Certains contenus de cette application ne sont pas disponibles pour le moment.
Si cette situation persiste, veuillez nous contacter àObservations et contact
1. (WO2018160024) DÉRIVÉ DE PIPÉRIDINE-ARYLE OU SEL PHARMACEUTIQUEMENT ACCEPTABLE DE CELUI-CI, SON PROCÉDÉ DE PRÉPARATION ET COMPOSITION PHARMACEUTIQUE CONTENANT CELUI-CI EN TANT QUE PRINCIPE ACTIF
Document

명세서

발명의 명칭

기술분야

1   2  

배경기술

3   4   5   6   7   8   9   10   11   12  

발명의 상세한 설명

기술적 과제

13   14  

과제 해결 수단

15   16   17   18  

발명의 효과

19   20  

발명의 실시를 위한 최선의 형태

21   22   23   24   25   26   27   28   29   30   31   32   33   34   35   36   37   38   39   40   41   42   43   44   45  

발명의 실시를 위한 형태

46   47   48   49   50   51   52   53   54   55   56   57   58   59   60   61   62   63   64   65   66   67   68   69   70   71   72   73   74   75   76   77   78   79   80   81   82   83   84   85   86   87   88   89   90   91   92   93   94   95   96   97   98   99   100   101   102   103   104   105   106   107   108   109   110   111   112   113   114   115   116   117   118   119   120   121   122   123   124   125   126   127   128   129   130   131   132   133   134   135   136   137   138   139   140   141   142   143   144   145   146   147   148   149   150   151   152   153   154   155   156   157   158   159   160   161   162   163   164   165   166   167   168   169   170   171   172   173   174   175   176   177   178   179   180   181   182   183   184   185   186   187   188   189   190   191   192   193   194   195   196   197   198   199   200   201   202   203   204   205   206   207   208   209   210   211   212   213   214   215   216   217   218   219   220   221   222   223   224   225   226   227   228   229   230   231   232   233   234   235   236   237   238   239   240   241   242   243   244   245   246   247   248   249   250   251   252   253   254   255   256   257   258   259   260   261   262   263   264   265   266   267   268   269   270   271   272   273   274   275   276   277   278   279   280   281   282   283   284   285   286   287   288   289   290   291   292   293   294   295   296   297   298   299   300   301   302   303   304   305   306   307   308   309   310   311   312   313   314   315   316   317   318   319   320   321   322   323   324   325   326   327   328   329   330   331   332   333   334   335   336   337   338   339   340   341   342   343   344   345   346   347   348   349   350   351   352   353   354   355   356   357   358   359   360   361   362   363   364   365   366   367   368   369   370   371   372   373   374   375   376   377   378   379   380   381   382   383   384   385   386   387   388   389   390   391   392   393   394   395   396   397   398   399   400   401   402   403   404   405   406   407   408   409   410   411   412   413   414   415   416   417   418   419   420   421   422   423   424   425   426   427   428   429   430   431   432   433   434   435   436   437   438   439   440   441   442   443   444   445   446   447   448   449   450   451   452   453   454   455   456   457   458   459   460   461   462   463   464   465   466   467   468   469   470   471   472   473   474   475   476   477   478   479   480   481   482   483   484   485   486   487   488   489   490   491   492   493   494   495   496   497   498   499   500   501   502   503   504   505   506   507   508   509   510   511   512   513   514   515   516   517   518   519   520   521   522   523   524   525   526   527   528   529   530   531   532   533   534   535   536   537   538   539   540   541   542   543   544   545   546   547   548   549   550   551   552   553   554   555   556   557   558   559   560   561   562   563   564   565   566   567   568   569   570   571   572   573   574   575   576   577   578   579   580   581   582   583   584   585   586   587   588   589   590   591   592   593   594   595   596   597   598   599   600   601   602   603   604   605   606   607   608   609   610   611   612   613   614   615   616   617   618   619   620   621   622   623   624   625   626   627   628   629   630   631   632   633   634   635   636   637   638   639   640   641   642   643   644   645   646   647   648   649   650   651   652   653   654   655   656   657   658   659   660   661   662   663   664   665   666   667   668   669   670   671   672   673   674   675   676   677   678   679   680   681   682   683   684   685   686   687   688   689   690   691   692   693   694   695   696   697   698   699   700   701   702   703   704   705   706   707   708   709   710   711   712   713   714   715   716   717   718   719   720   721   722   723   724   725   726   727   728   729   730   731   732   733   734   735   736   737   738   739   740   741   742   743   744   745   746   747   748   749   750   751   752   753   754   755   756   757   758   759   760   761   762   763  

청구범위

1   2   3   4   5   6   7   8   9   10  

명세서

발명의 명칭 : 피페리딘-아릴 유도체 또는 이의 약학적으로 허용 가능한 염, 이의 제조방법, 및 이를 유효성분으로 함유하는 약제학적 조성물

기술분야

[1]
본 발명은 G 단백질 결합 수용체(Gprotein-coupled receptor 119, 이하 'GPR119'라 함) 항진 활성을 가지는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염; 이의 제조방법; 및 이를 유효성분으로 함유하는 약제학적 조성물에 관한 것이다.
[2]

배경기술

[3]
당뇨(diabetes mellitus)는 췌장(이자, pancreas)이 인슐린(insulin)을 거의 또는 전혀 분비하지 않거나 신체가 분비된 인슐린을 효과적으로 이용하지 못하는 만성질환으로서 높은 수치의 혈당(blood glucose)을 보이는 고혈당증(hyperglycemia)을 나타내며, 심혈관 질환(cardiovascular disorders), 실명(blindness), 및 신부전(renal failure)을 포함하는 심각한 합병증을 유발할 수 있다. 세계적으로 1억 8천만 명으로 추정되는 당뇨 환자 수는 2030년까지 두 배로 증가할 것으로 예상되며, 그 중 대략 90-95% 정도가 제2형 당뇨(type 2 diabetes) 환자이다. 제2형 당뇨는 주로 간에서의 당 과다생산(hepatic glucose overproduction), 인슐린 저항성(insulin resistance), 및 인슐린을 분비하는 췌장의 베타 세포의 장애(pancreatic β-cell dysfunction)로 인한 인슐린 분비의 감소 과정을 통해 발병한다.
[4]
제2형 당뇨를 치료하기 위한 대표적인 방법으로는 식이요법 및 운동요법과 같은 비약물 요법이 있고, 상기 비약물 요법을 제외한 약물치료법(pharmacological therapy)으로 크게 분류된다. 약물치료법은 보통 식이요법과 운동요법과 같은 비약물요법으로 당 조절 목표가 실현되지 않을 때 시작되며, 광범위하게 처방되는 경구용 약물은 약물의 작용기전과 구조적 특징에 따라 분류될 수 있으며 각기 한계와 잠재적 위험성을 보이는 것으로 보고되고 있다.
[5]
메트포르민(metformin)은 바이구아나이드(biguanide) 계열 약물로서 주로 간에서의 당 과다생산 억제 및 인슐린 저항성 감소를 통해 작용하며 일반적으로 부작용이 없으나 잠재적 부작용으로서 유산산증(lactic acidosis)이 유도될 수 있는 것으로 보고되고 있다. 싸이아졸리딘디온(thiazolidinedione) 계열 약물은 PPARγ 항진제로서 로지글리타존(rosiglitazone)과 피오글리타존(pioglitazone)을 포함하는데 인슐린 민감성(insulin sensitization) 향상을 통해 작용하며 부종(edema). 체중증가(weight gain), 간독성(hepatotoxicity), 및 심부전(heart failure)과 같은 부작용을 보이는 것으로 보고되고 있다. 설포닐유레아(sulfonylurea) 계열 약물은 췌장의 베타세포의 인슐린 분비를 촉진하는데 당-비의존적(glucose-independent) 방식으로 작용하므로 저혈당(hypoglycemia)를 유발하며, 체중증가의 원인이 될 수도 있다. 메글리티나이드(meglitinide) 계열 약물 또한 설포닐유레아 계열 약물과 유사한 작용 기전 및 부작용을 가진다. 알파-글루코시데이즈 억제제(α-glucosidase inhibitor)는 식후 당 급등 억제를 위해 사용되는데 장관에서의 부작용이 나타난다. 인슐린 및 인슐린 유사체는 보통 경구용 약물과 복합요법으로 사용되는데 저혈당 및 체중증가 유도와 같은 부작용과 주사제로서의 한계를 가진다.
[6]
최근에는 앞선 제2형 당뇨에 대한 약물치료법과 관련한 저혈당 및 체중증가 문제를 해결하기 위하여 당-의존적(glucose-dependent) 방식으로 인슐린 분비를 증가할 수 있는 약물 개발에 많은 노력이 경주되고 있다.
[7]
엑세나티드(exenatide)와 같은 GLP-1 수용체 항진제(glucagon-like peptide 1 receptor agonist)는 디펩티딜 펩티데이즈-IV(dipeptidyl peptidase-IV, DPP-IV)에 의해 빠르게 분해되는 GLP-1을 모방한 유사체(GLP-1 mimetics)로서, DPP-IV에 의해 빠르게 분해되지 않으면서 당-의존적 인슐린 분비를 촉진하고 글루카곤(glucagon) 분비, 위 배출(gastrc emptying), 및 식욕을 억제하며, 베타세포 보호효과를 보이는 GLP-1의 효과를 나타내는 약물이다. 따라서 저혈당을 유발하지 않으며 체중감소 효과를 보이고 HbA1c 저하 효과를 보이나 장관 부작용과 췌장염(pancreatitis)과 같은 부작용 및 주사제로서의 한계를 지닌다. 한편으로, 시타글립틴(sitagliptin)과 빌다글립틴(vildagliptin)과 같은 DPP-IV 억제제(DPP-IV inhibitor)는 경구용 약물로서 GLP-1의 분해를 억제함으로서 작용하며 GLP-1 수용체 항진제와 유사한 HbA1c 저하 효과를 보이나 체중감소 효과는 관찰되지 않는다.
[8]
GPR119는 췌장섬의 베타 세포 및 위장관에서 발현되는 335개의 아미노산으로 구성된 단백질이다. 상기 단백질은 G-단백질에 커플링된 수용체 패밀리에 속하고, 올레오일에탄올아마이드(OEA), N-올레오일도파민 및 올바닐(olvanil)을 포함하는 몇몇 후보물질들은 내재성 리간드로서 제안되었다.
[9]
GPR119는 인슐린의 당-의존성 분비에 있어서 일정한 역할을 수행하고, 당뇨병의 치료를 위한 GPR119 수용체의 표적화가능성은 세포주 및 동물에서의 다수의 연구에 의해 지지된다. 라이소포스파티딜콜린에 의한 GPR119 수용체의 활성화는 마우스 췌장 베타 세포주에서 당-의존성 인슐린 분비를 상승시키고, 이 인슐린 분비는 GPR119-특이적 siRNA를 사용하여 차단할 수 있다.
[10]
따라서, 당뇨병과 같은 질환의 치료를 위한 GPR119 수용체의 활성화제가 필요하다.
[11]
이러한 맥락에서 GPR119는 제2형 당뇨치료제 개발을 위한 유망한 표적으로서 주요제약회사들의 집중적인 연구개발 대상이 되고 있다. 성인의 인체에서 GPR119는 주로 췌장과 장관에서 주로 발현되어 있으며, GLP-1 수용체와 유사하게 췌장의 베타세포에서 활성화시 당-의존적 인슐린 분비를 증가시키고 장관의 GLP-1 및/또는 GIP(glucose-dependent insulinotropic peptide) 분비 세포에서 활성화시 해당 인크레틴(incretin)의 분비를 증가시키는 것으로 알려져 있고, 펩타이드를 리간드로 하는 GLP-1 수용체와는 달리 GPR119는 강하고(potent) 선택적(selective)이지는 않지만 지질(lipid)을 리간드로 하므로 경구용 항진제를 발굴하고 개발하기에 비교적 용이한 작용점으로 간주된다. 따라서, GPR119는 GLP-1 수용체 항진제의 효능을 경구용 약물로서 구현할 수 있는 가능성을 지닌 작용점으로서 2006년 초 GPR119 항진제로서 APD-668 화합물(Ortho-McNeil, Arena)이 처음으로 임상 I상에 진입한 이래 APD-597 화합물(Ortho-McNeil, Arena), PSN-821 화합물(OSI), MBX-2982 화합물(Sanofi-Aventis, Metabolex), 및 GSK-1292263A 화합물(GSK)과 같은 GPR119 항진제들이 임상에 진입하였으며, 현재는 PSN-821 화합물(OSI), MBX-2982 화합물(Sanofi-Aventis, Metabolex), 및 GSK-1292263A 화합물(GSK)들이 임상 II상에 진입한 상태이다[Thomson Reuters Integrity].
[12]

발명의 상세한 설명

기술적 과제

[13]
본 발명자들은 효능과 안전성이 보장되는 제 2형 당뇨치료제 개발을 위한 노력을 통해, GPR119 항진 활성을 가지는 신규한 피페리딘-아릴 유도체 및 이의 약제학적으로 허용 가능한 염을 제조하고, 그를 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환 치료제를 제공함으로써, 본 발명을 완성하였다.
[14]

과제 해결 수단

[15]
본 발명의 목적은 GPR119 항진 활성을 가지는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공하는 것이다.
[16]
본 발명의 다른 목적은 상기 피페리딘-아릴 유도체의 제조방법을 제공하는 것이다.
[17]
본 발명의 또 다른 목적은 상기 피페리딘-아릴 유도체 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
[18]

발명의 효과

[19]
본 발명의 피페리딘-아릴 유도체는 신규한 화합물로서, 우수한 GPR119 항진 활성을 가지고 있으므로, GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨병성 합병증에 대한 효율적인 예방 및 치료제로 부작용없이 유용하게 사용할 수 있다.
[20]

발명의 실시를 위한 최선의 형태

[21]
상기 목적을 달성하기 위하여, 본 발명은 우수한 GPR119 항진 활성을 가지는 신규한 화합물로서, 하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공한다:
[22]
[화학식 1]
[23]
[24]
상기 화학식 1에서,
[25]
R 1은 수소 또는 (C 1-C 10)알킬이고;
[26]
X는 이고;
[27]
R 2는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[28]
R 3은 (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[29]
A 고리는 이고;
[30]
R 4 내지 R 8은 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고;
[31]
Z는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고;
[32]
L은 단일결합, -O-(CR'R") n-, -(CR'R") n-O- 또는 NR 9-(CR'R") n-이고;
[33]
R 9는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[34]
R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고;
[35]
n은 0 또는 1의 정수이고;
[36]
W는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고;
[37]
단, Z, L 및 W는 동시에 단일결합이 아니고;
[38]
Y는 (C 1-C 10)알킬카보닐, (C 1-C 10)알콕시카보닐, (C 3-C 7)사이클로알킬카보닐, (C 3-C 7)사이클로알콕시카보닐, (C 3-C 20)헤테로아릴, (C 3-C 20)헤테로아릴카보닐, SO 2R 10, (C 6-C 20)아릴, (C 6-C 20)아릴카보닐 또는 이고;
[39]
R 10은 (C 1-C 10)알킬, (C 3-C 7)사이클로알킬 또는 (C 6-C 20)아릴이고;
[40]
R 11 및 R 12는 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고;
[41]
상기 R 1, R 4 내지 R 6, R', R", R 11 및 R 12의 알킬, R 2, R 3 및 R 9의 알킬 또는 사이클로알킬, R 10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬, (C 3-C 7)사이클로알킬, (C 6-C 20)아릴, (C 6-C 20)아릴옥시, (C 1-C 10)알콕시, 할로(C 1-C 10)알콕시, (C 1-C 10)알킬설포닐, 아미노카보닐 및 (C 3-C 20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며;
[42]
상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.
[43]
또한, 본 발명은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체의 제조방법을 제공한다.
[44]
나아가, 본 발명은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체에 대한, 우수한 GPR119 항진 활성을 확인함으로써, 상기 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 함유하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
[45]

발명의 실시를 위한 형태

[46]
이하, 본 발명에 대하여 보다 구체적으로 설명한다. 이 때 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가지며, 하기의 설명에서 본 발명의 요지를 불필요하게 흐릴 수 있는 공지 기능 및 구성에 대한 설명은 생략한다.
[47]
[48]
본 발명은 하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 제공한다:
[49]
[화학식 1]
[50]
[51]
상기 화학식 1에서,
[52]
R 1은 수소 또는 (C 1-C 10)알킬이고;
[53]
X는 이고;
[54]
R 2는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[55]
R 3은 (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[56]
A 고리는 이고;
[57]
R 4 내지 R 8은 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고;
[58]
Z는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고;
[59]
L은 단일결합, -O-(CR'R") n-, -(CR'R") n-O- 또는 NR 9-(CR'R") n-이고;
[60]
R 9는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고;
[61]
R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고;
[62]
n은 0 또는 1의 정수이고;
[63]
W는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고;
[64]
단, Z, L 및 W는 동시에 단일결합이 아니고;
[65]
Y는 (C 1-C 10)알킬카보닐, (C 1-C 10)알콕시카보닐, (C 3-C 7)사이클로알킬카보닐, (C 3-C 7)사이클로알콕시카보닐, (C 3-C 20)헤테로아릴, (C 3-C 20)헤테로아릴카보닐, SO 2R 10, (C 6-C 20)아릴, (C 6-C 20)아릴카보닐 또는 이고;
[66]
R 10은 (C 1-C 10)알킬, (C 3-C 7)사이클로알킬 또는 (C 6-C 20)아릴이고;
[67]
R 11 및 R 12는 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고;
[68]
상기 R 1, R 4 내지 R 6, R', R", R 11 및 R 12의 알킬, R 2, R 3 및 R 9의 알킬 또는 사이클로알킬, R 10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬, (C 3-C 7)사이클로알킬, (C 6-C 20)아릴, (C 6-C 20)아릴옥시, (C 1-C 10)알콕시, 할로(C 1-C 10)알콕시, (C 1-C 10)알킬설포닐, 아미노카보닐 및 (C 3-C 20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며;
[69]
상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.
[70]
[71]
본 발명에 따른 화학식 1의 피페리딘-아릴 유도체는 신규한 화합물로서, 우수한 GPR119 항진 활성을 가지고 있어 GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨합병증의 치료제 및 예방제로 유용하다.
[72]
본 발명의 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체는 하기 화학식 1-1, 화학식 1-2 또는 화학식 1-3으로 표시될 수 있다.
[73]
[화학식 1-1]
[74]
[75]
[화학식 1-2]
[76]
[77]
[화학식 1-3]
[78]
[79]
[상기 식에서, R 1, X, Y 및 A 고리는 상기 화학식 1에서 정의한 바와 동일하고; Z는 (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; L은 -O-(CR'R") n-, -(CR'R") n-O- 또는 -NR 9-(CR'R") n-이고; R 9는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이고; W는 (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; 상기 Z 및 W의 아릴렌 또는 헤테로아릴렌은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬, (C 3-C 7)사이클로알킬, (C 6-C 20)아릴, (C 6-C 20)아릴옥시, (C 1-C 10)알콕시, 할로(C 1-C 10)알콕시, (C 1-C 10)알킬설포닐, 아미노카보닐 및 (C 3-C 20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.]
[80]
본 발명의 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R 1은 수소 또는 (C 1-C 10)알킬이고; X는 이고; R 2는 수소 또는 (C 1-C 10)알킬이고; R 3은 (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; A 고리는 이고; R 4 내지 R 8은 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; Z는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; L은 단일결합, -O-(CR'R") n-, -(CR'R") n-O- 또는 NR 9-(CR'R") n-이고; R 9는 수소 또는 (C 1-C 10)알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 (C 3-C 20)헤테로아릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 (C 1-C 10)알콕시카보닐, (C 3-C 20)헤테로아릴, (C 3-C 20)헤테로아릴카보닐, SO 2R 10, (C 6-C 20)아릴 또는 이고; R 10은 (C 1-C 10)알킬, (C 3-C 7)사이클로알킬 또는 (C 6-C 20)아릴이고; R 11 및 R 12는 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; 상기 R 10의 아릴, Z의 아릴렌 또는 헤테로아릴렌, 및 Y의 알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐 또는 아릴은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬 및 (C 3-C 7)사이클로알킬로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.
[81]
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 상기 는 하기 구조에서 선택될 수 있다:
[82]
[83]
(상기 R 13 및 R 14는 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; R 9는 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이다.)
[84]
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R 1은 수소 또는 메틸이고; X는 이고; R 2는 수소, 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; R 3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는 이고; R 4, R 5, R 6', R 6", R 7 및 R 8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌( ) 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH 2) n-, -(CH 2) n-O- 또는 NR 9-(CH 2) n-이고; R 9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는 이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.
[85]
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체에서 R 1은 수소 또는 메틸이고; X는 이고; R 3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는 이고; R 4', R 4", R 5', R 5", R 6', R 6", R 7 및 R 8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH 2) n-, -(CH 2) n-O- 또는 NR 9-(CH 2) n-이고; R 9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는 이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있다.
[86]
본 발명의 일 실시예에 따르면, 상기 화학식 1의 피페리딘-아릴 유도체는
[87]
(1) (E)-t-부틸 4-(((6-(4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[88]
(2) (E)-t-부틸 4-(((6-(4-(1-(t-부톡시이미노)에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[89]
(3) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[90]
(4) (E)-3-플루오로-4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,
[91]
(5) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,
[92]
(6) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[93]
(7) (E)-2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,
[94]
(8) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,
[95]
(9) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[96]
(10) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[97]
(11) (E)-3-플루오로-4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심,
[98]
(12) (E)-4-(5-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,
[99]
(13) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[100]
(14) (E)-4'-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,
[101]
(15) (E)-2,3',5'-트라이플루오로-4'-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,
[102]
(16) (E)-t-부틸 4-(((5-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,
[103]
(17) (E)-t-부틸 4-(((5-(4-((에톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,
[104]
(18) (E)-t-부틸 4-(((5-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,
[105]
(19) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,
[106]
(20) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5,6'-테트라플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[107]
(21) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심,
[108]
(22) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((메톡시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[109]
(23) (E)-t-부틸 4-(((4'-((에톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[110]
(24) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[111]
(25) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[112]
(26) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[113]
(27) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[114]
(28) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[115]
(29) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,
[116]
(30) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-에틸 옥심,
[117]
(31) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심,
[118]
(32) (E)-t-부틸 4-(((6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[119]
(33) (E)-t-부틸 4-(((6-(4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[120]
(34) (E)-4-(5-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,
[121]
(35) (E)-4-(5-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심,
[122]
(36) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[123]
(37) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[124]
(38) (E)-t-부틸 4-(((6-(2,6-다이플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[125]
(39) (E)-t-부틸 4-(((6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트,
[126]
(40) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 옥심,
[127]
(41) (E)-t-부틸 4-(((5-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트,
[128]
(42) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[129]
(43) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[130]
(44) (E)-4'-((1-((4-(t-부틸)페닐)설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[131]
(45) (E)-2,3',5'-트라이플루오로-4'-((1-(페닐설포닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[132]
(46) (E)-t-부틸 4-((7-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,
[133]
(47) (E)-t-부틸 4-((7-(2-플루오로-4-((하이드록시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,
[134]
(48) (E)-t-부틸 4-((7-(2-플루오로-4-((메톡시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,
[135]
(49) (E)-t-부틸 4-((7-(4-((에톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트,
[136]
(50) (E)-t-부틸 4-(((3,3',5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트,
[137]
(51) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[138]
(52) (E)-4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤즈알데하이드 옥심,
[139]
(53) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심,
[140]
(54) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[141]
(55) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[142]
(56) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[143]
(57) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[144]
(58) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,
[145]
(59) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[146]
(60) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[147]
(61) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심,
[148]
(62) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,
[149]
(63) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,
[150]
(64) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)메탄아민 옥사이드,
[151]
(65) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[152]
(66) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)사이클로헥산아민 옥사이드,
[153]
(67) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,
[154]
(68) (Z)-N-(4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,
[155]
(69) (Z)-N-(4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드,
[156]
(70) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[157]
(71) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,
[158]
(72) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,
[159]
(73) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[160]
(74) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[161]
(75) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[162]
(76) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[163]
(77) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드,
[164]
(78) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,
[165]
(79) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[166]
(80) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)사이클로헥산아민 옥사이드,
[167]
(81) (Z)-N-((4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[168]
(82) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[169]
(83) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[170]
(84) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[171]
(85) (Z)-N-(4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,
[172]
(86) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[173]
(87) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[174]
(88) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[175]
(89) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[176]
(90) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[177]
(91) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[178]
(92) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[179]
(93) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[180]
(94) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[181]
(95) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[182]
(96) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,
[183]
(97) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,
[184]
(98) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-6-일)메틸렌)메탄아민 옥사이드,
[185]
(99) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,
[186]
(100) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,
[187]
(101) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[188]
(102) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[189]
(103) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[190]
(104) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[191]
(105) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[192]
(106) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[193]
(107) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)에탄아민 옥사이드,
[194]
(108) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,
[195]
(109) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)메탄아민 옥사이드,
[196]
(110) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)에탄아민 옥사이드,
[197]
(111) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)프로판-2-아민 옥사이드,
[198]
(112) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[199]
(113) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[200]
(114) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[201]
(115) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[202]
(116) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)메탄아민 옥사이드,
[203]
(117) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)프로판-2-아민 옥사이드,
[204]
(118) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,
[205]
(119) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,
[206]
(120) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드,
[207]
(121) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,
[208]
(122) Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드,
[209]
(123) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5',6-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[210]
(124) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드,
[211]
(125) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,
[212]
(126) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,
[213]
(127) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,
[214]
(128) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[215]
(129) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드,
[216]
(130) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드,
[217]
(131) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드,
[218]
(132) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[219]
(133) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[220]
(134) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[221]
(135) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[222]
(136) (Z)-N-((4'-((1-((E)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[223]
(137) (Z)-N-((4'-((1-(4-에틸페닐)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[224]
(138) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[225]
(139) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[226]
(140) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[227]
(141) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[228]
(142) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[229]
(143) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[230]
(144) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[231]
(145) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[232]
(146) (Z)-N-((3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[233]
(147) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[234]
(148) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[235]
(149) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[236]
(150) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[237]
(151) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[238]
(152) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드,
[239]
(153) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[240]
(154) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[241]
(155) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드,
[242]
(156) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[243]
(157) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[244]
(158) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[245]
(159) (E)-3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[246]
(160) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[247]
(161) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[248]
(162) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[249]
(163) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[250]
(164) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[251]
(165) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심,
[252]
(166) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심,
[253]
(167) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드,
[254]
(168) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)에탄아민 옥사이드,
[255]
(169) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)프로판-2-아민 옥사이드,
[256]
(170) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[257]
(171) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드,
[258]
(172) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)메탄아민 옥사이드,
[259]
(173) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)에탄아민 옥사이드,
[260]
(174) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)프로판-2-아민 옥사이드,
[261]
(175) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[262]
(176) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)메탄아민 옥사이드,
[263]
(177) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)에탄아민 옥사이드,
[264]
(178) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)프로판-2-아민 옥사이드,
[265]
(179) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)-2-메틸프로판-2-아민 옥사이드,
[266]
(180) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, 및
[267]
(181) (E)-1-(5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드로 이루어진 군으로부터 선택되는 유도체로 이루어진 군으로부터 선택된다.
[268]
본 발명에 따른 상기 화학식 1로 표시되는 피페리딘-아릴 유도체는 물 또는 기타 유기 용매와 함께 수화물 또는 용매화물을 형성할 수 있다. 이러한 수화물 또는 용매화물도 마찬가지로 본 발명의 범주 내에 포함된다.
[269]
[270]
또한, 본 발명은 상기 화학식 1의 피페리딘-아릴 유도체의 제조방법을 제공한다.
[271]
본 발명의 화학식 1의 피페리딘-아릴 유도체의 제조방법으로 반응식 1 내지 8을 예시하였으며, 하기의 제조방법이 본 발명에 따른 화학식 1의 피페리딘-아릴 유도체를 제조하는 방법을 한정하는 것은 아니며, 하기의 제조방법의 변형은 당업자에게 자명할 것이며, 달리 언급이 없는 한 하기 반응식의 치환체의 정의는 화학식 1에서의 정의와 동일하다.
[272]
[반응식 1]
[273]
[274]
[상기 반응식 중, R 1, R 2, R 3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.]
[275]
상기 반응식 1에 도시된 바와 같이, 상기 화학식 2의 피페리딘 브로마이드 유도체와 상기 화학식 3의 보론산 유도체를 통상적인 스즈키 커플링 반응(Suzuki coupling reaction) 조건하에서 반응시켜 상기 화학식 4의 카보닐 유도체를 제조하는 제1단계; 및 상기 제조된 화학식 4의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 축합반응시켜 상기 화학식 1의 피페리딘-아릴 유도체를 제조하는 제2단계;로 이루어진다.
[276]
상기 제조방법을 각 단계별로 상세히 설명하면, 본 발명의 제1단계는 스즈키 커플링 반응의 통상적인 조건[Armin de Meijere and Francois Diederich, Metal-Catalyzed Cross-Coupling Reactions, 2nd Ed. Vol. 1, Chapter 2, 2004]하에 반응을 수행하며, 본 발명의 제2단계는 상기 제조된 화학식 4의 카보닐 유도체와 화학식 5 또는 화학식 6의 하이드록실아민과의 축합반응을 통해서 상기 화학식 1의 피페리딘-아릴 유도체를 제조하는 제2단계로 이루어진다. 제2단계에서 하이드록실아민(화학식 5 또는 화학식 6)은 2.0 내지 10 당량 사용하며, 이때 사용하는 염기는 무기염기(예를 들면, 소디움 아세테이트, 포타시움 아세테이트, 소디움 카보네이트, 포타시움 카보네이트 등등) 또는 유기 염기(예를 들면, 트리에틸아민, 디아이소프로필아민, 피리딘, 루티딘 등등)를 사용할 수 있으며, 바람직하게는 소듐 아세테이트를 사용한다. 또한, 이때 사용하는 용매는 메탄올, 에탄올, 프로판올과 같은 알콜류를 사용하며, 화합물에 따라 용해도가 낮은 경우는 디클로로메탄과 같은 용매를 혼합하여 사용할 수도 있다. 반응온도는 실온에서 100℃이며, 반응 시간은 1 내지 48시간이 바람직하다.
[277]
화학식 4의 카보닐 유도체와 화학식 5의 하이드록실아민을 축합반응시킨 경우를 하기 반응식 2에 도시하였고, 화학식 4의 카보닐 유도체와 화학식 5의 하이드록실아민을 축합반응시킨 경우를 하기 반응식 3에 도시하였다.
[278]
[반응식 2]
[279]
[280]
[반응식 3]
[281]
[282]
[상기 반응식 중, R 1, R 2, R 3, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.]
[283]
[284]
[반응식 4]
[285]
[286]
[상기 반응식 중, R 1, R 2, R 3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.]
[287]
상기 반응식 4에서 스즈키 커플링 반응 및 하이드록실아민과의 축합반응은 반응식 1에서 정의한 방법과 동일하며, 상기 화학식 9의 하이드록시 유도체로부터 화학식 1의 피페리딘-아릴 유도체의 제조는 통상적인 알킬화 반응 또는 잘 알려져 있는 미쯔노브 반응(Mitsunob reaction)을 통하여 친전자체(electrophile)를 도입하여 이루어진다.
[288]
[289]
[반응식 5]
[290]
[291]
[상기 반응식 중, R 1, R 2, R 3, X, Z, L, W, Y 및 A 고리는 상기 화학식 1에서의 정의와 동일하다.]
[292]
상기 반응식 5에서 상기 화학식 4-Boc로 표시되는 Boc(t-부톡시카르보닐)을 포함하는 유도체에 대해 통상적인 탈보호기화(deprotection) 조건하에서 반응하여 상기 화학식 4-H로 표시되는 아민 화합물을 얻고, 통상적인 알킬화 반응을 친전자체(electrophile)를 도입 후 하이드록실아민(화학식 5 또는 6)과 축합반응을 통해서 상기 화학식 1로 표시되는 피페리딘-아릴 유도체(Y가 Boc인 경우는 제외됨)를 제조할 수 있다. 또한, 상기 화학식 1-Boc로 표시되는 Boc(t-부톡시카르보닐)을 포함하는 유도체에 대해 통상적인 탈보호기화(deprotection) 조건하에서 반응하여 상기 화학식 1-H로 표시되는 화합물을 얻고, 통상적인 방법으로 친전자체(electrophile)를 도입하여 상기 화학식 1로 표시되는 피페리딘-아릴 유도체(Y가 Boc인 경우는 제외됨)를 제조할 수 있다.
[293]
[294]
[반응식 6]
[295]
[296]
[상기 반응식 중, R 13 및 R 14는 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; R 2, R 3, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.]
[297]
상기 반응식 6에서 상기 화학식 11로 표시되는 메틸 3-아미노-4-하이드록시벤조에이트와 상기 화학식 12로 표시되는 알데하이드 유도체를 반응시켜 상기 화학식 13으로 표시되는 에스터 유도체를 합성하고, 상기 화학식 13의 에스터 유도체를 환원시켜 상기 화학식 14로 표시되는 벤조옥사졸 알데하이드 유도체를 공지의 방법으로 쉽게 제조할 수 있다. 또한, 상기 화학식 1C의 피페리딘-아릴 유도체를 제조하기 위한 화학식 14의 벤조옥사졸 알데하이드 유도체와 하이드록실아민과의 축합반응은 상기 반응식 1에서 정의한 방법과 동일하다.
[298]
[299]
[반응식 7]
[300]
[301]
[상기 반응식 중, R 13 및 R 14는 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; R 2, R 3, R 4, R 5, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.]
[302]
상기 반응식 7에 도시된 상기 화학식 15의 페놀 유도체를 니트로화시켜 상기 화학식 16의 니트로페놀 유도체를 얻고, 수소 하에 팔라듐 촉매를 이용하여 니트로기를 아미노기로 환원시키고(상기 화학식 17의 아미노 유도체), 상기 화학식 18의 알데하이드 유도체와 반응시켜 상기 화학식 19의 벤조옥사졸 우도체를 합성하였다. 여기서 팔라듐 촉매를 이용하여 카복실 에스터기를 도입하여 상기 화학식 20의 카복실에스터 유도체를 제조하고, 이를 환원시켜 화학식 21의 알데하이드 유도체를 합성 하였다. 이와 같은 방법들은 일반적으로 잘 알려진 공지의 방법으로 합성 하였다. 또한, 상기 화학식 1D의 피페리딘-아릴 유도체를 제조하기 위한 화학식 21의 벤조옥사졸 알데하이드 유도체와 하이드록실아민과의 축합반응은 상기 반응식 1에서 정의한 방법과 동일하다.
[303]
[304]
[반응식 8]
[305]
[306]
[상기 반응식 중, R 4 및 R 5는 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; R 1, R 2, R 3, X, Y 및 n은 상기 화학식 1에서의 정의와 동일하다.]
[307]
상기 반응식 8에 도시된 상기 화학식 22에서 n이 1인 티아졸 메틸 클로라이드 유도체는WO2009-123992에 보고된 방법에 보고된 합성법을 이용하여 얻었다.
[308]
상기 반응식 8에 도시된 바와 같이, 상기 화학식 22의 티아졸 클로라이드 유도체와 상기 화학식 23의 아릴 알콜 유도체를 통상적인 알킬레이션 반응 조건하에서 반응시켜 상기 화학식 24의 카보닐 유도체를 제조하는 제1단계; 및 상기 제조된 화학식 24의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 축합반응시켜 상기 화학식 1E의 피페리딘-아릴 유도체를 제조하는 제2단계;로 이루어진다.
[309]
상기 제조방법을 각 단계별로 상세히 설명하면, 본 발명의 제1단계는 알킬레이션 반응의 통상적인 조건인 세슘 카보네이트 1 내지 3 당량, 포타슘 아이오다이드 1 내지 3 당량에 티아졸 메틸 클로라이트(상기 화학식 22) 1 당량을 아세토나이트릴 용매 하에 90℃에서 반응하며 반응시간은 2 내지 12시간이 바람직하다. 본 발명의 제2단계는 상기 제조된 화학식 24의 카보닐 유도체와 화학식 5 또는 화학식 6의 하이드록실아민과의 축합반응을 통해서 상기 화학식 1E의 피페리딘-아릴 유도체를 제조하는 제 2단계로 이루어진다. 제2단계에서 하이드록실아민(화학식 5 또는 화학식 6)은 2.0 내지 10 당량 사용하며, 이때 사용하는 염기는 무기염기(예를 들면, 소디움 아세테이트, 포타시움 아세테이트, 소디움 카보네이트, 포사이움 카보네이트 등등) 또는 유기 염기(예를 들면, 트리에틸아민, 디아이소프로필아민, 피리딘, 루티딘 등등)를 사용할 수 있으며, 바람직하게는 포타시움 아세테이트를 사용한다. 또한, 이때 사용하는 용매는 메탄올, 에탄올, 프로판올과 같은 알코류를 사용하며, 화합물에 따라 용해도가 낮은 경우는 디클로로메탄과 같은 용매를 혼합하여 사용할 수도 있다. 반응온도는 실온이며, 반응 시간은 48시간이 바람직하다.
[310]
[311]
또한, 본 발명은 상기 화학식 1의 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 GPR119 항진 활성과 관련된 질환의 예방 또는 치료용 약제학적 조성물을 제공한다.
[312]
상기 GPR119 항진 활성과 관련된 질환은 당뇨 또는 당뇨합병증이다.
[313]
상기 "당뇨"는 포도당-비관용(intolerance)을 초래하는 인슐린의 상대적 또는 절대적 부족으로 특징되는 만성질환을 의미한다. 본 발명의 조성물로 예방 또는 치료되는 당뇨는 모든 종류의 당뇨병을 포함하며, 예를 들어, 제1형 당뇨, 제2형 당뇨 및 유전성 당뇨를 포함한다. 제1형 당뇨는 인슐린 의존성 당뇨병으로서, β-세포의 파괴에 의해 주로 초래되고, 제2형 당뇨는 인슐린 비의존성 당뇨병으로서, 식사 후 불충분한 인슐린 분비 또는 인슐린 내성에 의해 유발된다.
[314]
상기 "당뇨합병증"은 그 발병, 진행 또는 치료 민감성에 있어 당뇨병이 영향을 미치는 모든 질환을 의미하며, 예를 들어 비만, 관상 동맥 질환, 허혈성 뇌졸중, 말초 혈관 질환, 간헐성 파행증, 심근경색증, 식후 지질혈증, 내당능 손상의 증상, 공복 혈당 손상의 증상, 대사성 산증, 케톤증, 관절염, 골다공증, 고혈압, 울혈성 심부전, 당뇨병성 망막증, 황반 변성, 백내장, 당뇨병성 신증, 사구체경화증, 만성 신부전, 당뇨병성 신경병증, 협심증, 혈전증, 아테롬성동맥경화증, 심근경색증, 일과성 허혈성 발작, 뇌졸중, 혈관 재협착, 고혈당증, 고인슐린혈증, 고지혈증, 고중성지방혈증, 인슐린 내성, 족부 궤양, 궤양성 결장염 및 심내막 기능부전을 포함하나, 이에 제한되지 않고 당뇨병의 합병증으로 당업계에 알려진 모든 질환을 포함한다.
[315]
본 발명에서의 약제학적으로 허용 가능한 염은 당해 기술 분야에서 통상적인 방법에 의해 제조될 수 있는 것으로, 예를 들면 염산, 브롬산, 황산, 황산수소나트륨, 인산, 질산, 탄산 등과 같은 무기산과의 염, 개미산, 초산, 프로피온산, 옥살산, 석신산, 벤조산, 시트르산, 말레인산, 말론산, 타르타르산, 글루콘산, 락트산, 게스티스산, 푸마르산, 락토비온산, 살리실릭산, 또는 아세틸살리실릭산(아스피린)과 같은 유기산과의 염, 글리신, 알라닌, 바닐린, 이소루신, 세린, 시스테인, 시스틴, 아스파라진산, 글루타민, 리진, 아르기닌, 타이로신, 프롤린 등과 같은 아미노산과의 염, 메탄설폰산, 에탄설폰산, 벤젠설폰산, 톨루엔설폰산 등과 같은 설폰산과의 염, 나트륨, 칼륨 등의 알칼리금속과의 반응에 의한 금속염, 또는 암모늄 이온과의 염 등을 포함한다.
[316]
또한, 본 발명의 약제 조성물은 상기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 약제학적으로 허용 가능한 이들의 염에 통상의 무독성 약제학적으로 허용 가능한 담체, 보강제 및 부형제 등을 첨가하여 약제학적 분야에서 통상적인 제제 예를 들면 정제, 캅셀제, 트로키제, 액제, 현탁제 등의 경구 투여용 제제 또는 비경구 투여용 제제로 제조하여, 상기 GPR119 항진 활성과 관련된 질환, 특히 당뇨 또는 당뇨합병증의 치료에 사용될 수 있다.
[317]
본 발명의 약제학적 조성물에 사용될 수 있는 부형제로는 감미제, 결합제, 용해제, 용해보조제, 습윤제, 유화제, 등장화제, 흡착제, 붕해제, 산화방지제, 방부제, 활탁제, 충진제, 방향제 등이 포함될 수 있다. 예를 들면 락토스, 덱스트로스, 슈크로스, 만니톨, 솔비톨, 셀룰로오스, 글라이신, 실리카, 탈크, 스테아린산, 스테린, 마그네슘 스테아린산염, 마그네슘 알루미늄 규산염, 녹말, 젤라틴, 트라가칸트 고무, 알지닌산, 소듐 알진산염, 메틸셀룰로오스, 소듐 카르복실메틸셀룰로오스, 아가, 물, 에탄올, 폴리에틸렌글리콜, 폴리비닐피롤리돈, 염화나트륨, 염화칼슘, 오렌지 엣센스, 딸기 엣센스, 바닐라 향 등을 들 수 있다.
[318]
또한, 본 발명에 따른 화학식 1로 표시되는 피페리딘-아릴 유도체의 인체에 대한 투여용량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질병정도에 따라 달라질 수 있으며, 몸무게가 70 kg인 성인환자를 기준으로 할 때 일반적으로 1일 0.01 mg 내지 5,000 mg이며, 의사 또는 약사의 판단에 따라 일정 시간간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.
[319]
[320]
이하, 실시예 및 실험예를 통해 본 발명을 상세히 설명한다. 단, 하기의 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
[321]
본 발명의 제조방법에 따른, 상기 화학식 1로 표시되는 피페리딘-아릴 유도체의 생성여부를 확인하기 위하여, 최종 반응 후 다중 컬럼크로마토그래피 장비(Quad3+; 미국 Biotage사 제품)로 분리 정제하였으며, NMR 및 Mass 스펙트럼으로 구조를 분석하였다.
[322]
[323]
실시예 1: (E)-t-부틸 4-(((6-(4-(( 메톡시이미노 ) 메틸 )페닐)피리딘-3-일) 옥시 )메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-((methoxyimino)methyl)phenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate, 화합물 1)의 제조
[324]
[325]
[326]
[327]
[1단계] 1,1- 다이메틸에틸 4-{[(6- 브로모 -3- 피리디닐 ) 옥시 ] 메틸 }-1- 피페리딘카복실레이트(화합물 1-a)의 제조
[328]
2-브로모-5-하이드록시피리딘(4.176 g, 24 mmol), t-부틸 4-(하이드록시메틸)피페리딘-1-카복실레이트(5.166 g, 24 mmol)와 트라이페닐포스핀(6.304 g, 24 mmol)을 THF(200 mL)에 녹인 다음, 다이아이소프로필 아조다이카복실레이트(4.853 g, 24 mmol)를 실온에서 적가하고 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 1-a를 얻었다(6.835 g, 77%).
[329]
[330]
[2단계] t-부틸 4-(((6-(4- 포밀페닐 )피리딘-3-일) 옥시 ) 메틸 )피페리딘-1- 카복실레이트(화합물 1-b)의 제조
[331]
압력 튜브에 화합물 1-a(500 mg, 1.34 mmol), 4-포밀페닐보론산(332 mg, 2 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh 3] 4, 5mol%)을 다이옥산(4 mL)에 가하고, 탄산나트륨(511 mg, 4.82 mmol)을 증류수(6 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 1-b를 얻었다(400 mg, 73%).
[332]
1H-NMR (300 MHz, CDCl 3) δ 10.05 (s, 1H), 8.40 (d, J=2.6Hz, 1H), 8.11 (d, J=8.3Hz, 2H), 7.96 (d, J=8.3Hz, 2H), 7.74 (d, J=8.7Hz, 1H), 7.28 (dd, J=8.7, 2.9Hz, 1H), 4.18-4.10 (m, 2H), 5.91 (d, H=6.3Hz, 2H), 2.80-2.70 (m, 2H), 2.04-1.97 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.35-1.24 (m, 2H).
[333]
[334]
[3단계] (E)-t-부틸 4-(((6-(4-(( 메톡시이미노 ) 메틸 )페닐)피리딘-3-일) 옥시 )메틸)피페리딘-1-카복실레이트(화합물 1)의 제조
[335]
화합물 1-b(340 mg, 0.82 mmol), O-메틸하이드록실아민·HCl(342 mg, 4.1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(336 mg, 4.1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 1을 얻었다(348 mg, 95%).
[336]
1H-NMR (300 MHz, CDCl 3) δ 8.37 (d, J=2.8Hz, 1H), 8.09 (s, 1H), 7.94 (d, J=8.2Hz, 2H), 7.68-7.65 (m, 3H), 7.25 (dd, J=8.7, 2.8Hz, 1H), 4.20-4.12 (m, 2H), 3.89 (d, J=6.3Hz, 2H), 3.99 (s, 3H) 2.79-2.72 (m, 2H), 2.04-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.34-1.24 (m, 2H).
[337]
[338]
실시예 2: (E)-t-부틸 4-(((6-(4-(1-(t- 부톡시이미노 )에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-(1-(tert-butoxyimino)ethyl)phenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate,화합물 2)의 제조
[339]
[340]
[341]
[342]
[1단계] t-부틸 4-(((6-(4- 아세틸페닐 )피리딘-3-일) 옥시 ) 메틸 )피페리딘-1-카복실레이트(화합물 2-a)의 제조
[343]
압력 튜브에 t-부틸 4-(((6-브로모피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(500 mg, 1.34 mmol), (4-아세틸페닐)보론산(331 mg, 2.02 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh 3] 4, 5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(511 mg, 4.82 mmol)을 증류수(7 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 2-a를 얻었다(444 mg, 80%).
[344]
1H-NMR (300 MHz, CDCl 3) δ 8.42 (d, J=2.8 Hz, 1H), 8.06 (s, 4H), 7.75 (d, J=8.7 Hz, 1H), 7.29 (dd, J=8.7, 2.9 Hz, 1H), 4.27-4.26 (m, 2H), 3.94 (d, J=6.3 Hz, 2H), 2.81-2.76 (m, 2H), 2.66 (s, 3H), 2.08-1.99 (m, 2H), 1.88-1.86 (m, 2H), 1.49 (s, 9H), 1.37-1.28 (m, 2H).
[345]
[346]
[2단계] (E)-t-부틸 4-(((6-(4-(1-(t- 부톡시이미노 )에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(화합물 2)의 제조의 제조
[347]
화합물 2-a(70, mg, 0.17 mmol), O-(t-부틸)하이드록실아민·HCl(125 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 80℃에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 2를 얻었다(65 mg, 80%).
[348]
1H-NMR (300 MHz, CDCl 3) δ 8.37 (d, J=2.8Hz, 1H), 7.92-7.90 (m, 2H), 7.77-7.75 (m, 2H), 7.67 (d, J=8.7Hz, 1H), 7.24 (dd, J=8.7, 2.8Hz, 1H), 4.22-4.14 (m, 2H), 3.89 (d, J=6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.23 (s, 3H), 2.03-1.97 (m, 1H), 1.85-1.83 (m, 2H), 1.47 (s, 9H), 1.37 (s, 9H), 1.34-1.24 (m, 2H).
[349]
[350]
실시예 3: (E)-t-부틸 4-(((6-(4-((t- 부톡시이미노 ) 메틸 )-2- 플루오로페닐 )피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트((E)-tert-butyl 4-(((6-(4-((tert-butoxyimino)methyl)-2-fluorophenyl)pyridin-3-yl)oxy)methyl)piperidine-1-carboxylate, 화합물 3)의 제조
[351]
[352]
[353]
[354]
[1단계] t-부틸 4-(((6-(2- 플루오로 -4- 포밀페닐 )피리딘-3-일) 옥시 ) 메틸 )피페리딘-1-카복실레이트(화합물 3-a)의 제조
[355]
압력 튜브에 t-부틸 4-(((6-브로모피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(419 mg, 1.12 mmol), (2-플루오로-4-포밀)페닐보론산(380 mg, 2.26 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh 3] 4, 5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(431 mg, 4.06 mmol)을 증류수(7 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 3-a를 얻었다(423 mg, 90%).
[356]
1H-NMR (300 MHz, CDCl 3) δ 10.02 (d, J=1.7Hz, 1H), 8.43 (d, J=2.8Hz, 1H), 8.19 (t, J=7.7Hz, 1H), 7.83 (dd, J=8.7, 1.7Hz, 1H), 7.76 (dd, J=8.0, 1.5Hz, 1H), 7.65 (dd, J=11.0, 1.4Hz, 1H), 7.26 (dd, J=8.9, 2.9Hz, 1H), 4.26-4.16 (m, 2H), 3.91 (d, J=6.3Hz, 2H), 2.83-2.75 (m, 2H), 2.06-2.01 (m, 1H), 1.89-1.86 (m, 2H), 1.49 (s, 9H), 1.37-1.30 (m, 2H).
[357]
[358]
[2단계] (E)-t-부틸 4-(((6-(4-((t- 부톡시이미노 ) 메틸 )-2- 플루오로페닐 )피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트(화합물 3)의 제조
[359]
화합물 3-a(665, mg, 1.6 mmol), O-(t-부틸)하이드록실아민·HCl(605 mg, 4.8 mmol)을 에탄올(10 mL)에 가한 다음 소듐 아세테이트(410 mg, 5 mmol)를 가하여 70℃에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 3을 얻었다(633 mg, 82%).
[360]
1H-NMR (300 MHz, CDCl 3) δ 8.41 (d, J=2.9Hz, 1H), 8.03 (s, 1H), 7.94 (t, J=8.1Hz, 1H), 7.75 (dd, J=8.7, 1.7Hz, 1H), 7.44 (dd, J=12.3, 1.4Hz, 1H), 7.39 (dd, J=8.1, 1.5Hz, 1H), 7.25 (dd, J=8.7, 2.9Hz, 1H), 4.22-4.16 (m, 2H), 3.90 (d, J=6.3Hz, 2H), 2.80-2.74 (m, 2H), 2.03-1.98 (m, 1H), 1.86-1.83 (m, 2H), 1.47 (s, 9H), 1.37 (s, 9H), 1.34 (m, 2H).
[361]
[362]
실시예 4: (E)-3- 플루오로 -4-(5-((1-(5- 아이소프로필아이소옥사졸 -3- 카보닐 )피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심((E)-3-fluoro-4-(5-((1-(5-isopropylisoxazole-3-carbonyl)piperidin-4-yl)methoxy)pyridin-2-yl)benzaldehyde O-(tert-butyl) oxime, 화합물 4)의 제조
[363]
[364]
[365]
[366]
화합물 3(485 mg, 1 mmol)을 다이클로로메탄(5 mL)에 녹이고, 4M-HCl/다이옥산(1 mL)을 가하여 밤새 교반하였다. 반응 혼합물은 농축하고, 잔여물을 건조하여 중간체 (E)-3-플루오로-4-(5-(피페리딘-4-일메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심 HCl 염을 얻었다. 이 중간체(84 mg, 0.2 mmol), 5-아이소프로필아이속사졸-3-카복실산(37 mg, 0.24 mmol), 1-에틸-3-(3-다이메틸아미노프로필)-카보다이이미드·HCl(EDC, 46 mg, 0.24 mmol), 1-하이드록시벤조트리아졸 모노하이드레이트(HBOt, 33 mg)를 다이클로로메탄(5 mL)에 혼합시키고 트라이에틸아민(101 mg, 1 mmol)을 가하고 실온에서 5시간 동안 교반하였다. 반응 혼합물은 브린(brine)을 가하고, 에틸 아세테이트로 추출, 분리된 유기층은 농축하여 관 크로마토그라피로 분리하여 상기 목적화합물 4를 얻었다(45 mg, 40%).
[367]
1H-NMR (300 MHz, CDCl 3) δ 8.40 (d, J=2.8Hz, 1H), 8.03 (s, 1H), 7.96 (t, J=8.0Hz, 1H), 7.76 (d, J=8.6Hz, 1H), 7.44 (d, J=12.2Hz, 1H), 7.40 (d, J=8.1Hz, 1H), 7.25 (dd, J=8.7, 2.8Hz, 1H), 6.26 (s, 1H), 4.83-4.80 (m, 1H), 4.54-4.51 (m, 1H), 3.96-3.90 (m, 2H), 3.20-3.08 (m, 2H), 2.87-2.81 (m, 1H), 2.23-2.14 (m, 1H), 2.02-1.94 (m, 2H), 1.51-1.24 (m, 17H).
[368]
[369]
실시예 5: (E)-4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심((E)-4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-carbaldehyde O-ethyl oxime , 화합물 5)의 제조
[370]
[371]
[372]
[373]
[1단계] 4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'- 트라이플루오로 -[1,1'-바이페닐]-4-카브알데하이드(화합물 5-a)의 제조
[374]
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(533 mg, 1.29 mmol), (2-플루오로-4-포밀)페닐보론산(326 mg, 1.94 mmol) 및 테트라키스(트라이페닐포스핀)팔라듐(0)(Pd[PPh 3] 4, 5mol%)을 다이옥산(8 mL)에 가하고, 탄산나트륨(550 mg, 5.18 mmol)을 증류수(12 mL)에 녹여 가한 다음, 120℃에서 3시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 5-a를 얻었다(551 mg, 94%).
[375]
1H-NMR (300 MHz, CDCl 3) δ 10.01 (d, J=1.7 Hz, 1H), 8.17 (s, 2H), 7.74 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, J=10.4, 1.5 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.12 (m, 2H), 4.79-4.75 (m, 2H), 4.07 (d, J=6.5 Hz, 2H), 2.97-2.88 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.17-2.08 (m, 1H), 1.99-1.94 (m, 2H), 1.43-1.20 (m, 2H), 1.18 (t, J=7.6 Hz, 3H).
[376]
[377]
[2단계] (E)-4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심(화합물 5)의 제조
[378]
화합물 5-a(91, mg, 0.2 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 5를 얻었다(78 mg, 78%).
[379]
1H-NMR (300 MHz, CDCl 3) δ 8.19 (s, 2H), 8.06 (s, 1H), 7.46-7.37 (m, 3H), 7.17-7.13 (m, 2H), 4.80-4.78 (m, 2H), 4.27 (q, J=7.0Hz, 2H), 4.07 (d, J=603Hz, 2H), 2.97-2.92 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 2.15-2.08 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 5H), 1.21 (t, J=7.6Hz, 3H).
[380]
[381]
실시예 6: (E)-4'-((1-( 사이클로헥실설포닐 )피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심((E)-4'-((1-(cyclohexylsulfonyl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-carbaldehyde oxime, 화합물 6)의 제조
[382]
[383]
[384]
[385]
[1단계] 4'-((1-( 사이클로헥실설포닐 )피페리딘-4-일) 메톡시 )-2,3',5'- 트라이플루오로 -[1,1'-바이페닐]-4-카브알데하이드(화합물 6-a)의 제조
[386]
t-부틸 4-(((2',3,5-트라이플루오로-4'-포밀-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트(449 mg, 1 mmol)를 다이클로로메탄(5 mL)에 녹이고, 4M-HCl/다이옥산(1 mL)을 가하여 밤새 교반하였다. 반응 혼합물은 농축하고, 잔여물은 다시 다이클로로메탄(5 mL)에 혼합시키고, 사이클로헥실설포닐클로라이드(273 mg, 1.5 mmol)와 트라이에틸아민(404 mg, 4 mmol)을 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 묽은 염산용액을 가하고 다이클로로메탄으로 추출, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 6-a을 얻었다(186 mg, 40%).
[387]
1H-NMR (300 MHz, CDCl 3) δ 10.02 (d, J=1.7 Hz, 1H), 7.75 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, J=10.4, 1.4 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.20-7.13 (m, 2H), 4.06 (d, J=6.0 Hz, 2H), 3.92-3.84 (m, 2H), 2.96-2.86 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H).
[388]
[389]
[2단계] (E)-4'-((1-( 사이클로헥실설포닐 )피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심(화합물 6)의 제조
[390]
화합물 6-a(52, mg, 0.1 mmol), 하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 6을 얻었다(50 mg, 93%).
[391]
1H-NMR (300 MHz, CDCl 3) δ 8.12 (s, 1H), 7.42-7.37 (m, 3H), 7.17-7.08 (m, 2H), 4.04 (d, J=6.0 Hz, 2H), 3.90-3.86 (m, 2H), 2.96-2.85 (m, 3H), 2.14-1.86 (m, 7H), 1.72-1.21 (m, 8H).
[392]
[393]
실시예 7: (E)-2,3',5'- 트라이플루오로 -4'-((1-(3- 아이소프로필 -1,2,4- 옥사다이아졸 -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심((E)-2,3',5'-trifluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-carbaldehyde O-ethyl oxime , 화합물 7)의 제조
[394]
[395]
[396]
[397]
[1단계] 2,3',5'- 트라이플루오로 -4'- 하이드록시 -[1,1'- 바이페닐 ]-4- 카브알데하이드(화합물 7-a)의 제조
[398]
압력 튜브에 4-브로모-2,6-다이플루오로페놀(209 mg, 1 mmol), (2-플루오로-4-포밀페닐)보론산(252 mg, 1.5 mmol), 소듐 2'-다이사이클로헥실포스피노-2,6-다이메톡시-1,1'-바이페닐-3-설포네이트 하이드라이드(26 mg, 5 mol%), 팔라듐 아세테이트(6 mg, 2.5 mol%) 및 포타슘 포스페이트(414 mg, 3 mmol)를 다이옥산(5 mL)에 가하여 혼합하고, 증류수(5 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 7-a를 얻었다(335 mg, 71%).
[399]
1H-NMR (300 MHz, CDCl 3) δ 10.01 (d, J=1.6 Hz, 1H), 7.74 (dd, J=7.9, 1.4 Hz, 1H), 7.67 (dd, J=10.5, 1.3 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.19 (m, 2H).
[400]
[401]
[2단계] 2,3',5'- 트라이플루오로 -4'-((1-(3- 아이소프로필 -1,2,4- 옥사다이아졸 -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드(화합물 7-b)의 제조
[402]
화합물 7-a(214, mg, 0.85 mmol), (1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메틸 메탄설포네이트(303 mg, 1.0 mmol) 및 세슘 카보네이트(450 mg, 1.38 mmol)를 DMF (5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 7-b를 백색 고체로 얻었다(234 mg, 60%).
[403]
1H-NMR (300 MHz, CDCl 3) δ 10.02 (d, J=1.7 Hz, 1H), 7.74 (dd, J=7.9, 1.5 Hz, 1H), 7.67 (dd, 10.4, 1.4 Hz, 1H), 7.57 (t, J=7.5 Hz, 1H), 7.21-7.13 (m, 2H), 4.26-4.18 (m, 2H), 4.08 (d, J=6.2 Hz, 2H), 3.16-3.06 (m, 2H), 2.93-2.84 (m, 1H), 2.11-2.05 (m, 1H), 2.01-1.96 (m, 2H), 1.54-1.40 (m, 2H), 1.29 (d, J=6.9 Hz, 6H).
[404]
[405]
[3단계] (E)-2,3',5'- 트라이플루오로 -4'-((1-(3- 아이소프로필 -1,2,4- 옥사다이아졸 -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심(화합물 7)의 제조
[406]
화합물 7-b(92mg, 0.2 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 7을 얻었다(67 mg, 수율 = 65%).
[407]
1H-NMR (300 MHz, CDCl 3) δ 8.04 (s, 1H), 7.44-7.37 (m, 3H), 7.18-7.09 (m, 2H), 4.28-4.18 (m, 4H), 4.05 (d, J=6.2 Hz, 2H), 3.15-3.06 (m, 2H), 2.94-2.85 (m, 1H), 2.14-2.03 (m, 1H), 2.02-1.95 (m, 2H), 1.53-1.38 (m, 2H), 1.33 (t, J=7.1 Hz, 3H), 1.29 (d, J=6.7 Hz, 6H).
[408]
[409]
실시예 8: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 55)의 제조
[410]
[411]
[412]
[413]
화합물 5-a(276 mg, 0.6 mmol), N-메틸하이드록실아민 염산염(250 mg, 3 mmol) 및 소듐 아세테이트(252 mg, 3 mmol)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 55를 백색 고체로 얻었다(226 mg, 77%).
[414]
1H-NMR (300 MHz, CDCl 3) δ 8.36 (d, J=12.6Hz, 1H), 8.21 (s, 2H), 7.81 (d, J=8.1Hz, 1H), 7.46-7.43 (m, 2H), 7.18-7.16 (m, 2H), 4.80-4.77 (m, 2H), 4.07 (d, J=6.1Hz, 2H), 3.99 (s, 3H), 2.98-2.93 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 2.16-1.10 (m, 1H), 2.00-1.98 (m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J=7.6Hz, 3H).
[415]
[416]
실시예 9: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 56)의 제조
[417]
[418]
[419]
[420]
화합물 5-a(270 mg, 0.59 mmol), N-아이소프로필하이드록실아민 염산염(250 mg, 2.24 mmol) 및 소듐 아세테이트(250 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 56을 백색 고체로 얻었다(181 mg, 60%).
[421]
1H-NMR (300 MHz, CDCl 3) δ 8.37 (dd, J=12.8, 1.3Hz, 1H), 8.16 (s, 2H), 7.81 (dd, J=8.2, 1.3Hz, 1H), 7.47 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.28-4.20 (m, 1H), 4.04 (d, J=6.5Hz, 2H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.14-2.07 (m, 2H), 1.98-1.94 (m, 2H), 1.52 (d, J=6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J=7.5 Hz, 3H).
[422]
[423]
실시예 10: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)-2-methylpropan-2-amine oxide, 화합물 57)의 제조
[424]
[425]
[426]
[427]
화합물 5-a(70 mg, 0.15 mmol), N-t-부틸하이드록실아민 염산염(93 mg, 0.75 mmol) 및 소듐 아세테이트(90 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 57을 백색 고체로 얻었다(57 mg, 72%).
[428]
1H-NMR (300 MHz, CDCl 3) δ 8.44 (dd, J=13.0, 1.3Hz, 1H), 8.16 (s, 2H), 7.83 (dd, J=8.3, 1.7Hz, 1H), 7.57 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.20-7.10 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J=6.5Hz, 2H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.14-2.05 (m, 1H), 1.98-1.94 (m, 2H), 1.62 (s, 9H), 1.44-1.30 (m, 2H), 1.18 (t, J=7.5Hz, 3H).
[429]
[430]
실시예 11: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)cyclohexanamine oxide, 화합물 58)의 제조
[431]
[432]
[433]
[434]
화합물 5-a(82 mg, 0.18 mmol), N-사이클로헥실하이드록실아민 염산염(141 mg, 0.75 mmol) 및 소듐 아세테이트(90 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 58을 백색 고체로 얻었다(60 mg, 60%).
[435]
1H-NMR (300 MHz, CDCl 3) δ 8.36 (dd, J=12.8, 1.5Hz, 1H), 8.17 (s, 2H), 7.81 (dd, J=8.2, 1.5Hz, 1H), 7.46 (s, 1H), 7.42 (t, J=8.1Hz, 1H), 7.16-7.13 (m, 2H), 4.78-4.74 (m, 2H), 4.04 (d, J=6.5Hz, 2H), 3.90-3.83 (m, 1H), 2.96-2.87 (m, 2H), 2.45 (q, J=7.5Hz, 2H), 2.16-1.91 (m, 9H), 1.74-1.70 (m, 1H), 1.59 (s, 9H), 1.41-1.28 (m, 5H), 1.18 (t, J=6.5Hz, 3H).
[436]
[437]
실시예 12: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 59)의 제조
[438]
[439]
[440]
[441]
4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드(130 mg, 0.28 mmol), N-아이소프로필하이드록실아민 염산염(961 mg, 0.86 mmol) 및 소듐 아세테이트(84 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 59를 백색 고체로 얻었다(100 mg, 68 %).
[442]
1H-NMR (300 MHz, CDCl 3) δ 9.35 (t, J=8.1 hz, 1H), 8.17 (s, 2H), 7.75 (s, 1H), 7.37 (dd, J=8.3, 1.8 Hz, 1H), 7.23 (dd, J=13.1, 1.8 Hz, 1H), 7.20-7.11 (m, 2H), 4.79-4.74 (m, 2H), 4.33-4.24 (m, 2H), 4.04 (d, J=6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.14-2.06 (m, 1H), 1.98-1.94 (m, 2H), 1.52 (d, J=6.5 Hz, 6H), 1.42-1.22 (m, 2H), 1.18 (t, J=7.6 Hz, 3H).
[443]
[444]
실시예 13: (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((2,3',5'-trifluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 60)의 제조
[445]
[446]
[447]
[448]
화합물 7-b(120 mg, 0.26 mmol), N-아이소프로필하이드록실아민 염산염(117 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 3일 동안 교반하였다. 반응 혼합물은 여과하고, 용매를 실온에서 감압농축한 후, 잔여물은 관 크로마토그라피로 분리하여 상기 목적화합물 60을 백색 고체로 얻었다(70 mg, 52%).
[449]
1H-NMR (300 MHz, DMSO-d 6) δ 8.46 (dd, J=13.5, 1.4Hz, 1H), 8.04 (s, 1H), 7.91 (dd, J=8.3, 1.4Hz, 1H), 7.66 (t, J=8.3Hz, 1H), 7.47-7.37 (m, 2H), 4.40-4.32 (m, 1H), 4.07 (d, J=6.3Hz, 2H), 4.04-3.98 (m, 2H), 3.19-3.09 (m, 2H), 2.85-2.76 (m, 1H), 2.08-1.96 (m, 1H), 1.92-1.84 (m, 2H), 1.42-1.28 (m, 2H), 1.36 (d, J=6.5 Hz, 6H), 1.19 (d, J=6.9 Hz, 6H).
[450]
[451]
실시예 14: (E)-4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O- 메틸 옥심((E)-4-(5-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-2,6-difluorobenzaldehyde O-methyl oxime, 화합물 61)의 제조
[452]
[453]
[454]
[455]
[1단계] 4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3- 플루오로피리딘 -2-일)-2,6-다이플루오로벤즈알데하이드 (화합물 61-a)의 제조
[456]
압력 튜브에 2-(4-(((6-브로모-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-일)-5-에틸피리미딘(395 mg, 1 mmol), (3,5-다이플루오로-4-포밀페닐)보론산(278 mg, 1.5 mmol), Pd[PPh 3] 4(58 mg, 5mol%) 및 탄산나트륨(424 mg, 4 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 110℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 61-a를 엷은 노란색 고체로 얻었다(320 mg, 70%).
[457]
1H-NMR (300 MHz, CDCl 3) δ 10.37 (s, 1H), 8.27 (dd, J=2.4, 1.2 Hz, 1H), 8.18 (s, 2H), 7.71-7.67 (m, 2H), 7.04 (dd, J=12.9, 2.4 Hz, 1H), 4.83-4.79 (m, 2H), 3.94 (d, J=6.3 Hz, 2H), 2.97-2.87 (m, 2H), 2.47 (q, J=7.6 Hz, 2H), 2.20-2.10 (m, 1H), 1.96-1.92 (m, 2H), 1.45-1.31 (m, 2H), 1.19 (t, J=7.6 Hz, 3H).
[458]
[459]
[2단계] (E)-4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3- 플루오르피리딘 -2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심(화합물 61)의 제조
[460]
화합물 61-a(70, mg, 0.15 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음, 소듐 아세테이트(106 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 61을 얻었다(50 mg, 67%).
[461]
1H-NMR (300 MHz, CDCl 3) δ 8.30(s, 1H), 8.27-8.26 (m, 1H), 8.21 (s, 2H), 7.66-7.64 (m, 2H), 7.05 (dd, J=12.8, 2.4 Hz, 1H), 4.84-4.82 (m, 2H), 4.07 (s, 3H), 3.95 (d, J=6.4 Hz, 2H), 2.97-2.91 (m, 2H), 2.49 (q, J=7.6 Hz, 2H), 2.18-2.14 (m, 1H), 1.97-1.95 (m, 2H), 1.45-1.36 (m, 2H), 1.21 (t, J=7.6 Hz, 3H).
[462]
[463]
실시예 15: ( Z)-N-(4-(5-((1-(t- 부톡시카보닐 )피페리딘-4-일) 메톡시 )-3- 플루오로피리딘 -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-((1-(tert-butoxycarbonyl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 62)의 제조
[464]
[465]
[466]
[467]
[1단계] t-부틸 4-(((6- 브로모 -5- 플루오로피리딘 -3-일) 옥시 ) 메틸 )피페리딘-1-카복실레이트(화합물 62-a)의 제조
[468]
6-브로모-5-플루오로피리딘-3-올(1005 mg, 5.23 mmol), t-부틸 4-(하이드록시메틸)피페리딘-1-카복실레이트(1227 mg, 5.23 mmol)와 트라이페닐포스핀(1495 mg, 5.23 mmol)을 THF(50 mL)에 녹이고, 다이아이소프로필 아조다이카복실레이트(1.3 mL)를 실온에서 적가하고 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 62-a를 백색 고체로 얻었다(1821 mg, 89%).
[469]
1H-NMR (300 MHz, CDCl 3) δ 7.93 (d, J=2.5 Hz, 1H), 6.99 (dd, J=9.0, 2.6 Hz, 1H), 4.18-4.15 (m, 2H), 3.84 (d, J=6.3 Hz, 2H), 2.78-2.70 (m, 2H), 2.04-1.92 (m, 1H), 1.82-1.78 (m, 2H), 1.46 (s, 9H), 1.34-1.21 (m, 2H).
[470]
[471]
[2단계] t-부틸 4-(((5- 플루오로 -6-(2- 플루오로 -4- 포밀페닐 )피리딘-3-일) 옥시 )메틸)피페리딘-1-카복실레이트(화합물 62-b)의 제조
[472]
압력 튜브에 화합물 62-a(500 mg, 1.28 mmol), (2-플루오로-4-포밀페닐)보론산(332 mg, 1.92 mmol), Pd[PPh 3] 4(74 mg, 5mol%) 및 및 탄산나트륨(544 mg, 5.13 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)을 가하여, 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 정제하여 상기 목적화합물 62-b를 얻었다(480 mg, 86%).
[473]
1H-NMR (300 MHz, CDCl 3) δ 10.04 (d, J=1.7Hz, 1H), 8.28 (dd, J=2.4, 0.9Hz, 1H), 7.78-7.65 (m, 3H), 7.06 (dd, J=11.0, 2.4Hz, 1H), 4.21-4.15 (m, 2H), 3.91 (d, J=6.3Hz, 2H), 2.80-2.72 (m, 2H), 2.05-1.95 (m, 1H), 1.86-1.82 (m, 2H), 1.47 (s, 9H), 1.38-1.21 (m, 2H).
[474]
[475]
[3단계] (Z)-N-(4-(5-((1-(t- 부톡시카보닐 )피페리딘-4-일) 메톡시 )-3- 플루오로피리딘 -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 62)의 제조
[476]
화합물 62-b(70 mg, 0.16 mmol), N-메틸하이드록실아민 염산염(83 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 10분 동안 교반한 후, 100℃에서 2시간 동안 교반하였다. 반응 혼합물은 여과하고, 용매는 감압농축한 후, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 62를 얻었다(37 mg, 50%).
[477]
1H-NMR (300 MHz, CDCl 3) δ 8.36 (dd, J=11.9, 1.3Hz, 1H), 8.24 (dd, J=2.4, 1.0Hz, 1H), 7.77 (dd, J=8.2, 1.4Hz, 1H), 7.59 (t, J=7.7Hz, 1H), 7.42 (s, 1H), 7.02 (dd, J=11.0, 2.4Hz, 1H), 4.18-4.10 (m,2 H), 3.89 (s, 3H), 3.87 (d, J=6.4Hz, 2H), 2.78-2.70 (m, 2H), 2.03-1.95 (m, 1H), 1.83-1.79 (m, 2H), 1.45 (s, 9H), 1.34-1.22 (m, 2H).
[478]
[479]
실시예 16: (Z)-N-(4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3-fluoropyridin-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 63)의 제조
[480]
[481]
[482]
[483]
[1단계] 2-(4-(((6- 브로모 -5- 플루오로피리딘 -3-일) 옥시 ) 메틸 )피페리딘-1-일)-5-에틸피리미딘(화합물 63-a)의 제조
[484]
6-브로모-5-플루오로피리딘-3-올(504 mg, 2.62 mmol), (1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸 메탄설포네이트(988 mg, 3.30 mmol) 및 세슘 카보네이트(1280 mg, 3.93 mmol)를 DMF (10 mL)에 가한 다음, 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 63-a를 백색 고체로 얻었다(825 mg, 80%).
[485]
1H-NMR (300 MHz, CDCl 3) δ 8.20 (s, 2H), 7.96 (d, J=2.4 Hz, 1H), 7.03 (dd, J=9.0, 2.5 Hz, 1H), 4.84 -4.80 (m, 2H), 3.89 (d, J=6.3 Hz, 2H), 2.96-2.90 (m, 2H), 2.49 (q, J=7.5 Hz, 2H), 2.16-2.10 (m, 1H), 1.95-1.90 (m, 2H), 1.42-1.34 (m, 2H), 1.21 (t, J=7.5 Hz, 3H).
[486]
[487]
[2단계] 4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3- 플루오로피리딘 -2-일)-3-플루오로벤즈알데하이드(화합물 63-b)의 제조
[488]
압력 튜브에 화합물 63-a(486 mg, 1.22 mmol), (2-플루오로-4-포밀페닐)보론산(310 mg, 1.85 mmol)Pd[PPh 3] 4(70 mg, 5mol%) 및 탄산나트륨(522 mg, 4.19 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 63-b를 백색 고체로 얻었다(437 mg, 81%).
[489]
1H-NMR (300 MHz, CDCl 3) δ 10.04 (d, J=1.7Hz, 1H), 8.29-8.28 (m, 1H), 8.18(s, 2H), 7.79-7.73 (m, 2H) 7.67 (d, J=9.9Hz, 1H), 7.07 (dd, J=11.0, 2.4Hz, 1H), 4.83-4.7 8(m, 2H), 3.93 (d, J=6.3Hz, 2H), 2.97-2.87 (m, 2H), 2.47 (q, J=7.5Hz, 2H), 2.19-2.11 (m, 1H), 1.96-1.92 (m, 2H), 1.44-1.31 (m, 2H), 1.19 (d, J=7.5Hz, 3H).
[490]
[491]
[3단계] (Z)-N-(4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 63)의 제조
[492]
화합물 63-b(73 mg, 0.16 mmol), N-메틸하이드록실아민 염산염(83 mg, 1 mmol) 및 소듐 아세테이트(82 mg, 1 mmol)를 에탄올(5 mL)에 가한 다음, 실온에서 10분 동안 교반한 후, 100℃에서 2시간 동안 교반하였다. 반응 혼합물은 여과하고, 용매는 감압농축한 후, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 63을 얻었다(68 mg, 87%).
[493]
1H-NMR (300 MHz, CDCl 3) δ 8.40 (dd, J=12.0 Hz, 1H), 8.28 (dd, J=2.4 Hz, 1H), 8.19 (s, 2H), 7.80 (dd, J=8.2, 1H), 7.63 (t, J=7.7 Hz, 1H), 7.44 (s, 1H), 7.06 (dd, J=11.0, 2.4 Hz, 1H), 4.83-4.80 (m, 2H), 3.96-3.88 (m, 5H), 2.95-2.91 (m, 2H), 2.49-2.46 (m, 2H), 2.19-2.12 (m, 1H), 1.96-1.93 (m, 2H), 1.44-1.34 (m, 2H), 1.20 (t, J=7.6 Hz, 3H).
[494]
[495]
실시예 17: (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((4'-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,3',5,5'-tetrafluoro-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 86)의 제조
[496]
[497]
[498]
[499]
[1단계] 4-(5-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3- 플루오로피리딘 -2-일)-2,6-다이플루오로벤즈알데하이드(화합물 86-a)의 제조
[500]
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(412 mg, 1 mmol), (3,6-다이플루오로-4-포밀페닐)보론산(278 mg, 1.5 mmol), Pd[PPh 3] 4(58 mg, 5mol%) 및 탄산나트륨(424 mg, 4 mmol)을 다이옥산(8 mL)에 가하여 혼합하고, 증류수(12 mL)를 가하여 110℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 86-a를 엷은 노란색 고체로 얻었다(400 mg, 85%).
[501]
1H-NMR (300 MHz, CDCl 3) δ 10.35 (s, 1H), 8.17 (s, 2H), 7.16-7.12 (m, 4H), 4.79-4.75 (m, 2H), 4.08 (d, J=6.5 Hz, 2H), 2.96-2.87 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 2.17-2.09 (m, 1H), 1.97-1.93 (m, 2H), 1.42-1.29 (m, 2H), 1.18 (t, J=7.6 Hz, 3H).
[502]
[503]
[2단계] (Z)-N-((4'-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드(화합물 86)의 제조
[504]
화합물 86-a(120, mg, 0.25 mmol), N-아이소프로필하이드록실아민 염산염(112 mg, 1 mmol) 및 포타슘 아세테이트(98 mg)를 에탄올(5 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 86을 백색 고체로 얻었다(87 mg, 65%).
[505]
1H-NMR (300 MHz, CDCl 3) δ 8.17 (s, 2H), 7.50 (s, 1H), 7.14-7.05 (m, 4H), 4.80-4.72 (m, 2H), 4.39-4.31 (m, 1H), 4.04 (d, J= 6.5 Hz, 2H), 2.97-2.87 (m, 2H), 2.46 (q, J= 7.6 Hz, 2H), 2.16-2.06 (m, 1H), 2.00-1.91 (m, 2H), 1.54 (d, J= 6.5 Hz, 6H), 1.42-1.25 (m, 2H), 1.18 (t, J= 7.6 Hz, 3H).
[506]
[507]
실시예 18: (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드((Z)-N-((3,3',5,5'-tetrafluoro-4'-((1-(3-isopropyl-1,2,4-oxadiazol-5-yl)piperidin-4-yl)methoxy)-[1,1'-biphenyl]-4-yl)methylene)propan-2-amine oxide, 화합물 94)의 제조
[508]
[509]
[510]
[511]
[1단계] 3,3',5,5'- 테트라플루오로 -4'- 하이드록시 -[1,1'- 바이페닐 ]-4- 카브알데하이드(화합물 94-a)의 제조
[512]
압력 튜브에 4-브로모-2,6-다이플루오로페놀(209 mg, 1 mmol), (3,5-디플루오로-4-포밀페닐)보론산(252 mg, 1.5 mmol), 소듐 2'-다이사이클로헥실포스피노-2,6-다이메톡시-1,1'-바이페닐-3-설포네이트 하이드라이드(26 mg, 5 mol%), 팔라듐 아세테이트(6 mg, 2.5 mol%) 및 포타슘 포스페이트(414 mg, 3 mmol)를 다이옥산(5 mL)에 가하여 혼합하고, 증류수(5 mL)를 가하여 90℃에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 94-a를 백색 고체로 얻었다(216 mg, 80%).
[513]
1H-NMR (300 MHz, CDCl 3) δ 10.38 (s, 1H), 7.22-7.15 (m, 4H).
[514]
[515]
[2단계] 3,3',5,5'- 테트라플루오로 -4'-((1-(3- 아이소프로필 -1,2,4- 옥사다이아졸 -5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드(화합물 94-b)의 제조
[516]
화합물 94-a(574 mg, 2.12 mmol), (1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메틸 메탄설포네이트(967 mg, 3.18 mmol) 및 세슘 카보네이트(450 mg, 1.38 mmol)를 DMF (10 mL)에 가한 다음, 90℃에서 3시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 94-b를 백색 고체로 얻었다(507 mg, 50%).
[517]
1H-NMR (300 MHz, CDCl 3) δ 10.38 (s, 1H), 7.21-7.16 (m, 4H), 4.25-4.22 (m, 2H), 4.11 (d, J=6.1 Hz, 2H), 3.15-3.10 (m, 2H), 2.94-2.89 (m, 1H), 2.12-2.07 (m, 1H), 2.01-1.98 (m, 2H), 1.53-1.44 (m, 2H), 1.31 (t, J=6.8 Hz, 6H).
[518]
[519]
[3단계] (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드(화합물 94)의 제조
[520]
화합물 94-b(90, mg, 0.18 mmol), O-에틸하이드록실아민·HCl(97 mg, 1 mmol)을 에탄올(5 mL)에 가한 다음 포타슘 아세테이트(98 mg, 1 mmol)를 가하여 실온에서 12시간 동안 교반하였다. 반응 혼합물은 농축하고, 잔여물을 관 크로마토그라피로 분리하여 상기 목적화합물 94를 얻었다(80 mg, 80%).
[521]
1H-NMR (300 MHz, CDCl 3) δ 7.51 (s, 1H), 7.12-7.07 (m, 4H), 4.40-4.31 (m, 1H), 4.23-4.22 (m, 2H), 4.05 (d, J=6.3 Hz, 2H), 3.15-3.05 (m, 2H), 2.93-2.83 (m, 1H), 2.08-2.00 (m, 1H), 1.96-1.94 (m, 2H), 1.54 (d, J=6.5 Hz, 6H), 1.53-1.38 (m, 2H), 1.29 (d, J=6.9 Hz, 6H).
[522]
[523]
실시예 19: (Z)-N-((4'-(((1-(t- 부톡시카보닐 )피페리딘-4-일) 메틸 )( 메틸 )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(tert-butoxycarbonyl)piperidin-4-yl)methyl)(methyl)amino)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 139)의 제조
[524]
[525]
[526]
[527]
[ 1 단계 ] t-부틸 4-(((4- 브로모 -2,6- 다이플루오로페닐 )아미노) 메틸 )피페리딘-1-카복실레이트(화합물 139-a)의 제조
[528]
4-브로모-2,6-다이플루오로아닐린(241 mg, 1 mmol)을 DMF(5 mL)에 녹인 다음, 60%-NaH(120 mg)를 가하여 실온에서 30분 동안 교반하고, t-부틸 4-(((메탈설포닐)옥시)메틸)피페리딘-1-카복실레이트(440 mg, 1.5 mmol)를 가한 후 실온에서 17시간 동안 반응하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 139-a를 얻었다(214 mg, 49%).
[529]
1H-NMR (300 MHz, CDCl 3) δ 7.01-6.99 (m, 2H), 4.15-4.12 (m, 2H), 3.67 (br, 1H), 3.21-3.19 (m, 2H), 2.70-2.68 (m, 2H), 2.70-2.68 (m, 2H), 1.784-1.72 (m, 2H), 1.67-1.63 (m, 1H), 1.47 (s, 9H), 1.20-1.12 (m, 2H).
[530]
[531]
[ 2 단계 ] t-부틸 4-(((4- 브로모 -2,6- 다이플루오로페닐 )( 메틸 )아미노) 메틸 )피페리딘-1-카복실레이트(화합물 139-b)의 제조
[532]
화합물 139-a(720 mg, 1.73 mmol)를 DMF(15 mL)에 녹인 다음, 60%-NaH(207 mg, 5.2 mmol)를 가하여 실온에서 30분간 교반하고, 요오드화메탄(500 mg, 3.5 mmol)을 가한 후 실온에서 17시간 동안 반응하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 139-b를 얻었다(362 mg, 50%).
[533]
1H-NMR (300 MHz, CDCl 3) δ 7.03-7.02 (m, 2H), 4.20-4.00 (m, 2H), 2.94 (d, J=7.0 Hz, 2H), 2.84 (s, 3H), 2.70-2.67 (m, 2H), 1.75-1.72 (m, 2H), 1.64-1.62 (m, 1H), 1.46 (s, 9H), 1.07-1.04 (m, 2H).
[534]
[535]
[ 3 단계 ] t- 부틸4 -(( 메틸(2',3,5-트라이플루오로-4'-포밀- [1,1'- 바이페닐 ]-4-일)아미노)메틸)피페리딘-1-카복실레이트(화합물 139-c)의 제조
[536]
화합물 139-b(280 mg, 0.66 mmol), (2-플루오로-4-포밀페닐)보론산(167 mg, 1.0 mmol) 및 Pd[PPh 3] 4(5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(280 mg, 2.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 139-c를 얻었다(248 mg, 80%).
[537]
1H-NMR (300 MHz, CDCl 3) δ 10.03 (s, 1H), 7.76 (dd, J=7.9, 1.5 Hz, 1H), 7.68 (dd, J=10.5, 1.5 Hz, 1H), 7.60 (t, J=7.5 Hz, 1H), 7.16-7.11 (m, 2H), 4.13-4.12 (m, 2H), 3.07 (d, J=6.6 Hz, 2H), 2.95 (s, 3H), 2.95 (s, 3H), 2.75-2.65 (m, 2H), 1.78-1.75 (m, 3H), 1.46 (s, 9H), 1.11-1.09 (m, 2H).
[538]
[539]
[ 4 단계 ] (Z)-N-((4'-(((1-(t- 부톡시카보닐 )피페리딘-4-일) 메틸 )( 메틸 )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드(화합물 139)의 제조
[540]
화합물 139-c(70 mg, 0.15 mmol), N-메틸하이드록실아민 염산염(100 mg, 1.2 mmol) 및 포타슘 아세테이트(150 mg)를 에탄올(10 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 139를 백색 고체로 얻었다(52 mg, 70%).
[541]
1H-NMR (300 MHz, CDCl 3) δ 8.35 (dd, J=12.8, 1.3Hz, 1H), 7.81 (dd, J=8.2, 1.4Hz, 1H), 7.45 (t, J=8.1Hz, 1H), 7.13-7.11 (m, 2H), 4.14-4.07 (m, 2H), 3.93 (s, 3H), 3.04 (d, J=6.7Hz, 2H), 2.92 (s, 3H), 2.72-2.66 (m, 2H), 1.78-1.68 (m, 3H), 1.46 (s, 9H), 1.13-1.05 (m, 2H).
[542]
[543]
실시예 20: (Z)-N-((4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )( 메틸 )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl)(methyl)amino)-2,3',5'-trifluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 143)의 제조
[544]
[545]
[546]
[547]
[ 1 단계 ] 4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )( 메틸 )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드(화합물 143-a)의 제조
[548]
4-브로모-N-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)-2,6-다이플루오로-N-메틸아닐린(380 mg, 0.89 mmol), (2-플루오로-4-포밀페닐)보론산(195 mg, 1.16 mmol), 및 Pd[PPh 3] 4(5mol%)을 다이옥산(5 mL)에 가하고, 탄산나트륨(382 mg, 3.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리하여 상기 목적화합물 143-a를 얻었다(333 mg, 80%).
[549]
1H-NMR (300 MHz, CDCl 3) δ 10.03 (s, 1H), 8.17 (s, 2H), 7.75 (dd, J=7.9, 1.5 Hz, 1H), 7.68 (dd, J=10.5, 1.5 Hz, 1H), 7.60 (t, J=7.6 Hz, 1H), 7.14-7.12 (m, 2H), 4.73-4.70 (m, 2H), 3.10 (d, J=6.8 Hz, 2H), 2.98 (s, 3H), 2.91-2.85 (m, 2H), 2.46 (q, J=7.6 Hz, 2H), 1.88-1.86 (m, 3H), 1.21-1.16 (m, 5H).
[550]
[551]
[ 2 단계 ] (Z)-N-((4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )( 메틸 )아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드(화합물 143)의 제조
[552]
화합물 143-a(94 mg, 0.2 mmol), N-메틸하이드록실아민 염산염(100 mg, 1.2 mmol) 및 포타슘 아세테이트(150 mg)를 에탄올(10 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리하여 상기 목적화합물 143을 백색 고체로 얻었다(70 mg, 70%).
[553]
1H-NMR (300 MHz, CDCl 3) δ 8.34 (dd, J=12.8, 1.4Hz, 1H), 8.17 (s, 2H), 7.82 (dd, J=8.2, 1.5Hz, 1H), 7.46 (t, J=8.2Hz, 1H), 7.42 (s, 1H), 7.13~7.12 (m, 2H), 4.72~4.70 (m, 2H), 3.93 (s, 3H), 3.07 (d, J=6.6Hz, 2H), 2.95 (s, 3H), 2.90~2.84 (m, 2H), 2.86 (q, J=7.6Hz, 2H), 1.88~1.86 (m, 3H), 1.19 (t, J=7.6Hz, 3H).
[554]
[555]
실시예 21: (Z)-N-((4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드((Z)-N-((4'-(((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl)amino)-3,3',5,5'-tetrafluoro-[1,1'-biphenyl]-4-yl)methylene)methanamine oxide, 화합물 150)의 제조
[556]
[557]
[558]
[559]
[1단계] 4- 브로모 -N-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )-2,6- 다이플루오로아닐린(화합물 150-a)의 제조
[560]
4-브로모-2,6-다이플루오로아닐린(1.04 g, 5 mmol)을 DMF(20 mL)에 녹인 다음, 60%-NaH(350 mg)를 가하여 실온에서 1시간 동안 교반하고, (1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸 메탄설포네이트(1.57 g, 5.25 mmol)를 가한 후 실온에서 17시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150-a를 얻었다(73%).
[561]
1H-NMR (300 MHz, CDCl 3) δ 8.18 (s, 2H), 7.00-6.99 (m, 2H), 4.77-4.73 (m, 2H), 3.70 (br, 1H), 3.23-3.20 (m, 2H), 2.88-2.83 (m, 2H), 2.47 (q, J=7.6 Hz, 2H), 1.85-1.75 (m, 3H), 1.29-1.28 (m, 5H).
[562]
[563]
[2단계] 4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드(화합물 150-b)의 제조
[564]
화합물 150-a(271 mg, 0.65 mmol), (3,5-다이플루오로-4-포밀페닐)보론산(157 mg, 0.85 mmol) 및 Pd[PPh 3] 4(5mol%)을 1,4-다이옥산(5 mL)에 가하고, 탄산나트륨(276 mg, 2.6 mmol)을 증류수(4 mL)에 녹여 상기 반응 용액에 첨가하고, 110℃에서 3시간 동안 교반하였다. 반응 혼합물은 냉각하여 에틸 아세테이트로 추출하고, 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150-b를 얻었다(263 mg, 84%).
[565]
1H-NMR (300 MHz, CDCl 3) δ 10.35 (s, 1H), 8.19 (s, 2H), 7.14-7.12 (m, 4H), 4.79-4.76 (m, 2H), 4.01-4.00 (m, 1H), 3.37-3.34 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J=7.6 Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.26 (m, 2H), 1.21 (t, J=7.6 Hz, 3H).
[566]
[567]
[3단계] (Z)-N-((4'-(((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 )아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드(화합물 150)의 제조
[568]
화합물 150-b(960 mg, 2.03 mmol), N-메틸하이드록실아민 염산염(508 mg, 6.1 mmol) 및 포타슘 아세테이트(700 mg)를 에탄올(70 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물은 포화 염화암모늄 용액을 가하여, 에틸 아세테이트로 추출하고 관 크로마토그라피로 분리 정제하여 상기 목적화합물 150을 백색 고체로 얻었다(712 mg, 70%).
[569]
1H-NMR (300 MHz, CDCl 3) δ 8.18 (s, 2H), 7.45 (s, 1H), 7.11-7.06 (m, 4H), 4.78-4.76 (m, 2H), 3.96 (s, 3H), 3.90 (br, 1H), 3.33-3.31 (m, 2H), 2.91-2.85 (m, 2H), 2.48 (q, J=7.6Hz, 2H), 1.89-1.86 (m, 3H), 1.31-1.22 (m, 2H), 1.20 (t, J=7.6Hz, 3H).
[570]
[571]
실시예 22: (Z)-N-((2- (4-((1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 메톡시 )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드((Z)-N-((2-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)benzo[d]oxazol-5-yl)methylene)methanamine oxide, 화합물 120)의 제조
[572]
[573]
[574]
[575]
[ 1 단계 ] 메틸 4-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,5- 다이플루오로벤조에이트(화합물 120-a)의 제조
[576]
압력 튜브에 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(1.1g, 7.54 mmol), 다이클로로[1,1'-비스(다이페닐포스피노)페로센] 팔라듐(II)(PdCl 2(dppf), 0.3 g, 0.37 mmol), dppf(1,1'-bis(diphenylphosphino)ferrocene, 0.4 g, 0.75 mmol) 및 Et 3N(2.28 g, 22.62 mmol)을 넣고 메탄올(25 mL)을 가하였다. CO(gas, 10 atm)를 첨가하고 130℃에서 4시간 동안 교반하였다. 반응 혼합물은 농축 후 관 크로마토그라피로 분리 정제하여 목적화합물 120-a를 얻었다(2.2 g, 76%).
[577]
1H-NMR (300 MHz, CDCl 3) δ 8.16 (s, 2H), 7.59-7.54 (m, 2H), 4.78-4.74 (m, 2H), 4.09 (d, 2H, J=6.48 Hz), 3.90 (s, 3H), 2.94-2.86 (m, 2H), 2.45 (q, 2H, J=7.56 Hz), 2.09-2.08 (m, 1H), 1.95-1.91 (m, 2H), 1.39-1.25 (m, 2H), 1.18 (t, 3H, J=7.56 Hz).
[578]
[579]
[2단계] 4-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,5-다이플루오로벤즈알데하이드(화합물 120-b)의 제조
[580]
화합물 120-a(2.2 g, 5.62 mmol)에 LAH(lithium aluminum hydride, 0.53 g, 11.2 mmol)를 넣고 건조된 THF(40 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고 감압 농축한 잔여물은 관 크로마토그라피로로 분리하여 중간체를 얻었다(1.5 g). 상기 중간체에 디클로로메탄(30 mL)을 가하고 0℃에서 Dess-martin 용액(0.3 Mol, 1.6 eq)을 천천히 넣어준 후, 실온에서 50분 동안 교반하였다. 반응 혼합물을 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-b를 얻었다(1.2 g, 78%).
[581]
1H-NMR (300 MHz, CDCl 3) δ 9.83 (s, 1H), 8.17 (s, 2H), 7.45-7.40 (m, 2H), 4.79-4.75 (m, 2H), 4.15 (d, 2H, J=6.30 Hz), 2.95-2.87 (m, 2H), 2.46 (q, 2H, J=7.62 Hz), 2.11-2.05 (m, 1H), 1.96-1.91 (m, 2H), 1.33-1.25 (m, 2H), 1.18 (t, 3H, J=7.60 Hz).
[582]
[583]
[ 3 단계 ] 메틸2 - (4-((1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 메톡시 )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-카복실레이트(화합물 120-c)의 제조
[584]
메틸 3-아미노-4-하이드록시벤조에이트(0.41 g, 2.49 mml)와 화합물 120-b(0.9 g, 2.49 mmol)에 메탄올(10 ml)을 넣고 실온에서 3시간 동안 교반하였다. 용매를 완전히 제거한 후 DDQ(2,3-Dichloro-5,6-dicyano-1,4-benzoquinone, 0.29 g, 3.98 mmol)와 디클로로메탄(10 ml)을 첨가하여 실온에서 8 시간 동안 교반하였다. 반응 혼합물을 포화 NaHCO 3 수용액과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-c를 얻었다(0.5 g, 42%).
[585]
1H-NMR (300 MHz, CDCl 3) δ 8.47 (s, 1H), 8.20 (s, 2H), 8.15 (d, 2H, J=8.55 Hz), 7.84-7.82 (m, 2H), 7.63 (d, 1H, J=8.55 Hz), 4.82-4.79 (m, 2H), 4.16 (d, 2H, J=6.45 Hz), 3.99 (s, 3H), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.15 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.35 (m, 2H), 1.21 (t, 3H, J=7.60 Hz).
[586]
[587]
[ 4 단계 ] 2- (4-((1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 메톡시 )-3,5- 다이플루오로페닐 )벤조[d]옥사졸-5-카브알데하이드(화합물 120-d)의 제조
[588]
화합물 120-c(500 mg, 0.98 mmol)에 LAH(74 mg, 1.97 mmol)와 THF(15 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 물과 에틸 아세테이트로 추출하고 감압 농축한 잔여물은 관 크로마토그라피로로 분리하여 중간체를 얻었다((2-(4-((1-(5-데틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)케탄올; 1H-NMR (500 MHz, CDCl 3) δ 8.19 (s, 2H), 7.84-7.79 (m, 2H), 7.77 (s, 1H), 7.56 (d, 1H, J=8.35 Hz), 7.42 (d, 1H, J=8.35 Hz), 4.84 (d, 2H, J=5.5 Hz), 4.81-4.78 (m, 2H), 4.14 (d, 2H, J=6.5 Hz), 2.97-2.91 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.12 (m, 1H), 1.99-1.89 (m, 2H), 1.43-1.38 (m, 2H), 1.35 (t, 3H, J=7.60 Hz)). 상기 중간체(260 mg, 0.54 mmol)에 디클로로메탄(5 mL)을 가하고 PCC(pyridinium chlorochromate, 185 mg, 0.86 mmol)를천천히 넣어주고, 실온에서 8시간 동안 교반하였다. 반응 혼합물을 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 120-d를 얻었다(100 mg, 39%).
[589]
1H-NMR (500 MHz, CDCl 3) δ 10.13 (s, 1H), 8.29 (s, 1H), 8.20 (s, 2H), 8.00 (d, 1H, J=8.40 Hz), 7.86-7.84 (m, 2H), 7.73 (d, 1H, J=8.40 Hz), 4.82-4.79 (m, 2H), 4.17 (d, 2H, J=6.5 Hz), 2.97-2.92 (m, 2H), 2.48 (q, 2H, J=7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 2H, J=7.60 Hz).
[590]
[591]
[ 5 단계 ] (Z)-N-((2- (4-((1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 메톡시 )-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드(화합물 120)의 제조
[592]
화합물 120-d(30 mg, 0.06 mmol), N-메틸하이드록실아민 염산염(34 mg, 0.4 mmol) 및 포타슘 아세테이트(40 mg, 0.4 mmol)를 에탄올(6 mL)에 넣고, 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 정제하여 상기 목적화합물 120을 얻었다(25 mg, 80%).
[593]
1H-NMR (500 MHz, CDCl 3) δ 9.26 (s, 1H), 8.23 (d, 1H, J=8.30 Hz), 7.82-7.80 (m, 2H), 7.61 (d, 2H, J=8.40 Hz), 7.53 (s, 1H), 4.80-4.77 (m, 2H), 4.14 (d, 2H, J=5.65 Hz), 3.95 (s, 3H), 2.97-2.92 (m, 2H), 2.47 (q, 2H, J=7.60 Hz), 2.19-2.13 (m, 1H), 1.99-1.97 (m, 2H), 1.43-1.40 (m, 2H), 1.21 (t, 3H, J=7.60 Hz).
[594]
[595]
실시예 23: (Z)-N-(4-(5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 벤조[d]옥사졸 -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-(5-(1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)benzo[d]oxazol-2-yl)-3-fluorobenzylidene)methanamine oxide, 화합물 124)의 제조
[596]
[597]
[598]
[599]
[ 1 단계 ] t-부틸 4-(4- 하이드록시페닐 )-5,6- 다이하이드로피리딘 -1(2H)- 카복실레이트(화합물 124-a)의 제조
[600]
(4-하이드록시페닐)보론산(1.2 g, 9.05 mmol), t-부틸 4-(((트라이플루오로메틸)설포닐)옥시)-5,6-다이하이드로피리딘-1(2H)-카복실레이트(3 g, 9.05 mmol), Na 2CO 3(4.7 g, 45.25 mmol)와 Pd(PPh 3) 4(0.52g,0.45mmol)를 혼합하고, 여기에 1,4-다이옥산(30 mL)과 물 (5 mL)을 넣고 110℃에서 2시간 동안 교반하였다. 반응 혼합물을 에틸 아세테이트로 추출하고 관 크로마토그리피로 분리 정제하여 상기 목적화합물 124-a를 얻었다(1.1 g, 46%).
[601]
1H-NMR (300 MHz, DMSO) δ 9.48 (br, OH), 7.24 (d, 2H, J=7.08 Hz), 6.72 (d, 2H, J=7.08 Hz), 5.92-5.90 (m, 1H), 3.95-3.91 (m, 2H), 3.53-3.49 (m, 2H), 2.39-2.36 (m, 2H), 1.43 (s, 9H).
[602]
[603]
[ 2 단계 ] t-부틸 4-(4- 하이드록시페닐 )피페리딘-1- 카복실레이트(화합물 124-b)의 제조
[604]
화합물 124-a(0.5 g, 1.81 mmol)에 메탄올(25 mL)을 넣고 Pd-C(10 mol%)를 첨가한 후 수소 반응기(50 psi)로 12시간 동안 반응시켰다. 반응 혼합물을 셀라이트(Celite) 여과 후 감압 농축하여 상기 목적화합물 124-b를 얻었다(450 mg, 90%).
[605]
1H-NMR (300 MHz, DMSO) δ 9.20 (br, OH), 7.06 (d, 2H, J=8.37 Hz), 6.72 (d, 2H, J=8.37 Hz), 4.11-4.07 (m, 2H), 2.81-2.80 (m, 2H), 2.63-2.55 (m, 3H), 1.76-1.72 (m, 2H), 1.46 (s, 9H).
[606]
[607]
[3 단계] 4-(피페리딘-4-일)페놀(화합물 124-c)의 제조
[608]
화합물 124-b(0.45 g, 1.6 mmol)에 CH 2Cl 2(5 mL)을 넣고 TFA(trifluoroacetic acid, 1 mL)를 첨가한 후 실온에서 12시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 상기 목적화합물 124-c를 얻었다(270 mg, 99%).
[609]
1H-NMR (500 MHz, DMSO) δ 7.01 (d, 2H, J=8.50 Hz), 6.71 (d, 2H, J=8.50 Hz), 3.36-3.34 (m, 2H), 2.96-2.94 (m, 2H), 2.71-2.68 (m, 1H), 1.88-1.85 (m, 2H), 1.77-1.69 (m, 2H).
[610]
[611]
[ 4 단계 ] 4-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)페놀(화합물 124-d)의 제조
[612]
화합물 124-c(0.27 g, 1.52 mmol)와 2-클로로-5-에틸피리미딘(0.22 mL, 1.86 mmol)과 K 2CO 3(0.38 g, 2.79 mmol)를 넣고 CH 3CN(7 mL)을 첨가하여 90℃에서 6시간 동안 교반하였다. 반응 혼합물에 포화 염화암모늄 수용액을 가하여 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-d를 얻었다(0.13 g, 30%).
[613]
1H-NMR (300 MHz, CDCl 3) δ 8.19 (s, 2H), 7.06 (d, 2H, J=8.40 Hz), 6.75 (d, 2H, J=8.40 Hz), 4.84-4.80 (m, 2H), 2.98-2.89 (m, 2H), 2.73-2.65 (m, 1H), 2.46 (q, 2H, J=7.60 Hz), 1.90-1.86 (m, 2H), 1.68-1.55 (m, 2H), 1.25 (t, 3H, J=7.60 Hz).
[614]
[615]
[ 5 단계 ] 4-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)-2-니트로페놀(화합물 124-e)의 제조
[616]
화합물 124-d(0.6 g, 2.1 mmol)에 AcOH(5 mL)를 넣고 0℃에서 F-HNO 3(fuming, 0.1 mL)를 넣어주고 30분 후에 F-HNO 3(0.1 mL)를 더 넣어주었다. 얼음물에 쏟아붓고 결정을 여과한 후, 회수된 고체는 물로 씻어주어 상기 목적화합물 124-e를 얻었다(600 mg, 86%).
[617]
1H-NMR (500 MHz, CDCl 3) δ 8.22 (s, 2H), 7.96 (s, 1H), 7.49 (d, 1H, J=8.65 Hz), 7.13 (d, 1H, J=8.65 Hz), 4.92-4.90 (m, 2H), 3.01-2.96 (m, 2H), 2.85-2.80 (m, 1H), 2.50 (q, 2H, J=7.60 Hz), 1.97-1.94 (m, 2H), 1.72-1.65 (m, 2H), 1.22 (t, 3H, J=7.6 Hz).
[618]
[619]
[ 6 단계 ] 2-아미노-4-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)페놀(화합물 124-f)의 제조
[620]
화합물 124-e(0.6 g, 1.81 mmol)에 메탄올(25 mL)을 넣고 Pd-C(10 mol%)를 첨가하여 수소 분위기(1 atm, 풍선) 하에 실온에서 2시간 동안 반응시켰다. 반응 혼합물을 셀라이트 여과 후, 감압 농축하여 상기 목적화합물 124-f를 얻었다(250 mg, 48%).
[621]
1H-NMR (300 MHz, CDCl 3) δ 8.18 (s, 2H), 6.67 (s, 1H), 6.63 (d, 1H, J=9.0 Hz), 6.52 (d, 1H, J=9.0 Hz), 4.85-4.80 (m, 2H), 2.96-2.86 (m, 2H), 2.67-2.60 (m, 1H), 2.46 (q, 2H, J=7.6 Hz), 1.89-1.85 (m, 2H), 1.68-1.54 (m, 2H), 1.21 (t, 3H, J=7.6 Hz).
[622]
[623]
[ 7 단계 ] 2-(4- 브로모 -2- 플루오로페닐 )-5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일)벤조[d]옥사졸(화합물 124-g)의 제조
[624]
화합물 124-f(250 mg, 0.83 mml)와 4-브로모-2-플루오로벤즈알데하이드(170 g, 0.83 mmol)에 MeOH(7 mL)을 넣고 실온에서 3 시간 동안 교반하였다. MeOH를 완전히 제거 후에 DDQ(300 mg, 1.32 mmol)와 디클로로메탄(7 mL)을 첨가하여 실온에서 8시간 동안 교반하였다. 반응 혼합물을 포화 NaHCO 3 수용액과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-g를 얻었다(0.10 g, 26%).
[625]
1H-NMR (300 MHz, CDCl 3) δ 8.20 (s, 2H), 8.09 (t, 1H, J=8.1 Hz), 7.69 (s, 1H), 7.54-7.45 (m, 3H), 7.29 (s, 1H), 4.93-4.88 (m, 2H), 3.03-2.87 (m, 3H), 2.47 (q, 2H, J=7.60 Hz), 2.02-1.97 (m, 2H), 1.78-1.68 (m, 2H), 1.20 (t, 3H, J=7.60 Hz).
[626]
[627]
[ 8 단계 ] 메틸 4-(5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 벤조[d]옥사졸 -2-일)-3-플루오로벤조에이트(화합물 124-h)의 제조
[628]
압력 튜브에 화합물 124-g(450 mg, 0.93 mmol), PdCl 2(dppf)(38mg,0.04mmol), dppf(49 mg, 0.09 mmol) 및 Et 3N(0.28 g, 2.79 mmol)을 넣고 메탄올(10 mL)을 가하였다. CO(gas, 10 atm)를 첨가하고 130℃에서 4시간 동안 교반하였다. 반응 혼합물은 농축 후 관 크로마토그라피로로 분리 정제하여 목적화합물 124-h를 얻었다(290 mg, 69%).
[629]
1H-NMR (300 MHz, CDCl 3) δ 8.30 (t, 1H, J=7.74 Hz), 8.28 (s, 2H), 7.97-7.90 (m, 2H), 7.69 (s, 1H), 7.55 (d, 1H, J=8.43 Hz), 7.34 (d, 1H, J=8.43 Hz), 4.93-4.89 (m, 2H), 3.03-2.89 (m, 3H), 2.47 (q, 2H, J=7.60 Hz), 2.16-2.02 (m, 2H), 1.82-1.71 (m, 2H), 1.20 (t, 3H, J=7.60 Hz).
[630]
[631]
[ 9 단계 ] (4-(5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 벤조[d]옥사졸 -2-일)-3-플루오로페닐)메탄올(화합물 124-i)의 제조
[632]
화합물 124-h(290 mg, 0.62 mmol)에 LAH(47 mg, 1.25 mmol)를 넣고 건조된 THF(10 mL)을 0℃에서 가하고 실온에서 2시간 동안 교반하였다. 반응 혼합물은 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리하여 상기 목적화합물 124-i를 얻었다(170 mg, 63%). 별도의 정제없이 바로 다음 반응에 사용하였다.
[633]
[634]
[ 10 단계 ] 4-(5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 벤조[d]옥사졸 -2-일)-3-플루오로벤즈알데하이드(화합물 124-j)의 제조
[635]
화합물 124-i(170 mg, 0.39 mmol)에 디클로로메탄(5 ml)을 넣고 DMP(Dimethyl Phthalate, 0.3 mol 1.9 mL)를 천천히 첨가하여, 실온에서 50분 동인 교반하였다. 반응 혼합물을 물과 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 124-j를 얻었다(100 mg, 59%).
[636]
1H-NMR (500 MHz, CDCl 3) δ 10.09 (s, 1H), 8.47-8.43 (m, 1H), 8.22 (s, 2H), 7.85 (d, 1H, J=7.8 Hz), 7.79 (d, 1H, J=10.4 Hz), 7.73 (s, 1H), 7.59 (d, 1H, J=8.50 Hz), 7.34 (d, 1H, J=8.50 Hz), 4.95-4.92 (m, 2H), 3.05-2.94 (m, 3H), 2.50 (q, 2H, J=7.6 Hz), 2.04-1.90 (m, 2H), 1.83-1.75 (m, 2H), 1.21 (t, 3H, J=7.60 Hz).
[637]
[638]
[ 11 단계 ] (Z)-N-(4-(5- (1-(5-에틸피리미딘-2-일) 피페리딘-4-일) 벤조[d]옥사졸 -2-일)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 124)의 제조
[639]
화합물 124-j(30 mg, 0.06 mmol), N-메틸하이드록실아민 염산염(34 mg, 0.4 mmol)과 포타슘 아세테이트(40 mg, 0.4 mmol)를 에탄올(6 mL)에 넣고 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사는 관 크로마토그라피로 정제하여 상기 목적화합물 124를 얻었다(25 mg, 72%).
[640]
1H-NMR (500 MHz, CDCl 3) δ 8.48 (d, 1H, J=12.5 Hz), 8.31-8.26 (m, 1H), 8.22 (s, 2H), 7.87 (d, 1H, J=8.30 Hz), 7.70 (s, 1H), 7.56 (d, 1H, J=8.30 Hz), 7.49 (s, 1H), 7.31 (s, 1H), 4.94-4.92 (m, 2H), 3.96 (s, 3H), 3.04-2.93 (m, 3H), 2.50 (q, 2H, J=7.6 Hz), 2.04-2.01 (m, 1H), 1.82-1.75 (m, 2H), 1.23 (t, 3H, J=7.60 Hz).
[641]
[642]
실시예 24: (Z)-N-(4-((2-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드((Z)-N-(4-((2-(1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)thiazol-4-yl)methoxy)-3-fluorobenzylidene)methanamine oxide, 화합물 167)의 제조
[643]
[644]
[645]
[646]
[ 1 단계 ] 4-((2-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)티아졸-4-일) 메톡시 )-3-플루오로벤즈알데하이드(화합물 167-a)의 제조
[647]
둥근 바닥 플라스크에 4-(클로로메틸)-2-(1-(5-에틸 피리미딘-2-일)피페리딘-4-일)티아졸(240 mg, 0.75 mmol), 3-플루오로-4-하이드록시벤즈알데하이드(146 mg, 1.043 mmol), 세슘 카보네이트(364 mg, 1.12 mmol)와 포타슘 아이오다이드(160.8 mg, 0.969 mmol)를 아세토나이트릴(10 mL)에 넣은 다음, 90℃에서 12시간 동안 교반하였다. 반응 혼합물은 에틸 아세테이트로 추출하고, 감압 농축하여 얻어진 잔사를 관 크로마토그라피로 분리 정제하여 상기 목적화합물 167-a를 얻었다(300 mg, 99%).
[648]
1H-NMR (300 MHz, CDCl 3) δ 9.87 (s, 1H), 8.19 (s, 2H), 7.64 (d, J=9.0 Hz, 2H), 7.26 (s, 1H), 7.23 (d, J=9.0 Hz, 2H), 7.18 (m, 1H), 5.32 (s, 2H), 4.85 (d, J=12.0 Hz, 2H), 3.29 (m, 1H), 3.04 (t, J=15 Hz, 2H), 2.49 (q, J=9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J=9.0 Hz, 3H).
[649]
[650]
[ 2 단계 ] (Z)-N-(4-((2-(1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드(화합물 167)의 제조
[651]
화합물 167-a(60 mg, 0.14 mmol), N-메틸하이드록실아민 염산염(35 mg, 0.42 mmol) 및 포타슘 아세테이트(41 mg, 0.42 mmol)를 에탄올(3 mL)에 가한 다음, 실온에서 48시간 동안 교반하였다. 반응 혼합물을 감압 농축하여 얻어진 잔사는 관 크로마토그라피로 정제하여 상기 목적화합물 167을 얻었다(56 mg, 87%).
[652]
1H-NMR (300 MHz, CDCl 3) δ 8.30 (d, J=15.0 Hz, 1H), 8.19 (s, 2H), 7.79 (d, J=9.0 Hz, 1H), 7.29 (s, 1H), 7.25 (s, 1H), 7.08 (t, J=9.0 Hz, 1H), 5.28 (s, 2H), 4.80 (d, J=15.0 Hz, 2H), 3.85 (s, 3H), 3.30 (m, 1H), 3.04 (t, J=15 Hz, 2H), 2.49 (q, J=9.0 Hz, 2H), 2.23 (m, 2H), 1.79 (m, 2H), 1.22 (t, J=9.0 Hz, 3H).
[653]
[654]
실시예 25: (E)-1-(5-(4-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드((E)-1-(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropyridin-2-yl)-N-isopropylmethanimine oxide, 화합물 181)의 제조
[655]
[656]
[657]
[658]
[단계 1] (1-(5- 에틸피리미딘 -2-일)피페리딘-4-일)메탄올((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methanol, 화합물 181-a)의 제조
[659]
반응물 피페리딘-4-일메탄올(9.32 g, 80.96 mmol)을 반응용매인 아세토니트릴에 녹인 후, 2-클로로-5-에틸피리미딘(10.00 g, 70.40 mmol)을 반응 플라스크에 넣어준 뒤 K 2CO 3(24.32g,176mmol)를 넣어주었다. 반응물을 90℃에서 16시간 동안 교반하였다. TCL로 반응을 체크한 뒤 반응 용매를 농축시키고 에틸 아세테이트와 물로 추출한 후 유기용매층을 회수하였다. Hex:EA=5:1에서 컬럼으로 분리하여 상기 목적화합물 181-a를 연노란색의 끈적끈적한 액체로 얻었다(25.02 g, 77.2%).
[660]
1H-NMR (300 MHz, CDCl 3) δ 8.15 (s, 1H), 4.74 (d, 2H, J= 12.2 Hz), 3,51 (d, 2H, J= 6.0 Hz), 2.91 (dt, 2H, J= 2.3 Hz, 12.9 Hz), 2.48 (q, 2H, J=7.6 Hz), 1.83 (m, 2H), 1.76 (m, 1H), 1.23 (m, 2H), 1.17 (t, 3H, J=7.6 Hz).
[661]
[662]
[단계 2] (1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메틸 메탄설포네이트 ((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methyl methanesulfonate , 화합물 181-b)의 제조
[663]
화합물 181-a(25.02 g 0.11 mol)를 플라스크에 넣고 디클로로메탄에 녹였다. 상기 플라스크에 트리에틸아민(12.56 g, 0.12 mol)을 넣어주었다. 메틸설포닐클로라이드(14.16 g, 0.12 mol)를 적정량의 디클로로메탄에 녹여 희석시킨 후 dropwise funnel을 이용하여 천천히 적가하고, 실온에서 8시간 동안 반응시켰다. TLC로 확인 후 반응이 모두 진행되었으면 1N의 HCl로 quenching하였다.이후 에틸 아세테이트로 추출하고 컬럼으로 분리하여 상기 목적화합물 181-b를 연갈색의 고체로 얻었다(16.23 g, 48%).
[664]
1H-NMR (300 MHz, CDCl 3) δ 8.17 (s, 2H), 4,78 (d, 2H, J= 13.5 Hz), 4.09 (d, 2H, J= 6.0 Hz), 3.01 (s, 2H), 2.90 (dt, 2H, J= 1.8 Hz, 13.2 Hz), 2.48 (q, 2H, J= 7.7 Hz), 2.04 (m, 1H), 1.85 (d, 2H, J= 12.8 Hz), 1.30 (qd, 2H, J= 3.8 Hz, 12.2 Hz), 1.20 (t, 3H, J= 7.7 Hz).
[665]
[666]
[단계 3] 2-(4-((4-브로모-2,6-다이플루오로페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(2-(4-((4-bromo-2,6-difluorophenoxy)methyl)piperidin-1-yl)-5-ethylpyrimidine, 화합물 181-c)의 제조
[667]
화합물 181-b(16.23 g, 54.21mmol)를 플라스크에 넣고 4-브로모-2,6-다이플루오로페놀(10.30 g, 49.28 mmol)과 CsCO 3(24.08 g,73.92 mmol)을 넣어주었다. 반응 용매로는 아세토니트릴을 사용하여 90℃에서 16시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 반응 용매를 모두 농축시키고 에틸 아세테이트로 추출한 후 Hex:EA=5:1에서 컬럼으로 분리하여 상기 목적화합물 181-c를 연노란색의 고체로 얻었다(19.34 g, 95.5%).
[668]
1H-NMR (300 MHz, CDCl 3) δ 8.17 (s, 2H), 7.08 (m, 2H), 4.77. (d, 2H, J= 13.4 Hz), 3.97 (d, 2H, J= 6.1 Hz), 2.94 (dt, 2H, J= 2.4 Hz, 13,0 Hz), 2.49 (q, 2H, J= 7.7 Hz), 2.10 (m, 1H), 1.94 (d, 2H, J= 13.0 Hz), 1.30 (qd, 2H, J= 4.0 Hz, 12.2 Hz), 1.20 (t, 3H, J= 7.7 Hz).
[669]
[670]
[단계 4] 2-(4-((2,6-다이플루오로-4-(4,4,5,5-테트라메틸-1,3,2-다이옥사보로란-2-일)페녹시)메틸)피페리딘-1-일)-5-에틸피리미딘(2-(4-((2,6-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)-5-ethylpyrimidine, 화합물 181-d)의 제조
[671]
화합물 181-c(10.00 g, 24.24 mmol)를 플라스크에 넣어준 뒤 4,4,4',4',5,5,5',5'-옥타메틸-2,2'-바이(1,3,2-다이옥사보롤란)(6.77 g, 26.68 mmol)을 넣었다. 상기 플르스크에 [1,1'-비스(다이페닐포스피노)페로신]다이클로로팔라듐(II)(1.38g, 1.69 mmol)을 넣어주었다. 그리고 포타슘 아세테이트(6.99g, 72.76 mmol)를 넣었다. 반응 용매로는 1,4-다이옥산을 사용하여 110℃에서 2시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 에틸 아세테이트와 소듐 바이카보네이트로 추출한 후 Hex:EA=9:1에서 컬럼으로 분리하여 상기 목적화합물 181-d를 연노란색 끈적한 액체로 얻었다(10.68g, 95.9%).
[672]
1H-NMR (300 MHz, CDCl 3) δ 8.16 (s, 2H), 7.31 (m, 2H), 4.77 (d, 2H, J= 12.9 Hz), 4.03 (d, 2H, J= 6.3 Hz), 2.93 (dt, 2H, J= 2.7 Hz, 13.3 Hz), 2.48 (q, 2H, J= 7.8 Hz), 2.09 (m, 1H), 1.95 (d, 2H, J= 12.9 Hz), 1.32 (s, 12H), 1.20 (t, 3H, J= 7.5 Hz).
[673]
[674]
[단계 5] 5- 브로모 -3- 플루오로피콜린알데하이드 (5- bromo -3-fluoropicolinaldehyde, 화합물 181-e)의 제조
[675]
5-브로모-3-플루오로피콜린니트릴(1.00 g, 5.00 mmol)을 THF에 녹인 후 -78℃까지 냉각시켰다. 그 후 THF에 녹인 DIBAL(853 mg, 6.00 mmol)을 천천히 넣어주었다. 반응은 온도를 유지시키며 8시간 동안 수행하였다. TLC 확인 후 반응이 모두 끝나면 1N HCl로 quenching하였다. 에틸 아세테이트로 추출한 후 Hex:EA=3:1에서 컬럼으로 분리하여 상기 목적화합물 181-e를 연노란색 고체로 얻었다(808 mg, 79.6%).
[676]
1H-NMR (300 MHz, CDCl 3) δ 10.16 (s, 1H), 8.68 (s, 1H), 7.81 (s, 1H, J= 1.69 Hz, 9.35 Hz).
[677]
[678]
[단계 6] 5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피콜린알데하이드(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropicolinaldehyde, 화합물 181-f)의 제조
[679]
화합물 181-e(808 mg, 3.98mmol)와 화합물 181-d(2.07 g, 4.18 mmol)를 플라스크에 넣었다. [1,1'-비스(다이페닐포스피노)페로신]다이클로로팔라듐(II)(227.42 mg, 0.279 mmol)을 플라스크에 넣어준 뒤 포타슘 아세테이트(1.14 g, 11.94 mmol)를 넣어주었다. 반응 용매로는 1,4-다이옥산을 사용하여 110℃에서 2시간 동안 반응시켰다. TCL로 반응을 체크한 뒤 에틸 아세테이트와 소듐 바이카보네이트로 추출한 후 컬럼으로 분리하여 상기 목적화합물 181-f를 흰색의 고체로 얻었다. (301 mg, 16.0%)
[680]
1H-NMR (300 MHz, CDCl 3) δ 10.23 (s, 1H), 8.77 (m, 1H), 8.17 (s, 2H), 7.69 (dd, 1H, J= 1.82 Hz, 10.92 Hz), 7.22 (d, 2H, J= 8.9 Hz), 4.80 (d, 2H, J= 13. 1 Hz), 4.11 (d, 2H, J= 6.6 Hz), 2.97 (dt, 2H, J= 2.4 Hz, 13.1 Hz), 2.50 (q, 2H, J= 7.4 Hz), 2.12 (m, 1H), 1.97 (d, 2H, J= 13.9 Hz), 1.43 (m, 2H), 1.21 (t, 3H, J= 7.6 Hz).
[681]
[682]
[단계 7] (E)-1-(5-(4-((1-(5- 에틸피리미딘 -2-일)피페리딘-4-일) 메톡시 )-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드((E)-1-(5-(4-((1-(5-ethylpyrimidin-2-yl)piperidin-4-yl)methoxy)-3,5-difluorophenyl)-3-fluoropyridin-2-yl)-N-isopropylmethanimine oxide, 화합물 181)의 제조
[683]
화합물 181-f(100 mg, 0.21 mmol)를 바이알에 넣어준 뒤 n-아이소프로필하이드록사민 염산염(73.33 mg, 0.65 mmol)을 넣고, 포타슘 아세테이트(64. 51 mg, 0.65 mmol)를 넣어주었다. 반응 용매로는 EtOH을 사용하여 실온에서 2일 동안 반응시켰다. TLC 확인 후 용액을 그대로 농축시켜 Hex:EA=2:1에서 컬럼하여 상기 목적화합물 181을 아이보리색의 고체로 얻었다(68.00 mg, 60.5%).
[684]
1H-NMR (300 MHz, CDCl 3) δ 8.72 (s, 1H), 8.17 (s, 2H), 7.77 (s, 1H), 7.75 (dd, 1H, J= 1.92 Hz, 10.9 Hz), 7.15 (d, 2h, J= 8.8 Hz), 4.79 (d, 2H, J= 13.2 Hz), 4.34 (m, 1H), 4.07 (d, 2H, J= 6.5 Hz), 2.97 (dt, 2H, J= 2.49 Hz), 2.49 (q, 2H, J= 7.6 Hz), 2.11 (m, 1H), 1.97 (d, 2H, J= 12.2 Hz), 1.56 (d, 6H, J= 6.5 Hz), 1.38 (m, 2H), 1.21 (t, 3H, J= 7.6 Hz).
[685]
[686]
상기 실시예 1 내지 25의 방법으로 화합물 1 내지 180을 제조하였으며, 하기 표 1 내지 44에 화합물 1 내지 182의 구조 및 1H NMR 데이터를 나타내었다.
[687]
[688]
[표1]
[689]
[표2]
[690]
[표3]
[691]
[표4]
[692]
[표5]
[693]
[표6]
[694]
[표7]
[695]
[표8]
[696]
[표9]
[697]
[표10]
[698]
[표11]
[699]
[표12]
[700]
[표13]
[701]
[표14]
[702]
[표15]
[703]
[표16]
[704]
[표17]
[705]
[표18]
[706]
[표19]
[707]
[표20]
[708]
[표21]
[709]
[표22]
[710]
[표23]
[711]
[표24]
[712]
[표25]
[713]
[표26]
[714]
[표27]
[715]
[표28]
[716]
[표29]
[717]
[표30]
[718]
[표31]
[719]
[표32]
[720]
[표33]
[721]
[표34]
[722]
[표35]
[723]
[표36]
[724]
[표37]
[725]
[표38]
[726]
[표39]
[727]
[표40]
[728]
[표41]
[729]
[표42]
[730]
[표43]
[731]
[표44]
[732]
[733]
실험예 1: GPR119 항진 활성
[734]
[735]
GPR119 발현벡터는 우선 Caco-2 세포에서 RNA 추출용액(Invitrogen, USA)을 이용하여 전 RNA(total RNA)를 추출하고 cDNA합성 키트(Bioneer, Korea)를 이용하여 cDNA를 합성한 다음 프라이머(정방향(forward): GTAAGTGAAGTCCTGCCACTTCG 서열번호 1, 역방향(reverse): TGAAATTCTCTGCCCTTACCG 서열번호 2)를 이용하여 PCR를 수행하여 pTARGET 벡터(Promega, USA)에 클로닝하였다. GPR119의 효과를 보기 위해 CRE 리포터 벡터(Promega, USA)와 pTARGET GPR119 벡터를 CHO-K1에 리포펙타민(lipofectamine, Invitogen, USA)을 이용하여 도입하였다. 두 벡터를 도입한 후 50 ㎍/ml G418(USB, USA), 200 ㎍/ml 하이그로마이신 B(Hygromycine B, Invitrogen, USA)로 선별하여 살아남은 세포 중에 AR231453에 활성을 잘 나타내는 C2-C5클론 세포를 획득했다. CHO-K1-GPR119-C2-C5세포(이하, '클론세포'로 명명)를 이용하여 GPR119 작용제(agonist)를 선별하고 작용제(agonist)의 EC 50를 구하였다. 클론세포는 RPMI(Giboco, USA), 10% FBS(Gibco. USA), 페니실린/스트렙토마이신(Gibco. USA) 배양에서 유지하였다.
[736]
그 방법은 다음과 같다. 우선 클론세포를 30,000개/웰(well)를 96 웰 플레이트(well plate)에 넣은 다음 24시간 동안 배양하였다. 24시간 배양한 클론세포에 본 발명의 화합물들을 처리하고 6시간 후 배지를 버리고 레프로터 라이시스 버퍼(reproter lysis buffer,Promega, USA)를 처리한 다음 -70℃에 30분 동안 보관하였다. 보관 후 실온에서 해동한 다음 루시페라제 어쎄이 키트(luciferase assay kit)을 이용하여 GPR 119 작용제의 활성을 루미노스칸 기기(Luminoskan 기기, Thermo Scientific, USA)를 이용하여 측정하였다. 측정한 값은 대조군인 DMSO만을 처리한 세포에 대한 측정값을 1로 잡고 각각 fold값으로 산출하여 GPR119의 활성 정도를 계산하였다. 산출된 화합물의 활성 fold값과 농도를 입력하여 프리즘 4(Prism4, GraphPad Inc. USA) 프로그램을 사용하여 EC 50값을 구하였다.
[737]
전술한 방법으로 도출한 본 발명의 대표적인 화합물들에 대한 GPR119 항진 활성 결과를 하기 표 45에 나타내었다.
[738]
[표45]
화합물 번호 GPR119 활성 (EC50, nM)
6 15
8 101
9 27
14 19
16 118
22 3.5
23 11
55 29
56 72
57 23
62 216
65 262
70 15
71 29
74 8
89 14
94 1
181 28
GSK1292263 25

[739]
본 발명의 실시예에서 제조된 피페리딘-아릴 유도체는 기존 화합물들과는 차별화된 골격을 가지며, GPR119 항진 활성 실험을 통하여 수 μM 이하 수준의 EC 50 값을 보이는 항진 활성을 확인함으로써, 비정상적인 혈당 수치를 보이는 상태인 당뇨의 치료제로서 유효한 약제조성물로 활용될 수 있다.
[740]
[741]
본 발명에 따른 상기 화학식 1로 표시되는 피페리딘-아릴 유도체는 목적에 따라 여러 형태로 제제화가 가능하다. 하기 제제예는 본 발명에 따른 피페리딘-아릴 유도체를 활성성분으로 함유시킨 제제예를 예시하는 것일 뿐, 이에 한정되는 것은 아니다.
[742]
[743]
제제예 1: 직접 가압 방식에 의한 정제의 제조
[744]
[745]
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후, 락토스 14.1 mg, 크로스포비돈 USNF 0.8 mg 및 마그네슘 스테아레이트 0.1 mg을 혼합하고 가압하여 통상의 정제의 제조방법에 따라 정제로 만들었다.
[746]
[747]
제제예 2: 습식 조립에 의한 정제의 제조
[748]
[749]
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후, 락토스 16.0 mg과 녹말 4.0 mg을 혼합하였다. 폴리솔베이트 80 0.3 mg을 순수한 물에 녹인 후, 이 용액의 적당량을 상기 혼합물에 첨가하여, 미립화하였다. 건조 후에 미립을 체질한 후 콜로이달 실리콘 디옥사이드 2.7 mg 및 마그네슘 스테아레이트 2.0 mg과 섞었다. 미립을 가압하여 통상의 정제의 제조방법에 따라 정제로 만들었다.
[750]
[751]
제제예 3: 분말 및 캡슐제의 제조
[752]
[753]
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 5.0 mg을 체로 친 후에, 락토스 14.8 mg, 폴리비닐 피롤리돈 10.0 mg, 마그네슘 스테아레이트 0.2 mg와 함께 섞었다. 혼합물을 적당한 장치를 사용하여 단단한 No. 5 젤라틴 캡슐에 채웠다.
[754]
[755]
제제예 4: 주사제의 제조
[756]
[757]
활성성분으로서, 본 발명의 화학식 1로 표시되는 피페리딘-아릴 유도체 100 mg을 함유시키고, 그 밖에도 만니톨 180 mg, Na 2HPO 4·12H 2O 26 mg 및 증류수 2974 mg을 함유시켜 통상적인 주사제의 제조방법에 따라, 주사제를 제조하였다.
[758]
[759]
상기에서 살펴본 바와 같이, 본 발명은 GPR119 항진 활성 효과를 가지는 신규한 화합물로서, 피페리딘-아릴 유도체 및 이의 약제학적으로 허용 가능한 염을 제공하였고, 그의 제조방법을 제공하였으며, 상기 피페리딘-아릴 유도체에 대한 GPR119 항진 활성 측정 결과, 수 μM 이하 수준의 활성을 확인함으로써, 신규 당뇨치료제를 제공하였다.
[760]
[761]
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 기술되었지만, 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속함은 당연한 것이다.
[762]
[763]

청구범위

[청구항 1]
하기 화학식 1로 표시되는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염: [화학식 1] 상기 화학식 1에서, R 1은 수소 또는 (C 1-C 10)알킬이고; X는 이고; *R 2는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; R 3은 (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; A 고리는 이고; R 4 내지 R 8은 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; Z는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; L은 단일결합, -O-(CR'R") n-, -(CR'R") n-O- 또는 NR 9-(CR'R") n-이고; R 9는 수소, (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이고; W는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 (C 1-C 10)알킬카보닐, (C 1-C 10)알콕시카보닐, (C 3-C 7)사이클로알킬카보닐, (C 3-C 7)사이클로알콕시카보닐, (C 3-C 20)헤테로아릴, (C 3-C 20)헤테로아릴카보닐, SO 2R 10, (C 6-C 20)아릴, (C 6-C 20)아릴카보닐 또는 이고; R 10은 (C 1-C 10)알킬, (C 3-C 7)사이클로알킬 또는 (C 6-C 20)아릴이고; R 11 및 R 12는 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; 상기 R 1, R 4 내지 R 6, R', R", R 11 및 R 12의 알킬, R 2, R 3 및 R 9의 알킬 또는 사이클로알킬, R 10의 알킬, 사이클로알킬 또는 아릴, Z 및 W의 아릴렌 또는 헤테로아릴렌, 및 Y의 알킬카보닐, 알콕시카보닐, 사이클로알킬카보닐, 사이클로알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐, 아릴 또는 아릴카보닐은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬, (C 3-C 7)사이클로알킬, (C 6-C 20)아릴, (C 6-C 20)아릴옥시, (C 1-C 10)알콕시, 할로(C 1-C 10)알콕시, (C 1-C 10)알킬설포닐, 아미노카보닐 및 (C 3-C 20)헤테로아릴로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있으며; 상기 헤테로아릴렌 및 헤테로아릴은 N, O 및 S로부터 선택되는 하나 이상의 헤테로원자를 포함한다.
[청구항 2]
제1항에 있어서, R 1은 수소 또는 (C 1-C 10)알킬이고; X는 이고; R 2는 수소 또는 (C 1-C 10)알킬이고; R 3은 (C 1-C 10)알킬 또는 (C 3-C 7)사이클로알킬이고; A 고리는 이고; R 4 내지 R 8은 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; Z는 단일결합, (C 6-C 20)아릴렌 또는 (C 3-C 20)헤테로아릴렌이고; L은 단일결합, -O-(CR'R") n-, -(CR'R") n-O- 또는 NR 9-(CR'R") n-이고; R 9는 수소 또는 (C 1-C 10)알킬이고; R' 및 R"은 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 (C 3-C 20)헤테로아릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 (C 1-C 10)알콕시카보닐, (C 3-C 20)헤테로아릴, (C 3-C 20)헤테로아릴카보닐, SO 2R 10, (C 6-C 20)아릴 또는 이고; R 10은 (C 1-C 10)알킬, (C 3-C 7)사이클로알킬 또는 (C 6-C 20)아릴이고; R 11 및 R 12는 각각 독립적으로 수소 또는 (C 1-C 10)알킬이고; 상기 R 10의 아릴, Z의 아릴렌 또는 헤테로아릴렌, 및 Y의 알콕시카보닐, 헤테로아릴, 헤테로아릴카보닐 또는 아릴은 각각 독립적으로 할로겐, (C 1-C 10)알킬, 할로(C 1-C 10)알킬 및 (C 3-C 7)사이클로알킬로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.
[청구항 3]
제2항에 있어서, 상기 는 하기 구조에서 선택되는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염: 상기 R 13 및 R 14는 각각 독립적으로 수소, 할로겐 또는 (C 1-C 10)알킬이고; R 9는 수소 또는 (C 1-C 10)알킬이고; n은 0 또는 1의 정수이다.
[청구항 4]
제2항에 있어서, R 1은 수소 또는 메틸이고; X는 이고; R 2는 수소, 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; R 3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는 이고; R 4, R 5, R 6', R 6", R 7 및 R 8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌( ) 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH 2) n-, -(CH 2) n-O- 또는 NR 9-(CH 2) n-이고; R 9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는 이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.
[청구항 5]
제2항에 있어서, R 1은 수소 또는 메틸이고; X는 이고; R 3은 메틸, 에틸, i-프로필, t-부틸 또는 사이클로헥실이고; A 고리는 이고; R 4', R 4", R 5', R 5", R 6', R 6", R 7 및 R 8은 각각 독립적으로 수소, 플루오로 또는 메틸이고; Z는 단일결합, 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 또는 벤조옥사졸릴렌이고; 상기 Z의 피리디닐렌, 페닐렌, 피리미디닐렌, 티에노[3,2-d]피리미디닐렌 및 벤조옥사졸릴렌은 각각 독립적으로 클로로, 브로모, 플루오로, 메틸, 에틸, 프로필, 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐 및 데실로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있고; L은 단일결합, -O-(CH 2) n-, -(CH 2) n-O- 또는 NR 9-(CH 2) n-이고; R 9는 수소 또는 메틸이고; n은 0 또는 1의 정수이고; W는 단일결합 또는 티아졸릴렌이고; 단, Z, L 및 W는 동시에 단일결합이 아니고; Y는 t-부톡시카보닐, 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐, 메틸설포닐, 에틸설포닐, t-부틸설포닐, 사이클로프로필설포닐, 사이클로헥실설포닐, 페닐설포닐, t-부틸페닐설포닐, 페닐 또는 이고; 상기 Y의 옥사다이아졸릴, 피리딜, 피리미딜, 아이소옥사졸릴카보닐 및 페닐은 각각 독립적으로 메틸, 에틸, i-프로필, n-프로필, 트라이플루오로메틸 및 사이클로프로필로 이루어진 군으로부터 선택되는 하나 이상의 치환체로 더 치환될 수 있는 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.
[청구항 6]
제1항에 있어서, 상기 피페리딘-아릴 유도체는 (1) (E)-t-부틸 4-(((6-(4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (2) (E)-t-부틸 4-(((6-(4-(1-(t-부톡시이미노)에틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (3) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (4) (E)-3-플루오로-4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심, (5) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심, (6) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (7) (E)-2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심, (8) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심, (9) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (10) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (11) (E)-3-플루오로-4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤즈알데하이드 O-(t-부틸) 옥심, (12) (E)-4-(5-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심, (13) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (14) (E)-4'-((1-(5-사이클로프로필아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심, (15) (E)-2,3',5'-트라이플루오로-4'-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심, (16) (E)-t-부틸 4-(((5-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트, (17) (E)-t-부틸 4-(((5-(4-((에톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트, (18) (E)-t-부틸 4-(((5-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트, (19) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심, (20) (E)-t-부틸 4-(((4'-((t-부톡시이미노)메틸)-2',3,5,6'-테트라플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (21) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-(t-부틸) 옥심, (22) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((메톡시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (23) (E)-t-부틸 4-(((4'-((에톡시이미노)메틸)-2',3,5-트라이플루오로-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (24) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (25) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (26) (E)-t-부틸 4-(((5-플루오로-6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (27) (E)-t-부틸 4-(((6-(4-((에톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (28) (E)-t-부틸 4-(((6-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)-5-플루오로피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (29) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심, (30) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-에틸 옥심, (31) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-(t-부틸) 옥심, (32) (E)-t-부틸 4-(((6-(2-플루오로-4-((메톡시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (33) (E)-t-부틸 4-(((6-(4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (34) (E)-4-(5-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심, (35) (E)-4-(5-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤즈알데하이드 O-메틸 옥심, (36) (E)-t-부틸 4-(((2',3,5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (37) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (38) (E)-t-부틸 4-(((6-(2,6-다이플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (39) (E)-t-부틸 4-(((6-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리딘-3-일)옥시)메틸)피페리딘-1-카복실레이트, (40) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤즈알데하이드 옥심, (41) (E)-t-부틸 4-(((5-(2-플루오로-4-((하이드록시이미노)메틸)페닐)피리미딘-2-일)옥시)메틸)피페리딘-1-카복실레이트, (42) (E)-4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (43) (E)-4'-((1-(사이클로프로필설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (44) (E)-4'-((1-((4-(t-부틸)페닐)설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (45) (E)-2,3',5'-트라이플루오로-4'-((1-(페닐설포닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (46) (E)-t-부틸 4-((7-(4-((t-부톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트, (47) (E)-t-부틸 4-((7-(2-플루오로-4-((하이드록시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트, (48) (E)-t-부틸 4-((7-(2-플루오로-4-((메톡시이미노)메틸)페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트, (49) (E)-t-부틸 4-((7-(4-((에톡시이미노)메틸)-2-플루오로페닐)티에노[3,2-d]피리미딘-4-일)(메틸)아미노)피페리딘-1-카복실레이트, (50) (E)-t-부틸 4-(((3,3',5-트라이플루오로-4'-((하이드록시이미노)메틸)-[1,1'-바이페닐]-4-일)옥시)메틸)피페리딘-1-카복실레이트, (51) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (52) (E)-4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤즈알데하이드 옥심, (53) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-에틸 옥심, (54) (E)-2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심, (55) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (56) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (57) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (58) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드, (59) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (60) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (61) (E)-4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오르피리딘-2-일)-2,6-다이플루오르벤즈알데하이드 O-메틸 옥심, (62) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드, (63) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드, (64) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)메탄아민 옥사이드, (65) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)-2-메틸프로판-2-아민 옥사이드, (66) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)사이클로헥산아민 옥사이드, (67) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드, (68) (Z)-N-(4-(5-((1-(5-메틸아이속사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드, (69) (Z)-N-(4-(5-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)피리딘-2-일)벤질리덴)프로판-2-아민 옥사이드, (70) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (71) (Z)-N-(4-(5-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드, (72) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드, (73) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (74) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (75) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드, (76) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로피리딘-2-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드, (77) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)사이클로헥산아민 옥사이드, (78) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드, (79) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드, (80) (Z)-N-(4-(4-((1-(t-부톡시카보닐)피페리딘-4-일)(메틸)아미노)티에노[3,2-d]피리미딘-7-일)-3-플루오로벤질리덴)사이클로헥산아민 옥사이드, (81) (Z)-N-((4'-((1-(사이클로헥실설포닐)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (82) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (83) (Z)-N-((4'-((1-(t-부톡시카보닐)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (84) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (85) (Z)-N-(4-(2-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리미딘-5-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드, (86) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (87) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-아이소프로필아이소옥사졸-3-카보닐)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (88) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (89) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (90) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (91) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (92) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (93) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (94) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (95) (Z)-N-((3,3',5,5'-테트라플루오로-4'-((1-(3-아이소프로필-1,2,4-옥사다이아졸-5-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (96) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드, (97) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드, (98) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)벤조[d]옥사졸-6-일)메틸렌)메탄아민 옥사이드, (99) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드, (100) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3-플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드, (101) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (102) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (103) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (104) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (105) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (106) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3,3',5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (107) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)에탄아민 옥사이드, (108) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드, (109) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)메탄아민 옥사이드, (110) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)에탄아민 옥사이드, (111) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,6-다이플루오로벤질리덴)프로판-2-아민 옥사이드, (112) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (113) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2-플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (114) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (115) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로-3',5'-다이메틸-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (116) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)메탄아민 옥사이드, (117) (Z)-N-(4-(5-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)피리딘-2일)-2,3-다이플루오로벤질리덴)프로판-2-아민 옥사이드, (118) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드, (119) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드, (120) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)메탄아민 옥사이드, (121) (Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드, (122) Z)-N-((2-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-7-플루오로벤조[d]옥사졸-5-일)메틸렌)프로판-2-아민 옥사이드, (123) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5',6-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (124) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)메탄아민 옥사이드, (125) (Z)-N-(4-(5-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)벤조[d]옥사졸-2-일)-3-플루오로벤질리덴)프로판-2-아민 옥사이드, (126) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드, (127) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드, (128) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (129) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)메탄아민 옥사이드, (130) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)프로판-2-아민 옥사이드, (131) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5',6-트라이플루오로-[1,1'-바이페닐]-3-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, (132) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (133) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)옥시)메틸)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (134) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (135) (Z)-N-((4'-((1-((Z)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (136) (Z)-N-((4'-((1-((E)-2-(t-부톡시이미노)프로파노일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (137) (Z)-N-((4'-((1-(4-에틸페닐)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (138) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (139) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (140) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (141) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (142) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (143) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (144) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)(메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (145) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (146) (Z)-N-((3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (147) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (148) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (149) (Z)-N-((4'-(((1-(t-부톡시카보닐)피페리딘-4-일)메틸)(메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (150) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (151) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (152) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)메탄아민 옥사이드, (153) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (154) (Z)-N-((2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (155) (Z)-N-((4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-일)메틸렌)에탄아민 옥사이드, (156) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (157) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (158) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3'-다이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (159) (E)-3'-클로로-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2-플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (160) (E)-4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (161) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (162) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-3,3',5,5'-테트라플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (163) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (164) (E)-2,3',5'-트라이플루오로-4'-((1-(5-(트라이플루오로메틸)피리미딘-2-일)피페리딘-4-일)메톡시)-[1,1'-바이페닐]-4-카브알데하이드 옥심, (165) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 옥심, (166) (E)-4'-(((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메틸)아미노)-2,3',5'-트라이플루오로-[1,1'-바이페닐]-4-카브알데하이드 O-메틸 옥심, (167) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)메탄아민 옥사이드, (168) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)에탄아민 옥사이드, (169) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)프로판-2-아민 옥사이드, (170) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-플루오로벤질리덴)-2-메틸프로판-2-아민 옥사이드, (171) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)프로판-2-아민 옥사이드, (172) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)메탄아민 옥사이드, (173) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)에탄아민 옥사이드, (174) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)프로판-2-아민 옥사이드, (175) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)벤질리덴)-2-메틸프로판-2-아민 옥사이드, (176) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)메탄아민 옥사이드, (177) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)에탄아민 옥사이드, (178) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)프로판-2-아민 옥사이드, (179) (Z)-N-(4-((2-(1-(5-에틸피리미딘-2-일)피페리딘-4-일)티아졸-4-일)메톡시)-3-메틸벤질리덴)-2-메틸프로판-2-아민 옥사이드, (180) (Z)-N-((4'-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3',5'-다이플루오로-[1,1'-바이페닐]-4-일)메틸렌)-2-메틸프로판-2-아민 옥사이드, 및 (181) (E)-1-(5-(4-((1-(5-에틸피리미딘-2-일)피페리딘-4-일)메톡시)-3,5-다이플루오로페닐)-3-플루오로피리딘-2-일)-N-아이소프로필메탄이민 옥사이드 로 이루어진 군으로부터 선택되는 유도체인 것을 특징으로 하는 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염.
[청구항 7]
1) 하기 화학식 2의 피페리딘 브로마이드 유도체 및 화학식 3 의 보론산 유도체를 반응시켜 화학식 4의 카보닐 유도체를 제조하는 단계; 및 2) 화학식 4의 카보닐 유도체를 화학식 5 또는 화학식 6의 하이드록실아민 유도체와 반응시켜 제1항의 화학식 1의 피페리딘-아릴 유도체를 제조하는 단계; 를 포함하는 피페리딘-아릴 유도체의 제조방법: [화학식 1] [화학식 2] [화학식 3] [화학식 4] [화학식 5] R 2O-NH 2 [화학식 6] R 3NHOH 상기 식에서, R 1, R 2, R 3, X, Z, L, W, Y 및 A 고리는 청구항 제1항에서의 정의와 동일함.
[청구항 8]
제1항 내지 제6항 중 어느 한 항에 따른 피페리딘-아릴 유도체 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 GPR119 항진 활성 관련 질환의 예방 또는 치료용 약제학적 조성물.
[청구항 9]
제8항에 있어서, 상기 GPR119 항진 활성 관련 질환은 당뇨 또는 당뇨 합병증인 것을 특징으로 하는 약제학적 조성물.
[청구항 10]
제9항에 있어서, 상기 당뇨 합병증은 비만, 관상 동맥 질환, 허혈성 뇌졸중, 말초 혈관 질환, 간헐성 파행증, 심근경색증, 식후 지질혈증, 내당능 손상의 증상, 공복 혈당 손상의 증상, 대사성 산증, 케톤증, 관절염, 골다공증, 고혈압, 울혈성 심부전, 당뇨병성 망막증, 황반 변성, 백내장, 당뇨병성 신증, 사구체경화증, 만성 신부전, 당뇨병성 신경병증, 협심증, 혈전증, 아테롬성동맥경화증, 심근경색증, 일과성 허혈성 발작, 뇌졸중, 혈관 재협착, 고혈당증, 고인슐린혈증, 고지혈증, 고중성지방혈증, 인슐린 내성, 족부 궤양, 궤양성 결장염 및 심내막 기능부전으로 구성된 군으로부터 선택되는 것을 특징으로 하는 약제학적 조성물.