 수용체 항체의 약물동태 평가
  1 게잡이원숭이 및 마우스에 있어서의 항인간 IL -6 수용체 항체의 약물동태 평가
 항인간 IL-6 수용체 항체인 6R_a_H1L1 및 등전점을 저하시킨 항인간 IL-6 수용체 항체인 6R_a_H2L2와 6R_a_H3L3의 게잡이원숭이에 있어서의 약물동태를 평가하였다. 6R_a_H1L1과 6R_a_H2L2를 각각 1.0 ㎎/㎏으로 정맥 내에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다. 또한, 6R_a_H2L2와 6R_a_H3L3를 각각 1.0 ㎎/㎏으로 피하에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다.
 혈장 중 농도측정은 ELISA법으로 측정하였다. 적당한 농도의 검량선 시료 및 혈장 측정시료를 Anti-human IgG(γ-chain specific) F(ab')2(Sigma사제)로 고상화한 이뮤노플레이트(Nunc-Immuno Plate, MaxiSorp(Nalge nunc International사제))에 분주하고, 실온에서 1시간 정치 후, Goat Anti-Human IgG-BIOT(Southern Biotechnology Associates사제) 및 Streptavidin-alkaline phosphatase conjugate(Roche Diagnostics사제)를 순차 반응시켜서, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용하여 산출하였다. 얻어진 혈장 중 농도추이의 데이터를 약물동태 해석 소프트 WinNonlin(Pharsight사제)으로 비모델 의존적 해석을 행하여 클리어런스(CL)를 산출하여 표 30에 나타내었다. 정맥 내 투여의 6R_a_H1L1과 6R_a_H2L2를 비교한 경우, 등전점을 저하시킨 6R_a_H2L2는 클리어런스가 작아, 등전점을 저하시킴으로써 약물동태가 향상되는 것이 확인되었다. 또한 피하투여의 6R_a_H2L2와 6R_a_H3L3를 비교한 경우, 등전점을 저하시킨 6R_a_H3L3는 클리어런스가 작아, 등전점을 저하시킴으로써 약물동태가 향상되는 것이 확인되었다.
  TIFF 112010026138634-pct00032.png 41 88
 계속해서 상이한 항인간 IL-6 수용체 항체인 6R_b_H1L1 및 등전점을 저하시킨 항인간 IL-6 수용체 항체인 6R_b_H2L2의 마우스(C57BL/6J, 닛폰 찰스리버)에 있어서의 약물동태를 평가하였다. 6R_b_H1L1과 6R_b_H2L2를 각각 1.0 ㎎/㎏으로 정맥 내에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다. 또한, 6R_b_H1L1과 6R_b_H2L2를 각각 1.0 ㎎/㎏으로 피하에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다.
 혈장 중 농도측정은 ELISA법으로 측정하였다. 먼저 Recombinant Human IL-6 sR(R&D Systems사제)을 EZ-Link TM Sulfo-NFS-Biotinylation Kit(PIERCE사제)를 사용하여 비오틴화 하였다. 이 비오틴화 human-sIL-6R을 Reacti-Bind Streptavidin High Binding Capacity(HBC) Coated Plates(PIERCE사제)에 분주하고, 실온에서 1시간 이상 정치하여 human-sIL-6R 고상화 플레이트를 제작하였다. 적당한 농도의 검량선 시료와 마우스 혈장 측정시료를 조제하고, human-sIL-6R 고상화 플레이트에 분주하여 실온에서 1시간 정치하였다. 그 후 Anti-human IgG-AP(SIGMA사제)를 반응시켜서, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용하여 산출하였다. 얻어진 혈장 중 농도추이의 데이터를 약물동태 해석 소프트 WinNonlin(Pharsight사제)으로 비모델 의존적 해석을 행하여 클리어런스(CL)를 산출하여 표 31에 나타내었다. 정맥 내 및 피하투여의 6R_a_H1L1과 6R_a_H2L2를 비교한 경우, 함께 등전점을 저하시킨 6R_a_H2L2는 클리어런스가 작아, 등전점을 저하시킴으로써 약물동태가 향상되는 것이 확인되었다.
  TIFF 112010026138634-pct00033.png 38 83
  2 마우스에 있어서의 항인간 GPC3 항체의 약물동태 평가
 항인간 GPC3 항체인 GPC3_H1L1 및 등전점을 저하시킨 항인간 GPC3 항체인 GPC3_H2L2와 GPC3_H3L3의 C.B-17/Icr-scid 마우스에 있어서의 약물동태를 평가하였다. GPC3_H1L1, GPC3_H2L2, GPC3_H3L3를 각각 5.0 ㎎/㎏으로 정맥 내에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다.
 혈장 중 농도측정은 ELISA법으로 측정하였다. 적당한 농도의 검량선 시료 및 목적하는 농도가 되도록 적절히 희석된 마우스 혈장 피험시료가 항원인 GPC3(추가이 세이야쿠사제)를 고상화한 이뮤노플레이트(Nunc-Immuno Plate, MaxiSoup(Nalge nunc International))에 분주되어, 당해 플레이트가 실온에서 1시간 정치되었다. 그 후, Goat Anti-Human IgG-BIOT(Southern Biotechnology Associates) 및 Streptavidin-alkaline phosphatase conjugate(Roche Diagnostics)가 순차 분주되어, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용하여 산출하였다. 얻어진 혈장 중 농도추이의 데이터를 약물동태 해석 소프트 WinNonlin(Pharsight사제)으로 비모델 의존적 해석을 행하고 클리어런스(CL)를 산출하여 표 32에 나타내었다. GPC3_H1L1과 GPC3_H2L2를 비교한 경우, 등전점을 저하시킨 GPC3_H2L2는 클리어런스가 작고, 또한 GPC3_H2L2와 GPC3_H3L3를 비교한 경우, 추가적으로 등전점을 저하시킨 GPC3_H3L3가 클리어런스가 작아, 등전점을 저하시킴으로써 약물동태가 향상되는 것이 확인되었다.
  TIFF 112010026138634-pct00034.png 30 71
  3 마우스에 있어서의 항인간 IL -31 수용체 항체의 약물동태 평가
 항인간 IL-31 수용체 항체인 31R_H1L1 및 등전점을 저하시킨 항인간 IL-31 수용체 항체인 31R_H2L2의 마우스(C57BL/6J, 닛폰 찰스리버)에 있어서의 약물동태를 평가하였다. 31R_H1L1과 31R_H2L2를 각각 1.0 ㎎/㎏으로 정맥 내에 단회 투여하고, 투여 전 및 투여 후에 경시적으로 채혈하였다.
 혈장 중 농도측정은 ELISA법으로 측정하였다. 적당한 농도의 검량선 시료 및 혈장 측정시료를 Anti-human IgG(Fc-specific) antibody(Sigma사제)로 고상화한 이뮤노플레이트(Nunc-Immuno Plate,MaxiSorp(Nalge nunc International사제))에 분주하고, 실온에서 1시간 정치하였다. 그 후, Goat Anti-Human IgG-ALP(Sigma사제)를 실온에서 1시간 반응시킨 후, BluePhos Microwell Phosphatase Substrates System(Kirkegaard & Perry Laboratories사제)을 기질로서 사용하여 발색반응을 행하고, 마이크로플레이트 리더로 650 ㎚의 흡광도를 측정하였다. 혈장 중 농도는 검량선의 흡광도로부터 해석 소프트웨어 SOFTmax PRO(Molecular Devices사제)를 사용하여 산출하였다.
 얻어진 혈장 중 농도추이의 데이터를 약물동태 해석 소프트 WinNonlin(Pharsight사제)으로 비모델 의존적 해석을 행하고 클리어런스(CL)를 산출하여 표 33에 나타내었다. 31R_H1L1과 31R_H2L2를 비교한 경우, 등전점을 저하시킨 31R_H2L2는 클리어런스가 작아, 등전점을 저하시킴으로써 소실속도가 작아지는 것이 확인되었다.
  TIFF 112010026138634-pct00035.png 22 70
  3 결론
 본 발명에 있어서는, 본 발명자들은, 항원의 종류가 상이한 복수의 항체에 있어서 CDR 서열의 아미노산 치환에 의해 항체의 항원으로의 결합활성을 감약시키지 않고, 항체의 등전점을 저하시켜서, 항체의 약물동태를 향상시킬 수 있는 것을 발견하였다. 발견한 CDR 서열의 아미노산 치환 중, H사슬 가변영역에 있어서 H31, H61, H62, H64, H65, L사슬 가변영역에 있어서는 L24, L27, L53, L54, L55(Kabat 넘버링)는, 항체의 종류에 의존하지 않고, 복수의 항체에 있어서, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 아미노산 치환을 도입하여, 약물동태를 향상시키는 것이 가능한 CDR 서열의 아미노산 치환인 것을 발견하였다. CDR 서열 중의 이들의 변이개소는, 항원의 종류에 관계없이, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 것이 가능할 것으로 생각되어, 항체의 약물동태를 향상시키는 아미노산 치환부위로서 유용할 것으로 생각되었다.
  [ 실시예 31] 등전점을 저하시킨 항인간 IL -6 수용체 항체, 항인간 GPC3 항체, 항인간 IL -31 수용체 항체의 헤테로다이머와 호모다이머의 표준적인 크로 마토그래피에 의한 피크 분리
  1 항 Factor IX 항체/항 Factor X 항체의 헤테로다이머의 발현
 특허문헌 WO/2007/114325에 공통의 L사슬을 갖는 IgG형의 이중 특이성 항체의 정제법에 관해 보고되어 있다. 공통의 L사슬을 갖는 IgG형의 이중 특이성 항체를 발현시키기 위해서는, 2종류의 H사슬(A사슬과 B사슬)과 공통의 L사슬을 발현시킬 필요가 있다. 이때, 목적의 이중 특이성 항체인 A사슬 B사슬 헤테로다이머뿐 아니라, A사슬 호모다이머 및 B사슬 호모다이머가 발현되어, 3종류의 항체의 혼합물로부터 목적의 이중 특이성 항체인 A사슬 B사슬 헤테로다이머를 정제할 필요가 있다. 동 특허에는, 종래의 방법에서는 표준적인 크로마토그래피에 의해 A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머를 피크 분리하고, A사슬 B사슬 헤테로다이머를 정제하는 것은 불가능하였으나, 2종류의 H사슬인 A사슬과 B사슬의 가변영역의 아미노산을 치환함으로써 A사슬 호모다이머와 B사슬 호모다이머에 등전점의 차를 도입함으로써, 표준적인 크로마토그래피인 양이온 교환 크로마토그래피에 의해 A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머를 피크 분리하고, A사슬 B사슬 헤테로다이머를 정제하는 것이 가능해진 것이 나타내어져 있다. 동 특허에 있어서는, 가변영역의 아미노산으로서, CDR의 아미노산 치환은 항체의 항원에 대한 결합활성에 영향을 미치는 것으로 생각되고 있었던 것으로부터, 프레임워크의 아미노산 치환만이 행해지고 않았다. 그러나, 전술한 바와 같이, 프레임워크의 아미노산 치환에서는 등전점의 대폭 변화를 도입할 수 없어, A사슬 B사슬 헤테로다이머를 보다 효율적으로 정제하기 위해서는, A사슬 호모다이머와 B사슬 호모다이머에 의해 큰 등전점의 차를 도입하는 것이 바람직하다. 이에, 실시예 28에서 발견된 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 CDR에 있어서의 아미노산 치환을 도입함으로써, A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머를 피크 분리하는 것이 가능한지 여부를 검토하였다.
  2 항인간 IL -6 수용체 항체/ pI 저하 항인간 IL -6 수용체 항체의 헤테로다 이머의 발현
 A사슬로서 6R_a_H1(서열번호:221), B사슬로서 항원으로의 결합활성을 감약시키지 않고 등전점을 저하시켜서 A사슬과 등전점에 차를 도입한 6R_a_H3(서열번호:223) 및 공통 L사슬로서 6R_a_L3(서열번호:226)를 사용하여, 참고예 2에 나타낸 방법으로, 6R_a_H1H3L3(A사슬 B사슬 헤테로다이머(6R_a_H1/H3/L3), A사슬 호모다이머(6R_a_H1/L3) 및 B사슬 호모다이머(6R_a_H3/L3)의 혼합물)의 발현·정제를 행하였다.
  3 항인간 GPC3 항체/ pI 저하 항인간 GPC3 항체의 헤테로다이머의 발현
 A사슬로서 GPC3_H2(서열번호:234), B사슬로서 항원으로의 결합활성을 감약시키지 않고 등전점을 저하시켜서 A사슬과 등전점에 차를 도입한 GPC3_H3(서열번호:235) 및 공통 L사슬로서 GPC3_L3(서열번호:238)를 사용하여, 참고예 2에 나타낸 방법으로, GPC3_H2H3L3(A사슬 B사슬 헤테로다이머(GPC3_H2/H3/L3), A사슬 호모다이머(GPC3_H2/L3) 및 B사슬 호모다이머(GPC3_H3/L3)의 혼합물)의 발현·정제를 행하였다.
  4 항인간 IL -31 수용체 항체/ pI 저하 항인간 IL -31 수용체 항체의 헤테로다이머의 발현
 A사슬로서 31R_H1의 정상영역을 변경한 31R_H1a(서열번호:244), B사슬로서 항원으로의 결합활성을 감약시키지 않고 등전점을 저하시켜서 A사슬과 등전점에 차를 도입한 31R_H2의 정상영역을 동일하게 변경한 31R_H2a(서열번호:245) 및 공통 L사슬로서 31R_L2(서열번호:243)를 사용하여, 참고예 2에 나타낸 방법으로, 31R_H1aH2aL2(A사슬 B사슬 헤테로다이머(31R_H1a/H2a/L2), A사슬 호모다이머(31R_H1a/L2) 및 B사슬 호모다이머(31R_H2a/L2)의 혼합물)의 발현·정제를 행하였다.
  5 양이온 교환 크로마토그래피에 의한 발현항체의 평가
 상기에서 제작한 항체의 A사슬 호모다이머와 B사슬 호모다이머의 VH/VL의 이론등전점의 차를, 이하의 표 34에 정리하였다. H사슬의 프레임워크뿐 아니라, CDR 서열에도 결합활성을 유지한 상태에서 등전점을 저하시키는 아미노산 치환을 도입함으로써, A사슬 호모다이머의 B사슬 호모다이머의 이론등전점에 최대 1.56의 차를 도입하는 것이 가능해졌다. 특허문헌 WO/2007/114325에 있어서, A사슬 호모다이머의 프레임워크에만 아미노산 치환을 도입함으로써 등전점을 저하시키고, 또한, B사슬 호모다이머의 프레임워크에만 아미노산 치환을 도입함으로써 등전점을 증대시킴으로써, A사슬 호모다이머와 B사슬 호모다이머의 VH/VL의 이론등전점에 1.13의 차를 도입할 수 있는 것이 나타내어져 있다. 본 검토에 있어서는, 한쪽의 사슬에만 아미노산 치환을 실시하였음(등전점을 저하시켰음)에도 불구하고, 프레임워크뿐 아니라 CDR 서열에도 아미노산 치환을 도입한 것으로 인해, 이론등전점에 최대 1.56의 차를 도입 가능한 것이 나타내어졌다. 즉, A사슬 호모다이머와 B사슬 호모다이머를 분리하기 위한 아미노산 치환으로서, 결합활성을 유지한 상태에서 프레임워크뿐 아니라 CDR 서열에도 아미노산 치환을 도입함으로써, 양쪽의 등전점의 차를 더욱 증대시킴으로써 가능하다는 것이 나타내어졌다. 일반적으로 표준적인 이온 교환 크로마토그래피에 의한 분리는 분리하고자 하는 2성분의 등전점의 차에 의존하는 것으로부터, 이것에 의해 양자를 보다 용이하게 분리하는 것이 가능해질 것으로 생각되었다.
  TIFF 112010026138634-pct00036.png 57 105
 6R_a_H1H3L3, GPC3_H2H3L3 및 31R_H1aH2aL2 각각의 A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머가, 양이온 교환 크로마토그래피에 의해 피크 분리 가능한지 여부를 평가하였다. 표준적인 양이온 교환 크로마토그래피의 칼럼으로서 ProPac WCX-10(Dionex)을 사용하고, 이동상 A로서 25 mM MES, pH 5.0, 이동상 B로서 25 mM MES, 1 M NaCl, pH 5.0을 사용하여, 적절한 유량 및 그라디언트로 실시하였다. 양이온 교환 크로마토그래피에 의한 평가를 행한 결과를 도 61에 나타내었다. 그 결과, 6R_a_H1H3L3, GPC3_H2H3L3 및 31R_H1aH2aL2 어느 것에 있어서도, A사슬 B사슬 헤테로다이머, A사슬 호모다이머 및 B사슬 호모다이머의 피크가 분리되는 것이 발견되었다.
 H사슬 가변영역에 있어서 H31, H61, H62, H64, H65(Kabat 넘버링)는, 항체의 종류에 의존하지 않고, 동일 개소의 아미노산 치환에 의해 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 것이 가능하여, 그것에 의해 헤테로다이머와 호모다이머를 양이온 교환 크로마토그래피에 의한 분리가 가능해지는 것이 발견되었다. CDR 서열 중의 이들의 변이개소는, 항원의 종류에 관계없이, 항체의 항원으로의 결합활성을 대폭 감약시키지 않고 항체의 등전점을 저하시키는 것이 가능할 것으로 생각되어, 이중 특이성 항체의 헤테로다이머와 호모다이머간의 등전점의 차이를 증대하기 위한 아미노산 치환부위로서 유용하다.
 [참고예 1]
 항체 발현벡터 유전자의 제작
 각 변이체의 제작은 QuikChange Site-Directed Mutagenesis Kit(Stratagene) 또는 PCR을 사용한 Assemble PCR을 행함으로써 행해진다. QuikChange Site-Directed Mutagenesis Kit(Stratagene)를 사용한 경우는 첨부 설명서의 방법으로 변이체를 제작하였다. Assemble PCR을 사용하여 행하는 방법은, 이하 중 어느 하나의 방법을 사용하여 행해졌다. 첫 번째의 방법은 개변부위를 포함하는 순사슬 및 역사슬의 배열을 토대로 하여 설계한 올리고 DNA의 합성을 행한다. 개변부위를 포함하는 순사슬의 올리고 DNA와 개변을 행하는 유전자가 삽입되어 있는 벡터에 결합하는 역사슬의 올리고 DNA, 개변부위를 포함하는 역사슬의 올리고 DNA와 개변을 행하는 유전자가 삽입되어 있는 벡터에 결합하는 순사슬의 올리고 DNA를 각각 조합시켜서, PrimeSTAR(TAKARA)를 사용하여 PCR을 행함으로써, 개변부위를 포함하는 단편을 5말단측과 3말단측 2개를 제작하였다. 그 2개의 단편을 Assemble PCR에 의해 연결함으로써, 각 변이체를 제작하였다. 두 번째의 방법은 가변영역 전체를 커버하도록 올리고 DNA를 적당 개수 제작하고, 그들의 올리고 DNA를 Assemble PCR을 사용하여 연결함으로써, 가변영역 전체를 제작하였다. 이들 방법에 의해 제작된 변이체를 동물세포에 있어서 삽입 유전자를 발현 가능하게 하는 발현벡터에 삽입하고, 얻어진 발현벡터의 염기서열은 당업자 공지의 방법으로 결정하였다.
 [참고예 2]
  항체의 발현 및 정제
 항체의 발현은 이하의 방법을 사용하여 행하였다. 인간 태아 신장암 세포 유래 HEK293H주(Invitrogen)를 10% Fetal Bovine Serum(Invitrogen)을 포함하는 DMEM배지(Invitrogen)에 현탁하고, 5~6×10 5 개/mL의 세포밀도로 접착세포용 디쉬(직경 10 cm, CORNING)의 각 디쉬로 10 mL씩 파종하고 CO 2 인큐베이터(37℃, 5% CO 2) 내에서 하루 배양한 후에, 배지를 흡인 제거하여, CHO-S-SFM-II(Invitrogen) 배지 6.9 mL를 첨가하였다. 조제한 플라스미드를 lipofection법에 의해 세포로 도입하였다. 얻어진 배양상청을 회수한 후, 원심분리(약 2000 g, 5분간, 실온)하여 세포를 제거하고, 추가적으로 0.22 ㎛ 필터 MILLEX(R)-GV(Millipore)를 통과시켜 멸균하여 배양상청을 얻었다. 얻어진 배양상청에 rProtein A Sepharose TM Fast Flow(Amersham Biosciences)를 사용하여 당업자 공지의 방법으로 정제하였다. 정제 항체농도는, 분광광도계를 사용하여 280 ㎚에서의 흡광도를 측정하였다. 얻어진 값으로부터 PACE법에 의해 산출된 흡광계수를 사용하여 항체농도를 산출하였다(Protein Science 1995 ; 4 : 2411-2423).
 [참고예 3]
  항인간 IL -6 수용체 항체의 Biacore 에 의한 IL -6 수용체로의 친화성 평가방법
  1. 가용형 인간 IL -6 수용체의 조제
 항원인 인간 IL-6 수용체의 재조합 인간 IL-6 수용체는 이하와 같이 조제하였다. J.Biochem. 108, 673-676(1990)에서 보고되어 있는 N 말단측 1번째에서 344번째의 아미노산 서열로 되는 가용형 인간 IL-6 수용체(Yamasaki등, Science 1988;241:825-828(GenBank # X12830))의 CHO세포 정상발현주를 제작하였다. 가용형 인간 IL-6 수용체 발현 CHO세포로부터 얻어진 배양상청으로부터, Blue Sepharose 6 FF 칼럼 크로마토그래피, 가용형 인간 IL-6 수용체에 대한 특이항체를 고정한 칼럼에 의한 친화성 크로마토그래피, 겔 여과 칼럼 크로마토그래피의 3개의 칼럼 크로마토그래피에 의해, 가용형 인간 IL-6 수용체를 정제하였다. 메인 피크로서 용출된 분획을 최종 정제품으로 하였다.
  2. Biacore 에 의한 가용형 인간 IL -6 수용체로의 친화성 평가
 Biacore T100(GE 헬스케어 바이오사이언스)을 사용하여, 항인간 IL-6 수용체 항체와 가용형 인간 IL-6 수용체의 항원 항체반응의 속도론적 해석을 행하였다. 당업자 공지의 방법으로, 센서칩 상에 rec-Protein A(ZYMED)(이하, Protein A)를 고정화하여, 이 고정화 Protein A에 항체를 포착하고, 추가적으로 항원을 애널라이트로서 반응시켜, 항체와 항원의 상호작용을 측정하였다. 러닝 버퍼에는 HBS-EP+를 사용하고, 유속은 20 μL/min로 하였다. 각 항체는 Protein A/G에 약 100 RU 결합하도록 조제하였다. 애널라이트로서 사용한 가용형 인간 IL-6 수용체는 HBS-EP+를 사용하여 0, 0.065, 0.131, 0.261 ㎍/mL로 조제하였다. 측정은 먼저 항체용액을 Protein A/G에 결합시키고, 거기에 애널라이트용액을 3분간 상호작용시키고, 그 후 HBS-EP+로 전환하여 10 또는 15분간 해리상을 측정하였다. 해리상의 측정 종료 후, 10 μL의 10 mM glycine-HCl(pH 1.5)로 세정하여, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하였다. 각종 항체에 대해서 이 사이클을 따라 측정을 행하였다. 얻어진 센서그램을 Biacore 전용 데이터 해석 소프트웨어인 Biacore T100 Evaluation Software(GE 헬스케어 바이오사이언스)를 사용하여 속도론적인 해석을 행하였다.
  [ 참고예 4]
  항인간 IL -6 수용체 항체의 BaF /6R세포에 의한 IL -6 수용체 중화활성 평가방법
 IL-6 의존 증식성을 나타내는 세포주를 얻기 위해, 이하에 나타내는 바와 같이, 인간 gp130 및 인간 IL-6R을 발현한 BaF3 세포주의 수립을 행하였다. 전장 인간 IL-6R cDNA를 PCR에 의해 증폭하고, pcDNA3.1(+)(Invitrogen)로 클로닝하여, hIL-6R/pcDNA3.1(+)을 구축하였다. pCOS2Zeo/gp130을 전기천공법처리에 의해 BaF3세포에 유전자 도입하고, human interleukin-6(R&D systems), 100 ng/mL의 human interleukin-6 soluble receptor(R&D systems) 존재하에서 선발하여, 인간 gp130 발현 BaF3 세포주(이하, BaF/gp130)를 수립하였다. 또한 전장 인간 IL-6R cDNA를 PCR에 의해 증폭하고, pcDNA3.1(+)(Invitrogen)로 클로닝하여, hIL-6R/pcDNA3.1(+)를 구축하였다. pcDNA3.1(+)/hIL-6R을 전기천공법처리에 의해 상기에서 제작한 BaF/gp130세포에 유전자 도입하고, human interleukin-6(R&D systems) 존재하에서 선발하여, 인간 IL-6R 발현 BaF3 세포주(이하, BaF/6R)를 수립하였다. 이 BaF/6R은, human interleukin-6(R&D systems) 존재하에서 증식하는 것으로부터, 항인간 IL-6 수용체 항체의 증식저해활성(즉 인간 IL-6 수용체 중화활성)의 평가에 사용하는 것이 가능하다.
 BaF/6R을 사용하여, 항인간 IL-6 수용체 항체의 인간 IL-6 수용체 중화활성을 평가하였다. BaF/6R을 10% FBS를 포함하는 RPMI1640배지로 3회 세정한 후에, 2.5~5.0×10 4 cells/mL가 되도록 20 ng/mL의 human interleukin-6(TORAY)(최종농도는 10 ng/mL) 및 10% FBS를 포함하는 RPMI1640배지로 현탁하여, 96 well-plate(CORNING)의 각 well에 50 μL씩 분주하였다. 다음으로, 항인간 IL-6 수용체 항체를 10% FBS를 포함하는 RPMI1640로 희석하여, 각 well에 50 μL씩 혼합하였다. 37℃, 5% CO 2 조건하에서, 3일간 배양하여, PBS로 2배로 희석한 WST-8 시약(Cell Counting Kit-8, 가부시키가이샤 도진 화학연구소)을 20 μL/well로 첨가하고, 직후에 SUNRISE CLASSIC(TECAN)을 사용하여 450 ㎚의 흡광도(참조파장 620 ㎚)를 측정하였다. 2시간 배양한 후에, 다시 450 ㎚의 흡광도(참조파장 620 ㎚)를 측정하여, 2~4시간의 흡광도 변화를 지표로 인간 IL-6 수용체 중화활성을 평가하였다.
 [참고예 5]
  항인간 GPC3 항체의 경합 ELISA 에 의한 각 변이개변 항체의 결합활성의 평가
 제작한 항체의 결합활성을 경합 ELISA를 사용하여 행하였다. 1 ㎍/㎖가 되도록 조제된 가용형 GPC3 코어 폴리펩티드(서열번호:207)가 96웰 플레이트에 1 웰당 100 μL 첨가되었다. 당해 플레이트는 4℃에서 하룻밤 정치되어, 가용형 GPC3 코어 폴리펩티드가 당해 플레이트에 고상화되었다. 당해 플레이트에 고상화된 가용형 GPC3 코어 폴리펩티드는 SkanWASHER 400(Molecular Devices)을 사용하여 세정 완충액으로 3회 세정되고 200 ㎕의 블로킹 완충액이 첨가되어 4℃에서 30분 이상 블록되었다. 그 가용형 GPC3 코어 폴리펩티드가 고상화되어 블록된 플레이트는 다음으로 SkanWASHER 400을 사용하여 세정 완충액으로 3회 세정되었다. 그 후, 각종 농도의 GPC3-H2L2 항체 또는 기타 항체와 최종농도 0.3 ㎍/㎖의 비오틴화된 GPC3-H2L2 항체가 각각 100 ㎕ 혼합된 혼합액 200 ㎕가 플레이트 1 웰당 첨가되었다. GPC3-H2L2 항체의 비오틴화는 Biotin Labeling 키트(Roche)를 사용하여 키트의 프로토콜에 따라 실시되었다. 당해 플레이트는 실온에서 1시간 정치된 후, SkanWASHER 400(Molecular Devices)을 사용하여 세정 완충액으로 5회 세정되었다. 그 1 웰당 기질 완충액에 의해 20,000배로 희석된 100 ㎕의 Goat anti streptabidin Alkaline phosphatase(ZYMED)가 첨가된 당해 플레이트는, 실온에서 1시간 정치된 후 SkanWASHER 400을 사용하여 세정 완충액으로 5회 세정되었다. 기질 완충액을 사용하여 1 ㎎/㎖가 되도록 Phosphatase Substrate(Sigma)가 조제되고, 1 웰당 100 ㎕ 첨가되어 1시간 정치되었다. Benchmark Plus(BIO-RAD)를 사용하여 655 ㎚의 대조흡광도를 사용하여, 각 웰 중의 반응액의 405 ㎚에 있어서의 흡광도가 측정되었다.
 [참고예 6]
  항인간 IL -31 수용체 항체의 Biacore 에 의한 IL -31 수용체로의 친화성 평가방법
  1. 가용형 인간 IL -31 수용체의 조제
 인간 IL-31 수용체의 cDNA를 주형으로, PCR법에 의해 세포외 영역만을 증폭하고, 또한 C 말단에 FLAG 태그 서열을 부가하고, 포유동물세포용 발현벡터에 삽입하였다. 직쇄형상으로 한 이 벡터 10 ㎍을 차이니즈 햄스터 난소 세포주 DG44로 전기천공법에 의해 도입하여(BioRad Gene PulserII, 25μF, 1.5 kV), 고발현을 나타내는 세포주를 얻었다. 이 세포주를 대량 배양한 배양상청으로부터 항FLAG 항체 칼럼(SIGMA제), 겔 여과법에 의해 정제하여 가용형 NR10을 얻었다. 가용형 인간 IL-31 수용체의 아미노산 서열을 서열번호:246에 나타내었다.
  2. Biacore 에 의한 가용형 인간 IL -31 수용체로의 친화성 평가
 Biacore T100(GE 헬스케어 바이오사이언스)을 사용하여, 항인간 IL-31 수용체 항체와 가용형 인간 IL-31 수용체의 항원 항체반응의 속도론적 해석을 행하였다. 당업자 공지의 방법으로, 센서칩 상에 rec-Protein A(ZYMED)(이하, Protein A)를 고정화하여, 이 고정화 Protein A에 항체를 포착하고, 추가적으로 항원을 애널라이트로서 반응시켜, 항체와 항원의 상호작용을 측정하였다. 각 항체는 Protein A/G에 적당한 양 결합하도록 조제하였다. 애널라이트로서 사용한 가용형 인간 IL-31 수용체는 HBS-EP+를 사용하여 0, 38.5, 77.0, 154 nM으로 조제하였다. 측정은 먼저 항체용액을 Protein A/G에 결합시켜서, 거기에 애널라이트용액을 3분간 상호작용시키고, 그 후 HBS-EP+로 전환하여 5분간 해리상을 측정하였다. 해리상의 측정 종료 후, 10 μL의 10 mM glycine-HCl(pH1.5)로 세정하여, 센서칩을 재생하였다. 이 결합·해리·재생을 분석의 1 사이클로 하였다. 각종 항체에 대해 이 사이클을 따라 측정을 행하였다. 얻어진 센서그램을 Biacore 전용 데이터 해석 소프트웨어인 Biacore T100 Evaluation Software(GE 헬스케어 바이오사이언스)를 사용하여 속도론적인 해석을 행하였다.
산업상 이용 가능성
 본 발명에 의해, 상보성 결정영역(CDR)의 표면에 노출 가능한 하나 이상의 아미노산 잔기의 전하를 항원에 대한 결합활성을 유지하면서 개변함으로써, 항체의 등전점을 개변하는 방법, 다중 특이성 항체를 정제하는 방법, 항체의 혈장 중 약물동태를 개선하는 방법, 등전점이 개변된 항체를 유효성분으로서 함유하는 의약 조성물 및 그 제조방법이 제공되었다. 항체의 등전점을 개변함으로써 다중 특이성 항체를 효율적으로 고순도로 정제하는 것이 가능하다. 또한, 항체의 등전점을 개변함으로써, 혈장 중 약물동태를 개선시키는 것이 가능해져, 투여빈도를 적게 하여 지속적으로 치료효과를 발휘하는 것이 가능하다. 또한 본 발명의 방법에 의해 얻어지는 항체는, 항원으로의 결합활성이 유지되어 있다.