WIPO logo
Mobile | Deutsch | English | Español | 日本語 | 한국어 | Português | Русский | 中文 | العربية |
PATENTSCOPE

Recherche dans les collections de brevets nationales et internationales
World Intellectual Property Organization
Recherche
 
Options de navigation
 
Traduction
 
Options
 
Quoi de neuf
 
Connexion
 
Aide
 
Traduction automatique
1. (WO2003083142) DETECTION UNIVERSELLE DE L'ARNM DU PAPILLOMAVIRUS HUMAIN
Dernières données bibliographiques dont dispose le Bureau international   

N° de publication :    WO/2003/083142    N° de la demande internationale :    PCT/GB2003/001317
Date de publication : 09.10.2003 Date de dépôt international : 26.03.2003
Demande présentée en vertu du Chapitre 2 :    27.10.2003    
CIB :
C12Q 1/70 (2006.01)
Déposants : NORCHIP A/S [NO/NO]; Industriveien 9, N-3490 Klokkarstua (NO) (Tous Sauf US).
KARLSEN, Frank [NO/NO]; (NO) (US Seulement).
ALLARD, Susan, Joyce [GB/GB]; (GB) (MG only)
Inventeurs : KARLSEN, Frank; (NO)
Mandataire : MURPHY, Colm, Damien; Boult Wade Tennant, 70 Gray's Inn Road, London WC1X 8BT (GB)
Données relatives à la priorité :
0207242.9 27.03.2002 GB
Titre (EN) UNIVERSAL DETECTION OF HUMAN PAPILLOMAVIRUS mRNA
(FR) DETECTION UNIVERSELLE DE L'ARNM DU PAPILLOMAVIRUS HUMAIN
Abrégé : front page image
(EN)The invention relates to an oligonucleotide primer set for use in the detection of HPV in a test sample, comprising at least one oligonucleotide primer which is an oligonucleotide selected from group (i) as defined below and at least one oligonucleotide primer which is an oligonucleotide selected from group (ii) as defined below: (i) oligonucleotides comprising one of the following nucleotide sequences: X1 GAAAAATAAACTGTAAATCATA; X1−GAAAAATAAACTGTAAATCATATTC; or X1−GATAAATAAACTGTAAATCATATTC wherein X1 represents a nucleotide sequence comprising a promoter (ii) oligonucleotides comprising one of the following nucleotide sequences: GCMCAGGGWCATAAYAAT; or GCMCAGGGWCATAAYAATGG.
(FR)L'invention concerne un ensemble d'amorces oligonucléotidiques utilisées dans la détection du papillomavirus dans un échantillon d'essai. Cet ensemble d'amorces comprend au moins une amorce nucléotidique sélectionnée dans le groupe (i), tel que défini ci-après, et au moins une amorce oligonucléotidique sélectionnée dans le groupe (ii), tel que défini ci-après : (i) des oligonucléotides comprenant une des séquences nucléotidiques suivantes: X1 GAAAAATAAACTGTAAATCATA; X1-GAAAAATAAACTGTAAATCATATTC; ou X1-GATAAATAAACTGTAAATCATATTC, où X1 représente une séquence oligonucléotidique qui comprend un promoteur ; (ii) des oligonucléotides comprenant une des séquences nucléotidiques suivantes: GCMCAGGGWCATAAYAAT; ou GCMCAGGGWCATAAYAATGG.
États désignés : AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NI, NO, NZ, OM, PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW.
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM)
Office européen des brevets (OEB) (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IT, LU, MC, NL, PT, RO, SE, SI, SK, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)