WIPO logo
Mobile | Deutsch | English | Español | 日本語 | 한국어 | Português | Русский | 中文 | العربية |
PATENTSCOPE

Recherche dans les collections de brevets nationales et internationales
World Intellectual Property Organization
Recherche
 
Options de navigation
 
Traduction
 
Options
 
Quoi de neuf
 
Connexion
 
Aide
 
Traduction automatique
1. (WO2007013089) MISE AU POINT D'UNE TROUSSE DE DIAGNOSTIC CONTRE LA PROTÉINE D'ENVELOPPE RECOMBINÉE DU PRUNUS NECROTIC RINGSPOT VIRUS
Dernières données bibliographiques dont dispose le Bureau international   

N° de publication : WO/2007/013089 N° de la demande internationale : PCT/IN2005/000390
Date de publication : 01.02.2007 Date de dépôt international : 29.11.2005
Demande présentée en vertu du Chapitre 2 : 03.01.2007
CIB :
C12Q 1/70 (2006.01) ,G01N 33/569 (2006.01)
Déposants : KULSHRESHTHA, Saurabh[IN/IN]; IN (UsOnly)
HALLAN, Vipin[IN/IN]; IN (UsOnly)
RAIKHY, Gaurav[IN/IN]; IN (UsOnly)
ZAIDI, Aijaz, Asghar[IN/IN]; IN (UsOnly)
COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH[IN/IN]; INTELLECTUAL PROPERTY MANAGEMENT DIVISION Third Floor, Niscair Building 14 Satsang Vihar Marg Special Institutional Area New Delhi 110 067, IN (AllExceptUS)
Inventeurs : KULSHRESHTHA, Saurabh; IN
HALLAN, Vipin; IN
RAIKHY, Gaurav; IN
ZAIDI, Aijaz, Asghar; IN
Représentant
commun :
COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH; INTELLECTUAL PROPERTY MANAGEMENT DIVISION Third Floor, Niscair Building 14 Satsang Vihar Marg Special Institutional Area New Delhi 110 067, IN
Données relatives à la priorité :
1979/DEL/200526.07.2005IN
Titre (EN) DEVELOPMENT OF DIAGNOSTIC KIT AGAINST THE RECOMBINANT COAT PROTEIN OF PRUNUS NECROTIC RINGSPOT VIRUS
(FR) MISE AU POINT D'UNE TROUSSE DE DIAGNOSTIC CONTRE LA PROTÉINE D'ENVELOPPE RECOMBINÉE DU PRUNUS NECROTIC RINGSPOT VIRUS
Abrégé :
(EN) The present invention deals with a set of primers of sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful for detection of Prunus necrotic ringspot virus in plants. It also relates to a method for detection of Prunus necrotic ringspot virus in plants by using said primers. Further the invention also relates to a diagnostic kit useful for detection of coat protein of Prunus necrotic ringspot in plants.
(FR) La présente invention concerne un jeu de primers de la séquence ID 1 : primer en amont AACTGCAGATGGTTTGCCGAATTTGCAA et séquence ID 2 : primer en aval GCTCTAGACTAGATCTCAAGCAGGTC utile pour détecter le Prunus necrotic ringspot virus dans des végétaux. Elle se rapporte également à un procédé de détection du Prunus necrotic ringspot virus dans des végétaux au moyen de ces primers. Elle concerne par ailleurs une trousse de diagnostic utile dans la détection de la protéine d'enveloppe du Prunus necrotic ringspot dans des végétaux.
États désignés : AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BW, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, LY, MA, MD, MG, MK, MN, MW, MX, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, SM, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM)
Office européen des brevets (OEB (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IS, IT, LT, LU, LV, MC, NL, PL, PT, RO, SE, SI, SK, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG)
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)