WIPO logo
Mobile | Deutsch | English | Español | 日本語 | 한국어 | Português | Русский | 中文 | العربية |
PATENTSCOPE

Recherche dans les collections de brevets nationales et internationales
World Intellectual Property Organization
Recherche
 
Options de navigation
 
Traduction
 
Options
 
Quoi de neuf
 
Connexion
 
Aide
 
Traduction automatique
1. (WO2005064015) AMORCE ET PROCEDE D'IDENTIFICATION DE PLANTES RICHES EN ARTEMISININE
Dernières données bibliographiques dont dispose le Bureau international   

N° de publication :    WO/2005/064015    N° de la demande internationale :    PCT/IN2003/000404
Date de publication : 14.07.2005 Date de dépôt international : 29.12.2003
Demande présentée en vertu du Chapitre 2 :    29.07.2005    
CIB :
C12Q 1/68 (2006.01)
Déposants : COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH [IN/IN]; Rafi Marg, 110 001 New Delhi (IN) (Tous Sauf US).
KHANUJA, Suman, Preet, Singh [IN/IN]; (IN) (US Seulement).
PAUL, Shilpi [IN/IN]; (IN) (US Seulement).
SHASANY, Ajit, Kumar [IN/IN]; (IN) (US Seulement).
DAROKAR, Mahendra, Pandurang [IN/IN]; (IN) (US Seulement).
SHUKLA, Ashutosh, Kumar [IN/IN]; (IN) (US Seulement).
GUPTA, Madan, Mohan [IN/IN]; (IN) (US Seulement).
KUMAR, Anuruddha [IN/IN]; (IN) (US Seulement)
Inventeurs : KHANUJA, Suman, Preet, Singh; (IN).
PAUL, Shilpi; (IN).
SHASANY, Ajit, Kumar; (IN).
DAROKAR, Mahendra, Pandurang; (IN).
SHUKLA, Ashutosh, Kumar; (IN).
GUPTA, Madan, Mohan; (IN).
KUMAR, Anuruddha; (IN)
Mandataire : BHOLA, Ravi; K & S Partners, 84-C, C-6 Lane, Off Central Avenue, Sainik Farms, 110 062 New Delhi (IN)
Données relatives à la priorité :
Titre (EN) PRIMERS AND A SCREENING METHOD FOR IDENTIFICATION OF ARTEMISININ PRODUCING PLANTS
(FR) AMORCE ET PROCEDE D'IDENTIFICATION DE PLANTES RICHES EN ARTEMISININE
Abrégé : front page image
(EN)The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
(FR)L'invention porte sur une paire d'amorces, soit: une amorce directe SEQ ID NO. 1 présentant la séquence CCAAGCTTGCTGAACGCATCGG, et une amorce inverse SEQ ID No. 2 présentant la séquence CCAAGCTTGCCACGCAGGATTATC, et sur une méthode de criblage permettant l'identification précoce de plantes Artemisia annua à forte teneur en artémisinine et favorisant de ce fait la génération de populations de plantes à teneur renforcée en artémisinine.
États désignés : AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NI, NO, NZ, OM, PG, PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW.
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (BW, GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM)
Office européen des brevets (OEB) (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IT, LU, MC, NL, PT, RO, SE, SI, SK, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)