Traitement en cours

Veuillez attendre...

Paramétrages

Paramétrages

Aller à Demande

1. WO2020111436 - MUTANT DE PROTÉINE DU RÉCEPTEUR CAMP ET PROCÉDÉ DE PRODUCTION D'ACIDE L-AMINÉ L'UTILISANT

Document

명세서

발명의 명칭

기술분야

1   2  

배경기술

3   4   5  

발명의 상세한 설명

기술적 과제

6   7  

과제 해결 수단

8   9   10   11   12   13   14  

발명의 효과

15   16  

발명의 실시를 위한 최선의 형태

17   18   19   20   21   22   23   24   25   26   27   28   29   30   31   32   33   34   35   36   37   38   39   40   41   42   43   44   45   46   47   48   49   50   51   52   53   54   55   56   57   58   59   60   61   62   63   64   65   66   67   68   69   70   71   72   73   74  

발명의 실시를 위한 형태

75   76   77   78   79   80   81   82   83   84   85   86   87   88   89   90   91   92   93   94   95   96   97   98   99   100   101   102   103   104   105   106   107   108   109   110   111   112   113   114   115   116   117   118   119   120   121   122   123   124   125   126   127   128   129   130   131   132   133   134   135   136   137   138   139   140   141   142   143   144   145   146   147   148   149   150   151   152   153   154   155   156   157   158   159   160   161   162   163   164   165   166   167  

청구범위

1   2   3   4   5   6   7   8   9   10   11  

명세서

발명의 명칭 : CAMP 수용 단백질 변이체 및 이를 이용한 L-아미노산 제조방법

기술분야

[1]
본 출원은 cAMP 수용 단백질 변이체, 이를 포함하는 미생물, 및 이를 이용한 L-아미노산 제조방법에 관한 것이다.
[2]

배경기술

[3]
CRP(cyclic AMP receptor protein)는 대장균에서 가장 많이 알려진 전사조절인자로, CAP(catabolite activator protein)이라고도 불린다. CRP는 탄소원에 의존적인 조절 기작을 특징적으로 가지는데 대표적인 것이 '대사산물 억제작용(catabolite repression)'이다. 이 작용은 세포내의 cyclic AMP (이하'cAMP')의 농도에 의해 촉발되는데, 포도당과 같은 선호되는 탄소원이 있을 때에는 adenylate cyclase의 활성이 저해되어 cAMP가 낮아지고, 이 신호를 통하여서 catabolite 대사 유전자들의 발현이 억제된다. 반대의 경우 adenylate cyclase의 활성이 증가되고, 그 결과 repressor들을 억제하여 catabolite 대사 유전자들의 발현이 시작된다. 그 외에도 CRP는 cAMP를 통한 세포내 신호전달, 삼투조절, 세포의 긴급상황발생시 대처, 바이오필름 생성, 질소고정, 철분 수송등의 다양한 역할을 하는 것으로 알려져 있다.
[4]
보고된 바에 따르면, 418개의 대장균 유전자가 CRP에 의해 조절을 받는 것으로 알려져 있으나, 해당 기작은 아직 상세히 밝혀지지 않았다(J Biol Eng. (2009) 24;3:13). 이처럼 광범위한 조절 능력으로 CRP는 돌연변이에 의하여 다양한 표현형을 보일 수 있는 가능성을 가지고 있고, 그러한 장점으로 인해 다양한 환경에서 적용 가능한 세포수준의 균주 재설계에 적합한 대상으로 연구되고 있다. 최근에는 생물정보학적인 방법으로 선별된 CRP의 아미노산 변이에 의해 DNA의 결합정도를 변화시켜 조절 대상 유전자의 발현을 변화시킨 방법 (Nucleic Acids Research, (2009) 37: 2493-2503)과 zinc finger DNA결합부위와 CRP를 융합하여 인공적인 전사인자(ATF, artificial transcription factor)를 만든 것으로 열, 삼투 및 저온에 내성을 가지는 대장균을 선별((Nucleic Acids Research, (2008) 36: e102) 하는 등 다양한 실험이 이루어지고 있다. 즉, CRP의 발현변화는 광범위한 수준의 하위 단계 유전자 발현 변화를 촉진하여 유용한 형질을 가진 미생물을 제작하는데 좋은 도구가 될 가능성이 크다.
[5]

발명의 상세한 설명

기술적 과제

[6]
본 발명자들은 서열번호 1의 아미노산 서열에서 하나 이상의 아미노산 치환을 포함하는 신규한 변이형 단백질을 발굴하고, 상기 변이형 단백질이 L-아미노산의 생산능을 증가시킴을 확인함으로써, 본 출원을 완성하였다.
[7]

과제 해결 수단

[8]
본 출원의 하나의 목적은 cAMP 수용 단백질 변이체를 제공하는 것이다.
[9]
본 출원의 다른 하나의 목적은 상기 cAMP 수용 단백질 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
[10]
본 출원의 또 다른 목적은 상기 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다.
[11]
본 출원의 또 다른 목적은 상기 변이체를 포함하는, 에스케리키아 속 미생물을 제공하는 것이다.
[12]
본 출원의 또 다른 목적은 상기 에스케리키아 속 미생물을 배지에서 배양하는 단계를 포함하는 L-아미노산 생산방법을 제공하는 것이다.
[13]
본 출원의 또 다른 목적은 상기 변이체 또는 상기 변이체를 포함하는 에스케리키아 속 미생물의 L-아미노산 생산 용도를 제공하는 것이다.
[14]

발명의 효과

[15]
본 출원의 cAMP 수용 단백질 변이체를 포함하는, L-아미노산을 생산하는 에스케리키아 속 미생물을 배양하는 경우, 고수율의 L-아미노산 생산이 가능하다. 이에, 산업적인 면에서 생산의 편의성과 함께 제조원가 절감 등의 효과를 기대할 수 있다.
[16]

발명의 실시를 위한 최선의 형태

[17]
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
[18]
[19]
상기 목적을 달성하기 위한 본 출원의 하나의 양태는 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 치환을 포함하는 cAMP 수용 단백질 변이체를 제공하는 것이다. 구체적으로, 본 출원은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 치환을 포함하는 cAMP 수용 단백질 변이체를 제공하며, 상기 아미노산 치환은 N-말단으로부터 33번째 아미노산이 라이신으로 치환된 것을 포함한다. 더욱 구체적으로, 서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된 것을 포함하는, cAMP 수용 단백질 변이체를 제공하는 것이다.
[20]
[21]
본 출원에서 용어, "cAMP 수용 단백질(cAMP receptor protein, CRP)"은 대장균에서 가장 많이 알려진 전사조절인자로서 그 자체로 활성인자와 저해인자의 기능을 함께 가지고 있어 'dual regulator'라고도 불린다. 일반적으로 구조유전자의 앞쪽에 위치한 22개의 염기를 가지는 대칭형 DNA서열에 결합하여 DNA의 구부러짐을 유도하고, 카르복시 말단에 있는 첫 번째 활성부위와 아미노 말단에 있는 두번 째 활성부위가 전사를 담당하는 RNA중합효소와 상호작용하도록 하여 활성인자의 역할을 하고, 억제인자의 역할을 할 경우에는 활성단백질이 활성부위에 결합하지 못하도록 그 위치를 선점하거나, 활성단백질과 결합하여 활성부위에 결합하지 않는 구조로 변환시키는 방법을 취하는 것으로 알려져 있다. 상기 cAMP 수용 단백질은 crp 유전자에 의해 코딩되는 cAMP 수용 단백질이다.
[22]
본 출원의 "cAMP 수용 단백질(cyclic AMP receptor protein, CRP)"는 이화대사물 활성화 단백질(catabolite activator protein, CAP), CRP 단백질, CAP 단백질 등과 혼용되어 사용될 수 있다.
[23]
본 출원에서 상기 CRP는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 일 예로, 에스케리아 속( Escherichia sp.) 유래 CRP일 수 있으며, 더욱 구체적으로는 서열번호 1로 기재된 아미노산 서열을 포함하는 폴리펩티드/단백질일 수 있으나, 이에 제한되지 않다. 또한 상기 아미노산 서열과 동일한 활성을 갖는 서열은 제한없이 포함될 수 있다. 또한, 서열번호 1의 아미노산 서열 또는 이와 80% 이상의 상동성(homology) 또는 동일성(identity)을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 상기 아미노산은 서열번호 1 및 상기 서열번호 1과 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위내에 포함됨은 자명하다.
[24]
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 변이형 폴리펩티드는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다. 이러한 변이형은 일반적으로 상기 폴리펩티드 서열 중 하나를 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 식별될 수 있다. 즉, 변이형의 능력은 본래 단백질(native protein)에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 이러한 변이형은 일반적으로 상기 폴리펩티드 서열 중 하나를 변형하고, 변형된 폴리펩티드의 반응성을 평가하여 식별될 수 있다. 또한, 일부 변이형은 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이형을 포함할 수 있다. 다른 변이형은 성숙 단백질 (mature protein)의 N- 및/또는 C- 말단으로부터 일부분이 제거된 변이형을 포함할 수 있다.
[25]
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이형은 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 양으로 하전된 (염기성) 아미노산은 알지닌, 리신, 및 히스티딘을 포함하고; 음으로 하전된 (산성) 아미노산은 글루탐산 및 아르파르트산을 포함하고; 방향족 아미노산은 페닐알라닌, 트립토판 및 타이로신을 포함하고, 소수성 아미노산은 알라닌, 발린, 이소류신, 류신, 메티오닌, 페닐알라닌, -프롤린, 글리신 및 트립토판을 포함한다.
[26]
또한, 변이형은 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널 (또는 리더)서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
[27]
본 출원에서 용어, "cAMP 수용 단백질 변이체"는 cAMP 수용 단백질 활성을 갖는 폴리펩티드의 아미노산 서열에서 하나 이상의 아미노산 치환을 포함하는 cAMP 수용 단백질 변이체로서, 상기 아미노산 치환은 N-말단으로부터 33번째 위치의 아미노산이 다른 아미노산으로 치환된 것을 포함한다. 구체적으로는 AMP 수용 단백질 활성을 갖는 폴리펩티드의 아미노산 서열에서 33번째 위치의 아미노산이 다른 아미노산으로 치환된 33번째 위치의 아미노산이 다른 아미노산으로 치환된 단백질 변이체를 포함한다. 예를 들어, 상기 단백질 변이체는 서열번호 1의 아미노산 서열 내 N-말단으로부터 33번째 위치의 변이가 일어난 단백질 변이체를 포함한다. 보다 구체적으로, 상기 단백질 변이체는 서열번호 1의 아미노산 서열에서 33번째 아미노산이 다른 아미노산으로 치환된 단백질일 수 있다. 상기 '다른 아미노산'은 33번째 아미노산인 L-글루타민을 제외한 다른 아미노산이면 제한되지 않는다. 구체적으로, 상기 변이체는 서열번호 1의 아미노산 서열에서 33번째 아미노산이 염기성 아미노산으로 치환된 단백질일 수 있다. 상기 염기성 아미노산은 L-라이신, L-알지닌 및 L-히스티딘 중 하나 일 수 있다. 보다 구체적으로, 상기 변이체는 서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신(Lysine)으로 치환된 단백질일 수 있으나, 이에 제한되지 않는다.
[28]
또한 상기 변이체는 위에서 설명한 서열번호 서열번호 1 및/또는 상기 서열번호 1와 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산에서 N-말단으로부터 33번째 위치의 아미노산이 변이된 것을 의미한다.
[29]
본 출원에서 용어, "cAMP 수용 단백질 변이체"는 상기 cAMP 수용 단백질 변이체는 변이형 CRP 단백질, CRP 변이체, 변이형 cAMP 수용 단백질, 변이형 CAP 단백질, CAP 변이체, 변이형 이화대사물 활성화 단백질, 이화대사물 활성화 단백질 변이체 등과 혼용되어 사용될 수 있다.
[30]
본 출원의 목적상 상기 cAMP 수용 단백질 변이체를 포함하는 미생물의 경우, L-아미노산 생산량이 상기 cAMP 수용 단백질 변이체가 존재하지 않는 미생물에 비하여 증가하는 것을 특징으로 한다. 상기 CRP 변이체는 천연의 야생형 또는 비변이 cAMP 수용 단백질에 비하여 L-아미노산 생산능이 증가되도록 유전자 조절 활성을 갖는 것을 특징으로 한다. 이는 본 출원의 CRP 변이체가 도입된 미생물을 통해 L-아미노산 생산량을 증가시킬 수 있다는 것에 의의가 있다. 구체적으로, 상기 L-아미노산은 L-쓰레오닌 또는 L-트립토판일 수 있으나, 상기 변이형 cAMP 수용 단백질이 도입 또는 포함되어 생산될 수 있는 L-아미노산이면 제한없이 포함된다.
[31]
[32]
상기 cAMP 수용 단백질 변이체는 그 예로, 서열번호 1로 표시되는 아미노산 서열 내 33번째 아미노산이 다른 아미노산으로 치환된 아미노산 서열을 포함하는, 변이체로 서열번호 3으로 이루진 것일 수 있다. 서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신(Lysine)으로 치환된 변이체는, 서열번호 3으로 이루어진 것일 수 있으나, 이에 제한되지 않는다. 또한, 상기 CRP 변이체는 서열번호 3의 아미노산 서열 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 본 출원의 상기 CRP 변이체는 서열번호 3 및 상기 서열번호 3과 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 단백질을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 33번째 위치의 아미노산 서열 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
[33]
즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 '이라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 단백질과 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 변이형 단백질과 동일 혹은 상응하는 활성을 가지는 경우라면 상기 아미노산 서열 앞뒤에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본원의 범위 내에 속하는 것이 자명하다.
[34]
[35]
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다.
[36]
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
[37]
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
[38]
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
[39]
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
[40]
[41]
본 출원의 다른 하나의 양태는 상기 CRP변이체를 코딩하는 폴리뉴클레오티드, 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다.
[42]
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이형 단백질을 코딩하는 폴리뉴클레오티드 단편을 의미한다.
[43]
본 출원의 CRP 변이체를 코딩하는 폴리뉴클레오티드는, 본 출원의 cAMP 수용 단백질 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다. 상기 CRP 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 1의 아미노산 서열에서 33번째 아미노산이 다른 아미노산으로 치환된 변이형 단백질을 코딩하는 서열이라면 제한없이 포함될 수 있다. 구체적으로, 서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된 변이체를 코딩하는 폴리뉴클레오티드 서열일 수 있다. 예를 들어, 본 출원의 CRP변이체를 코딩하는 폴리뉴클레오티드는 서열번호 3의 아미노산 서열을 코딩하는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다. 보다 구체적으로는 서열번호 4로 이루어진 폴리뉴클레오티드 서열로 구성된 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 따라서, 코돈 축퇴성 (codon degeneracy)에 의해 상기 서열번호 3의 아미노산 서열로 이루어진 폴리펩타이드 또는 이와 상동성 또는 동일성을 가지는 폴리펩타이드로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다.
[44]
또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 아미노산 서열에서 33번째 아미노산이 다른 아미노산으로 치환된 CRP 변이체를 코딩하는 서열이라면 제한없이 포함될 수 있다.
[45]
상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 80% 이상, 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1 X SSC, 0.1% SDS, 구체적으로는 60℃, 0.1 X SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1 X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
[46]
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
[47]
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
[48]
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
[49]
[50]
본 출원에서 사용된 용어, "벡터"는 적합한 숙주 내에서 목적 변이형 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 변이형 단백질을 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
[51]
본 출원에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
[52]
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 변이형 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동 재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 변이형 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다. 본 출원의 또 하나의 양태로서, 본 출원은 상기 변이형 단백질을 포함하거나, 상기 변이형 단백질을 코딩하는 폴리뉴클레오티드를 포함하여, L-아미노산을 생산하는 미생물을 제공하는 것이다. 구체적으로 변이형 단백질 및/또는 상기 변이형 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 미생물은 변이형 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환에 의해 제조되는 미생물일 수 있으나, 이에 제한되지 않는다.
[53]
본 출원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
[54]
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이형 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
[55]
[56]
본 출원의 다른 하나의 양태는 상기 cAMP 수용 단백질 변이체를 포함하는, 에스케리키아 속( Escherichia sp.) 미생물을 제공하는 것이다.
[57]
본 출원에서 사용되는 용어 "CRP 변이체를 포함하는 미생물"이란, 본 출원의 CRP 변이체가 발현되도록 재조합된 미생물을 의미할 수 있다. 예를 들어 CRP 변이체를 코딩하는 폴리뉴클레오티드를 포함하거나, 또는 CRP 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어 상기 변이체를 발현할 수 있는 숙주세포 또는 미생물을 의미한다. 본 출원의 목적상 구체적으로 상기 미생물은 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 치환을 포함하는 cAMP 수용 단백질 변이체를 발현하는 미생물로서, 상기 아미노산 치환은 N-말단으로부터 33번째 아미노산이 라이신으로 치환되어, cAMP 수용 단백질 활성을 갖는, 변이형 단백질을 발현하는 미생물일 수 있으나 이에 제한되지 않는다.
[58]
상기 CRP변이체를 포함하는 미생물은, 상기 CRP 변이체를 포함하여 L-아미노산, 그 예로, L-쓰레오닌 또는 L-트립토판을 생산할 수 있는 미생물이라면 모두 가능하나, 이에 제한되지 않는다. 예를 들어, 상기 CRP변이체를 포함하는 미생물은, 천연의 야생형 미생물 또는 L-아미노산을 생산하는 미생물에 CRP 변이체가 발현되어, L-아미노산 생산능이 증가된 재조합 미생물일 수 있다. 상기 L-아미노산 생산능이 증가된 재조합 미생물은, 천연의 야생형 미생물 또는 비변형 미생물에 비하여 L-아미노산 생산능이 증가된 미생물일 수 있으며, 상기 L-아미노산은 L-쓰레오닌 또는 L-트립토판일 수 있으나, 이에 제한되는 것은 아니다.
[59]
[60]
본 출원에서 용어, "L-아미노산을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-아미노산 생산을 위하여 유전적 변이가 일어나거나 활성을 강화시킨 미생물 일 수 있다. 본 출원의 목적상 상기 L-아미노산을 생산하는 미생물은 상기 변이형 단백질을 포함하여, 목적하는 L-아미노산의 생산능이 증가된 것일 수 있다. 구체적으로, 본 출원에서 L-아미노산을 생산하는 미생물 또는 L-아미노산 생산능을 갖는 미생물은, L-아미노산 생합성 경로 내 유전자 일부가 강화 또는 약화되거나, L-아미노산 분해 경로 내 유전자 일부가 강화 또는 약화된 미생물일 수 있다.
[61]
[62]
상기 '비변형 미생물'은 천연형 균주 자체이거나, 상기 CRP 변이체를 포함하지 않는 미생물, 또는 상기 CRP 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되지 않은 미생물을 의미한다. 상기 '미생물'은 L-아미노산을 생산할 수 있는 미생물이라면, 원핵 미생물 및 진핵 미생물 어느 것이나 포함될 수 있다. 예를 들면 에스케리키아( Escherichia) 속, 어위니아( Erwinia) 속, 세라티아( Serratia) 속, 프로비덴시아( Providencia) 속, 코리네박테리움( Corynebacterium) 속 및 브레비박테리움( Brevibacterium)속에 속하는 미생물 균주가 포함될 수 있다. 구체적으로는 에스케리키아속 미생물일 수 있으며, 보다구체적으로는 대장균일 수 있으나, 이에 제한되지 않는다.
[63]
[64]
본 출원의 또 하나의 양태로서, 상기 cAMP 수용 단백질 변이체를 포함하는 L-아미노산을 생산하는 에스케리키아 속 미생물을 배지에서 배양하는 단계를 포함하는 L-아미노산 생산방법을 제공한다.
[65]
상기 용어 'cAMP 수용 단백질 변이체', 및 'L-아미노산'은 앞에서 설명한 바와 같다.
[66]
상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물 (예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물 (예: 인산 또는 황산)을 사용하여 적정 pH (예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있다. 배양온도는 20 내지 45 ℃, 구체적으로는 25 내지 40 ℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한 되는 것은 아니다. 상기 배양에 의하여 생산된 L-아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
[67]
아울러, 사용되는 배양용 배지는 탄소 공급원으로는 당 및 탄수화물 (예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방 (예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산 (예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올) 및 유기산 (예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물 (예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 또는 무기 화합물 (예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염 (예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
[68]
상기 방법은 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다.
[69]
본 출원의 상기 배양 단계에서 생산된 L-아미노산을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 L-아미노산을 수집(collect)할 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수 할 수 있다.
[70]
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다. 따라서, 상기의 회수되는 L-아미노산은 정제된 형태 또는 L-아미노산을 함유한 미생물 발효액일 수 있다(Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
[71]
본 출원의 또 다른 하나의 양태로서, L-아미노산의 생산을 위한 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 치환을 포함하는 cAMP 수용 단백질 변이체의 용도를 제공한다.
[72]
본 출원의 또 다른 하나의 양태로서, L-아미노산의 생산을 위한 상기 cAMP 수용 단백질 변이체를 포함하는, 에스케리키아 속 미생물의 용도를 제공한다.
[73]
상기 용어 'cAMP 수용 단백질 변이체', 및 'L-아미노산'은 앞에서 설명한 바와 같다.
[74]

발명의 실시를 위한 형태

[75]
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니며, 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
[76]
[77]
실시예 1. 재조합 벡터 pCC1BAC-crp의 제작
[78]
[79]
1-1. 유전자 crp 단편의 준비
[80]
유전자 crp와 발현조절부위 부위를 포함하는 서열번호 5의 DNA 단편 약 0.96kb를 얻기 위해, Qiagen(사)의 Genomic-tip 시스템을 이용하여 대장균 야생주인 W3110의 염색체 DNA (gDNA)를 추출하고, 상기 gDNA를 주형으로 PCR HL premix kit(BIONEER사 제품, 이하 동일함)를 사용하여 PCR (polymerase chain reaction)을 수행하였다. 유전자 crp단편 부위를 증폭시키기 위한 PCR은 서열번호 6 및 7의 프라이머를 사용하여 95℃에서 30초의 변성(denaturation), 56℃에서 30초의 어닐링(annealing), 및 72℃에서 2분의 신장(elongation)으로 이루어진 사이클을 27회 반복 수행하였다.
[81]
상기 PCR 결과물을 EcoR I으로 절단하여 0.96 Kb 크기의 DNA 단편(이하, " crp 단편"이라 명명함)을 0.8% 아가로스 겔(agarose gel)에서 전기영동한 후 용리하여 수득하였다.
[82]
[표1]
서열번호 프라이머명 서열(5'-3')
6 crp-F CACGAATTCTTTGCTACTCCACTGCGTCA
7 crp-R ACACGAATTCTTAACGAGTGCCGTAAACG

[83]
[84]
1-2. 재조합 벡터 pCC1BAC- crp 의 제작
[85]
Copycontrol pCC1BAC vector (EPICENTRE, USA)를 EcoR I으로 처리하여 0.8% 아가로스 겔(agarose gel)에서 전기영동한 후 용리하여 수득하고, 실시예 1-1에서 얻어진 crp 단편을 라이게이션(ligation)시켜 pCC1BAC- crp 플라스미드를 제작하였다.
[86]
[87]
실시예 2. 재조합 벡터 pCC1BAC- crp 변이체 라이브러리의 제작
[88]
[89]
2-1. error-prone PCR을 이용한 돌연변이 crp 단편의 준비
[90]
야생형 대장균인 W3110 염색체 DNA를 주형으로 clonetech사의 diversify PCR random mutagenesis kit(catalog #: K1830-1, Table Ⅲ, mutagenesis reactions 4)을 이용하여 PCR을 수행하였다. 구체적으로, PCR은 실시예 1-1에서 사용된 서열번호 6 및 7의 프라이머를 사용하여 94℃에서 30초의 변성(denaturation), 68℃에서 1분의 신장(elongation)으로 이루어진 사이클을 27회 반복 수행하였다.
[91]
상기 PCR 결과물을 EcoR I으로 절단하여 0.96Kb 크기의 돌연변이된 crp 단편(이하, " crp m 단편"이라 명명함)들을 0.8% 아가로스 겔(agarose gel)에서 전기영동한 후 용리하여 수득하였다.
[92]
[93]
2-2. 재조합 벡터 pCC1BAC- crp 변이체 라이브러리의 제작
[94]
벡터 pCC1BAC을 제한효소 EcoR I으로 처리한 후, 알칼라인 포스파타제(alkaline phosphatase (NEB))를 처리하여 준비하였다. 준비된 벡터에 실시예 2-1에서 수득한 crp m 단편들을 라이게이션(ligation)시켜 TransforMax EPI300 Electrocompetent E.coli (EPICENTRE, USA)에 전기천공법을 이용하여 형질전환하였다. 형질전환시킨 균주는 클로람페니콜을 포함하는 LB고체배지(15ug/ml) 에서 콜로니(colony)를 선별하였다. 이렇게 획득된 콜로니들을 모아 플라스미드 프랩(plasmid prep)을 수행하여 pCC1BAC- crp m library를 제작하였다.
[95]
[96]
실시예 3. crp 변이체 라이브러리의 쓰레오닌 생산균주 도입 및 성장이 개선된 균체의 선별
[97]
[98]
3-1. pCC1BAC- crp m library의 쓰레오닌 생산 균주 도입
[99]
실시예 2에서 수득된 pCC1BAC- crp m library를 쓰레오닌을 생산하는 미생물 KCCM10541의 electro-competent cell에 전기천공법을 이용하여 형질전환(transformation)시켜 도입하였다. 본 실시예에서 사용된 대장균 KCCM10541(대한민국등록특허 제10-0576342호)은 L-쓰레오닌을 생산하는 대장균 KFCC10718(대한민국등록특허 제10-0058286호)로부터 galR 유전자가 불활성화된 대장균이다.
[100]
pCC1BAC- crp m library가 도입된 미생물의 대조군으로서, KCCM10541에 pCC1BAC- crp를 위와 같은 방법으로 형질전환하여 KCCM10541/pCC1BAC- crp(WT)을 제작하였다.
[101]
[102]
3-2. 재조합 미생물의 성장 속도 비교
[103]
1% 포도당(glucose), 0.2 g/L의 효모 추출물(yeast extract)이 포함된 M9 최소배지를 deep well microplate에 분주한 후, 상기 실시예 3-1에서 만들어진 형질전환체 및 대조군 균주를 접종하였다. 마이크로 크기 항온 배양기 쉐이커(Micro size constant temperature incubator shaker, TAITEC, Japan)를 이용(37℃, 200 rpm 조건)하여 HTS (High Throughput Screening) 방법으로 20시간동안 상기 균주를 배양시켜 성장이 개선된 균주들을 선별하였고, 그 중 최종적으로 1종의 균주를 선별하였다(표 2).
[104]
야생형 crp유전자가 도입된 KCCM10541 균주의 경우 crp 추가 도입에 의하여 약간의 OD 증가를 보이나, 성장이 개선된 형질전환체의 경우 OD가 동일 배양 시간후 야생형 crp 대비 높게 측정됨을 확인하였다. 또한, 선별된 crp 변이체에 대해 플라스미드 미니-프랩(plasmid mini-prep)후 서열 분석을 진행하였으며, 그 결과는 표 2에 정리하였다.
[105]
[표2] m 쓰레오닌 생산균주의 crp library 도입후 성장 개선된 형질전환체 정보
균주 OD600 변이
KCCM10541/pCC1BAC 2.3 -
KCCM10541/pCC1BAC-crp(WT) 2.8 -
KCCM10541/pCC1BAC-crpTM3 3.9 Q33K

[106]
[107]
3-3. 재조합 미생물의 쓰레오닌 역가 비교
[108]
상기 실시예 3-2에서 선별된 재조합 미생물의 쓰레오닌 역가를 측정하기 위하여 하기 표 3의 조성대로 제조된 쓰레오닌 역가 배지에서 배양하여 L-쓰레오닌 생산성 향상을 확인하였다.
[109]
[110]
[표3] 쓰레오닌 역가 배지 조성
조성물 농도(리터당)
Glucose 70 g
KH2PO4 2 g
(NH4)2SO4 25 g
MgSO4·7H2O 1 g
FeSO4·7H2O 5 mg
MnSO4·4H2O 5 mg
효모액기스 2 g
탄산칼슘 30 g
pH 6.8

[111]
[112]
구체적으로, 33℃ 배양기(incubator) 내 LB 고체 배지에서 밤새 배양한 대장균 KCCM10541/pCC1BAC-crp(WT) 및 대장균 KCCM10541/pCC1BAC- crpTM3를 각각 상기 표 3의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 48시간 동안 배양하여 당 소모속도 및 쓰레오닌 농도를 비교하였다.
[113]
그 결과, 하기 표 4에 기재된 바와 같이, 대조군인 KCCM10541/pCC1BAC- crp(WT) 균주는 24시간에서 소모당이 26.1 g/L이지만, 돌연변이 crpTM3를 도입한 균주는 모균주 대비 약 21%, 야생형 crp를 추가도입한 균주 대비 약 16 % 개선된 당 소모속도를 보임을 확인하였다.
[114]
또한, L-쓰레오닌 생산량의 경우 48시간 배양하였을 때, 야생형 crp를 추가도입한 균주의 경우는 29.0 g/L 를 생산하였으나, 상기에서 수득된 돌연변이 균주는 배양 속도가 증가함에도 불구하고, L-쓰레오닌의 생산량이 32.5 g/L까지 증가되어, 모균주 대비 약 13%, 야생형 crp를 추가도입한 균주 대비 약 12% 증가된 농도를 나타냄을 확인하였다.
[115]
이는 crp 변이형의 도입에 의하여 수율이 증가하며 균체의 당 소모능을 증가시킬 수 있는 좋은 변이형질로 보여, 발효시 생산효율 향상에 크게 기여할 수 있을 것으로 보인다.
[116]
[117]
[표4] crp 변이형이 포함된 쓰레오닌 균주 역가 비교
균주 소모당(g/L)* 쓰레오닌(g/L)**
KCCM10541/pCC1BAC 25.0 28.8
KCCM10541/pCC1BAC-crp(WT) 26.1 29.0
KCCM10541/pCC1BAC-crpTM3 30.2 32.5

[118]
* 24시간 측청치, **48시간 측청치
[119]
[120]
실시예 4. pCC1BAC- crpTM3 변이체의 트립토판 생산균주 도입
[121]
[122]
4-1. pCC1BAC- crpTM3의 스크리닝 균주 도입
[123]
실시예 3에서 수득된 pCC1BAC- crpTM3 를 트립토판을 생산하는 균주 KCCM11166P의 electro-competent cell에 전기천공법을 이용하여 형질전환(transformation)시켜 도입하였다. 본 실시예에서 사용된 KCCM11166P는 tehB 유전자가 결실되고, NAD 키나아제의 활성이 강화된 L-트립토판 생산 대장균 이다 (대한민국등록특허 제10-1261147호).
[124]
pCC1BAC- crpTM3 가 도입된 미생물의 대조군으로서, KCCM11166P에 pCC1BAC- crp(WT)를 위와 같은 방법으로 형질전환하여 KCCM11166P/pCC1BAC- crp(WT)을 제작하였다.
[125]
[126]
4-2. 재조합 미생물의 성장 속도 비교
[127]
1% 포도당, 0.2 g/L의 효모 추출물이 포함된 M9 최소배지를 deep well microplate에 분주 한 후, 상기 실시예 4-1에서 기술된 대로 만들어진 형질전환체 및 대조군 균주를 접종하였다. 하여 마이크로 크기 항온 배양기 쉐이커(Micro size constant temperature incubator shaker, TAITEC, Japan)를 이용(37℃, 200 rpm 조건)하여 HTS (High Throughput Screening) 방법으로 16시간 동안 상기 균주를 배양시켜 KCCM11166P/pCC1BAC- crpTM3 형질전환체의 성장이 개선되는 것을 확인하였다(표 5).
[128]
야생형 crp 유전자가 도입된 KCCM11166P 균주의 경우 crp 추가 도입에 의하여 동일 배양 시간후 측정하였을 때, 동등 수준의 OD를 보이나, 성장이 개선된 형질 전환체의 경우 OD가 야생형 crp 대비 높게 측정됨을 확인하였다.
[129]
[130]
[표5] 트립토판 생산균주의 crpTM3 도입 후 성장 개선된 형질전환체 정보
균주 OD600 변이
KCCM11166P/pCC1BAC 3.4 -
KCCM11166P/pCC1BAC-crp(WT) 3.5 -
KCCM11166P/pCC1BAC-crpTM3 3.9 Q33K

[131]
[132]
4-3. 재조합 미생물의 트립토판 역가 비교
[133]
상기 실시예 4-2에서 제조한 재조합 미생물의 트립토판 역가를 측정하기 위하여 하기 표 6의 조성대로 제조된 트립토판 역가 배지에서 배양하여 L-트립토판 생산효율 향상을 확인하였다.
[134]
[표6] 트립토판 역가 배지 조성
조성물 농도(리터당)
Glucose 60 g
K2HPO4 1 g
(NH4)2SO4 10 g
NaCl 1 g
MgSO4·7H2O 1 g
구연산나트륨 5 g
효모액기스 2 g
탄산칼슘 40 g
구연산나트륨 5 g
페닐알라닌 0.15 g
타이로신 0.1 g
pH 6.8

[135]
[136]
구체적으로, 37℃ 배양기(incubator)에서 LB 고체 배지상에 밤새 배양한 대장균 KCCM11166P/pCC1BAC- crp(WT) 및 대장균 KCCM11166P/pCC1BAC- crpTM3를 각각 상기 표 6의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 48시간 동안 배양하여 당 소모속도 및 트립토판 농도를 비교하였다. 그 결과, 하기 표 7에 기재된 바와 같이, 대조군인 KCCM11166P/pCC1BAC- crp(WT) 균주는 22시간에서 소모당이 30.2 g/L이지만, 돌연변이형 crpTM3를 도입한 균주는 모균주 대비 약 12%, 야생형 crp를 추가도입한 균주 대비 약 8 %까지 개선된 당 소모속도를 보임을 확인하였다.
[137]
L-트립토판 생산량의 경우 48시간 배양하였을 때, 야생형 crp를 추가 도입한 균주의 경우는 8.4 g/L 를 생산하였으나, 상기에서 수득된 돌연변이 균주들은 배양 속도가 증가함에도 불구하고, L-트립토판의 생산량이 9.0 g/L까지 증가되어, 모균주 대비 약 7 %, 야생형 crp를 추가 도입한 균주 대비 약 10% 증가된 농도를 보임을 확인 하였다.
[138]
이는 crp 변이형의 도입에 의하여 균체의 당 소모능이 증가되며, 수율도 향상 시킬 수 있는 좋은 변이형질로 보여, 발효시 생산성 향상에 크게 기여할 수 있을 것으로 보인다.
[139]
[표7] crp 변이형이 포함된 트립토판 균주 역가 비교
균주 소모당(g/L)* 트립토판(g/L)**
KCCM11166P/pCC1BAC 29.0 8.2
KCCM11166P/pCC1BAC-crp(WT) 30.2 8.4
KCCM11166P/pCC1BAC-crpTM3 32.5 9.0

[140]
*22시간 측정치, ** 48시간 측정치
[141]
[142]
실시예 5. 유효 crp 변이형 내재 벡터의 야생형 대장균 도입
[143]
[144]
5-1. 유효 pCC1BAC- crp 변이형의 야생형 유래 쓰레오닌 생산균주 도입
[145]
상기 실시예 3에서 스크리닝된 crp 변이형을 포함한 벡터가 야생형 균주에서도 동등한 효과를 보이는지 확인해 보기 위하여, pCC1BAC- crp(WT) 및 pCC1BAC- crpTM3의 벡터를 쓰레오닌을 생산할 수 있는 야생형 유래 균주에 전기천공법을 이용하여 형질전환(transformation)시켜 도입하였다. 또한 대조군으로 pCC1BAC- crp(WT)를 도입한 균주도 제작하였다.
[146]
본 실시예에 사용된 쓰레오닌을 생산할 수 있는 야생형 유래 균주는 W3110::PcysK-ppc/pACYC184-thrABC이며, W3110::PcysK-ppc/pACYC184-thrABC는 염색체상의 포스포에놀파이루베이트 카르복실레이즈를 코딩하는 ppc 유전자의 native 프로모터를 cysK 유전자의 프로모터로 치환하고, 쓰레오닌 생합성 오페론 유전자를 벡터 형태로 도입하여 카피수를 증가시켜 쓰레오닌 생성량을 증가시킨 균주이다. 구체적으로는, 대한민국 등록특허 제10-0966324호에 기재된 방법대로, pUCpcycKmloxP를 이용하여 W3110::PcycK-ppc 균주를 제작 한 후, 상기 균주에 pACYC184-thrABC(대한민국 등록특허 제10-1865998호)를 전기천공법을 이용하여 형질전환하였다.
[147]
상기 제조된 균주들은 하기 표 8의 조성대로 제조된 쓰레오닌 평가 배지에서 배양하여 성장속도와 L-쓰레오닌 생산능을 비교하였다.
[148]
[표8] 쓰레오닌 평가 배지 조성
조성물 농도(리터당)
Glucose 70 g
KH2PO4 2 g
(NH4)2SO4 25 g
MgSO4·7H2O 1 g
FeSO4·7H2O 5 mg
MnSO4·7H2O 5 mg
DL-메티오닌 0.15 g
효모엑기스 2 g
탄산칼슘 30 g
pH 6.8

[149]
[150]
구체적으로, 33℃ 배양기(incubator)에서 LB 고체 배지 중에 밤새 배양한 W3110, 각각의 균주를 표 8의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 48시간 동안 배양하였으며, 이의 결과를 하기 표 9에 나타내었다. 하기 결과에서 알 수 있듯이, 야생형 균주에서도 본 출원에서 선별한 변이형 단백질이 쓰레오닌을 고수율로 효율적으로 생산할 수 있음을 시사하는 것이다.
[151]
[표9] 야생형 유래 균체 성장 및 쓰레오닌 생성능 평가 결과
균주 OD 쓰레오닌(g/L)**
W3110::PcysK-ppc/pACYC184-thrABC/pCC1BAC 10.8 1.5
W3110::PcysK-ppc/pACYC184-thrABC/pCC1BAC-crp(WT) 11.0 1.6
W3110::PcysK-ppc/pACYC184-thrABC/pCC1BAC-crpTM3 13.5 2.5

[152]
[153]
5-2. 유효 pCC1BAC-crp 변이형의 야생형 유래 트립토판 생산균주 도입
[154]
상기 실시예 4에서 스크리닝된 crp 변이형을 포함한 벡터가 야생형 균주에서도 동등한 효과를 보이는지 확인 하기 위하여, pCC1BAC- crp(WT) 및 pCC1BAC- crpTM3의 벡터를 트립토판을 생산할 수 있는 야생형 유래 균주로 형질전환(transformation)시켜 도입하였다.
[155]
본 실시예 사용된 트립토판을 생산할 수 있는 야생형 유래 균주는 W3110 trp△2/pCL-Dtrp_att-trpEDCBA로서, 트립토판 오페론 조절 부위의 조절 기작이 해제되고, 트립토판을 과량 생산할 수 있도록 트립토판 오페론 발현이 강화된 벡터가 도입된 균주이다 (대한민국 등록특허 제10-1532129호). 벡터가 도입된 균주들은 하기 표 10의 조성대로 제조된 트립토판 평가 배지에서 배양하여 L-트립토판 생산능을 비교하였다.
[156]
[표10] 트립토판 평가 배지 조성
조성물 농도(리터당)
Glucose 2 g
K2HPO4 1 g
(NH4)2SO4 12 g
NaCl 1 g
Na2HPO4·H2O 5 g
MgSO4·H2O 1 g
MnSO4·H2O 15 mg
CuSO4·H2O 3 mg
ZnSO4·H2O 30 mg
구연산나트륨 1 g
효모액기스 1 g
페닐알라닌 0.15 g
pH 6.8

[157]
[158]
구체적으로, 37℃ 배양기(incubator)에서 LB 고체 배지 상에 밤새 배양한 균주들을 각각 상기 표 9의 25 ㎖ 평가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 48시간 동안 배양하여 OD 및 트립토판 농도를 비교하여 표 11에 나타내었다. 하기 결과에서 알 수 있듯이, 야생형 균주에서도 본 출원에서 선별한 변이형 단백질이 트립토판을 고수율로 효율적으로 생산할 수 있음을 시사하는 것이다.
[159]
[표11] 야생형 유래 균체 성장 및 트립토판 생성능 평가 결과
균주 OD 트립토판(g/L)**
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC 10.8 0.5
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC-crp(WT) 11.0 0.6
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC-crpTM3 12.7 0.9

[160]
[161]
본 발명자들은 KCCM11166P 균주 기반, pCC1BAC- crpTM3가 도입되어 트립토판 생산능 및 당 소모속도가 개선된 균주(KCCM11166P/pCC1BAC- crpTM3)를 "CA04-2807"로 명명한 후 부다페스트 조약 하에 국제기탁기관인 한국미생물보존센터 (KCCM)에 2018년 11월 07일자에 기탁하여 수탁번호 KCCM12373P를 부여받았다.
[162]
[163]
상기와 같은 결과들은, 본 출원의 crp 변이체가 도입된 에스케리키아속 미생물에서 당 소모 속도가 개선되면서 L-아미노산 생성능이 증가되어 결과적으로 비변형 균주보다 L-아미노산의 생산능이 증가되는 것을 시사하는 것이다.
[164]
[165]
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
[166]
[167]

청구범위

[청구항 1]
서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된, cAMP 수용 단백질(cAMP receptor protein) 변이체.
[청구항 2]
제1항의 cAMP 수용 단백질 변이체를 코딩하는 폴리뉴클레오티드.
[청구항 3]
제1항의 cAMP 수용 단백질 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터.
[청구항 4]
서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된, cAMP 수용 단백질 변이체를 포함하는, 에스케리키아 속( Escherichia sp.) 미생물.
[청구항 5]
제4항에 있어서, 상기 에스케리키아 속 미생물은 대장균인, 에스케리키아 속 미생물.
[청구항 6]
제4항에 있어서, 상기 에스케리키아 속 미생물은 L-아미노산을 생산하는 것인, 에스케리키아 속 미생물.
[청구항 7]
제6항 있어서, 상기 L-아미노산은 L-쓰레오닌 또는 L-트립토판인 것인, 에스케리키아 속 미생물.
[청구항 8]
서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된, cAMP 수용 단백질 변이체를 포함하는, 에스케리키아 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산을 생산하는 방법.
[청구항 9]
제8항에 있어서, 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 추가적으로 포함하는, L-아미노산을 생산하는 방법.
[청구항 10]
제8항에 있어서, 상기 L-아미노산은 L-쓰레오닌 또는 L-트립토판인 것인, L-아미노산을 생산하는 방법.
[청구항 11]
서열번호 1의 아미노산 서열에서 33번째 아미노산이 라이신으로 치환된 cAMP 수용 단백질 변이체 또는 상기 변이체를 포함하는 에스케리키아 속 미생물의 L-아미노산 생산 용도.