Traitement en cours

Veuillez attendre...

Paramétrages

Paramétrages

Aller à Demande

1. WO2017076974 - BIOMARQUEUR POUR LA STRATIFICATION DU RISQUE DANS UNE MALADIE CARDIOVASCULAIRE

Note: Texte fondé sur des processus automatiques de reconnaissance optique de caractères. Seule la version PDF a une valeur juridique

[ EN ]

BIOMARKER FOR RISK STRATIFICATION IN CARDIOVASCULAR DISEASE

FIELD OF THE INVENTION

The present invention relates to the field of medicine and in particular to the field of cardiovascular disease. More in particular, the invention relates to a circulating human microRNA (miRNA) present in blood samples and the use of said miRNA , in particular in risk stratification of human patients suffering from or suspected to suffer from heart failure. The present invention thus provides for the use of the said mRNA in stratifying the risk of mortality and/or re-hospitalization of heart failure patients. More specifically, the invention relates to the field of risk-stratification in cardiovascular disease, in particular heart failure, using miR-1306-5p.

BACKGROUND ART

Heart failure (HF) may be considered as the fatal funnel through which all cardiovascular disorders eventually travel. Despite advances in the understanding and treatment of HF, patients diagnosed with HF still have a poor prognosis. HF is a syndrome rather than a primary diagnosis, which results from any structural or functional cardiac disorder that impairs the ability of the heart to support the physiological circulation. Basically, HF is normally due to heart damage that has developed over time and which cannot be cured. The heart damage causes the heart muscle to weaken, which in turn impairs its blood pumping activity to a point where there is not enough blood and oxygen to meet the body's needs, eventually leading to the expression or occurrence of HF.

In the clinic, a number of diagnostic tools are typically used by clinicians or health practitioners to diagnose HF in a patient (e.g. suffering or suspected of suffering of HF), including:

a clinical/physical examination, such as checking for a history of cardiac disease, determining weight gain/loss, duration, etiology, edema, pulmonary status, and determining left ventricular function/Ejection Fraction (EF) by means of an echocardiogram, etc.;

a laboratory evaluation, such as performing a blood count, serum electrolytes, urea, serum creatinine, etc.; and

a determination of levels (generally in blood samples) of known protein biomarkers such as BNP and/or NT-proBNP.

As soon as a patient is diagnosed with HF, it remains difficult to assess the (near-) future risk of developing severe complications related to HF (herein after also referred to as worsening of the disease, i.e. HF). Such severe complications are well-known to the skilled person and are, for example, described by Ponikowski P et al. (2016) ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: The Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC). Eur J Heart Fail. 2016 Aug;18(8):891-975. Complications related to HF include death as a direct result of the failing heart (mortality), or (re-)hospitalization due to complications that come with the disease. Other complications may include kidney damage, heart valve dysfunction, heart rhythm anomalies, liver damage and others, all of which can contribute to (re-)hospitalization and/or cause death. In the field, besides mortality, re-hospitalization of the patient is also considered 'worsening' of the disorder (Ponikowski, supra). Predicting the course of the disease in a given HF patient is considered difficult, but extremely important as it may for example save life, improve HF patients life and long-term prognosis, and may allow for prediction or treatment decisions and improved HF disease management.

As mentioned above, different factors are associated with HF but there is stillno simple integrative manner to estimate the course of the disease. It is well-known that dynamic factors like renal function, haemoglobin levels, cardiac protein biomarker levels or extent of coronary artery disease appear relevant, whereas also static factors like genetic background, race and gender appear to contribute to a high extent to the course of the disease. Ideally one would integrate all these aspects in one single and simple measurement to generate reliable risk profiles for HF patients. Attempts to reach this goal have led to the development of several HF risk prediction models such as the SEATTLE HF model (Levy et al. 2006. The Seattle Heart Failure Model: prediction of survival in heart failure. Circulation 1 13(1 1 ):1424-1433) and the Framingham risk score. However, it should be noted that these models are complex and include variables that are subject to interpretation by a clinician and are therefore not in all cases reliable. Further, calculating these risk scores is time consuming and cumbersome and therefore not often used or not easily used in daily clinical practice. Above all, current prediction models do not provide reliable risk prediction due to the complexity of the presentation of HF and the wide variety of underlying causes, as discussed herein. Hence, one of the major challenges in the prognostication or prediction as well as the monitoring of treatment of HF is the identification of reliable biomarkers that can be measured routinely and rapidly in easily accessible samples,

such as whole blood samples, or samples derived from blood, such as serum or plasma.

Over the years, cardiologists have used protein markers to diagnose and assess the severity of HF. For instance, the Brain Natriuretic Peptide (BNP) and its N-terminal product referred to as N-terminal prohormone of brain natriuretic peptide ((NT-proBNP) have become classical biomarkers (Di Angelantonio et al. (2009) B-type natriuretic peptides and cardiovascular risk: systematic review and meta-analysis of 40 prospective studies. Circulation 120(22):2177-2187). In recent years, new and emerging protein biomarkers have been identified but they are at present not generally accepted and/or not widely used. Examples of such possible biomarkers include: hs-TNT, ST-2, Galectin-3 and GDF15 (Van Kimmenade et al. 2012 Emerging Biomarkers in Heart Failure. Clinical Chemistry 58(1 ): 127-138). However, the current protein-based biomarkers are considered to have relatively limited value in accurately prognosticating patients with HF, because measuring protein biomarkers in the clinical laboratory of the hospital takes time. Moreover, the tests are generally very expensive, also because each protein biomarker requires a separate test with different reagents. The physician wants to get a full picture of a patient that comes to the hospital with acute cardiac symptoms and often has to ask the clinical laboratory to perform several biomarker tests. This takes time, which clinicians do not have when diagnosing a patient in an acute life-threatening situation.

An ideal biomarker fulfills at least a number of criteria: it should be accessible through non-invasive procedures; it should have a high degree of specificity and sensitivity; it should distinguish between different pathologies that require early detection; it should be sensitive to relevant changes in the state or course of the disease; it should have a sufficiently long half-life within the sample; it should have the capability for rapid and accurate detection; and it should be 'actionable' (i.e. the outcome of a test leads to a treatment decision and improved HF disease management).

Over the last decade, a new type of molecular biomarker has been identified that fulfills most - if not all - of these criteria: microRNA molecules (herein, and generally referred to as 'miRNA' or 'miRNAs' in the plural form). miRNAs have been explored over the recent years for their potential as biomarkers for numerous disorders including cardiovascular disease such as HF (see WO 2005/1 1 121 1 ; WO 2009/012468; WO 2010/126370; WO 201 1/133036; WO 2012/160551 ). miRNAs are a growing class of

evolutionary conserved small non-coding RNAs (18-24 nucleotides) that regulate gene expression at the posttranscriptional level by targeting the 3' untranslated region of mRNA transcripts. The first miRNA was discovered in the early nineties whereas the presence in vertebrates was confirmed in 2001. By influencing protein translation, miRNAs have emerged as powerful regulators of a wide range of biological processes. miRNAs are present in blood, where they have been detected in different blood-derived samples and separate blood components, such as plasma, serum, platelets, exosomes, micro-vesicles, apoptotic bodies, erythrocytes and nucleated blood cells. Multiple research groups have reported on the use of miRNAs as circulating biomarkers for diagnosis of cardiovascular and other diseases. Thus far, distinctive patterns of circulating miRNAs have been found for several cardiovascular diseases, such as:

Myocardial infarction (Wang GK et al. 2010. Circulating microRNA: a novel potential biomarker for early diagnosis of acute myocardial infarction in humans. Eur Heart J 31 :659-666);

Heart failure (Tijsen AJ et al. 2010 miR-423-5p as a circulating biomarker for heart failure. Circ Res 106:1035-1039);

Atherosclerotic disease (Fichtlscherer S et al. 2010 Circulating microRNAs in patients with coronary artery disease. Circ Res 107:677-684);

- Diastolic heart failure (Wong LL et al. 2015 Circulating microRNAs in heart failure with reduced and preserved left ventricular ejection fraction. Eur J Heart Fail. Jan 23);

Unstable angina pectoris (Zeller T et al. 2014 Assessment of microRNAs in patients with unstable angina pectoris. Eur Heart J. 35(31 ) 2106-14); and - Hypertension (Li S et al. 201 1 Signature microRNA expression profile of essential hypertension and its novel link to human cytomegalovirus infection. Circulation 124:175-184).

An overview of studies related to the detection of miRNAs as biomarkers in cardiovascular diseases is provided in Creemers et al. (Circulating microRNAs: Novel biomarkers and extracellular communicators in cardiovascular disease? 2012. Circ Res 1 10:483-495). It has become clear that gene regulation by miRNAs is often a process involving multiple miRNAs, and indeed several miRNAs are generally found over-expressed or down-regulated when one focuses on a single disorder.

HF is the single most frequent cause of hospitalization in elderly and the societal costs in Europe and US exceed 400 billion euro per year. In some countries, such as the US, hospitals receive a penalty when re-hospitalization numbers are too high (e.g. the Hospital Readmissions Reduction Program in the US uses a 30-day readmission cut-off for heart failure). Therefore, next to the clinical relevance of a risk prediction test for patients admitted to the hospital with HF, the economic impact by assessing and hereby minimizing the risk of short term re-hospitalization is substantial. As outlined above, there remains a strong need for new, alternative or improved reliable and easy-to-determine biomarkers and the use thereof inthe riskassessment of HF and/or risk stratification of HF (i.e. in patient(s) suffering or suspected to suffer from HF).

SUMMARY OF THE INVENTION

The invention relates to (human) miR-1306-5p for use as a biomarker in the risk stratification of human patients suffering from heart failure (HF), or of human patients suspected to suffer from HF. The invention also relates to an in vitro method for risk stratification of a human HF patient (i.e. a human patient suffering from heart failure), or of a patient suspected to suffer from HF, the method comprising the steps of: determining the level of miR-1306-5p in a biological sample (obtained) from the patient; comparing this determined level of miR-1306-5p to the level of miR-1306-5p (determined) in a standard sample; and determining the risk of re-hospitalization and/or mortality of the patient, wherein an increase in the level of miR-1306-5p in the biological sample (of the patient suffering or suspected of suffering from HF) compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk, e.g. an increased risk of re-hospitalization and/or mortality of the patient. The method thus allows for risk stratification of a human patient suffering from heart failure or of a patient suspected to suffer from HF. In another embodiment, the invention relates to a method for risk stratification of a human HF patient, or of a human patient suspected to suffer from HF, the method comprising the steps of: obtaining a biological sample from the patient; determining the level of miR-1306-5p in the biological sample; comparing the level determined in the previous step to the level of miR-1306-5p in a standard sample; and determining the risk of re-hospitalization and/or mortality of the patient, wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk. In yet another embodiment, the invention relates to a method of treatment of a human HF patient, or of a human patient suspected to suffer from HF, the method comprising the steps of: obtaining a biological sample from the patient; comparing the level of miR-

1306-5p in the biological sample to the level of miR-1306-5p in a standard sample; treating the patient in the event that the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk of re-hospitalization and/or mortality (i.e. wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk).

Preferably, the risk is determined for a period of approximately four, three, two, or preferably approximately one year following sampling the biological sample. In another preferred aspect, the risk is determined by adding the patient's weighted value of one or more established risk factors for HF, as is known to the skilled person (see, for example, Passantino A et al. World J Cardiol. 2015 Dec 26;7(12):902-1 1 ). In yet another preferred aspect, the risk is determined by adding the weighted value of the level of N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (determined) in a biological sample from the patient in comparison to the NT-proBNP level in a standard sample.

Preferably, the standard sample is a sample obtained from an HF patient not having experienced a worsening condition due to HF within one year following sampling (i.e. obtaining the sample), or from a healthy individual (e.g. a person not suffering from HF, for example a person not suffering from HF at least one year after sampling) at any time. Also preferred are methods according to the invention, wherein the biological sample and/or the standard sample is a blood sample, more preferably a serum sample or a plasma sample.

The invention also relates to an in vitro method of determining whether a human HF patient is at risk of suffering from a worse condition due to HF, for example within four, three, two or one year from sampling, comprising: determining in a biological sample from said patient the expression of miR-1306-5p; and determining in a standard sample the expression of miR-1306-5p (i.e. the level of MIR-1306-5p in the sample), wherein an upregulation of miR-1306-5p in said biological sample in comparison to the level in said standard sample is indicative for a risk of a worsening condition of said patient due to HF, and wherein said standard sample is from a HF patient not having experienced a worse condition within one year following sampling, or from a healthy individual.

DETAILED DESCRIPTION

It is contemplated that any method, use or composition described herein can be implemented with respect to any other method, use or composition described herein. Embodiments discussed in the context of methods, use and/or compositions of the invention may be employed with respect to any other method, use or composition described herein. Thus, an embodiment pertaining to one method, use or composition may be applied to other methods, uses and compositions of the invention as well.

Definitions

Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, preferred materials and methods are described herein.

The term "heart failure" (abbreviated as HF) as understood in the art and as used herein refers to the pathophysiologic state in which the heart, via an abnormality of cardiac function (detectable or not), fails to pump blood at a rate commensurate with the requirements of the metabolizing tissues and/or pumps only from an abnormally elevated diastolic filling pressure. Heart failure may be caused by myocardial failure but may also occur in the presence of near-normal cardiac function under conditions of high demand. Heart failure always causes circulatory failure, but the converse is not necessarily the case because various non-cardiac conditions (e. g. hypovolemic shock, septic shock) can produce circulatory failure in the presence of normal, modestly impaired, or even supranormal cardiac function. The term "heart failure" thus includes systolic and diastolic heart failure, acute heart failure and chronic heart failure, irrespective of the cause of heart failure, and irrespective of whether or not there is a genetic component associated with the heart failure and/or the cause of heart failure.

In agreement with the above definition, MeSH (Medical Subject Headings), the NLM (National Library of Medicine) controlled vocabulary thesaurus used for indexing articles for PubMed defines HF as heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (e.g. ventricular dysfunction), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as myocardial infarction.

Examples of conditions or diseases that may lead or contribute to HF include: coronary artery disease, heart attack, high blood pressure (hypertension), faulty heart valves, damage to the heart muscle (cardiomyopathy), myocarditis, congenital heart defects, abnormal heart rhythms (heart arrhythmias), and other diseases or conditions such as diabetes, HIV, hyperthyroidism, hypothyroidism, or a buildup of iron (hemochromatosis) or protein (amyloidosis), severe infections, allergic reactions, viruses that attack the heart muscle, blood clots in the lungs, the use of certain medications and others.

Heart failure signs and symptoms may include: shortness of breath (dyspnea), fatigue and weakness, swelling (edema) of the legs, ankles and feet, rapid or irregular heartbeat, reduced ability to exercise, persistent cough or wheezing with white or pink blood-tinged phlegm, increased need to urinate at night, swelling of the abdomen (ascites), sudden weight gain from fluid retention, lack of appetite and nausea, difficulty concentrating or decreased alertness, sudden, severe shortness of breath and coughing up pink, foamy mucus, and others.

The term "risk stratification" is known to the skilled person and refers to a medical decision or an estimate of a person's or patient's risk of suffering of a particular condition (e.g. HF) and/or complications from an initial condition (e.g. complications relating to HF). Risk stratification is in the art typically made based on a constellation of activities or features such as laboratory measurments (e.g. measurement of blood biomarkers such as BNP and/or NT-proBNP) and clinical testing (e.g. echocardiogram). The practice of performing risk stratification assessment in clinic is also valuable or useful for determining the need-or lack thereof-for preventive intervention. In other words, the practice of assessing risk stratification allows to predict or estimate whether a patient suffering from HF or suspected to suffer from HF has an increased risk of being re-hospitalized or worse, has an increased risk of dying due to the HF or related causes some time during the next period of time, for example the following 12 months (or longer, up to 2, 3, or 4 years) after the patient has been assessed, for example, with the method as disclosed herein.

In the present invention, the term "risk stratification of a human patient suffering from HF or of a human patient suspected to suffer from HF" includes the act of estimating or determining said patient's risk of suffering from HF and/or complications from conditions relating to HF, such as re-hospitalization and/or mortality of said patient, using the method as taught herein, i.e. using the blood biomarker of the invention (miR-1306-5p.

The skilled person knows how to establish if a human patient is suffering from HF, for example the patient may be presenting heart failure signs and symptoms such as shortness of breath (dyspnea), fatigue and weakness, swelling (edema) of the legs, ankles and feet, rapid or irregular heartbeat, reduced ability to exercise, persistent cough or wheezing with white or pink blood-tinged phlegm, increased need to urinate at night, swelling of the abdomen (ascites), sudden weight gain from fluid retention, lack of appetite and nausea, difficulty concentrating or decreased alertness, sudden, severe shortness of breath and coughing up pink, foamy mucus, and others.

Likewise, a human patient suspected to suffer from HF may be a patient who already suffers or has suffered from one or more conditions or diseases known to lead to or contribute to HF such as coronary artery disease, heart attack, high blood pressure (hypertension), faulty heart valves, damage to the heart muscle (cardiomyopathy), myocarditis, congenital heart defects, abnormal heart rhythms (heart arrhythmias), and other diseases or conditions such as diabetes, HIV, hyperthyroidism, hypothyroidism, or a buildup of iron (hemochromatosis) or protein (amyloidosis), severe infections, allergic reactions, viruses that attack the heart muscle, blood clots in the lungs, the use of certain medications and others.

The term 'subject' or 'patient' as used herein refers to a human subject or a human patient.

The term 'sample' as used herein is used in its broadest sense as containing nucleic acids. A sample may comprise a bodily fluid such as blood or urine; the soluble fraction of a cell preparation, or an aliquot of media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, buccal cells, skin, or hair; and the like.

A preferred sample for detection of a miRNA according to the invention is a body fluid selected from blood and urine. A most preferred sample is a blood sample. A blood sample may comprise a whole blood sample, or a sample that is obtained by centrifugation and/or filtration such as, for example, plasma, serum, platelets, red blood cell, white blood cells, as is known to the skilled person. A blood sample may be obtained by venepuncture, arteripuncture and/or capillary puncture such as, for example, a finger prick. The sample, preferably a blood sample, may be collected in a tube comprising an anticoagulant such as a heparin tube or an EDTA-tube, as is known to the skilled person.

The term 'biological sample' or 'test sample' as used herein refers to a sample (e.g. blood sample or tissue sample) taken from a subject or a patient suffering from HF or who is at risk of suffering from HF. Typically a test or biological sample derives from an unhealthy human subject or human patient.

The term 'control sample' or 'standard sample' as used herein refers to a sample (e.g. blood sample) taken from a human subject or a human patient not suffering from HF or who is not at risk of suffering from HF. Typically a control sample or standard sample derives from a healthy human subject. In some embodiments the control sample is from a patient not having experienced a worsening condition due to HF within one year following sampling.

Alternatively, a patient may be followed over time, e.g. samples may be obtained from the patient during different time points (for example every 6 months or year) and the level of miR-1306-5p, and changes therein may be followed over time and/or compared with previous samples taken from the same patient, for example with a sample obtained and for which within one year following sampling of said sample, the patient has not experienced a worsening condition due to HF.

In the present invention, the miRNAs follow a standard nomenclature system, as is known to the skilled person. For instance, an uncapitalized "mir-" refers to a pre-miRNA, while a capitalized "miR-" refers to a mature form. miRNAs with nearly identical sequences are annotated with an additional lower case letter. For example, miR-1306a is closely related to miR- 1306b. miRNAs that are 100% identical but are encoded at different places in the genome are indicated with additional dash-number suffix: miR-1306-1 and miR-1306-2 are identical but are produced from different pre- miRNAs. Species of origin is designated with a three-letter prefix, e.g., hsa-miR-1306 would be from human (Homo sapiens) and oar-miR-1306 would be a sheep (Ovis aries) miRNA. When relative expression levels are known, an asterisk following the name indicates an miRNA expressed at low levels relative to the miRNA in the opposite arm of a hairpin. For example, miR- 306 and miR- 1306* would share a pre- miRNA hairpin, but relatively more miR- 1306 would be found in the cell. The suffices 5p and 3p indicate if a miRNA is derived from the 5'arm or the 3'arm of the pre-miRNA respectively. These suffices are used when both miRNAs are expressed at equal levels. For example miR-1306-5p and miR-1306-3p would share a pre-miRNA hairpin. According to the present invention, miRNAs as mentioned herein are capable of counteracting expression of specific gene products. As used herein, the term "miRNA" encompasses any isoform of the said miRNA and all members of the said miRNA family are capable of counteracting expression of the specific gene products. The term "miRNA" thus includes precursors such as pri-miRNA and pre-miRNA, star-sequences such as miR-1305 and miR-1306*, family members; and cluster members. Preferably, the term miRNA relates to the mature form of miR-1306-5p, the sequence of which is disclosed herein.

The term 'increased (expression) level' and 'decreased (expression) level' of the biomarker (e.g. miR-1306-5p)) of the invention refers to a substantially or significantly increased expression level or substantially or significantly decreased expression level of the biomarker (e.g. miR-1306-5p) as taught herein. For instance, a level of expression of miR-1306-5p in a test or biological sample from a HF patient is increased or decreased when it is at least 1 % or 5%, such as 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% higher or lower, respectively, than the expression level of miR-1306-5p in a control sample or standard sample, e.g. from a subject not suffering from HF.

The term 'about', as used herein indicates a range of normal tolerance in the art, for example within 2 standard deviations of the mean. The term 'about' can be understood as encompassing values that deviate at most 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.05%, or 0.01 % of the indicated value.

The term 'comprising' or 'to comprise' and their conjugations, as used herein, refer to a situation wherein said terms are used in their non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It also encompasses the more limiting verb 'to consist essentially of and 'to consist of.

Reference to an element by the indefinite article 'a' or 'an' does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article 'a' or 'an' thus usually means 'at least one'.

Method of the invention

The overall challenge in reliably assessing and predicting cardiovascular risk in general (including HF) is in identifying alternative, novel, reliable and easy-to-measure biomarkers. As discussed above, HF is a multi-factorial syndrome and various biological pathways such as biomechanical strain, remodeling, inflammation, cardiomyocyte injury and renal function are or may be involved in the disease process. This means that identification of reliable biomarkers has been challenging The present inventors have reasoned that miRNAs could provide a new class of reliable biomarkers that is, for example, complementary to currently used clinical data, signs and symptoms of HF. Specifically, the present inventors sought to determine whether molecular profiling of circulating miRNAs derived from either plasma, serum or whole blood (or specific separated fractions thereof) could be used for diagnosing HF, and whether it could also be used to predict risk or to prognosticate patients with HF or for use in a method to assess risk stratification of a human patient suffering from HF or of a human patient suspected to suffer from HF. The present inventors further sought to determine whether HF patients with a more malignant course of the disease would have a miRNA expression pattern that is different from the miRNA pattern of HF patients experiencing a milder course of the disease. It was envisioned that such difference could possibly be determined by miRNA profiling. If such an miRNA or set/panels of miRNAs would exist, these would - alone or in concert with the established clinical parameters - allow determining the risk a given HF patient to be re-hospitalized within a certain period of time after initial diagnosis of HF, or determining the risk of suffering from more severe outcomes such as the risk of mortality as a result of HF. The inventors asked themselves whether it would be possible to identify one or more miRNAs and determine their expression in blood samples that would predict whether a given HF patient would have an increased risk of worsening HF such as being hospitalized again, or worse, the patient could have an increased risk of dying within a certain period of time after being diagnosed with HF. Such knowledge would help the clinicians to devise appropriate treatment, for instance replacing a routine treatment by another treatment which is more indicated for the patient's conditions.

Surprisingly, the inventors established that the level of and alterations in a particular miR, i.e. miR-1306-5p, can be used to identify patients at higher risk of suffering from HF or complications (e.g. re-hospitalisation and/or death/mortality) thereof and who would benefit from a more tailored therapy management. The benefits of identifying such patients, based on blood levels of miR-1306-5p, include: 1 ) such patients may be seen more frequently by the treating cardiologist instead of less frequent visits to the GP or nurse, 2) such patients may be evaluated to add therapies (like adding angiotensin receptor antagonists) or by using different combinations of medicaments like replacing ace inhibition by neprylisin, and 3) the threshold to consider invasive therapies like cardiac resynchronization would be lower in such patients.

For the invention, the inventors used an animal model of cardiac disease/stress to identify miRNAs that are produced and released by the heart and validated for the miRNA of the invention that it could predict the course of the disease in the case of patients already diagnosed with HF.

In a first aspect there is provided for miR-1306-5p for use as a biomarker in the risk stratification of human patients suffering from heart failure (HF), or of human patients suspected to suffer from HF.

As explained herein and as shown in the example miR1306-5p may be used as a biomarker to predict risk related to HF and the course of the disease.

In a next aspect, the present invention relates to an in vitro method of risk stratification of a subject suffering from HF (i.e. a human HF patient), or a patient suspected to suffer from HF, the method comprising: a) determining the level of expression of miR-1306-5p in a biological sample from the subject;

b) comparing the level of expression of said miR-1306-5p in said biological sample (as determined in step a) to the level of miR-1306-5p in a standard sample;

and c) determining the risk of re-hospitalization and/or mortality of the patient (e.g. due to HF, or due to complications thereof)

wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in said standard sample is indicative for an increased risk, e.g. an increased risk of worsening HF such as re-hospitalization or mortality due to HF or complications thereof.

In some embodiment step c) comprises determining the risk of re-hospitalization and/or mortality due to HF, or due to complications thereof, within, for example, 1 , 2, 3 or 4 years from the initial diagnosis of HF, wherein an increase in the level (e.g. the level of expression) of miR-1306-5p in said biological sample compared to the level of miR-1306-5p in said standard sample is indicative for an increased risk of worsening HF such as re-hospitalization or mortality due to HF or complications thereof. The skilled person will understand that a subsequent decrease may be indicative for a decreased risk of worsening HF such as re-hospitalization or mortality.

The skilled person understands that time limits in years are approximate values. Hence, although the risk stratification preferably relates to a period of one year after the sample has been obtained from the patient, such should be regarded as an approximate period. Nevertheless, alterations (i.e. increase) in the level of miR-1306-5p in blood samples (preferably serum or plasma) as compared to standard and comparable samples from patients not suffering from worsening effects, of from healthy individuals, is indicative for worsening of the condition (e.g. re-hospitalization or death of said patient), which generally takes place in the first year after the patient has been initially diagnosed with HF (and the sample is generally drawn).

In a preferred embodiment, the level of the biomarker (i.e. miR-1306-5p) of the present invention in a biological sample of a subject suffering from HF is significantly higher than in the standard sample. The biological sample is preferably a blood sample, and more preferably, the blood sample is a plasma sample.

In a further preferred embodiment, the standard sample may be obtained or derived from a patient with HF that encountered a milder form of the disease wherein no mortality or re-hospitalization due to HF occurred within one year from sampling . Alternatively the standard sample may be obtained or derived from a healthy individual or individuals (not suffering from HF).

It was found that the miRNA of the present invention (i.e. miR-1306-5p) may be reliably used in a method for assessing risk stratification of HF, particularly for assessing or predicting a worsening condition such as mortality and/or re-hospitalization of a HF patients. Preferably, the prediction of worsening expressed by re-hospitalization, major adverse cardiac events (MACE; for example cardiac death, nonfatal myocardial infarction, unstable angina (see, for example, J Thorac Imaging. 2012 Jan;27(1 ):23-8. doi: 10.1097/RTI.0b013e3181f55d0d) and/or mortality relates to the period of approximately four, three, two and preferably approximately one year following the sampling. Such sampling is generally when the initial diagnosis of HF in said patient was made. The skilled person is aware of the fact that MACE are generally accepted as being related to HF, and that such events generally lead to (re-)hospitalization. This means that the term "re-hospitalization" generally includes the occurrence of MACE.

The skilled person is also aware of the fact that not all HF patients will die or will have to be (re-) hospitalized due to their HF, since some patients recover well and respond well to their treatment, or will die or get re-hospitalized because of other reasons. However, some patients that are initially diagnosed with HF, run a higher risk of dying or run a higher risk of MACE (Major Adverse Cardiac Events) and re-hospitalization due to their disease, than other HF patients. The present invention provides the tools and methods to address that specific risk by providing a newly identified miRNA, i.e. miR-1306-5p, of which its altered expression levels (i.e. increased level (i.e. amounts and/or concentrations) in biological samples is indicative of higher risk of re-hospitalization and/or mortality/death in HF patients.

The assessment and use of miR-1306-5p according to the present invention can optionally be broadened by determining the levels of other biomarkers, such as the protein biomarker NT-proBNP. Hence, miR-1306-5p, optionally combined with NT-proBNP, may be used in the method for assessing risk stratification of patients with HF (suffering or suspected to suffer) as taught herein.

The level of miR-1306-5p can be determined quickly upon initial diagnosis of HF, or suspicion of HF, using methods known to the person skilled in the art. The level ("level of expression") of miR-1306-5p of the present invention in a blood sample (preferably serum or plasma, most preferably plasma) of a (suspected) HF patient, or diagnosed HF patient, will tell the clinician what the risks are of worsening of the patient's condition over the next period of time, preferably within a period of approximately 1 , 2, 3 or 4 years, most preferably within a period of one year from drawing (obtaining) the sample from the patient (sampling), for example at or around the time the initial diagnosis of HF was made. More preferably, because of the high costs that comes with re-hospitalization, it is preferred that the short term risks are can be calculated. It is therefore preferred to assess the risk of worsening of the patient's condition within the period of one year from the time of sampling. The inventors of the present invention

have found that in the event that the miRNA of the present invention (i.e. miR-1306-5p) is upregulated (e.g. an increased level) in a sample, e.g. a blood sample (serum, plasma, or whole blood) in comparison to a standard sample, that such HF patients have an increased risk of dying (increased mortality) or being re-hospitalized within one year from their initial diagnosis of HF. This knowledge greatly adds to the way HF patients could be treated after being diagnosed with HF to lower that risk, or to monitor such subjects more intensively. The present invention provides a miRNA (i.e. miR-1306-5p) for the prediction of mortality and/or re-hospitalization, preferably for human subjects suffering from HF.

In addition to measuring the expression of the miRNA of the present invention (i.e. miR-1306-5p) in a sample, e.g. a blood sample (preferably a plasma sample) of a HF patient (suffering or suspected of suffering), one or more established risk factors can be determined for said patient. The skilled person is aware of the standard established risk factors that are generally addressed or routinely assessed for a patient that has (suspected) HF. In an embodiment, these established risk factors are preferably measured in concert with the expression of the miRNA of the present invention (i.e. miR-1306-5p). In a preferred embodiment, the concentration of miR-1306-5p in a sample, e.g. a blood sample, from said patient is measured. In another preferred aspect, the same miRNA is measured together with measuring the level of the protein biomarker NT-proBNP. In both cases, the measurement may be followed by calculating a risk score through an algorithm, said algorithm preferably combining the weighted values of one or more established risk factors and the weighted values of said miRNA concentration. Notably, said algorithm preferably compares the combined weighted values to a standard value from a sample of one or more patients having HF but experiencing a milder form of the disease without re-hospitalization or mortality. Finally, based on the result of the biomarker expression, preferably in combination with the assessment of one or more established risk factors in the algorithm, the prognosis of said patient is determined. In a highly preferred embodiment the risk of re-admission/re-hospitalization and/or the risk of mortality due to HFis determined in this way. Besides determining the risk of re-hospitalization and/or mortality, also the likelihood of improvement and the selection or adjustment of a treatment can be based on the outcome of the methods of the present invention.

As outlined above, patients as well as their clinicians will benefit from a quick and reliable assay. Measuring the expression of miRNAs (e.g. miR-1306-5p) can generally

be performed in a quick and reliable manner. The inventors of the present invention have shown that such is possible. Therefore, in a highly preferred embodiment, the methods of the present invention are performed in a single step assay.

The inventors of the present invention performed studies, shown in the accompanying examples, in which miR-1306-5p is identified as a miRNA biomarker for HF and studies in which this potential is confirmed by measuring this miRNA in large cohorts of well characterized HF patients.

The current invention relates to human miRNA miR-1306-5p for use in the risk stratification of human patients suffering from HF. The sequence of human miR-1306-5p is 5'- ccaccuccccugcaaacgucca -3' (SEQ ID NO:1 ). As outlined in the accompanying examples, it was found that miR-1306-5p was increased in expression in a pig model of HF. When the expression of the human equivalent (as provided herein as SEQ ID NO:1 ) was measured in two large cohorts of human HF patients, there appeared to be a significant correlation between HF-related hospitalization on the one hand and a combined cardiovascular death and hospitalization because of the HF. Hence, miR-1306-5p turns out to be an excellent tool for reliably (quickly) determining the risk of (re-)hospitalization and death due to cardiovascular disease in human HF patients.

In a further aspect, the present invention relates to miR-1306-5p for use as a biomarker in the risk stratification of human patients suffering from heart failure (HF), or of human patients suspected to suffer from HF. In some preferred embodiments, the risk stratification relates to the assessment of whether a patient that enters the clinic with symptoms that relate to or are directly caused by HF will run an increased risk of being re-hospitalized or worse, may die due to the HF some time during the following 12 months (or longer, up to 2, 3, or 4 years) after the patient has entered the clinic (i.e. or when the biological sample is obtained from such patient) for the first time with the HF symptoms.

The invention also relates to an in vitro method for risk stratification of a human HF patient, or of a patient suspected to suffer from HF, the method comprising the steps of:

(a) determining the level of miR-1306-5p in a biological sample from the patient;

(b) comparing the level determined in the previous step to the level of miR-1306-5p in a standard sample; and

(c ) determining the risk of re-hospitalization and/or mortality of the patient;

wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk.

Such in vitro method is generally performed in the hospital soon after the patient has entered the clinic and HF is suspected or diagnosed. In this process, samples are drawn and one or more of these samples (or parts thereof) may be used in the methods of the present invention, generally performed by a lab technician, generally in a separate laboratory. Hence, the drawing of the biological (blood) sample is not included as a step in the in vitro method of the present invention.

In another embodiment, the invention relates to a method for risk stratification of a human HF patient, or of a human patient suspected to suffer from HF, the method comprising the steps of:

(a) obtaining a biological sample from the patient;

(b) determining the level of miR-1306-5p in the biological sample;

(c) comparing the level determined in step b) to the level of miR-1306-5p in a standard sample; and determining the risk of re-hospitalization and/or mortality of the patient;

(d) wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk. The present method is particularly advantageous for assessing the risk of being re-hospitalized once the patient is in the hospital due to HF-related or HF-like complaints or symptoms, within the years (preferably within the first year following the first HF assessment or diagnosis of HF, and/or after taking of the biological (blood) sample(s)). Further, the invention is directed to assessing the risk of dying from HF within the next period, e.g. years (preferably within the first year) after the sample is taken, for example when a patient is first entering the clinician's consultation room (generally in a hospital) because of HF complaints or HF-like symptoms. Obtaining a blood sample is routinely performed by the person skilled in the art. Deriving plasma or serum samples from such whole blood samples is also used by the skilled person on a regular basis, and does not need extensive specification.

The invention also relates, in yet another embodiment, to a method of treatment of a human HF patient, or of a human patient suspected to suffer from HF, the method comprising the steps of:

(a) obtaining a biological sample from the patient;

(b) comparing the level of miR-1306-5p (as determined) in the biological sample to the level of miR-1306-5p in a standard sample; and

(c) treating the patient in the event that the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk of re-hospitalization and/or mortality (i.e. wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR-1306-5p in the standard sample is indicative for an increased risk).

The treatment of the HF patient can be adjusted depending on the results obtained from the risk assessment performed according to the method of the present invention using the level of miR-1306-5p in a blood sample of the patient in comparison to the level of that miRNA in a standard sample, as outlined further herein.

In a preferred aspect of the methods according to the present invention, the risk is determined for a period of approximately four, three, two, or preferably approximately one year following sampling the biological sample, for example as sampled at the moment of the initial diagnosis. It is clear that it cannot be excluded that samples are stored and assessed at a later stage, especially when it is not directly clear that a patient suffers from HF or is at risk of suffering from HF. For instance, samples may be taken in environments where no clinical personnel is present that can immediately recognize the HF, or when no additional means are available to do HF tests. In a further preferred aspect, the risk is determined by adding the patient's weighted value of one or more established risk factors for HF. An in yet another preferred aspect, the risk is determined by adding the weighted value of the level of NT-proBNP in a biological sample from the patient in comparison to the NT-proBNP level in a standard sample. The assessment of NT-proBNP may be on the same sample as for the level of miR-1306-5p, but this may also be on another sample from the patient. Often, multiple (blood) samples are drawn that go different paths in the clinic and are studied by different people. Nevertheless, in yet another preferred aspect, the standard sample is from an HF patient not having experienced a worsening condition due to HF within one year following sampling, whereas in another preferred embodiment, the standard sample may also be from a healthy individual. The standard sample does not necessarily have to be as fresh as the patient sample and may be stored separately and obtained at a different time point as compared to the biological sample of the

patient. In a preferred aspect, the biological sample is a blood sample. More preferably, the blood sample is a serum sample or a plasma sample.

The invention also relates to an in vitro method of determining whether a human HF patient is at risk of suffering from a worse condition due to HF within four, three, two or one year from sampling (i.e. obtaining the biological sample), comprising:

(a) determining in a biological sample from said patient the expression of miR-1306-5p; and

(b) determining in a standard sample the expression of miR-1306-5p:

wherein an up-regulation of miR-1306-5p (or increase in level) in said biological sample in comparison to the level in said standard sample is indicative for a risk of a worsening condition of said patient due to HF, and wherein said standard sample is from a HF patient not having experienced a worse condition within one year following sampling, or from a healthy individual.

In yet another embodiment, the invention relates to miR-1306-5p for use in the risk stratification of patients suffering from general HF. When combined with the protein marker NT-proBNP, the invention therefore also relates to a panel of biomarkers for use in the risk stratification of patients suffering from general heart failure, wherein the panel comprises the protein marker NT-proBNP and the miRNA miR-1306-5p. Each of these two biomarkers are assessed separately, but may in combination be used in the risk stratification according to the methods as outlined herein.

It will be understood by the skilled person that a biological sample from the HF patient or from the individual that is suspected to suffer from HF is a same type of sample as the standard sample. In other words, when the biological sample is a serum sample, then the standard sample is also a serum sample. When the biological sample is a whole blood sample, the standard sample is also a whole blood sample. When the biological sample is a plasma sample, the standard sample is also a plasma sample.

In a preferred embodiment, the level of the miRNA (i.e. miR-1306-5p) is determined as described herein, preferably by using a technology such as FireFly or Modaplex or any one of the other systems as described above and known in the art.

In a further preferred embodiment, said risk of worsening is determined for a period of one year following sampling. It will be understood by the skilled person that the term 'worsening' as used herein refers to the condition of the patient due to his/her suffering from HF. The disease often is accompanied/worsened by major adverse cardiac events (MACE) that may eventually result in a condition that requires re-hospitalization, but that also may result in death (mortality).

In a preferred aspect of the methods according to the present invention, said risk of worsening is determined by adding the patient's weighted values of one or more established risk factors for HF. Preferably one or more of the established risk factors that are generally considered by the clinician are taken along. Non-limiting examples of such established risk factors are listed herein. In yet another preferred embodiment of the present invention, said risk of worsening is determined by adding the weighted value of the expression level of NT-proBNP in a biological sample from said patient in comparison to the expression level in a standard sample. Preferably the same or the same type of biological sample is used as that is used for the miRNA expression profiles, but this is not absolutely required, for instance when the NT-proBNP is already measured in other samples from the patient at a different point in time, or because the type of sample better suits the determination of NT-proBNP. NT-proBNP is an often used protein biomarker for the assessment and diagnosis of HF. Although NT-proBNP has the disadvantage of being a protein biomarker that requires time to measure, it may contribute in an even further significant risk stratification of heart failure patients as disclosed herein. For the risk stratification of HF patients, it is preferred that the standard sample is a biological sample from a patient suffering from HF, but that did not experience re-hospitalization or mortality within one year following drawing a sample of the patient. The biological sample and said standard sample that are used in the methods of the present invention are preferably blood samples, more preferably plasma samples.

In methods according to the invention, in which risk stratification is performed for HF patients, the standard sample is a biological sample from a HF patient that did not experience a worse condition in the four, three, two and preferably one year following the sampling of the standard sample.

Healthcare professionals are interested in defining the prognosis of an individual patient with HF in order to establish the right treatment regimen. Patients with a high risk on an adverse outcome may be treated more aggressively. Until now the likelihood of survival could be determined reliably only in populations and not in individual HF

patients. However, the new miRNA of the invention (i.e. miR-1306-5p) used for prognostication in HF according to the present invention now provide better information for patients and their families to help them appropriately plan for their futures. It also identifies patients in whom cardiac transplantation or mechanical device therapy should be considered, or would appear not necessary. In general, the present invention now makes it possible to guide the physician in better selecting the right treatment for each individual HF patient based on the estimated risk a patient has to develop an event due to the cardiovascular disease in the first three years following the initial diagnosis.

According to a further aspect of the current invention there is also provided for a method of reducing hospitalization of patients suffering from HF, or of human patients suspected to suffer from HF, the method comprising the steps of:

a) determining the level of miR-1306-5p in a biological sample from the patient; b) comparing the level determined in step a) to the level of miR-1306-5p in a standard sample; and

c) determining the risk of re-hospitalization of the patient, wherein an increase in the level of miR-1306-5p in the biological sample compared to the level of miR- 1306-5p in the standard sample is indicative for an increased risk.

As discussed herein elsewhere, HF is the single most frequent cause of hospitalization in elderly and the societal costs in Europe and US exceed 400 billion euro per year. In some countries, such as the US, hospitals receive a penalty when re-hospitalization numbers are too high (e.g. the Hospital Readmissions Reduction Program in the US uses a 30-day readmission cut-off for heart failure). Therefore, next to the clinical relevance of a risk prediction test for patients admitted to the hospital with HF, the economic impact by assessing and hereby minimizing the risk of (short term) re-hospitalization is substantial. By now determining the level of miR-1306-5p as detailed herein, re-hospitalization may be reduced, as assessing the level of miR-1306-5p helps to minimize the risk of re-hospitalization, for example by closer monitoring the patient and/or treating the patients in view of the (increased) risk.

It should be noted that the above-mentioned embodiments illustrate rather than limit the invention, and that those skilled in the art will be able to design many alternative embodiments. In the claims, any reference signs placed between parentheses shall not be construed as limiting the claim. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these

measures cannot be used to advantage, and the skilled person understands that such combinations are thus disclosed as such.

Having now generally described the invention, the same will be more readily understood through reference to the following examples which is provided by way of illustration and is not intended to be limiting of the present invention.

EXAMPLES

Example 1. Identification of a novel miRNA biomarker for heart failure

To identify novel miRNA biomarkers for heart failure (HF) the inventors performed an RNA sequencing discovery experiment. The setup of this experiment allowed the inventors to identify miRNAs that are produced by the heart and secreted by the heart into the bloodstream. In brief, a constriction of the aorta (AoB) was performed in swine. This mechanical constriction of the aorta can be compared to an aorta stenosis (a partial occlusion of the aorta) often resulting in heart failure. Tissue samples were taken from the heart and from both the arteries and coronary venous. This allowed the investigators to examine if miRNAs are produced by the heart during constriction of the aorta and if they are released into the blood. If so, these miRNAs could serve as potential biomarkers for (early) HF.

Experiments were performed in AoB-treated (n=4) and sham/control-operated (n=4) Yorkshire x Landrace swine of either sex weighing 25-30 kg. All procedures were performed in compliance with the "Guiding principles in the care and use of animals" as approved by the Council of the American Physiological Society and under the regulations of the local Animal Care Committee. Swine were sedated with ketamine (20 mg/kg, i.m.) and midazolam (1 mg/kg, i.m.), Under isoflurane anesthesia, a left thoracotomy was performed and the proximal ascending aorta was dissected free, and, in AoB-animals a band was placed, resulting in a systolic pressure gradient of 60 mmHg. Subsequently, the chest was closed and the animals were allowed to recover. Eight weeks later, swine we re-anesthetized with sodium pentobarbital (15 mg/kg, i.v.), intubated, and placed on a positive-pressure ventilator (02:N2=1 :3 v/v). Catheters were inserted into the right external jugular vein for infusion of physiological saline and sodium pentobarbital (10-15 mg/kg/h) to maintain anesthesia. Following sternotomy, fluid-filled catheters were surgically inserted into the aorta for measurement of aortic blood pressure and sampling of arterial blood. The anterior interventricular vein was cannulated with a 20-gauge catheter for coronary venous blood sampling. Subsequently, arterial and coronary venous blood samples were simultaneously obtained, followed by arresting and excision of the heart and harvesting of myocardial tissue samples from the left ventricular anterior wall. RNA was isolated from epicardial and endocardial tissue and from arterial and coronary venous plasma samples of AoB-treated (n=4) and sham-operated (n=4) swine at 8 weeks follow-up after sham and AoB. For subsequent sequencing RNA was pooled from epicardial (x4), endocardial (x4), arterial (x4) and coronary venous (x4) AoB-treated and sham-operated samples, respectively. Pooled RNA from each sample was then divided into two, which gave rise to 2 technical replicates per sample. This resulted in a total of 16 samples. Sequencing libraries were prepared using the NEBNext® Multiplex Small RNA Library Prep Set for lllumina® kit. Samples were sequenced on an lllumina NextSeq 500 platform and base-calling was performed using the bcl2fastq 2.0 Conversion Software from lllumina. Quality control of fastq files was performed using FASTQC (www.bioinformatics.bbsrc.ac.uk/projects/fastqc/). Trimmomatic version 0.32 (Bolger et al, Bioinformatics Vol. 30 no. 15 2014, pages 21 14-2120) was used to carry out 3' adapter clipping of reads, using a phred score cut-off of 30 in order to trim low quality bases whilst ensuring that reads with a length below 18 bases were discarded. In order to align RNA-seq reads to the genome all known hairpin sequences belonging to Sus Scrofa (pig), Homo Sapiens (human), Bos Taurus (cow) and Equus Caballus (horse) were downloaded from release 20 of miRBase. A blast database containing these species-specific hairpin sequences was generated. First, reads from all RNA-seq fastq files were aligned to pig hairpin sequences using BLASTN. Reads failing to map to pig hairpins were then aligned to human, cow and horse hairpin sequences using BLASTN. To further increase alignment efficiency, reads that remained unaligned were mapped to version 10.2 of the Sus Scrofa ncRNA and cDNA database, downloaded from Ensembl. In cases where a sequence was mapped to multiple hairpins, the one with the highest bitscore, i.e. the best alignment, was chosen. Differential expression analysis was performed to distinguish between the groups. This analysis was performed using the R Bioconductor package, DESeq2. The inventors focused on the difference in normalized transcript numbers between coronary venous plasma and arterial plasma to reflect the transcoronary gradient. In brief this means that if a positive gradient is observed miRNAs are detected in the blood leaving the heart than in the blood entering the heart, suggesting that these miRNAs are released by the heart/myocardium. In addition the inventors assessed the relative abundance of transcripts in the tissue samples. miRNA expression from sham epicardial tissue was compared to AoB epicardial tissue and sham-operated endocardial tissue was compared to AoB-treated endocardial tissue. Plasma samples were analyzed to obtain a transcoronary gradient in a comparable fashion; sham arterial plasma vs. coronary venous plasma, and AoB arterial plasma vs. coronary venous plasma. Owing to the availability of replicates, the dispersion method "pooled" from DESeq2 was used to accurately estimate dispersion between each comparison. DESeq2's negative binomial model was used to estimate differentially expressed miRNAs for each analysis. At the end, only those miRNAs passing a fold-change (log2) cut-off of 1 .0 together with a

False Discovery Rate (FDR) cut-off of 0.05 were deemed significantly differentially expressed. A number of miRNAs showed a positive and significant transcoronary gradient. Among these were known myomirs such as miR-133a. Besides known cardiovascular related miRNAs also miRNAs not know to be involved in cardiac biology and cardiovascular disease showed a significant positive gradient. One of these miRNAs, miR-1306-5p (sequence: 5'- ccaccuccccugcaaacgucca -3'), was further analyzed for its potential role as blood-based miRNA biomarker for HF.

Example 2. Validation of miR-1306-5p as biomarker in human patients with HF. After identification of miR-1306-5p following the experiments as outlined in example 1 , the predominant question was whether miR-1306-5p could be used as biomarker for HF and whether the increased level of this miRNAs in a blood sample, or a blood derived sample such as a plasma or serum sample, could be assessed to predict risks specifically in patients that were diagnosed with HF, or in patients that were suspected to suffer from HF. It has been shown previously that miRNAs could be used in diagnosis of HF (e.g. miR-423-5p in EP 2425016 B1 ). To investigate this further, the inventors assessed the expression profiles of miR-1306-5p in a well-defined cohort of 475 patients that were all diagnosed with HF.

miR-1306-5p was validated in human plasma samples from a dutch HF study. This study was designed to allow analysis of novel potential biomarkers for prognostication of HF patients with a particular interest directed towards changes in blood-biomarker patterns over time and their value for prognostication in HF patients. The study was approved by the medical ethics committee at all participating centers. All patients provided written informed consent. Patients were eligible if ≥18 years old and hospitalized for acute HF, resulting from decompensation of known, chronic HF or newly diagnosed HF, and all three of the following criteria were met: (1 ) natriuretic peptide levels elevated to≥3 times the upper limit of normal (ULN), (2) evidence of sustained systolic or diastolic left ventricular dysfunction, and (3) treatment with intravenous diuretics. Patients were excluded in case they suffered from HF precipitated by a non-cardiac condition, by an acute ST-segment elevation myocardial infarction or by severe valvular dysfunction without sustained left ventricular dysfunction. Furthermore, patients were excluded if they were scheduled for coronary revascularization, listed for heart transplantation, suffered from severe renal failure for which dialyses was needed, or had a coexistent condition with a life expectancy <1 year.

Blood samples were obtained during hospitalization at admission (day 1 ), once during days 2 to 4 and subsequently at discharge. Additionally, blood samples were obtained at outpatient clinic follow-up visits, planned 2 to 4 weeks, 3 months, 6 months and 9 to 12 months after discharge. A short medical evaluation was performed and blood samples were collected at every follow-up visit. Adverse cardiovascular events and changes in medication were recorded in electronic case report forms.

Non-fasting blood samples were obtained by venipuncture and transported to the clinical chemistry laboratory of each participating hospital for further processing according to a standardized protocol. The collected material was centrifuged at 1700 G / Relative Centrifugal Force, and EDTA plasma was separated. Blood aliquots were subsequently stored at a temperature of -80°C within 2 hours after venipuncture.

Plasma was thawed on ice and RNA isolation was performed using the TRIZOL LS reagent (Life Technology) according to the manufacturer's protocol, with a starting volume of 200 μΙ plasma. Subsequently, 8 μΙ of the eluate from the RNA isolation was used for the reverse transcription reaction. The transcription followed the manufacturer's protocol of the miScript Reverse Transcription Kit (Qiagen). For realtime quantitative polymerase chain reaction (qPCR), 2 μΙ of 10x diluted cDNA was used in a total volume of 10 μΙ. The real-time PCR reaction was performed on a LightCycler 480 using the following program: 5 min of pre-incubation at 95°C; 10 sec of denaturation at 95°C, 20 sec of annealing at 58°C and 30 sec of elongation at 72°C, in a total of 45 cycles. Data were analyzed with LinRegPCR quantitative PCR data analysis software. miR-1306-5p expression was normalized for miR-486-5p.

Since concentrations of circulating miRNAs may be low, PCR of circulating miRNAs may be sensitive to false or inaccurate signals. Therefore, the inventors used a quality assessment algorithm to ensure the validity of each measurement. In brief, the inventors distinguished three groups of measurements: 'detectable', 'non-detectable' (signal too low) and 'invalid'. If the measurement passed all the quality checks, it was considered valid and was marked 'detectable'. In case of a 'non-detectable' signal, the measurement was set to a low value, which was based on the PCR experiment parameters. If the measurement did not pass the quality controls of the algorithm, it was defined as 'invalid'. Such measurements were not used in further analyses. miR-1306-5p is expressed well and is not low; identification of miR1306-5p does not depend on the specific method used.

The primary endpoint comprised the composite of all-cause mortality and readmission for HF. The latter was defined as an unplanned re-hospitalization due to acute HF, Secondary endpoints included the individual components of the primary endpoint and

additionally cardiovascular mortality. During follow-up, information on vital status and hospital readmissions was obtained until at least 9 months with a maximum of 400 days after the index hospital admission.

miRNA results were analyzed by using different statistical tools. Normally distributed continuous variables are presented as mean ± standard deviation (SD). Non-normally distributed continuous variables are expressed as median and interquartile range (IQR). Categorical data are displayed as count and percentage. miRNA levels were In transformed for all further analyses. The inventors assessed the associations between repeated miRNA measurements and repeated NT-proBNP and troponin I measurements by means of linear mixed models. The associations between the baseline miRNA measurements and the risk of a study endpoint were assessed using Cox proportional hazards models. First, analyses were performed univariably. Subsequently, the inventors corrected for age and gender. Finally, additional multivariable adjustment was performed. Potential confounders were selected based on previous literature and included systolic blood pressure, diabetes mellitus, BMI, previous hospitalization for HF during the last 6 months, ischemic HF, baseline creatinine level, and baseline NT-proBNP level. Individual covariates each contained less than 7% missing values. Data on all covariates were complete in 87% of the patients. Multiple imputation was applied to account for missing covariates. The results are presented as hazard ratios (HR) per In [arbitrary unit] of miRNA level with 95% confidence intervals (CI). Subsequently, repeated miRNA measurements were examined in relation to the risk of a study endpoint. Specifically, associations between the current level of miR-1306-5p at a particular time point and the risk of an endpoint at that same time point were assessed using a joint modeling approach, which combines a linear mixed-effects model for the repeated miRNA measurements with a Cox proportional hazards model for the risk of experiencing the event of interest. For the mixed model, the inventors used cubic splines, with knots set at 1 week and 1 month after initial hospitalization. Analyses were first performed without adjustment, and were subsequently adjusted for the potential confounding variables listed above. The results are presented as hazard ratios (HRs) per In [arbitrary unit] miRNA concentration at any point in time, along with the corresponding 95% Cls. All analyses were performed with R Statistical Software using package JM. All tests were two-tailed and p-values <0.05 were considered statistically significant.

In 475 patients from the Dutch HF study miR-1306-5p could be measured. Baseline characteristics of these patients are summarized in Table 1 .

Table 1 . Baseline characteristics of the dutch HF study

IQR = Inter-quartile range, eGFR = estimated glomerular filtration rate.

Variables Overall sample (n=475)

Demographic characteristics, median (IQR) or % 5

Age, years 74 (65-81 )

Female, % 37

Caucasian, % 94

Measurements at baseline, median (IQR) or %

Body mass index, kg/m2 27 (25-31 )

Systolic blood pressure, mmHg 124 (1 10-145)

Diastolic blood pressure, mmHg 70 (63-82)

Heart rate, bpm 81 (70-100) eGFR 55 (38-71 )

Left ventricular ejection fraction, % 30 (21 -42)

Heart failure with reduced ejection fraction, % 83

NT-proBNP (pg/ml) 4135 (2123-9328)

Medical history, %

Previous heart failure admission within 6 months 20

Ischemic heart failure 48

Myocardial infarction 36

Hypertension 51

Atrial fibrillation 42

Diabetes Mellitus 36

Stroke 17

A total of 1 13 patients died, of which 77 were confirmed to die from a cardiovascular cause, and 123 patients were re-hospitalized for decompensated HF. After measurement of miR-1306-5p it was assessed whether this miRNA is associated with the primary endpoint. In Table 2, model 3, it is shown that baseline miR-1306-5p levels were significantly and independently associated with the primary endpoint (HRs(95%CI): 1 .13(1 .03-1 .24). miR-1306-5p was also significantly and independently associated with the secondary endpoint HF hospitalization (multivariable adjusted HR(95%CI): 1.21 (1 .09-1 .35).

Table 2. Associations between baseline miRNA levels and clinical outcome

Hazard ratio (95% CI)

miRNA

Model 1 Model 2 Model 3

Primary endpoint 1306-5p* 1.19 (1.09 - 1.30) 1.18 (1.09 - 1.29) 1.13 (1.03 - 1.24)

All-cause 1306-5p* 1.10 (0.98 - 1.25) 1.09 (0.97 - 1.23) 1.04 (0.91 - 1.19) mortality

Heart failure 1306-5p* 1.27 (1.15 - 1.40) 1.27 (1.15 - 1.40) 1.21 (1.09 - 1.35) hospitalizations

Model 1 unadjusted; model 2 adjusted for age and sex; model 3 adjusted for age, sex, systolic blood pressure, diabetes mellitus, BMI, previous hospitalization for HF during the last 6 months, ischemic HF, baseline creatinine level, and baseline NT-proBNP level.

* Hazard ratio per per ln[arbitrary unit] of miR level

The associations between repeated miRNA measurements and the primary endpoint are shown in Table 3. The temporal pattern of miR1306-5p level was positively and independently associated with the primary endpoint (HR(95%CI): 3.78(1 .66-8.60)). Finally, the temporal pattern of miR-1306-5p level was positively associated with the secondary endpoint all-cause mortality after adjustment for age and sex (HR(95%CI): 1 .83(1 .15-2.90)).

Table 3. Associations repeated miRNA measurements and clinical outcome.


Model 1 unadjusted; model 2 adjusted for age, sex; model 3 adjusted for age, sex, systolic blood pressure, diabetes mellitus, BMI, previous hospitalization for HF during the last 6 months, ischemic HF, baseline creatinine level, and baseline NT-proBNP level; * Composite of all-cause mortality and re-admission for HF; Λ p<0,05

It is concluded that miR-1306-5p provides an excellent tool to give information about the worsening of the HF related disorder in the patient, wherein re-hospitalization and/or mortality occurs within approximately 1 year after the sample was taken (= generally the point in time that the initial assessment of the disease is performed along with the disease-related hospitalization) and wherein the patient suffers from HF. It is concluded that this miRNA appears to be the first biomarker asset that can be applied for this purpose.

Example 3. Validation of miR-1306-5p in two independent HF cohorts

The inventors further validated the role of miR-1306-5p as biomarker for worsening HF in two independent HF cohorts.

Cohort I

This cohort has previously been used in HF studies. Between August 2006 and June 201 1 ambulatory patients treated at a multidisciplinary HF unit were consecutively included in the study in an outpatient setting. Patients were referred to the unit by cardiology or internal medicine departments and, to a lesser extent, by the emergency or other hospital departments. The principal referral criterion was HF according to the European Society of Cardiology guidelines irrespective of etiology and at least one HF hospitalization. Blood samples were obtained by venipuncture between 9 a.m. and noon during routine ambulatory visits, and adequate centrifugation plasma samples

were stored at -80 °C. All participants provided written informed consent and the local ethics committee (Clinical Investigation Ethics Committee, Hospital Universitari Germans Trias i Pujol, Badalona, Spain) approved the study. All the study procedures were in accord with the ethical standards outlined in the 1975 Declaration of Helsinki, as revised in 1983.

Cohort II

The study was approved by the Henry Ford Hospital Institutional Review Board and all patient participants gave written informed consent. All study procedures were in accord with the ethical standards outlined in the 1975 Declaration of Helsinki, as revised in 1983. The Henry Ford Heart Failure Pharmacogenomic Registry (Cohort II) is a prospective, observational, cohort study which enrolled 1750 HF patients between 2007 and 2015. Patients whose health care was administered by the covered entity (Health Alliance Plan) and who met enrollment criteria were recruited and prospectively enrolled. Inclusion criteria included age >=18 and symptomatic HF meeting Framingham definition. Exclusion criteria included ESRD (on dialysis) or inability to provide written informed consent. Patients were characterized at baseline in terms of their HF symptoms, quality of life, and comorbid conditions and blood samples were collected for genetic and biomarker analysis. Patients were required to have had an assessment of their ejection fraction prior to study entry (most often echocardiography). Among the total cohort 1 150 patients had an ejection fraction (EF) <50% at diagnosis (HFrEF subgroup) while 600 subjects had an EF >= 50% (HFpEF subgroup). After venipuncture the whole blood samples were centrifuged, plasma separated, then aliquoted and frozen within 1 hour of collection. Samples were stored at -70 °C until thawed for analysis. From this cohort, the first 1380 patients were used for miRNA measurement and analysis.

In cohort I, RNA was isolated from 500 μΙ plasma using the mirVana™ kit (Thermofisher scientific, Waltham, MA USA) according to the manufacturer's instructions. RNA pellet was collected in 100 μΙ RNAse-free water. In cohort II, blood was collected in EDTA tubes and RNA was extracted from 200 μΙ plasma using 750 μΙ TRIzol LS reagent (Invitrogen Corp., Carlsbad, CA) and was incubated for 10 min at RT followed by 200 μΙ chloroform. The mixture was centrifuged at 12,000 g for 10 min, and the aqueous layer was transferred to a new tube. RNA was precipitated by isopropanol and washed with 75% ETOH subsequently. RNA pellet was collected in 100 μΙ RNAse-free water. A total of 8 μΙ of the eluate from the RNA isolation was used as input in a reverse transcription reaction. Complementary DNA was obtained using miScript reverse transcription kit (Qiagen, Venlo, Netherlands) and qScript™ microRNA cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, USA), according to the manufacturer's protocol. QPCR was performed using Sybr Green (Roche, Basel, Switzerland) in a total volume of 10 μ I according to the manufacturer's instruction. Data were analyzed using LinRegPCR quantitative qPCR data analysis software. Baseline characteristics of the study population were presented as mean ± SD or median (interquartile range [IQR]) for continuous variables, and absolute number with percentages for categorical variables. Both cohorts had less than 3% missing data among all clinical variables. The inventors used multiple imputation for missing values of the following variables: cohort I: BMI (n=13), duration of HF (n=1 ), sodium (n=7), creatinine (n=3), hemoglobin (n=2); cohort II: age (n=1 ), BMI (n=29), LVEF (n=5), sodium (n=9), hemoglobin (n=10), creatinine (n=9).

Raw qPCR data was log-transformed and normalized using miR-486-5p. Cox proportional hazard analysis was used to analyze the association of the candidate miRNAs with the risk for HF related morbidity and mortality as defined previously. C-statistics (C-stats) were used to quantify the discriminative ability between HF patients that reached the endpoints and those who did not. C-stats were corrected for optimism by bootstrapping (n=100). Analyses were performed by IBM SPSS Statistics version 22 and statistical environment R studio version 0.98.1 103. The primary endpoint for this study comprised the composite of all-cause mortality and HF hospitalization. Secondary endpoints were all-cause mortality and HF hospitalization alone. First, the inventors analyzed the association of miR-1306-5p with the risk for the outcomes univariately.

Second, miR-1306-5p was used in addition to established objectively measurable risk factors, sex, age, serum creatinine, hemoglobin level and NT-proBNP level. Several models were built, to analyze the discriminating power of each of those models on HF related morbidity and mortality. Model 1 only contained age (continuous) and sex; model 2 only contained hemoglobin (continuous) and creatinine (continuous); model 3 only contained NT-proBNP (continuous); model 4a-d, contained extended models with the addition of the discriminating miRNAs panel.

Cohort lincluded 834 patients at baseline with a mean age of 68 ± 13 years, and 71 % was male. The mean left ventricular ejection fraction (LVEF) was 35 ± 14 %, and the main etiology of HF was ischemic heart disease (52%). The population mainly

consisted of cases with HFrEF (84%). During a mean follow-up of 3.8 years, 183 (22%) patients were hospitalized due to HF, and 344 (41 %) participants died.

In Cohort II, miRNA levels were measured in 1380 HF patients at baseline with a mean age of 69 ± 12 years, and 58% was male. The population contained both cases with HFrEF (59%) and HFpEF (41 %). During a mean follow-up of 1 .9 years, 461 (33%) patients were hospitalized due to HF, and 230 (17%) participants died. (Table 4)

Table 4. Baseline characteristics for cohort I and II

Cohort 1 Cohort II

n 834 1380

Age, years 68.1 ± 12.7 68.9 ± 12.1

Male 588 (71 ) 793 (58)

BMI, kg/m 27.5 ± 5.2 31.6 ± 7.8

LVEF, % 35.4 ± 13.6 42.4 ± 15.5

HFrEF 698 (84) 821 (59)

HFpEF 136 (16) 559 (41 )

Duration heart failure,

24 (3-62) - months [median, IQR]

All-cause mortality 344 (41 ) 230 (17)

Hospitalization for heart

183 (22) 461 (33)

failure

Creatinine 1.9 ± 3.8 1.3 ± 0.9

Sodium, mmol/L 139.0 ± 3.5 139.5 ± 3.0

Hemoglobin, g/dL 12.8 ± 1.8 12.7 ± 1.7

NT-proBNP, ng/L

181 (68, 41 1 ) 191 (80, 446)

[median, IQR]

Current smoker 137 (17) 786 (57)

Ischemic etiology of heart

436 (52) - failure

Diabetes 303 (36) 573 (42)

Hypertension 514 (62) - Treatments: - ACEI or ARB 750 (90) - Beta-blocker 756 (91 ) - Loop diuretic 763 (91 ) - Anticoagulants 388 (47) - Antiplatelet 533 (64) - Values are expressed as mean ± SD or n (%), unless indicated otherwise. Abbreviations: ACEI: angiotensin-converting enzyme inhibitor; ARB: angiotensin II receptor blocker; BMI: body mass index; CV: cardiovascular; eGFR: estimated glomerular filtration rate; hs-cTnT: high-sensitivity circulating troponin T; LVEF: left ventricular ejection fraction; NT-proBNP: N-terminal pro-B-type brain natriuretic peptide.

The investigators assessed whether miR-1306-5p had predictive value of on outcomes in a univariate analysis. miR-1306-5p was significantly associated with the primary

endpoint (all-cause mortality and HF hospitalization) in both cohorts with a HR of 1 .13 [95% CI: 1 .03 to 1 .25] in cohort I and a HR of 1 .12 [95% CI: 1 .04 to 1 .20] in cohort II (Table 5).

Table 5. Combined endpoint: all-cause mortality or HF hospitalization

Cohort I Cohort II

microRNA HR 95%CI p-value HR 95%CI p-value

1 .13* 1 .03-1 .25 0.009

miR-1306-5p 1 .12* 1 .04-1 .20 0.002

For all-cause mortality, miR-1306-5p was predictive and emerged in both cohorts. (Table 6).

Table 6. Endpoint all-cause mortality in Cohort I and Cohort II

Cohort I Cohort II

microRNA HR 95%CI p-value HR 95%CI p-value

1 .17* 1 .06-1 .30 0.003

miR-1306-5p 1 .08 0.97-1 .21 0.165

For HF hospitalization miR-1306-5p was significantly predictive in cohort II (Table 7.)

Table 7. Endpoint HF hospitalization in Cohort I and Cohort II

Cohort I Cohort II

microRNA HR 95%CI p-value HR 95%CI p-value

1 .08 0.94-1 .24

miR-1306-5p 0.306 1 .13* 1 .05-1 .22 0.001

* p<0.05;† Hazard ratios per log-unit increase of miRNA expression for the outcomes Table 5) Combined endpoint (all-cause mortality or HF hospitalization) Table 6) all-cause mortality and Table 7) HF hospitalization.

Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.

While this invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications. This application is intended to cover any variations, uses, or adaptations of the inventions following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth as follows in the scope of the appended claims.

All references cited herein, including journal articles or abstracts, published or corresponding patent applications, patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the entire contents of the references cited within the references cited herein are also entirely incorporated by references.

Reference to known method steps, conventional methods steps, known methods or conventional methods is not in any way an admission that any aspect, description or embodiment of the present invention is disclosed, taught or suggested in the relevant art.

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art (including the contents of the references cited herein) , readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.