Certains contenus de cette application ne sont pas disponibles pour le moment.
Si cette situation persiste, veuillez nous contacter àObservations et contact
1. (WO2018100581) COMPOSÉ DE TRAITEMENT DU DIABÈTE SUCRÉ DE TYPE 2 ET DE LA RÉSISTANCE À L'INSULINE
Dernières données bibliographiques dont dispose le Bureau international    Formuler une observation

N° de publication : WO/2018/100581 N° de la demande internationale : PCT/IL2017/051307
Date de publication : 07.06.2018 Date de dépôt international : 30.11.2017
CIB :
C12Q 1/68 (2018.01)
C CHIMIE; MÉTALLURGIE
12
BIOCHIMIE; BIÈRE; SPIRITUEUX; VIN; VINAIGRE; MICROBIOLOGIE; ENZYMOLOGIE; TECHNIQUES DE MUTATION OU DE GÉNÉTIQUE
Q
PROCÉDÉS DE MESURE, DE RECHERCHE OU D'ANALYSE FAISANT INTERVENIR DES ENZYMES OU DES MICRO-ORGANISMES; COMPOSITIONS OU PAPIERS RÉACTIFS À CET EFFET; PROCÉDÉS POUR PRÉPARER CES COMPOSITIONS; PROCÉDÉS DE COMMANDE SENSIBLES AUX CONDITIONS DU MILIEU DANS LES PROCÉDÉS MICROBIOLOGIQUES OU ENZYMOLOGIQUES
1
Procédés de mesure, de recherche ou d'analyse faisant intervenir des enzymes ou des micro-organismes; Compositions à cet effet; Procédés pour préparer ces compositions
68
faisant intervenir des acides nucléiques
Déposants :
MIR2ME LTD. [IL/IL]; 1 Emek Ayalon St. 7170634 Modiin, IL
Inventeurs :
HILLEL, Joseph; IL
ATZMON, Gil; IL
GEFEL, Dov; IL
KALMAN, Rony; IL
ZIV, Ehud; IL
BAXTER JONES, Colin; GB
WAYN, Lior; IL
MAIMONI, Oren; IL
Mandataire :
SHMELZER, Zeev; Ben-Ami & Associates P.O Box 94 7610002 Rehovot, IL
Données relatives à la priorité :
24935501.12.2016IL
Titre (EN) COMPOUND FOR DIABETES MELLITUS TYPE 2 AND INSULIN RESISTANCE
(FR) COMPOSÉ DE TRAITEMENT DU DIABÈTE SUCRÉ DE TYPE 2 ET DE LA RÉSISTANCE À L'INSULINE
Abrégé :
(EN) A compound for use as a medicament for administration thereof into a body for treating type 2 diabetic mellitus (T2DM) or for treating insulin resistance, the compound including a nucleotides sequence of UGGAGUGUGACAAUGGUGUUUG or at least 85% thereof, for silencing the complementary Messenger RNAs thereof.
(FR) L'invention concerne un composé utilisable comme médicament, et son administration dans un corps pour traiter le diabète sucré de type 2 (T2DM) ou la résistance à l'insuline. Ce composé comprend une séquence nucléotidique de UGGAGUGUGACAAUGGUGUUUG ou au moins 85% de celle-ci, pour le silençage de ses ARN messagers complémentaires.
États désignés : AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, RU, TJ, TM)
Office européen des brevets (OEB (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG)
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)