Certains contenus de cette application ne sont pas disponibles pour le moment.
Si cette situation persiste, veuillez nous contacter àObservations et contact
1. (WO2019063844) VACCINATION CONTRE LE VIRUS RESPIRATOIRE SYNCYTIAL
Note: Texte fondé sur des processus automatiques de reconnaissance optique de caractères. Seule la version PDF a une valeur juridique

RESPIRATORY SYNCYTIAL VIRUS VACCINATION

FIELD OF THE INVENTION

The present invention in general relates to novel respiratory syncytial virus (RSV) F nucleic acids and (glyco)proteins or peptides encoded therefrom. It further provides vaccines comprising such nucleic acids, (glyco)proteins or peptides, as well as uses thereof in the prophylaxis and/or treatment of RSV infections.

BACKGROUND TO THE INVENTION

The respiratory syncytial virus (RSV) is a major cause of infant morbidity and mortality related to lower respiratory tract disease. The disease burden in children younger than 5 years is estimated at 33.8 million infections annually from which 10% requires hospitalization. A vaccine to control RSV disease burden remains elusive and treatment options are mainly supportive.

Palivizumab, a humanized monoclonal antibody which targets a conserved epitope of the RSV fusion (F) protein, is prophylactically administered to high-risk children and is able to reduce

RSV-related hospitalizations significantly. Re-infections are very common due to an incomplete and short-lived immunity.

RSV is an enveloped virus with a non-segmented negative-stranded RNA genome belonging to the family Pneumoviridae and genus Orthopneumovirus. From the 1 1 proteins which the RSV genome encodes, three are membrane-bound proteins including the small hydrophobic (SH) protein, attachment (G) protein and F protein which are subjected to the addition of glycan structures during their synthesis. A wide range of viral proteins is modified by the attachment of glycan structures co- and post-translationally. The most common type is N-glycosylation which is characterized by attachment of the glycan structure to a asparagine (N) residue of the polypeptide chain within the consensus sequence N-X-S/T. The SH protein, known as a pore-forming protein that enhances membrane permeability of the host cells, is expressed in different forms; glycosylated forms but predominantly non-glycosylated forms. The G protein is important in the RSV entry process by regulating host cell attachment and contains both potential N-glycosylation and O-glycoyslation sites (S or T residues within the polypeptide chain) which determine its high molecular weight. Variation within the RSV G O-glycosylation profile is responsible for its high degree of variability among virus strains and may provide an immune evasion strategy. In contrast, five N-glycosylation sites of the F protein are highly conserved. Two sites (N27, N70) are located at the F2 subunit, one site (N500) at the F1 subunit and two remaining sites (N1 16, N126) within p27, a short amino acid sequence between both subunits which is released after cleavage to form the mature RSV F protein. Depending on the strain, an additional potential site is found at positon N120 within p27. The RSV F protein regulates binding and fusion during host cell entry, moreover, it is the only required membrane protein for infection in cell cultures. RSV neutralization by human serum is predominantly obtained by the activity of RSV F-specific antibodies; and monoclonal antibodies (mAbs) specific for the RSV F protein

(palivizumab) are able to reduce hospitalization due to severe bronchiolitis and pneumonia when administered prophylactically to high-risk infants. As such, vaccine research is mainly focused on the RSV F protein.

Virus glycosylation plays a direct role in protein processing such as protein folding and cleavage, in intracellular trafficking of the protein and in biological functions of the protein in question. All these factors are indirectly or directly related to viral infectivity. Removal of N-linked glycans can result either in enhanced or reduced infectivity of the involved virus and can differ between N-glycans within a viral glycoprotein. In this context, glycosylation is often an important determinant of viral pathogenicity and additionally, virus-specific pathogenic characteristics can be determined by the glycosylation profile of viral proteins. Previous studies already investigated RSV glycosylation either by chemical or enzymatic deglycosylation or by site-directed mutagenesis of specific glycosylation sites in plasmids encoding the RSV F protein. By this means, no requirement of glycosylation was observed in proteolytic cleavage and cell surface transport of the RSV F protein. Virus infectivity was significantly reduced after enzymatic removal of the N-glycans attached on the RSV glycoproteins. Additionally, inhibition of RSV glycan maturation by alpha-mannosidase inhibitor deoxymannojirimycin affected RSV infectivity remarkably. Since both RSV glycoproteins F and G are responsible for efficient infectivity and contain N-linked glycans, it remains questioned to which extent N-glycosylation of the individual glycoproteins affects RSV infectivity. At protein level, it was shown that the N-glycan positioned at N500 of the RSV F protein is important for its fusion activity, removal of other N-linked glycans had no impact. The functional role of the F2 subunit N-glycans and the p27 N-glycans remains to be determined.

As detailed in example 1 , recombinant RSV strains containing individual N-glycosylation-deficient mutations in the F protein were developed using a BAC-based RSV rescue system (Hotard et al., 2012). It allowed us to characterize the individual RSV F N-glycosylation sites in the context of the virus instead of the RSV F protein only and to study their role in in vitro and in vivo growth as well as in RSV pathogenesis.

Additionally, the immunogenicity of viral glycoproteins is often determined by their glycosylation profile. The attachment of N-linked glycans can affect the recognition of antibodies by shielding antigenic sites on the protein. Removal of specific N-linked glycans on viral glycoproteins can elicit more potent neutralizing antibody responses and may be an interesting approach for vaccine design. In the context of DNA vaccines or live-attenuated vaccines (LAVs), this approach was already broadly investigated for multiple viruses. Interestingly, immunization of mice with a specific bRSV F glycomutant showed higher antibody responses compared with the wild-type (WT) bRSV F protein. However, it is not clear how the individual N-linked glycans impact the immunogenicity of the hRSV fusion protein and to which extent the observations of the glycomutant bRSV F protein immunizations can be extrapolated to hRSV F.

As detailed in example 2, individual, conserved RSV F N-glycosylation sites were in vitro characterized by analysis of cell surface expression, fusiogenicity and antibody reactivity. The

influence of deglycosylation on antibody responses was determined by intramuscular immunization of mice with plasmids encoding glycomutant RSV F proteins. Subsequent RSV challenge of the immunized mice was performed to analyze the protective effect of the antibody responses.

SUMMARY OF THE INVENTION

In a first aspect, the present invention provides a vaccine comprising:

- a human Respiratory Syncytial Virus (RSV) F nucleic acid sequence or (glyco)protein or peptide encoded therefrom; or

- a virus comprising a human Respiratory Syncytial Virus (RSV) F nucleic acid sequence or

(glyco)protein or peptide encoded therefrom;

wherein said nucleic acid sequence has a modification in the p27 encoded region, and wherein said modification is a removal of an N-glycosylation site in said p27 encoded region.

In a particular embodiment of the present invention, said modification consists of the amino acid substitution of asparagine into glutamine, alanine, or any other amino acid except for asparagine, at said N-glycosylation site in the p27 encoded region.

In another particular embodiment of the present invention, said modification is selected from the list comprising: removal of the N1 16 glycosylation site in the p27 encoded region, removal of the N120 glycosylation site in the p27 encoded region, removal of the N126 glycosylation site in the p27 encoded region, or a combination thereof.

In yet a further embodiment of the present invention, said modification is selected from the list comprising: N1 16Q in the p27 encoded region, N120Q in the p27 encoded region, N126Q in the p27 encoded region, or a combination thereof.

In yet a further embodiment of the present invention, said vaccine further comprises one or more additional modifications in the F1 encoded region and/or the F2 encoded region; more specifically, said one or more further modifications results in removal of a further N-glycosylation site in said F1 encoded region and/or F2 encoded region; even more specifically said further modification is selected from the list comprising: removal of the N27 glycosylation site of the F2 encoded region, removal of the N70 glycosylation site of the F2 encoded region, removal of the N500 glycosylation site of the F1 encoded region, or a combination thereof. In a more specific embodiment, said further modification is selected from the list comprising N27Q in the encoded region, N70Q in the encoded region, N500Q in the encoded region or a combination thereof.

The present invention also provides a virus comprising a human RSV nucleic acid sequence or (glyco)protein or peptide encoded therefrom; wherein said nucleic acid sequence has a modification in the p27 encoded region, and wherein said modification results in removal of an N-glycosylation site in said p27 encoded region.

In a particular embodiment, the present invention provides a vaccine as defined herein or a virus as defined herein for use in human or veterinary medicine; more specifically for use in the prophylaxis and/or treatment of an RSV infection in a subject in need thereof.

The present invention also provides a method for the prophylaxis and/or treatment of human RSV infections comprising administering to a subject in need thereof, a vaccine as herein or a virus as defined herein.

Further aspects of the present invention are provided in the below numbered statements:

Statement 1 . A Respiratory Syncytial Virus (RSV) F type I nucleic acid sequence; or (glyco)protein or peptide encoded therefrom; said nucleic acid sequence having a modification in the p27 encoded region.

Statement 2. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in statement 1 ; wherein said modification results in deglycosylation of an N-glycosylation site in the p27 encoded region.

Statement 3. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in statement 2; wherein said deglycosylation consists of the amino acid substitution of asparagine into glutamine, alanine, or any other amino acid except for asparagine, at said N-glycosylation site in the p27 encoded region.

Statement 4. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 to 3; wherein said modification is selected from the list comprising: deglycosylation of the N1 16 site in the p27 encoded region, deglycosylation of the N120 site in the p27 encoded region, deglycosylation of the N126 site in the p27 encoded region, or a combination thereof.

Statement 5. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 to 4; wherein said modification is selected from the list comprising: N1 16Q in the p27 encoded region, N120Q in the p27 encoded region, N126Q in the p27 encoded region, or a combination thereof.

Statement 6. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in any one of statements 1 to 5, further comprising one or more additional modifications in the F1 encoded region and/or the F2 encoded region.

Statement 7. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in statement 6, wherein said one or more further modifications result in deglycosylation of a further N-glycosylation site in said F1 encoded region and/or F2 encoded region.

Statement 8. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in statement 7, wherein said further modification is selected from the list comprising: deglycosylation of the N27 site of the F2 encoded region, deglycosylation of the N70 site of the F2 encoded region, deglycosylation of the N500 site of the F1 encoded region, or a combination thereof.

Statement 9. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in statement 8, wherein said further modification is selected from the list comprising N27Q in the encoded region, N70Q in the encoded region, N500Q in the encoded region or a combination thereof.

Statement 10. An attenuated virus comprising an RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 -9.

Statement 1 1 . The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 -9 or the virus as defined in statement 10 for use in human or veterinary medicine.

Statement 12. The RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 -9 or the virus as defined in statement 10 for use in the prophylaxis and/or treatment of an RSV infection in a subject in need thereof.

Statement 13. A vaccine comprising an RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 -9 or a virus as defined in statement 10.

Statement 14. A method for the prophylaxis and/or treatment of RSV infections comprising administering to a subject in need thereof, an RSV nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 -9, a virus as defined in statement 10 or a vaccine as defined in statement 13.

Statement 15. The RSV nucleic acid sequence or protein or peptide encoded therefrom for use as defined in statement 12; or the vaccine for use as defined in statement 12; or the method as defined in statement 14, wherein said subject is selected from the list comprising: humans, primates, farm animals, domestic animals, laboratory animals and birds.

Statement 16. A Respiratory Syncytial Virus (RSV) F type I nucleic acid sequence or protein or peptide encoded therefrom as defined in anyone of statements 1 to 3; wherein said modification is selected from the list comprising: deglycosylation of the N27 site in the F2 subunit encoded region, deglycosylation of the N70 site in the F2 subunit encoded region, deglycosylation of the N1 16 site in the p27 encoded region, deglycosylation of the N120 site in the p27 encoded region, deglycosylation of the N126 site in the p27 encoded region, deglycosylation of the N500 site in the F1 subunit encoded region deglycosylation, or a combination thereof.

Statement 17. A Respiratory Syncytial Virus (RSV) F type I nucleic acid sequence or protein or peptide encoded therefrom; said nucleic acid sequence having the following modifications: deglycosylation of the N27 site of the encoded F2 unit and deglycosylation of the N500 site of the encoded F1 unit.

BRIEF DESCRIPTION OF THE DRAWINGS

With specific reference now to the figures, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention only. They are presented in the cause of providing what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

Figure 1 : Influence of RSV F deglycosylation on in vitro RSV growth. (A) HEp-2 cells were infected with the indicated virus at a MOI of 0.5. After 2 h incubation, the cells were washed and fresh medium was added to the cells for further incubation. At the indicated time points, supernatant was collected and titrated by plaque assay. (B) Two μΙ_ of virus stocks with known viral titers (PFU/mL) were dried overnight, fixed with PF and stained with polyclonal goat anti-RSV. To visualize the particles, staining with AF555-conjugated donkey anti-goat IgG was performed. Particles were semi-quantified by fluorescence microscopic analysis and expressed as mean particles/mL of three independent repeats. Particle/PFU ratios were calculated by the following equitation: [mean particles/mL] / [PFU/mL]. Data represents the mean (± SEM) of two (A) or three (B) independent repeats.

Figure 2: Virus replication in different cell lines. Subconfluent HEp-2, A549 and BEAS-2B cells were infected with the indicated virus for 24 h and subsequently fixed, permeabilized and stained with DAPI to visualize the nuclei. The ratio infected cells (mKate-positive cells) to the total amount of cells was determined by fluorescence microscopy in 10 random fields. Data represent the mean of two independent repeats (± SD).

Figure 3: Influence of RSV F deglycosylation on in vivo replication. BALB/c mice were infected with 2x105 PFU/mL of indicated virus by intranasal inoculation. Lungs were collected and weighed 4 and 6 days p.i. to determine lung viral titers in lung homogenates by an immunodetection plaque assay. *, P < 0.05 (n=5-6 animals/group).

Figure 4: Antibody responses induced by recombinant RSV strains expressing glycosylation-deficient RSV F proteins. (A) Serum was collected 8 days p.i. and infected HEp-2 monolayers were titrated with 2-fold serial dilutions of heat-inactivated serum. Antibody binding was detected by HRP-conjugated goat anti-mouse IgG and DAB. Endpoint titers were determined by light microscopic analysis. (B) Serum neutralizing Ab titers were determined by incubation of serial two-fold dilutions of heat-inactivated serum with virus for 1 h at 37°C prior inoculation of HEp-2 monolayers. After 3 days incubation, plaques were visualized by immunostaining with palivizumab and HRP secondary antibodies. The 50% endpoint titers were determined by manual plaque counting.

Figure 5: Pulmonary mucin expression after infection with RSV F glycosylation-deficient strains. Right lungs were collected 8 days p.i., paraffin-embedded and stained with PAS. Within the group, 30 airways of each mouse were scored (n=5-6 animals/group) 0-4 for PAS-positive cells by light microscopic analysis.

Figure 6: Surface expression analysis of RSV F glycosylation mutants. Flow cytometric analysis of BSR T7/5 cells expression glycosylation mutants of the RSV F protein. BSR T7/5 cells were transfected with a pCAXL plasmid encoding one of the glycosylation mutants of the RSV F protein and a GFP expressing plasmid (EGFP-N3). After 24 h incubation the cells were detached and stained with human RSV antiserum at 4°C to assure surface staining only. Secondary anti-human IgG conjugated with AF647 was used to detect RSV F proteins. Fluorescence intensities of fluorescence channel (FL) 4 were measured of 5000 cells expressing GFP (FL1 ). Surface expression is expressed as the MFI relative to F WT expression. Data represents the means (± SD) from 3 independent repeats. *, P < 0.05.

Figure 7: Evaluation of the influence of deglycosylation on the recognition of RSV F-specific mAbs. (A) Flow cytometric analysis of BSR T7/5 cells expression glycosylation mutants of the RSV F protein. BSR T7/5 cells were transfected with a pCAXL plasmid encoding one of the glycosylation mutants of the RSV F protein and a GFP expressing plasmid (EGFP-N3). After 24 h incubation the cells were detached and stained with RSV F-specific mAbs (palivizumab (A), AM14 (B), D25 (C), MPE8 (D) or 101 F (E)) at 4°C. Secondary anti-human or anti-mouse IgG conjugated with AF647 were used to detect RSV F proteins. Fluorescence intensities of fluorescence channel (FL) 4 were measured of 5000 cells expressing GFP (FL1 ). Surface expression is expressed as the MFI relative to F WT expression. Data represents the means (± SD) from 3 independent repeats. *, P < 0.05.

Figure 8: The influence of RSV F deglycosylation on syncytia formation. After 24 h incubation of BSR T7/5 cells transfected with glycomutant RSV F plasmids, the cells were fixed and permeabilized. RSV F proteins were stained with palivizumab and secondary goat anti-human IgG AF488. Syncytia were visualized by staining the nuclei with DAPI and further analyzed by fluorescence microscopy. Syncytia size of 100 transfected cells was counted. Data represents the mean (± SD) of three independent repeats.

Figure 9: Dual split protein assay to measure RSV F fusion activity. HEK293T cells were transfected with one of the RSV F plasmids as well as the 1 -7 fragment of rLuc-GFP or with the 8-1 1 fragment of rLuc-GFP which corresponds with effector cells and target cells respectively. After 48 h incubation, the effector and target cells were washed, resuspended in media and further co-cultured. The activity of the reconstituted Renilla luciferase in fused cells was measured after 16-24 hours by adding cell-permeable coelenterazine. Five co-culturing replicates were performed for each biological condition. Data represents the mean values (± SD) of five co-culturing replicates. ****, P < 0.001 .

Figure 10: Antibody responses after DNA immunization of BALB/c mice. Two subsequent immunizations of the indicated plasmids were intramuscular administered to BALB/c mice. Serum was collected 2 weeks after the second immunization. (A) HEp-2 monolayers were infected with RSV A2L19F for 24 hours and methanol fixed afterwards. Serum antibody titers were determined by titration of 2-fold serial dilutions of heat-inactivated serum. Binding of the antibodies was detected by HRP-conjugated goat anti-mouse IgG and DAB. Endpoint titers were determined by light microscopic analysis. (B) Plaque reduction neutralization assays were performed to determine neutralizing antibody responses after boost immunization. Serial twofold dilutions of heat-inactivated serum were incubated with RSV A2L19F for 1 h at 37°C prior inoculation of HEp-2 monolayers. Plaques were visualized by immunostaining with palivizumab and HRP secondary antibodies. The 50% endpoint titers were determined by manual plaque counting. *, P < 0.05 (n=5-6 animals/group).

Figure 11 : Antibody responses before and after challenge of immunized mice. Antibody (A) and neutralizing antibody responses (B) after immunization and before infection. Antibody (C) and neutralizing antibody responses (D) after immunization and before infection after immunization and after infection. To determine serum antibody titers RSV A2L19F infected HEp-2 monolayers were titrated with 2-fold serial dilutions of heat-inactivated serum after methanol fixation. Binding of the antibodies was detected by HRP-conjugated goat anti-mouse IgG and DAB. Endpoint titers were determined by light microscopic analysis. (B) PRNT was performed by incubation of serial two-fold dilutions of heat-inactivated serum with RSV A2L19F for 1 h at 37°C prior inoculation of HEp-2 monolayers. Plaques were visualized by immunostaining with palivizumab and HRP secondary antibodies. The 50% endpoint titers were determined by manual plaque counting. *, P < 0.05 (n=3-6 animals/group).

Figure 12: Lung viral RNA levels after RSV challenge. Five days post infection of the immunized mice with 1 x106 PFU of RSV A2L19F, the left lungs were collected and homogenized. To determine relative RNA levels in the infected lungs RT-qPCR was performed. (n=3-6 animals/group).

Figure 13: Schematic representation of the RSV F protein. Structure of the RSV F protein with the 5 conserved N-glycosylation sites (N27, N70, N1 16, N126 and N500); and 1 non-conserved N-glycosylation sites (N120). Sites N27 and N70 are located in the F2 subunit, sites N1 16, N120 and N126 are located in the small peptide p27 and site N500 is positioned at the F1 subunit.

Figure 14. Mice were immunized by intranasal inoculation with the indicated recombinant viruses and 5 weeks post immunization challenged with RSV A2-K-line19F. Serum was collected three weeks post immunization (A), 5 weeks post immunization, before challenge (B) and after challenge (C). (Left panel) Serum antibody titers were determined by titration of 2-fold serial dilutions of heat-inactivated serum. Binding of the antibodies was detected by HRP-conjugated goat anti-mouse IgG. Endpoint titers were determined by light microscopic analysis. (Right panel) PRNT were performed to determine neutralizing antibody responses. Serial 2-fold dilutions of heat-inactivated serum were incubated with RSV A2-K-line19F for 1 h at 37°C prior to inoculation of HEp-2 monolayers. Plaques were visualized by immunostaining with palivizumab and HRP-conjugated secondary antibodies. The 50% endpoint titers were determined by manual plaque counting. The dotted line represents the detection limit. * p < 0.05; ** p < 0.01 ; *** p < 0.001 ; n = 5-6 animals/group (Student's unpaired two-tailed t test).

Figure 15: Two subsequent immunizations of the indicated F DNA constructs were intramuscularly administered to BALB/c mice. Serum was collected 3 weeks after prime immunization (A), 2 weeks after boost immunization, before challenge (B), and 5 days post

challenge (C). (Left panel) HEp-2 monolayers were infected with RSV A2-K-line19F for 24 h and methanol fixed afterwards. Serum antibody titers were determined by titration of 2-fold serial dilutions of heat-inactivated serum. Binding of the antibodies was detected by HRP-conjugated goat anti-mouse IgG. Endpoint titers were determined by light microscopic analysis. (Right panel) PRNT were performed to determine neutralizing antibody responses. Serial 2-fold dilutions of heat-inactivated serum were incubated with RSV A2-K-line19F for 1 h at 37°C prior to inoculation of HEp-2 monolayers. Plaques were visualized by immunostaining with palivizumab and HRP-conjugated secondary antibodies. The 50% endpoint titers were determined by manual plaque counting. The dotted line represents the detection limit. * p < 0.05; ** p < 0.01 ; **** p < 0.0001 ; n = 5-6 animals/group (Student's unpaired one-tailed f test).

Figure 16: Five days after infection of the indicated F DNA immunized mice with 1 X106 PFU of RSV A2-K-line19F, the lefts lungs were collected and homogenized in HBSS. RT-qPCR was performed to determine the relative RSV RNA levels in the infected lungs. *, p < 0,05; **, p < 0,01 ; n = 3-6 animals/group (Student's unpaired two-tailed t test).

DETAILED DESCRIPTION OF THE INVENTION

As already detailed herein before, in a first aspect, the present invention provides a Respiratory Syncytial Virus (RSV) F (type I) nucleic acid sequence; or (glyco)protein or peptide encoded therefrom; said nucleic acid sequence having a modification in the p27 encoded region. More specifically the present invention provides a vaccine comprising a Respiratory Syncytial Virus (RSV) F nucleic acid sequence; or (glyco)protein or peptide encoded therefrom. Alternatively, said vaccine comprising a virus encoding a Respiratory Syncytial Virus (RSV) F nucleic acid sequence; or (glyco)protein or peptide encoded therefrom. In particular, said vaccine is characterized in that said nucleic acid sequence has a modification in the p27 encoded region, and wherein said modification results in deglycosylation of an N-glycosylation site in said p27 encoded region; more in particular said modification results in removal of an N-glycosylation site in said p27 encoded region.

For the sake of clarity, the RSV F protein is a type I glycoprotein, therefore, in the context of the present invention, the terms "RSV F" and "RSV F type 1 " are used interchangeably.

As used herein, the terms "mutated," "modified," "mutation," or "modification" indicate any modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, an insertion, or a deletion of part or all of a gene. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are the results of artificial mutation pressure. In still other embodiments, the mutations in the RSV F proteins are the result of genetic engineering.

As schematically illustrated in figure 13, the RSV F protein comprises 2 major subunits, i.e. the F1 and F2 subunits, the latter encompassing the p27 peptide. The pre-protein is cleaved into 2 subunits (i.e. the F1 and F2) which remain linked to each other through disulphide bridges, while the p27 peptide is removed from the mature protein. The p27 region specifically contains 3 N-glycosylation sites, i.e. N1 16, N120 and N126; while the F2 subunit further comprises the N27 and N70 glycosylation sites; and the F1 subunit comprises the N500 glycosylation site.

Whenever referred to the positions of the modification sites, N glycosylation sites or any specific amino acids, the location thereof is based on the amino acid sequence of the preprocessed RSV F (fusion) protein as represented by SEQ ID N° 1 and corresponding to NCBI Accession Number FJ614813, protein ID AC083297.1 . Furthermore, whenever reference is made to modifications in nucleic acid sequences specifically, said modification is specified in accordance with the corresponding amino acid encoded region. For example, the N1 16 site in the p27 region corresponds to nucleic acid sequences 346-348 of the full-length nucleic acid sequence of the RSV F gene as represented by SEQ ID N°2.

While in the present invention, any reference to RSV is meant to correspond to the human RSV, the present invention is also suitable in the context of other types of RSV such as for example bovine RSV. Evidently for such other RSV types, the location of the modification may differ, and in such instance, the invention is meant to cover the corresponding modification site in said other type of RSV as compared to the recited modification site in the human RSV. For example, bovine RSV F contains the N-glycosylation sites N27, N70, N120 and N500.

In a specific embodiment, the modification as referred to in the present invention results in deglycosylation of an N-glycosylation site in the p27 encoded region. As used in the present invention the term "deglycosylation" is meant to be the removal of N-linked oligosaccharides from a glycoprotein, more specifically the removal of an N-glycosylation site from said F protein. More specifically, this can be achieved by an amino acid substitution of asparagine, preferentially into glutamine at said N-glycosylation site. Alternatively, asparagine can be substituted by alanine or any other amino acid except for asparagine. Asparagine is the naturally occurring amino acid sequence at the referred sites and is glycosylated in the corresponding natural glycoprotein or peptide derived thereof. By replacing such Asparagine (one letter code 'N') by a glutamine (one letter code 'Q'), the naturally occurring glycosylation is no longer available, and the corresponding glycoprotein or peptide derived thereof is thus not glycosylated, i.e. it is in the deglycosylated form. On the nucleic acid level, asparagine is naturally encoded by any of the codons AAU and AAC, whereas glutamine is encoded by any of the codons CAA and CAG. Hence, removal of a glycosylation site in the encoded protein can be achieved by modifying the nucleic acid sequence at the corresponding location to replace the codons AAU or AAC by CAA or CAG. A similar strategy can be used when replacing asparagine by any other amino acid, i.e. the codons encoding asparagine are at that instance replaced by the codons encoding such other amino acid. A person skilled in the art is well aware of the codon usage for each of the individual amino acid.

In the present invention, deglycosylation or removal of an N-glycosylation site in the p27 peptide was found to be highly suitable within the context of the present invention, as detailed in the example section. Hence, in a preferred embodiment, the modification (specifically deglycosylation removal of an N-glycosylation site) occurs at the N1 16 site in the p27 encoded region, the N120 site in the p27 encoded region, the N126 site in the p27 encoded region, or a combination thereof. More specifically, the modifications of the present invention are selected from the list comprising: N1 16Q in the p27 encoded region, N120Q in the p27 encoded region, N126Q in the p27 encoded region, or a combination thereof. It was particularly surprisingly that although the p27 peptide is removed (by cleavage) from the F glycoprotein and does not form part of the mature protein, modification thereof was found to provide protection against RSV infections, making it highly suitable for vaccination purposes.

Further to the modification of the p27 encoded region; the nucleic acid sequences or encoded proteins or peptides may also comprise one or more additional modifications in the F1 encoded region and/or other parts of the F2 encoded region. Again, said further modification preferably results a deglycosylation or removal of an N-glycosylation site of a further N-glycosylation site in said F1 encoded region and/or F2 encoded region. Said further N-glycosylation sites may be selected from the N27 site of the F2 encoded region, deglycosylation removal of an N-glycosylation site of the N70 site of the F2 encoded region, deglycosylation removal of an N-glycosylation site of the N500 site of the F1 encoded region, or a combination thereof. In a very specific embodiment, said further modification is selected from the list comprising N27Q in the encoded region, N70Q in the encoded region, N500Q in the encoded region or a combination thereof.

Although the nucleic acid sequences and proteins or peptides encoded therefrom may be used as such, or as being part of an RNA or DNA vector, they may also be presented in a virus, such as an attenuated virus comprising such sequences.

It was found that the modified nucleic acids and proteins or peptides encoded therefrom, as well as the attenuated viruses comprising these molecules, are particularly suitable in providing protection against RSV infections. Hence in a specific embodiment, the nucleic acids and proteins or peptides encoded therefrom, as well as the attenuated viruses comprising such molecules are used in the preparation of a vaccine against RSV. Therefore, the present invention also provides a vaccine comprising an RSV nucleic acid sequence; or protein or peptide encoded therefrom as defined herein or a virus as defined herein.

The present invention also provides an RSV nucleic acid sequence; protein or peptide encoded therefrom; a virus as defined herein; or a vaccine comprising such sequences or viruses for use in human or veterinary medicine; more specifically for use in the prophylaxis and/or treatment of an RSV infection in a subject in need thereof.

The term "subject" as used herein refers to any member of the subphylum cordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species. Farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats (including cotton rats) and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like are also non-limiting examples . The terms "mammals" and "animals" are included in this definition. Preferably the subject is a human. Both adult and newborn individuals are intended to be covered. In particular, infants and young children are appropriate subjects or patients for prophylaxis or treatment using the nucleic acids, proteins, peptides and/or vaccines of the present invention. The present invention may be suitable for the prophylaxis and/or treatment of RSV infections in otherwise healthy individuals, it may also be suitable for the prophylaxis and/or treatment of RSV infections in premature children, infants with congenital heart diseases, infants with chronic lung diseases, elderly patients and/or immunocompromised patients.

As the present invention is directed both to modified nucleic acid sequences as well as protein or peptide sequences encoded therefrom, the vaccines according to the present invention, may be in any form capable of comprising such sequences. In that respect, the vaccine according to the present invention may for example be in the form of a nucleic acid/vector vaccine, a DNA or RNA vaccine, a vector vaccine, a protein vaccine, a peptide vaccine, or a vaccine based on an (attenuated) virus.

As used herein, the term " vaccine" refers to a formulation which contains a modified or mutated RSV F nucleic acid sequence or protein/peptide encoded therefrom, which is in a form that is capable of being administered to a subject in need thereof and which induces a protective immune response sufficient to induce immunity to prevent and/or ameliorate an infection or

disease, and/or to reduce at least one symptom of an infection or disease, and/or to enhance the efficacy of another dose of a modified or mutated RSV F nucleic acid or protein/peptide encoded therefrom.

As mentioned above, the immunogenic compositions of the invention prevent or reduce at least one symptom of RSV infection in a subject. Symptoms of RSV are well known in the art. They include rhinorrhea, sore throat, headache, hoarseness, cough, sputum, fever, rales, wheezing, and dyspnea. Thus, the method of the invention comprises the prevention or reduction of at least one symptom associated with RSV infection. A reduction in a symptom may be determined subjectively or objectively, e.g., self assessment by a subject, by a clinician's assessment or by conducting an appropriate assay or measurement (e.g. body temperature), including, e.g., a quality of life assessment, a slowed progression of a RSV infection or additional symptoms, a reduced severity of a RSV symptoms or a suitable assays {e.g. antibody titer and/or T-cell activation assay). The objective assessment comprises both animal and human assessments.

Typically, the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved. In this form, the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat an infection. Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies and/or cytokines and/or the activation of cytotoxic T cells, antigen presenting cells, helper T cells, dendritic cells and/or other cellular responses.

Administration of the compositions according to the invention can be performed using standard routes of administration. Non-limiting embodiments include parenteral administration, such as intradermal, intramuscular, subcutaneous, transcutaneous, or mucosal administration, e.g. intranasal, oral, and the like. In one embodiment, a composition is administered by intramuscular injection. The skilled person knows the various possibilities to administer a composition, e.g. a vaccine in order to induce an immune response to the antigen(s) in the vaccine. The nucleic acid molecules, proteins, peptides, vectors, and/or (vaccine) compositions may be administered, either as prime, or as boost, in a homologous or heterologous prime-boost regimen. If a boosting vaccination is performed, typically, such a boosting vaccination will be administered to the same subject at a time between one week and one year, preferably between two weeks and four months, after administering the composition to the subject for the first time (which is in such cases referred to as 'priming vaccination'). In certain embodiments, the administration comprises a prime and at least one booster administration.

In a further embodiment, the present invention provides a Respiratory Syncytial Virus (RSV) F nucleic acid sequence or protein or peptide encoded therefrom in accordance with the present

invention; wherein said modification is selected from the list comprising: deglycosylation or removal of an N-glycosylation site of the N27 site in the F2 subunit encoded region, deglycosylation or removal of an N-glycosylation site of the N70 site in the F2 subunit encoded region, deglycosylation or removal of an N-glycosylation site of the N1 16 site in the p27 encoded region, deglycosylation or removal of an N-glycosylation site of the N120 site in the p27 encoded region, deglycosylation or removal of an N-glycosylation site of the N126 site in the p27 encoded region, deglycosylation or removal of an N-glycosylation site of the N500 site in the F1 subunit encoded region, or a combination thereof.

In a final aspect, the present invention provides a Respiratory Syncytial Virus (RSV) F nucleic acid sequence or protein or peptide encoded therefrom; said nucleic acid sequence having the following modifications: deglycosylation or removal of an N-glycosylation site of the N27 site in the encoded F2 unit and deglycosylation or removal of an N-glycosylation site of the N500 site in the encoded F1 unit.

In a very specific embodiment, the present invention provides a nucleic acid sequence selected from the list comprising: SEQ ID N° 1 (wild-type); SEQ ID N° 3 (N27Q); SEQ ID N° 5 (N70Q); SEQ ID N° 7 (N1 16Q); SEQ ID N° 9 (N120Q); SEQ ID N° 1 1 (N126Q); SEQ ID N° 13 (N500Q); SEQ ID N° 17 (N1 16Q & N120Q), SEQ ID N° 18 (N1 16Q & N126Q), SEQ ID N° 19 (N120Q & N126Q), SEQ ID N° 20 (N1 16Q & N120Q & N126Q) or fragments thereof; as well as vectors, cells, viruses, ... comprising such nucleic acid sequences.

The viruses as used in the context of the present invention may specifically encompass a nucleic acid sequence selected from the list comprising SEQ ID N° 21 (wild-type) SEQ ID N° 22 (N27Q); SEQ ID N° 23 (N70Q); SEQ ID N° 24 (N1 16Q); SEQ ID N° 25 (N120Q); SEQ ID N° 26 (N126Q); SEQ ID N° 27 (N1 16Q & N126Q), SEQ ID N° 28 (N1 16Q & N120Q), SEQ ID N° 29 (N120Q & N126Q), SEQ ID N° 30 (N1 16Q & N120Q & N126Q), SEQ ID N° 31 (N500Q); or fragments therof.

In another specific embodiment, the present invention provides a protein or peptide selected from the list comprising: SEQ ID N° 2 (wild-type); SEQ ID N° 4 (N27Q); SEQ ID N° 6 (N70Q); SEQ ID N° 8 (N1 16Q); SEQ ID N° 10 (N120Q); SEQ ID N° 12 (N126Q); SEQ ID N° 14 (N500Q) or fragments thereof; as well as cells, viruses, ... comprising such proteins or peptides.

The sequences as used herein correspond to human codon-optimized F sequences for the used DNA constructs, as well as original (non-codon optimized) F sequences in the used recombinant viruses. It is evident that any F sequences, being it codon-optimized or not are envisaged within the context of the invention.

EXAMPLES

EXAMPLE 1 : F Glycosylation in viral replication and pathogenesis

MATERIAL AND METHODS

Cells and virus

The human epidermoid carcinoma larynx cell line (HEp-2), A549 and Vera cell line were obtained from the ATCC and BEAS-2B cells were generous provided by U. Power (Queens' University Belfast). The cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% inactivated fetal bovine serum (iFBS). BSR T7/5 cells were a gift of K.K Conzelmann (Max-von-Pettenhofer-lnstitut, Munich, Germany) and grown in Glasgow's minimal essential medium (GMEM) supplemented with 10% iFBS, 2% minimal essential amino acids and 1 mg/mL geneticin. Cell culture media and supplements were obtained from Thermo Fisher Scientific. The mKate2-expressing BAC-RSV construct, named pSynkRSV-line19F, and helper plasmids pcDNA3.1 RSV L, M2.1 , N and P were provided by M. Moore (Emory University of School of Medicine, Georgia, USA).

Construction and recovery of recombinant viruses

The RSV F glycosylation mutants were obtained by switching the asparagine (N) residue (AAT/AAC) at the conserved positions N27 (SEQ ID N° 3, 4), N70 (SEQ ID N° 5, 6), N1 16 (SEQ ID N° 7, 8), N126 (SEQ ID N° 1 1 , 12) or N500 (SEQ ID N° 13, 14) into a glutamine (Q) residue (CAA/CAG). WT and recombinant RSV Iine19 F sequences were synthetized by Genscript and delivered in pUC57 simple. Subcloning into vector pSynkRSV-line19F was performed using appropriate restriction enzymes (New England Biolabs) to excise insert DNA from vector pUC57 simple and ligate the insert into vector pSynkRSV-line19F using T4 DNA ligase (New England Biolabs). Ligation products were transformed into electrocompetent E. coli cells and plasmid DNA was recovered using PureLink® HiPure Plasmid Midiprep Kit according to the manufacturer's instructions (Thermo Fisher Scientific). The sequences of the recombinant vectors were confirmed by DNA sequencing (VIB Genetic Service Facility, University of Antwerp).

Recombinant virus was recovered as described previously (Hotard et al., 2012). Briefly, BSR T7/5 cells, passaged with 1 mg/mL Geneticin, were seeded in 6 well plates to be 100% confluent at the time of transfection. The appropriate concentrations of the recombinant BAC constructs (0.8 vg), helperplasmids pcDNA3.1 RSV L (0.2 ^g), RSV N (0.4 pg), RSV P (0.4 pg) and RSV M2.1 (0.4 g) and 6,6 μί Lipofectamine 2000 (Thermo Fisher Scientific) were diluted in 100 μί opti-MEM (Thermo Fisher Scientific) and mixed. After 20 minutes incubation, transfection complexes of 600 μί were added to the cells, incubated for 2 h at room temperature on a shaking plate and further incubated with an additional 600 μΙ_ GMEM supplemented with 3% iFBS overnight. Then, transfection complexes were replaced by medium and sub-passed in T25 flasks two days post-transfection. Every 2 or 3 days the cells were sub-cultured until cytopathic effect was evident throughout the flask and subsequently scraped and snap frozen. Subconfluent HEp-2 cell cultures were used to propagate recovered virus for three passages to minimize adaptation to HEp-2 cells. Virus stocks were titrated by a conventional plaque assay in HEp-2 cells as described previously (Schepens et al., 2014). RSV RNA of the final stocks was isolated using a viral RNA isolation kit (Qiagen) according the manufacturer's protocol. A reverse-transcriptase-PCR kit (Agilent Technologies) was used to synthesize cDNA that was further analyzed by sequencing (VIB Genetic Service Facility, University of Antwerp) to verify the presence of the N-glycosylation mutations in the final virus stocks.

Western blot analysis

For Western blotting, virus was pelleted by ultracentrifugation (90 min, 20.000 rpm, 4°C) (Optima™ XPN) and resuspended in HBSS. Aliquots were mixed 1 :1 with Laemmli sample buffer (Bio-Rad) with or without β-mercapthoethanol. After boiling the mixtures, the cell lysates were loaded and separated on 4-20% polyacrylamide gels (Bio-Rad) and transferred to a Immobilon-P transfer membrane (Millipore). RSV F proteins were stained with palivizumab and HRP-conjugated goat anti-human IgG (Thermo Fisher Scientific). Protein bands were visualized with chromogenic 3,3' diaminobenzidine (DAB) (Sigma-Aldrich).

In vitro infection

HEp-2, A549 and BEAS-2B cells were seeded in 96-well black flat Clear® bottom microtiter plates (Greiner Bio-one) to be subconfluent after overnight incubation. Cells were infected with WT or recombinant RSV expressing glycosylation-deficient F proteins at a multiplicity of infection (MOI) of 0.1 in 50 μΙ_ basal growth medium (DMEM) and incubated for 2 h at 37°C. Unbound virus was washed away and pre-warmed medium was added to the cells for further incubation. After 24 h the cells were fixed with 4% paraformaldehyde (PF), permeabilized with 0,5% Triton-X100 (Thermo Fisher Scientific) and nuclei were stained with DAPI (Sigma). Cells were analyzed by fluorescence microscopy (Axio Observer, Zeiss). Infection percentages were determined by imaging 10 random fields whereby mKate2 expression served as a marker for RSV-infected cells.

Indirect immunofluorescence staining of RSV F surface proteins

Infection of subconfluent HEp-2 cells seeded on coverslips in 24-well plates was performed as described before (Leemans et al., 2017). After 24 h incubation, the cells were fixed with 4% paraformaldehyde (PF). To visualize the surface-expressed RSV F proteins, the cells were stained with a RSV F-specific monoclonal antibody (palivizumab) (UZA, Antwerp) and AF488-

conjugated anti-human IgG (Thermo Fisher Scientific). Nuclei were stained with DAPI (Sigma-Aldrich). The images were obtained using a Leica SP8 confocal microscope and Volocity 3D Image Analysis Software.

Fusion assay

HEp-2 cells were seeded in 96-well black flat Clear® bottom microtiter plates (Greiner Bio-one) to be subconfluent at the time of infection. Cells were infected with WT or recombinant RSV expressing glycosylation-deficient F proteins at a multiplicity of infection (MOI) of 0.5. After 36 h infection, the cells were fixed with 4% PF, permeabilized with 0.5% Triton X-100 (Thermo Fisher Scientific) and stained with DAPI. Syncytium frequency (cells with more than two nuclei) and mean syncytium size was determined of 100 mKate-positive cells by fluorescence microscopy. Fusion index was calculated by the product of the mean syncytium frequency and mean syncytium size. Cells were analyzed using a Axio Observer inverted microscope with an HXP 120C compact light source (Zeiss).

Virus particle staining

Optimal dilutions were prepared from WT or recombinant RSV expressing glycosylation-deficient F proteins in basal growth medium (DMEM) to get a well-distributed population of virus particles. Two μΙ_ of the dilution was dried overnight in a 96-well black flat Clear® bottom microtiter plate (Greiner Bio-one) and subsequently fixed with 4% PF, blocked with 1 % BSA for

1 h and stained with a polyclonal goat anti-RSV antibody (Virostat). The particles were visualized with AF555-conjugated donkey anti-goat IgG (Thermo Fisher Scientific). Images were acquired by fluorescence microscopy (Axio Observer, Zeiss) and further semi-quantitative analyzed using ImageJ software (Schindelin et al., 2012). Particle/PFU ratios were calculated as particles per ml divided by PFU per ml.

In vitro virus growth curve

Subconfluent HEp-2 cells in 6-well plates were infected with WT or recombinant RSV expressing glycosylation-deficient F proteins at a MOI of 0.1 in 750 μΙ_ basal growth medium (DMEM). After

2 hours incubation at 37°C, the cells were washed twice with pre-warmed medium to remove unbound virus and fresh medium (+10% iFBS) was added for further incubation. Samples of supernatant were collected 16, 24, 48, 72 and 96 hours post-infection (p.i.), clarified by centrifugation, snap-frozen and stored until plaque titration by an immunodetection plaque assay in HEp-2 cells (Schepens et al., 2014).

Infection of BALB/c mice

Female 7-8 weeks old BALB/c mice (Janvier, France) were randomly allocated to individually ventilated cages of 9 animals each. Food (Carfil, Belgium) and drinking water were available ad libitum. Prior RSV challenge, the mice were anesthetized with 5% isoflurane (Halocarbon®, New Jersey, USA) and subsequently intranasal inoculated with 2x105 PFU of pelleted WT or glycomutant RSV diluted in 100 μΙ_ HBSS. Mice were sacrificed by C02 4, 6 and 8 days p.i. and the lungs were excised. The left lung was homogenized in HBSS containing 20% sucrose and clarified by centrifugation (4°C, 15 min, 1000 x g) for further titration by plaque assay in Vera cells as described (Schepens et al., 2014). The right lung was fixed by formaldehyde (PF) for the preparation of paraffin slides (see below). The animal studies were approved by the Animal Ethical Committee of the University of Antwerp (UA-ECD 2015-63).

Antibody responses and neutralization assay

RSV-infected HEp-2 cells (MONO.5) were used as antigen and propagated in 96-well microtiter plates (Falcon). After methanol fixation, permeabilization with 0.5 % Triton X-100 and blocking with 1 % bovine serum albumin (BSA) (Santa Cruz Technologies), two-fold dilutions (starting from 1 :10) of the heat-inactivated mice serum were added to the cells and incubated for 1 h at 37°C. Afterwards, the cells were stained with HRP conjugated goat anti-human IgG (Thermo Fisher Scientific). 3,3'diaminobenzidine (DAB) (Sigma) was added to the cells as a substrate for HRP. Light microscopic analysis was performed to determine the antibody titers of the serum and are displayed as log 2 of the lowest concentration were staining of RSV-infected cells was observed.

Plaque reduction neutralization assays were performed to determine the neutralizing antibody titers. Prior inoculation of subconfluent HEp-2 monolayers, 2-fold dilutions of heat-inactivated serum in duplicate were incubated with virus inoculum for 1 h at 37°C. Binding of virus was allowed for 2 h at 37°C and afterwards an overlay of DMEM + 0.6% Avicel (FMC Biopolymer) was added to the cells. After 3 days incubation at 37°C, cells were fixed with 4% PF, permeabilized with Triton X-100 and blocked with 1 % BSA. Plaques were stained with palivizumab and HRP-conjugated goat anti-human IgG. Chloronapthol (Thermo Fisher Scientific) was used to visualize the plaques. Neutralization titers were calculated by the concentration resulting in a 50 % reduction compared to control wells.

Histochemistry

Right lungs were excised 8 days p.i.. The lungs were fixed in 10% paraformaldehyde, transferred to 60% isopropanol and paraffin embedded. Sections of 5 μΜ thickness were stained with periodic acid-Schiff (PAS) to evaluate pulmonary mucin expression and score as previously described (Moore et al., 2009).

Statistical analysis

Data are presented as means of two or three independent repeats. WT RSV data was compared with the glycosylation-deficient mutant RSV strains using a student t-test by GraphPad Prism 6. P values <0.05 were considered statistically significant.

RESULTS

Recovery of recombinant RSV expressing glycosylation-deficient F proteins using a RSV-BAC clone

The RSV F protein conserves 5 potential N-glycosylation sites (N27, N70, N1 16, N126 and N500) which were individually or all together substituted by a glutamine (Q) residue to obtain glycosylation-deficient RSV F proteins. To study the impact of deglycosylation (or removal of an N-glycosylation site) at the level of infectious virus, we attempt to rescue viable virus by a BAC-based RSV rescue system (Hotard et al., 2012). A RSV-BAC clone, encoding the complete RSV genome, was used as vector for the recombinant RSV F sequences. After subcloning, the recombinant BAC clones were transfected in BSR T7/5 cells together with RSV helperplasmids (RSV L, P, N and M2.1 ) to recover recombinant virus. Viable virus was rescued for all individual glycosylation mutants indicating no essential role of the N-glycans in viral replication. However, no viable virus could be rescued from cDNA containing all conserved glycoyslation-deficient mutations. After three passages in HEp-2 cells, RNA was isolated of the different recombinant RSV stocks and further processed to cDNA for sequence analysis to confirm the presence of the N-glycoyslation substitutions.

Recombinant strains with N-glycan deletions on the mature RSV F protein have a reduced molecular weight

The molecular weight of glycoproteins is determined by the amount and extent of the attached N-glycan structures. Denaturation of pelleted virus under non-reducing or reducing conditions and subsequently separated by molecularweight by gel electrophoresis. Staining of the blot with palivizumab after protein transfer visualized the RSV F proteins of the recombinant viruses (data not shown). Non-reducing conditions resulted in protein bands around 70 kDA, corresponding to the non-cleaved RSV F protein. Deglycosylation (i.e. removal of an N-glycosylation site) of the N-glycans present on the mature protein (N27Q, N70Q and N500Q) resulted in a reduced molecular weight compared with WT F whereas deletion of p27 glycans N1 16 or N126 did not change the molecular weight of RSV F (data not shown). Reduction by β-mercaptoethanol resulted in cleavage of RSV F into subunits F1 (50 kDa) and F2. Since N500 is the only glycan positioned at the F1 subunit and this subunit possesses the antigenic site of palivizumab, only here a reduction in molecular weight was observed (data not shown).

Surface expression after deglycosylation (removal of an N-glycosylation site) was assessed by immunofluorescence staining of surface-expressed RSV F proteins. After infection of HEp-2 cells, the cell surface was stained with palivizumab and AF488-conjuaged secondary antibody. Microscopic analysis showed expression at the cell surface for all glycomutant RSV F proteins (data not shown).

The efficiency of in vitro RSV syncytium formation is determined by the N-glycan attached to N500

Previous studies with glycosylation-deficient RSV F proteins showed the importance of the N-glycan positioned at N500 for efficient in vitro RSV F fusion activity (Zimmer et al., 2001 ; Li et al., 2007). In the present study, it was assessed whether these findings could be confirmed when the RSV F glycosylation-deficient mutations are incorporated in virus particles. Syncytia (cells with more than two nuclei) were analyzed and nuclei were quantified manually by fluorescence microscopy after 36 h infection. WT virus developed large syncytia in HEp-2 cells, a well-described feature of in vitro RSV infection. Mean syncytium frequency showed no remarkable differences between RSV F WT and the glycomutant viruses except for RSV F N500Q. Additionally, mean syncytium size was also strongly reduced for RSV F N500Q. The product of both was expressed as the fusion index in relation to the fusion activity of RSV F WT virus and showed a reduced activity for all the mutants, most remarkably for RSV F N500Q. Taken together, these data demonstrate that the N-glycan at position N500 is essential for efficient in vitro syncytium formation of RSV-infected HEp-2 cells (table 1 ).

Table 1: Efficiency of RSV syncytium formation after RSV F deglycosylation. Thirty six hours after infection of HEp-2 cells with the recombinant RSV strains, the cells were fixed and permeabilized. Syncytia were visualized by staining the nuclei with DAPI and further analyzed by fluorescence microscopy. Mean syncytia size and syncytium frequency was determined of 100 mKate-positive HEp-2 cells. Data represents the mean (± SD) of three independent repeats. Fusion index represents product of the mean syncytium size and mean syncytium frequency relative to RSV WT (100%).

Mean syncytium Mean syncytium Relative fusion

size frequency (%) index (%)

RSV F WT 10.36 ± 0.56 63.56 ± 7 100

RSV F N27Q 7.45 ± 1 .56 54.57 ± 4 61 .71

RSV F N70Q 7.01 ± 1 .53 52.61 ± 6 55.96

RSV F N1 16Q 4.67 ± 1 .99 42.15 ± 1 1 29.90

RSV F N126Q 7.83 ± 1 .14 49.34 ± 6 58.68

RSV F N500Q 3.95 ± 1 .29 18.64 ± 6 1 1 .18

Deglycosylation of N-glycan at position N500 results in impaired in vitro growth

Glycosylation of viral proteins is known as an important determinant of virus infectivity for numerous viruses. Previous studies showed reduced infectivity after enzymatic or chemical deglycosylation of all RSV glycoproteins. Here we examined the effect of deglycosylation (or removal of an N-glycosylation site) of the individual RSV F N-linked glycans on RSV growth in HEp-2 cells. Prior infection, viral titers were determined by an immunodetection plaque assay to ensure the same MOI for the different strains. Infection was performed at a MOI of 0.5 and supernatant was collected and titrated by plaque assay at different time points. In the first time interval, the first replication cycle takes place in infected cells and viral titers decline. Approximately 16 h p.i., infected cells start to release new virus particles which is characterized by a progressive increase in viral titers. At each time point, the highest titers are obtained for the WT virus. In vitro virus growth of the WT virus is followed by N126Q, N70Q, N27Q, N1 16Q and N500Q with the lowest titers.

Virus particles were semi-quantified after indirect immunofluorescence staining to determine the particle/PFU ratio. Low ratios indicate that much of the particles are able to yield plaques in a plaque assay whereas high ratios correspond with a high amount of particles that fail to complete infection. The mean particle/PFU ratio of recombinant virus N500Q is significantly higher as compared to the WT virus, showing that N500Q produces much more non-infectious virus particles. No remarkable differences could be observed for the other mutant viruses. These observations are consistent with the results of the virus growth curve and provide an explanation for the slower growth of mutant N500Q (see figure 1 ). HEp-2 is the most commonly used cell line to propagate RSV and study RSV replication in vitro. However, cell lines which more closely resemble the natural host cell are available and also frequently used. A549 cells are widely used as a model for type II pulmonary epithelial cells and BEAS-2B cells are immortalized human bronchial epithelial cells. The different cell lines were infected at the same MOI and after 24 h incubation infection ratios were determined (see figure 2). Of the cell lines used, A549 cells showed the highest infection ratios after 24 h. In contrast with HEp-2 and A549 cells, no impaired replication of N500Q was observed in BEAS-2B cells.

Impaired in vivo virus growth after individual deglycosylation of N-glycans linked on the mature RSV F protein

To date, the importance of RSV F glycoyslation in virus infectivity was mainly studied in in vitro systems. Moreover, the role of the individual N-linked glycans of RSV F in this process remains unknown. Therefore, the impact of deletion of N-linked glycans of the RSV F protein individually on virus growth was assessed by infection of BALB/c mice with the RSV F glycomutant strains and determination of viral lung titers at 4, 6 and 8 days p.i.. Using a conventional plaque assay no viral plaques could be observed in the lung homogenates of any of the infected animals at day 8. Both at day 4 and day 6 p.i., no remarkable differences in lung titers were observed

between WT virus and mutants N1 16Q and N126Q, corresponding with the results of the in vitro growth. As observed in the in vitro assay, N500Q showed significant lower lung titers at day 4 and 6 p.i. in comparison with WT virus. Unexpectedly, also mutant viruses N27Q and N70Q showed remarkable lower lung titers 4 and 6 days p.i. which was not observed in vitro (see figure 3). Taken together, our data indicate an important role of glycosylation in the in vivo growth of RSV.

Additionally, for many viruses humoral immunity was shown to be dependent on the glycoyslation profile of viral proteins since deglycosylation can result in enhanced antibody responses.

Eight days p.i. serum antibody titers and neutralizing antibody titers were measured. In general, rather low antibody responses were induced and no significant differences were observed between the groups. Not surprisingly, no or very low neutralizing antibody titers were observed early in infection. Only N126Q induced significant higher titers (see figure 4).

RSV disease is characterized by exacerbated mucus production causing airway hyperresponsiveness and airway constriction. Moore et al (2009) identified differences in the capacity to cause abundant mucus production between RSV F proteins of different RSV strains. In this study, strain RSV A2L19F was used containing the mucogenic F protein of strain L19 (Hotard et al., 2012; Moore et al., 2009). Eight days p.i. lungs were excised, fixed and stained with PAS to visualize and score the mucin-producing cells. Compared with mock-infected mice, more PAS-positive bronchi were observed in the RSV-infected mice, except for mutants N27Q and N70Q (see figure 5). Interestingly, mutant N500Q induced the highest mucin expression, suggesting a limiting role of the glycan at this position in mucus production in the setting of RSV infection in BALB/mice.

DISCUSSION

So far, studies regarding the role of RSV F glycosylation at the level of infectious virus are rather limited. In this study we aimed to characterize the impact of individual mutation of the N-glycoyslation sites of the RSV F protein on in vitro and in vivo growth. Five conserved N-glycosylation sites are spread over the RSV F polypeptide chain. Substitution of the N residue into a Q residue was performed to prevent post-translational attachment of the glycan structure and to obtain RSV F proteins deficient in a specific glycan. Recombinant virus was recovered after incorporation of the glycomutant RSV F sequences into a RSV-BAC clone and transfection in BSR T7/5 cells. N-glycan structures can account for a significant proportion of the molecular weight of the protein, as analyzed using Western blot analysis. Non-reducing conditions of F detected with F1 subunit-specific palivizumab showed a shift for N27Q, N70Q and N500Q whereas reducing conditions showed only a shift for N500Q due to its unique location on the F1 subunit. The molecular weight of RSV F remained unchanged after deletion of the p27 N1 16 and N126, confirming their absence on the mature RSV F protein.

Viral envelope proteins play an essential role in the virus life cycle. Here, we showed that individual mutation of all five conserved RSV F N-glycosylation sites resulted in the recovery of replication-competent virus. However, differences in in vitro growth between the individual mutants were observed indicating that RSV F glycosylation determines replication efficiency. Moreover, no viable virus could be rescued after deglycosylation of all RSV F conserved N-glycans, suggesting that the presence of two or more N-glycans is required for in vitro viral replication. Attempting to recover all combinations should reveal the combination of N-linked glycosylation sites indispensable for RSV replication.

The efficiency of viral replication is determined by different steps of the replication cycle, from host cell entry to assembly and release of new virus particles, which are often dependent on the glycosylation profile of viral proteins. In this report, previous findings about the impact of individual mutation of RSV F N-glycosylation sites on cell surface transport were confirmed in the context of a viral infection since RSV F surface expression was observed for all single mutants (Zimmer et al., 2001 ). Additionally this study showed that syncytium formation of RSV F-transfected cells was dramatically disturbed after deglycosylation (or removal of an N-glycosylation site) of N500 indicating an important role of this glycan for fusion activity of the protein. In this report, the importance of N500 was confirmed after infection of HEp-2 cells with recombinant virus expressing mutant F N500Q. The formation of multinucleated cells is a typical characteristic of RSV growth in cell lines, in particular HEp-2 cells. Our results indicate that this feature determines the efficiency of in vitro growth since a good correlation was observed between the fusion index and in vitro growth. However, replication of N500Q was not impaired in BEAS-2B cells suggesting that syncytium formation is of minor importance to ensure efficient viral replication in this cell line. The observed differences between the cell lines emphasize the importance of evaluating the effect of N-glycan removal on in vivo replication. After infection of BALB/c mice, significant reductions in lung viral load were observed for mutants N27Q, N70Q and N500Q, all sites located on the mature RSV F sequence. For N500Q an explanation is provided by the increased particle/PFU ratio indicating that more non-infectious particles are produced after removal of N500 as well as by its disturbed capacity to form syncytia. However, despite giant-cell pneumonia was observed in RSV-infected immunocompromised patients and different studies using well-differentiated cultures of human airway epithelium observed syncytia after RSV infection, syncytium formation is rather limited in vivo. Additionally, no dramatic impairment of syncytium formation was observed for mutants N27Q and N70Q. This indicates that efficient RSV in vivo growth is ensured by other mechanisms which are affected after removal of glycans N27, N70 and N500.

Due to the importance of viral glycosylation in determining and maintaining the antigenic conformation of viral proteins, removal of N-glycans can affect virus-specific antibody responses. As demonstrated herein above, deletion of specific RSV F glycosylation sites can enhance antibody responses. To study the impact of RSV F glycan removal on antibody elicitation after infection, the duration of infection is a limitation in this study since serum antibody responses peak after approximately 21 days in mice. However, already a significant difference in neutralizing antibody titer was observed for mutant virus N126Q 8 days p.L Therefore, it would be interesting to further evaluate this impact after prolonged infection of mice and to evaluate the effect on protection against RSV challenge.

For decades, many attempts have been made to develop a vaccine to control the RSV burden. The most recommended approach for the pediatric population is live attenuated vaccination (LAV) since this was shown to be safe in RSV-na'ive infants and children. Nonetheless, it remains challenging to find an optimal balance between sufficient attenuation and immunogenicity. In this context, combined RSV glycomutations which attenuate the virus and induce enhanced antibody responses may provide insights in LAV approaches. However, single point mutations have a high potential for reversion and the influence of the mutations on pathogenicity needs to be considered. For multiple viruses the role of glycosylation in viral pathogenicity was already demonstrated. RSV-associated lower respiratory tract disease in children is characterized by excessive mucus production. Since RSV strains with different F sequences were identified that induced varying levels of airway mucin expression in mice, it was suggested that RSV F is an important mediator for this process (Moore et al., 2009). In our study a mucogenic strain was used and enhanced mucin expression was observed 8 days p.i by PAS staining, compared with mock-infected mice. Mutants N27Q and N70Q showed comparable levels of PAS-positive cells with mock-infected mice whereas the levels of mutants N1 16Q and N126Q coincided with these of WT-infected mice. For these mutants the levels of PAS-positive cells were consistent with the in vivo virus growth.

In summary, previous observations about the impact of individual mutation of RSV F glycoyslation sites in RSV F cell surface transport and fusion capacity were confirmed in the context of replication-competent virus. We showed that complete removal of glycosylation resulted in replication-incompetent virus particles. Additionally, the importance of the individual sites of the mature RSV F protein in in vivo growth was demonstrated.

EXAMPLE 2: Deletion of N-glycan 1 16 located at P27 of the respiratory syncytial virus fusion protein elicits enhanced antibody responses after DNA immunization

MATERIAL AND METHODS

Cells, virus and antibodies

BSR T7/5 and HEp-2 cell line (see example 1 ). The HEK293T cell line was obtained from the ATCC. The cells were grown in MEM supplemented with 10% iFBS. The RSV reference strain A2 was obtained from the BEI resources and propagated in HEp-2 cells. RSV cDNA-containing BAC pSynkRSV-line19F was obtained from M.L. Moore and recovered as described before to obtain strain RSV A2 L19F (Hotard et al., 2012). As RSV polyclonal antibodies goat anti-RSV (Virostat) and RSV reference antiserum BEI resources were used. RSV F-specific mAbs AM14, 101 F, D25 and MPE8 were provided by J.A. Melero (Centra Nacional de Microbiologia and CIBER de Enfermedades Respiratorias, Instituto de Salud Carlos III, Spain),, J.S. McLellan (Geisel School of Medicine at Dartmouth, USA), and B.S. Graham (Vaccine research center, NIAID, NIH, USA). Corresponding secondary antibodies were obtained from Thermo Fisher Scientific and include Alexa Fluor (AF) 555 donkey anti-goat IgG, AF488 and AF647 goat anti-human IgG, AF647 goat anti-mouse IgG and HRP-conjugated goat anti-mouse and goat anti-human IgG.

Construction and expression of recombinant RSV F proteins

The RSV F glycosylation mutants were obtained by switching the asparagine (N) residue (AAT/AAC) at position N27, N70, N1 16, N126 or N500 into a glutamine (Q) residue (CAA/CAG). A triple and penta mutant F protein was developed by replacing 3 asparagine residues (N27/N70/N500) and all 5 conserved asparagine residues (N27/70/1 16/126/500), respectively. Synthesis of the recombinant codon-optimized RSV F proteins was performed by Genscript and delivered in pUC57 simple, a commonly used plasmid for cloning. Appropriate restriction enzymes (New England Biolabs) were used to excise the DNA from the vector and subsequently the DNA was ligated into a mammalian expression vector pBUDCE4.1 (Thermo Fisher Scientific) or pCAXL (provided by X. Saelens, VIB, UGent, Belgium) by using T4 DNA ligase (New England Biolabs). The sequences of the recombinant RSV F proteins were confirmed by DNA sequencing (VIB Genetic Service Facility, University of Antwerp). The resulting plasmids were transfected in BSR T7/5 cells by using ViaFect™ Tranfection Reagent (Promega) to obtain expression of the recombinant RSV F proteins. Briefly, BSR T7/5 cells were seeded to be approximately 75% confluent at the time of transfection. A 3:1 ratio transfection reagent:plasmid DNA was used and diluted in Opti-MEM (Thermo Fisher Scientific). After 20 minutes incubation the transfection complexes were added to the cells in complete GMEM and further incubated at 37°C.

Western blot analysis

BSR T7/5 cells were seeded in T25 flasks to reach a confluency of approximately 75% at the time of transfection. Transfection of plasmid DNA with ViaFect™ Tranfection Reagent (Promega) was performed as described above. After incubation period of 24 h the cells were washed twice with ice-cold PBS following lysis with RIPA buffer (Millipore) and protease inhibitors (Roche). Cells were scraped and incubated at 4°C for 30 min and centrifuged (10.000 x g, 10 min). Lysates were mixed 1 :1 with Laemmlli sample buffer (Bio-Rad). After boiling the mixtures, the cell lysates were loaded and separated on 4-20% polyacrylamide gels (Bio-Rad) and transferred to a Immobilon-P transfer membrane (Millipore). RSV F proteins were visualized with palivizumab and HRP-conjugated goat anti-human IgG (Thermo Fisher Scientific). Chemiluminiscence was measured after incubation with a chemiluminescent substrate (Thermo Fisher Scientific) using a GenoPlex Chemi camera (VWR).

Immunofluorescence analysis of surface expression

Cells were co-transfected with plasmids expressing WT or glycomutant RSV F proteins and a GFP expressing plasmid EGFP-N3 (Clontech) as transfection control. Transfected cells on coverslips in 24-well plates were incubated with polyclonal goat serum for 1 h at 4°C. Afterwards, the cells were fixed with 4% paraformaldehyde (PF) and permeabilized with 0.5% Triton X-100. Donkey anti-goat IgG conjugated with AF555 was used to visualize surface-expressed antigen-antibody complexes by fluorescence microscopy (Leica SP8 confocal microscope).

Flow cytometric analysis

BSR T7/5 cells were seeded in 6-well plates to be subconfluent after overnight incubation at 37°C and subsequently co-transfected with plasmids expressing WT or glycomutant RSV F proteins and a GFP expressing plasmid EGFP-N3 (Clontech) like described above. After 24 h, transfected cells were resuspended in ice-cold PBS and pelleted by centrifugation (210 x g, 10 min, 4°C). The pellet was washed once with PBS and then incubated with human anti-RSV reference serum (BEI resources) or the RSV F-specific monoclonal antibodies Palivizumab (UZA, Antwerpen), D25, MPE8, AM14 and 101 F for 1 h at 4°C. To remove unbound antibodies the cells were washed two times with PBS. Then goat anti-human or goat anti-mouse AF647-conjugated secondary antibodies (Thermo Fisher Scientific) were added to the cell pellets for 1 h at 4°C, washed with PBS and analyzed by flow cytometry with a FACSCalibur. Forward-scattered light (FSC), side-scattered light, the green fluorescence (FL-1 ) and far-red fluorescence signal (FL-4) were stored for further analysis. Mean fluorescence intensity (MFI) of the N-glyocyslation deficient RSV F transfected cells was calculated relative to the MFI of the WT RSV F protein (100%).

Fusion assay

Transfection of BSR T7/5 cells was performed as described above. After 24 h incubation, the cells were analyzed by fluorescence microscopy after immunofluorescence staining of the cells with palivizumab and AF488 conjugated goat anti-human IgG. Staining of the cells with DAPI was performed to count the syncytia (cells with more than two nuclei) of 100 transfected cells. HEK293T cells were plated out at a cell density of 7.5x105 cells per well in 6 well plates. The following day 'effector' cells were transfected with 2 μg of WT or glycomutant RSV F proteins as well as 250 ng of the 1 -7 fragment of rLuc-GFP (Ishikawa et al., 2012). In separate plates, 'target' cells were transfected with 250 ng of the 8-1 1 fragment of rLuc-GFP. All transfections were executed using the TransitX transfection reagent (Mirus), as per the manufacturer's protocol for DNA plasmid transfection. Following 48 h of incubation (37°C, 5% C02), 'RSV effector' and 'target' cell populations were independently washed, resuspended in media, counted and co-cultured at a ratio of 1 :1 in white-walled 96-well plates to a final density of 1 x105 cells per well. 16-24 hours later the activity of the reconstituted Renilla luciferase in fused cells was measured (using a Promega GloMax multi-mode plate reader) by removing the media and adding 2 pg/mL of cell-permeable coelenterazine 400A (Biotium) in PBS to a final volume of 100 μΙ. Of note, control wells contained the same combination of effector and target cells; however, the effector cells in this instance were not transfected with RSV F expression constructs. Five co-culturing replicates were performed for each biological condition.

Immunization of mice with plasmid DNA and RSV challenge

Female 7-8 weeks old BALB/c mice (Janvier, France) were randomly allocated to 10 individually ventilated cages of 6 animals each. Food (Carfil, Belgium) and drinking water were available ad libitum. Mice were anesthetized with 5% isoflurane (Halocarbon®, New Jersey, USA) before they were immunized intramuscularly in both quad ceps muscle with 100 μg of Endotoxin-free plasmid DNA in total (dissolved in 100 μΙ_ 0.9% NaCI solution) at day 0 and day 21 . The 10 different treatment groups included pCAXL RSV F WT, N27Q, N70Q, N1 16Q, N126Q, N500Q, N27/500, N70/500, N27/70/1 16/126/500Q and as negative control the empty pCAXL vector. Mice were anesthetized with 5% isoflurane before serum was collected via retro-orbital bleeding at day 0, day 21 , day 35 and day 56.

RSV challenge was performed by intranasal inoculation of 106 PFU diluted in 100 μΙ_ HBSS. Five days post challenge (day 61 ), serum was collected before mice were sacrificed by C02 and lungs were removed. The left lung was homogenized in HBSS for the determination of RSV RNA levels (see below) while the right lung was fixed by formaldehyde (PF) for the preparation of paraffin slides (see below). The animal studies were approved by the Animal Ethical Committee of the University of Antwerp (UA-ECD 2015-63).

Antibody responses and neutralization assay

See example 1 : Antibody responses and neutralization assay

Determination of lung viral titer by qRT-PCR

To determine the lung RSV load by qRT-PCR, left lungs were excised and total RNA from the cleared lung homogenates was prepared by using the High Pure RNA tissue Kit (Roche) according to the manufacturer's instructions. Next, cDNA was prepared by the use of random hexamer primers and the Transcriptor First strand cDNA synthesis kit (Roche). The relative levels of genomic RSV M cDNA were determined by qRT-PCR using primers specific for the RSV A2 M gene (5TCACGAAGGCTCCACATACA3' - SEQ ID N° 15 and 5'GCAGGGTCATCGTCTTTTTC3' - SEQ ID N° 16) and a nucleotide probe (#150 Universal Probe Library, Roche) labeled with fluorescein (FAM) at the 5'-end and with a dark quencher dye near the 3'- end.

Immunohistochemistry

Right lungs were excised, fixed in 10% paraformaldehyde and paraffin embedded. Sections of 5 μΜ thickness were stained with goat anti-RSV IgG (Virostat) and using a Vectastain ABC kit (Vector Laboratories) to detect RSV antigens in the lung.

Statistical analysis

Data are presented as means (±SD) of three independent repeats and were analyzed by a one-or two-tailed student's t-test using GraphPad Prism 6. P values <0.05 were considered statistically significant.

RESULTS

Expression analysis of the RSV F glycomutants and the effect of deglycosylation on RSV F-specific mAb recognition

Deletion of a specific N-glycan of the RSV F protein was obtained by the substitution of the N residue into a Q residue. Since RSV F possesses 5 conserved N-glycosylation sites, 5 distinct mutated sequences of RSV F were made (F N27Q, F N70Q, F N1 16Q, F N126Q, F N500Q). Additionally, a mutant sequence without the N-glycans of the mature protein (F N27-70-500Q) and all conserved sites (F N27-70-1 16-126-500Q) were included. After subcloning the sequences into a mammalian expression plasmid pCAXL, DNA sequencing verified the presence of the substitutions at the distinct positions. Transient expression of the RSV F proteins was obtained after transfection of the plasmids into BSR T7/5 cells, BHK cells stably expressing T7 RNA polymerase (Buchholz et al., 1999). Protein glycosylation is dependent of the host cell type with the consequence that variation exists between glycan structures of different cell types. In this study, analyzing the impact of complete deletion of a RSV F N-glycan, this variability is of minor importance. Indirect immunofluorescence staining showed expression of all RSV F constructs in BSR T7/5 cells (data not shown).

To evaluate the impact of deglycosylation (or removal of an N-glycosylation site) on RSV F surface expression, fluorescence intensities of transfected BSR T7/5 were measured after staining surface RSV F proteins with human anti-RSV serum. Cells were co-transfected with a GFP-expressing plasmid which served as a marker of transfected cells. Confirmation by immunofluorescence staining was performed and co-expression was observed for the majority of the transfected cells (data not shown). In addition, intracellular staining of the glycomutant RSV F proteins ruled out the influence of a reduced binding capacity due to deglycosylation (data not shown). Flow cytometry analysis showed surface expression of all mutant RSV F proteins. However, significant reductions were observed for mutations N70Q, N500Q, N27-70-500Q and N27-70-1 16-126-500Q (Figure 6). The latter two in particular showed low surface intensities compared to the parental protein.

Additionally, the influence of RSV F glycosylation on the recognition of well-described RSV F-specific mAbs was studied (McLellan et al., 2013; Johnson et al., 1997; Corti et al., 2013; Gilman et al., 2015; McLellan et al., 2010). Deletion of N-glycans could improve or decrease recognition of the neutralizing epitopes. Instead of human RSV antiserum, the surface of co-transfected cells was stained with the mAbs and further analyzed by flow cytometry (Figure 7). The MFI of the mutant F proteins was expressed relative to the MFI of WT F expression (100%). The significant reductions observed here correspond with the reductions in surface expression displayed in Fig. 6 suggesting that RSV F glycosylation has no influence on the recognition of these epitopes. However, mutation of site N500Q, the unique site of the F1 subunit, resulted in lower recognition of all the mAbs.

Depending on the extent of the glycan, protein deglycosylation can reduce their molecular weight. Gel electrophoresis of lysed transfected cells under non-reduced conditions was performed to separate the glycomutants by molecular weight. Staining of the membrane after protein transfer with palivizumab and HRP-conjugated anti-human IgG resulted in visualization of disulphide-linked RSV F proteins where the parental protein shows a molecular weight of ±70 kDA (data not shown). The molecular weight of mutants RSV F N27Q and N500Q was clearly reduced whereas the reduction of mutant F N70Q was less clear, suggesting variable sizes of N-glycans at the different positions. Deletion of N-glycans at positions N1 16 and N126 did not resulted in a lower molecular weight. Due to low expression levels of the partial and fully deglycosylated RSV F proteins, it was not possible to visualize these bands on the blot.

RSV F fusion activity is determined by the N-glycan at position N500

Previous observations about the role of glycosylation in the fusion capacity of the RSV F protein were confirmed in our study by two different assays (Zimmer et al., 2001 ; Li et al., 2007). Twenty-four hours after transfection of BSR T7/5 cells, syncytia formation has occurred and was visualized by immunofluorescence staining of the RSV F protein as well as staining of the nuclei with DAPI (data not shown). Fused cells were considered a syncytium when containing more than 2 nuclei. Large syncytia with a mean of 5 nuclei or more were developed, except for cells transfected with RSV F plasmids containing mutation N500Q (Fig. 8). No cells with more than two nuclei were observed for these plasmids.

Secondly, a dual split protein assay was performed to measure the fusion capacity of the recombinant RSV F proteins compared with the WT RSV F proteins. This assay is highly sensitive and was already widely used to study the impact of specific mutations of viral glycoproteins on their fusion activity. Cells transfected with the RSV F plasmids and the 1 -7 fragment of rLuc-GFP were co-cultured with target cells transfected with the 8-1 1 fragment of rLuc-GFP to initiate fusion. The fusion activity was expressed as the activity of the reconstituted Renilla luciferase (Fig. 9). Similar results were obtained, only the mutants lacking the N500 glycan showed a reduced or no luciferase activity, further confirming the importance of this glycan for in vitro fusion activity of RSV F. Between the parental protein and the other glycomutants, no remarkable differences could be observed.

Enhanced antibody responses after DNA immunization with N116Q

For multiple viruses, removal of N-glycans of viral proteins was shown to enhance humoral immunity after DNA immunization. Since the RSV F protein is known as the most important target of neutralizing antibodies responses and therefore the major focus of vaccine development, the impact of deglycosylation (or removal of an N-glycosylation site) of individual RSV F glycosylation sites on antibody elicitation was characterized in more detail. Therefore 6-7 weeks old female BALB/c mice were intramuscular immunized with plasmid DNA encoding glycomutant RSV F proteins. Two consecutive immunizations were done with an interval of three weeks. Serum was collected to follow up the antibody titers as well as the neutralizing antibody titers (Figure 10A-B). In general, all F constructs induced antibodies, and antibody titers increased after a second boost immunization (data not shown). Significantly lower antibody titers compared to pCAXL F WT were observed after immunization with plasmid DNA encoding fully deglycosylated RSV F proteins (pCAXL F N27-70-1 16-126-500Q). For the other glycomutants, no remarkable differences in mean antibody titers were observed. Interestingly, PRNA showed significant lower neutralizing antibody titers for pCAXL F N27-70-1 16-126-500Q but also for pCAXL N70Q.

RSV challenge of immunized mice

The efficacy of neutralizing antibody responses to clear viral infection and provide protection was evaluated by determination of the lung viral load after RSV challenge. Based on the previous findings, mice immunized with plasmids which elicited higher (F N1 16Q) or remarkably lower (F N70Q) neutralizing titers and two control groups (F WT and pCAXL) were challenged with RSV A2L19F by intranasal inoculation five weeks after boost immunization. Antibody titers were determined before and after RSV challenge. Based on the antibody titers before challenge, no distinction could be made between the different groups (Figure 11 A). In contrast, the neutralizing antibody titers elicited by F N70Q were beneath the detection limit before challenge (Figure 11 B). Higher neutralizing capacity was observed for a antibodies elicited after F WT and F N1 16Q immunization with high and low varying levels respectively. Five days post-challenge antibody titers as well as neutralizing titers increased, in particular in mice immunized with F N1 16Q (Figure 11 C-D). Significant higher neutralizing titers were observed compared to F WT immunized mice. F N70Q neutralizing titers also increased after challenge, indicating some extent of priming after immunization, but remained generally lower.

To which extent DNA immunization with vectors encoding the RSV F protein is able to clear lung viral infection in mice and how this is influenced by N-glycosylation of the protein, viral RNA loads were relatively quantified by RT-qPCR. The presence of neutralizing antibodies in the lungs of the mice made it not possible to determine viral titers in lung homogenates by a traditional viral plaque assay. Overall, RSV RNA levels were remarkably reduced compared with mice immunized with an empty plasmid (Figure 12). The lowest levels were observed for F N1 16Q, corresponding the high serum neutralizing antibody titers in this group. Interestingly, despite the low neutralizing titers of N70Q, lower levels of RSV RNA were observed here compared with F WT.

Immunohistochemical staining of lung tissue for RSV antigens showed representative images of lung RSV loads (data not shown). Overall, a good correlation was observed between the viral RNA levels in the infected lungs and the presence of RSV antigens in the fixed lungs.

DISCUSSION

Extensive research already showed the importance of glycosylation in the biology and function of a large number of viral proteins. Due to its ability to promote survival and virulence by modulation of virus infectivity and pathogenicity and by interference with antiviral immune responses, glycosylation has become an area of growing interest. Since the N-glycosylation sites of RSV F are highly conserved, a determinant role in the structure or functionality of the protein is very likely as well as in the antigenicity of the protein. The sites are well-identified and certain characteristics were described but gaps remain in the knowledge about hRSV F glycosylation, in particular in its relation to RSV F immunogenicity. Since the protein is the major antigenic target for RSV vaccine development this might be of importance.

In order to characterize the RSV F glycosylation at protein level, deglycosylation (or removal of an N-glycosylation site) was performed by substitution of the N residue into a Q residue at the 5 potential N-glycosylation sites of the RSV F protein of strain L19 that are conserved among RSV isolates (Moore et al., 2009). The presence of N-glycans at positions N27, N70 and N500 was demonstrated by Western blot analysis since a reduction in molecularweight was observed. No differences in molecular weight were observed for mutants N1 16Q and N126Q according to previous observations and due to their absence on the mature RSV F protein (Zimmer et al., 2001 ). Previous studies suggested no role of glycosylation in RSV F cell surface transport (Zimmer et al., 2001 ). It was presumed that cleavage might be required for surface expression and that glycosylation only facilitates cleavage through generation of a more stabilized

conformation of F0. In our study, immunofluorescent staining showed surface staining for all glycomutants but intensity levels were reduced for N70Q and especially for N27-70-500Q and N27-70-1 16-126-500Q. Reductions were verified by semi-quantitative FCM analysis of surface expression. However, it cannot be excluded that this effect is due to subsequent inadequate cleavage rather than deglycosylation itself and remains to be studied.

The glycosylation role in RSV F fusion activity was already shown by Zimmer et al., 2001 . In this study a more sensitive assay was used based on the reconstitution of Renilla luciferase after fusion of RSV F transfected cells beside scoring the syncytia formation after transfection. Both assays confirmed a determinant role of the glycan at position N500 in RSV F fusion while the others seemed to be unimportant for its fusion activity (Zimmer et al., 2001 ). It was hypothesized that the position of N500 within the heptad repeat region could explain the importance for efficient fusion or alternatively, N500 could be involved in the conformational reorganization from prefusion to postfusion conformation that takes place during the fusion process.

Further characterization of the RSV F glycomutants was performed by studying the influence of glycosylation in the recognition of a panel of mAbs directed against well-defined epitopes of the RSV F protein. Deletion of N-glycans can result in improved recognition by making the epitopes more accessible or alternatively, influence recognition negatively by modifying the protein conformation. After normalization with the surface expression levels determined by a RSV-specific pAb, no remarkable differences in mAb recognition were observed, indicating that the neutralizing epitopes of these mAbs not rely on glycosylation.

How glycosylation can affect the immunogenicity of a viral protein is well-studied for numerous viruses. To our knowledge, this is the first report studying the impact of deglycosylation of hRSV F proteins on antibody responses by immunization of BALB/c mice with plasmids encoding RSV F glycomutants. Previous research already showed the potential of RSV F DNA immunization in mice to induce in vitro neutralizing antibody responses which was also obtained in our approach using codon-optimized RSV F sequences. Based on the antibody titers after two subsequent immunizations, a role of N-glycosylation at position N70 in the induction of humoral responses could be suggested. Total deglycosylation of RSV F induced low antibody titers with almost no neutralizing activity which might be due to lower expression levels.

RT-qPCR of lung viral RNA after RSV challenge showed partial clearance of pulmonary RSV in mice immunized with plasmids encoding the RSV F protein compared with lung RNA levels after immunization with an empty vector due to priming of higher neutralizing antibody responses compared to titers induced by natural infection. Unexpectedly, higher titers and more efficient clearance were obtained by N1 16Q immunization, a N-glycan located at p27 and absent on the mature RSV F protein. Removal of N-glycans can result in unmasking of neutralizing epitopes which was demonstrated for the highly glycosylated HIV Env protein and the HCV envelope protein. Alternatively, since N-glycosylation is known as an important determinant for proper folding and processing of glycoproteins, deglycosylation can result in conformational changes and affect the accessibility of the neutralizing epitopes of the protein. Krarup et al. (2015) suggested a potential role of p27 in ensuring proper trimer formation. According to this hypothesis, deglycosylation of this peptide may influence trimerization whereby conformational changes could result in exposure of neutralizing epitopes.

Nearly the same level of protection was acquired for the F WT and F N70Q immunized groups, despite the poorly neutralizing titers of the latter group. This can be due to the requirement of a minimum of neutralizing activity, elicited by N70Q, to provide this level of protection. On the other hand, this might be a consequence of other antibody mechanisms or immune responses that were induced after immunization and potentially upregulated after deglycosylation. High antibody titers were elicited after N70Q immunization suggesting a potential role of antibody-effector mechanisms such as antibody-dependent cell-mediated cytotoxicity (ADCC). Recently, RSV G-specific antibodies were identified in human serum whose in vitro neutralization is mediated by this mechanism. Here we analyzed only neutralizing antibody responses, but viral N-glycosylation can also affect the efficacy of cytotoxic T-cell (CTL) responses. Proteolysis to form peptides or glycopeptides and recognition of T cell receptors by MHC molecules can be affected by glycans positioned near proteolytic sites. Additionally, previous immunization experiments showed upregulation of Th1 cell responses after immunization of mice with a full-length RSV F DNA vaccine.

Extensive research to develop a safe and immunogenic RSV vaccine is carried out since many years. Plasmid DNA and gene-based vaccines have the advantage to induce humoral and cellular immune responses, which are both important to provide protection against severe RSV infections. DNA immunization is a promising vaccine approach with high stability levels and is easy for large-scale production. Nevertheless, poor immunogenicity remains a major struggle in their development as well as the safety and regulatory issues. For RSV, numerous gene-based vaccines are currently in preclinical development and a couple candidates are in clinical phase I and II. Therefore, it might be more promising to evaluate our findings regarding the role of glycosylation in RSV F immunogenicity in gene-based vectors. Also in the context of other vaccine approaches such as RSV F based subunit vaccines and LAVs, our findings could be potentially an added value but requires more extensive research with soluble RSV F proteins and RSV infectious clones respectively.

In conclusion, our study showed enhanced antibody responses after deletion of N-glycan

N1 16 located at p27 in the context of DNA immunization in BALB/c mice. Surprisingly, this glycan is not present on the mature RSV F protein and deglycosylation may impact the conformation of the protein before cleavage. Further research is needed to uncover the mechanism through which deletion of N1 16 results in enhanced exposure or potentially unmasking of epitopes and how this mutation could be implemented in potential vaccine candidates.

EXAMPLE 3:

Material and methods

Immunization of mice with recombinant RSV

Female 7-8 weeks old BALB/c mice (Janvier, France) were randomly allocated to 10 individually ventilated cages of 6 animals each. Food (Carfil, Belgium) and drinking water were available ad libitum. Mice were anesthetized with 5% isoflurane (Halocarbon®, New Jersey, USA) before they were immunized with recombinant RSV by intranasal inoculation (106 PFU diluted in 100 pL HBSS). The 6 different treatment groups included RSV F WT, F N27Q, F N70Q, F N1 16Q, F N126Q and F N500Q. RSV challenge was performed in all mice by intranasal inoculation RSV F WT (106 PFU diluted in 100 μΙ_ HBSS). Mice were anesthetized with 5% isoflurane before serum was collected via retro-orbital bleeding at day 0, day 21 and day 35. Five days post challenge (day 40), serum was collected before mice were sacrificed by C02 and lungs were removed. The animal studies were approved by the Animal Ethical Committee of the University of Antwerp (UA-ECD 2015-63).

Antibody responses and neutralization assay

See example 1 : Antibody responses and neutralization assay

Results

The effect of the removal of specific N-glycosylation sites on the induction of neutralizing antibody responses was studied by immunization of BALB/c mice with RSV expressing one of the five glycomutant F proteins (F N27Q, F N70Q, F N1 16Q, F N126Q, F N500Q) or the wild-type protein. Three weeks post immunization, before and after challenge, serum was collected and total and neutralizing antibodies were determined (Fig. 14). Immunization with RSV F N1 16Q induced significantly higher neutralizing antibody titers before challenge compared to immunization with RSV F WT, indicating a beneficial effect of the F N1 16Q mutation in the induction of neutralizing antibodies in the context of infectious virus. Five weeks post immunization, the mice were challenged with WT virus and euthanized 5 days post challenge.

EXAMPLE 4

Material and methods

Construction and expression of recombinant RSV proteins

Single or multiple RSV F glycosylation mutants were obtained by switching the asparagine (N) residue (AAT/AAC) at position N27, N70, N 1 16, N 120, N 126 or N500 into a glutamine (Q) residue (CAA/CAG). Synthesis of the recombinant codon-optimized RSV F proteins was performed by Genscript and delivered in pUC57 simple, a commonly used plasmid for cloning. Approp ate restriction enzymes (New England Biolabs) were used to excise the DNA from the vector and subsequently the DNA was ligated into a mammalian expression vector pBUDCE4.1 (Thermo Fisher Scientific) or pCAXL (provided by X. Saelens, VIB, UGent, Belgium) by using T4 DNA ligase (New England Biolabs). The sequences of the recombinant RSV F proteins were confirmed by DNA sequencing (VIB Genetic Service Facility, University of Antwerp). The resulting plasmids were transfected in BSR T7/5 cells by using ViaFectTM Tranfection Reagent (Promega) to obtain expression of the recombinant RSV F proteins. Briefly, BSR T7/5 cells were seeded to be approximately 75% confluent at the time of transfection. A 3:1 ratio transfection reagent:plasmid DNA was used and diluted in Opti-MEM (Thermo Fisher Scientific). After 20 minutes incubation the transfection complexes were added to the cells in complete GMEM and further incubated at 37°C.

Immunization of mice with plasmid DNA and RSV challenge

See example 2: Immunization of mice with plasmid DNA and RSV challenge

Antibody responses and neutralization assay

See example 1 : Antibody responses and neutralization assay

Determination of lung viral titer by qRT-PCR

See example 2: Determination of lung viral titer by qRT-PCR

Results The DNA immunization expe ment was repeated with the F N 1 16Q DNA construct together with different single, double and triple RSV F p27 glycomutant constructs. Here, we confirmed the enhanced neutralizing antibody response upon immunization with F N 1 16Q DNA compared to WT DNA immunization (Fig. 15). Additionally, DNA immunization with the p27 glycomutants, F N 120Q and F N 120-126Q, also showed higher antibody responses. The level of protection against RSV challenge was studied by quantification of the lung RSV RNA levels by qPCR. A higher protection level after F N 1 16Q DNA immunization compared to F WT DNA immunization was confirmed (Fig . 16). Immunization with F N 120Q.F N 1 16-126Q DNA and F N 120-126Q also resulted in lower lung RSV RNA levels compared to F WT DNA immunization.

REFERENCES

Buchholz, U.J., S. Finke, and K.K. Conzelmann, Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J Virol, 1999. 73(1 ): p. 251 -9.

Corti, D., et al., Cross-neutralization of four paramyxoviruses by a human monoclonal antibody. Nature, 2013. 501 (7467): p. 439-43.

Gilman, M.S., et al., Characterization of a Prefusion-Specific Antibody That Recognizes a Quaternary, Cleavage-Dependent Epitope on the RSV Fusion Glycoprotein. PLoS Pathog, 2015. 11 (7): p. e1005035.

Hotard, A.L., et al., A stabilized respiratory syncytial virus reverse genetics system amenable to recombination-mediated mutagenesis. Virology, 2012. 434(1 ): p. 129-36.

Ishikawa, H., et al., Generation of a dual-functional split-reporter protein for monitoring membrane fusion using self-associating split GFP. Protein Eng Des Sel, 2012. 25(12): p. 813-20.

Krarup, A., et al., A highly stable prefusion RSV F vaccine derived from structural analysis of the fusion mechanism. Nat Commun, 2015. 6: p. 8143.

Leemans, A., et al., Antibody-Induced Internalization of the Human Respiratory Syncytial Virus Fusion Protein. J Virol, 2017. 91 (14).

Li, P., et al., Functional analysis of the N-linked glycans within the fusion protein of respiratory syncytial virus. Methods Mol Biol, 2007. 379: p. 69-83.

Johnson, S., et al., Development of a humanized monoclonal antibody (MEDI-493) with potent in vitro and in vivo activity against respiratory syncytial virus. J Infect Dis, 1997. 176(5): p. 1215-24.

McLellan, J.S., et al., Structure of a major antigenic site on the respiratory syncytial virus fusion glycoprotein in complex with neutralizing antibody 101 F. J Virol, 2010. 84(23): p. 12236-44.

McLellan, J.S., et al., Structure of RSV fusion glycoprotein trimer bound to a prefusion-specific neutralizing antibody. Science, 2013. 340(6136): p. 1 1 13-7.

Moore, M.L., et al., A chimeric A2 strain of respiratory syncytial virus (RSV) with the fusion protein of RSV strain line 19 exhibits enhanced viral load, mucus, and airway dysfunction. J Virol, 2009. 83(9): p. 4185-94.

Schepens, B., et al., Protection and mechanism of action of a novel human respiratory syncytial virus vaccine candidate based on the extracellular domain of small hydrophobic protein. EMBO Mol Med, 2014. 6(1 1 ): p. 1436-54.

Schindelin, J., et al., Fiji: an open-source platform for biological-image analysis. Nat Methods, 2012. 9(7): p. 676-82.

Zimmer, G., I. Trotz, and G. Herrler, N-glycans of F protein differentially affect fusion activity of human respiratory syncytial virus. J Virol, 2001 . 75(10): p. 4744-51 .