Recherche dans les collections de brevets nationales et internationales

1. (WO2018060239) PROCÉDÉ AMÉLIORÉ DE SÉLECTION DE CELLULES PRODUISANT UN POLYPEPTIDE

Pub. No.:    WO/2018/060239    International Application No.:    PCT/EP2017/074481
Publication Date: Fri Apr 06 01:59:59 CEST 2018 International Filing Date: Thu Sep 28 01:59:59 CEST 2017
IPC: C07K 16/00
C12N 15/85
Applicants: F. HOFFMANN-LA ROCHE AG
HOFFMANN-LA ROCHE INC.
Inventors: KOPETZKI, Erhard
PLOETTNER, Oliver
Title: PROCÉDÉ AMÉLIORÉ DE SÉLECTION DE CELLULES PRODUISANT UN POLYPEPTIDE
Abstract:
La présente invention concerne un acide nucléique comprenant dans la direction 5' à 3' i) un premier fragment d'acide nucléique codant pour un polypeptide d'intérêt sans un codon de terminaison de translation de trame, ii) un second fragment d'acide nucléique fonctionnellement lié audit premier fragment d'acide nucléique qui commence avec le site donneur d'épissage 5' d'un domaine CH3 ou CH4 de chaîne lourde de 5 immunoglobulines et qui est terminé par le site accepteur d'épissage 3' de l'exon M1 du domaine transmembranaire d'immunoglobuline suivante de la chaîne lourde de l'immunoglobuline suivante et qui comprend dans la trame un codon de terminaison de translation et un signal de polyadénylation, et iii) un troisième fragment d'acide nucléique fonctionnellement lié audit deuxième acide nucléique codant pour au moins un fragment d'un domaine transmembranaire 10, le second fragment d'acide nucléique ayant à son extrémité 3' la séquence nucléotidique CTACCACCCCCTTCCTGTCCAG (SEQ ID NO : 29) ou TGACCACGCCAATCGTGTCCAG (SEQ ID NO : 14) ou CTACCACGCCAATCGTGTCCAG (SEQ ID NO : 31).