WIPO logo
Mobile | Deutsch | English | Español | 日本語 | 한국어 | Português | Русский | 中文 | العربية |
PATENTSCOPE

Recherche dans les collections de brevets nationales et internationales
World Intellectual Property Organization
Recherche
 
Options de navigation
 
Traduction
 
Options
 
Quoi de neuf
 
Connexion
 
Aide
 
Traduction automatique
1. (WO2003068050) PROCEDE DE DETECTION DE L'AGENT CARCINO-EMBRYONNAIRE ET METHODE POUR LE DIAGNOSTIC DU CANCER BASEE SUR UN TEL PROCEDE
Dernières données bibliographiques dont dispose le Bureau international   

N° de publication :    WO/2003/068050    N° de la demande internationale :    PCT/US2003/004201
Date de publication : 21.08.2003 Date de dépôt international : 13.02.2003
CIB :
C12Q 1/68 (2006.01)
Déposants : GEORGETOWN UNIVERSITY [US/US]; 3900 Reservoir Road, N.W., Washington, DC 20007 (US) (Tous Sauf US).
JUHL, Hartmut [DE/US]; (US) (US Seulement).
HAMPTON, Regina [US/US]; (US) (US Seulement)
Inventeurs : JUHL, Hartmut; (US).
HAMPTON, Regina; (US)
Mandataire : TESKIN, Robin, L.; Pillsbury Winthrop LLP, 1600 Tysons Boulevard, Mclean, VA 22102 (US)
Données relatives à la priorité :
60/355,834 13.02.2002 US
Titre (EN) METHOD FOR THE DETECION OF CARCINOEMBRYONIC AGENT AND CANCER DIAGNOSIS METHOD BASED THEREON
(FR) PROCEDE DE DETECTION DE L'AGENT CARCINO-EMBRYONNAIRE ET METHODE POUR LE DIAGNOSTIC DU CANCER BASEE SUR UN TEL PROCEDE
Abrégé : front page image
(EN)The present invention provides a method of detecting carcinoembryonic antigen (CEA) comprising detecting a DNA sequence comprising the sequence: GATATAGCAGCCCTGGTGTAGTTTCTTCATTTCAGGAAGACTG. The invention also provides a method of diagnosis of disseminated cancer comprising obtaining a cell sample, extracting DNA from the cell and detecting the presence of the sequence: GATATAGCAGCCCTGGTTSGTTTCTTCATTTCAGGAAGACTG.
(FR)La présente invention a trait à un procédé de détection de l'antigène carcino-embryonnaire (ACE) comportant la détection d'une séquence d'ADN comprenant la séquence GATATAGCAGCCCTGGTGTAGTTTCTTCATTTCAGGAAGACTG. L'invention a trait également à une méthode de diagnostic de cancer disséminé comportant l'obtention d'un échantillon cellulaire, l'extraction d'ADN à partir de la cellule et la détection de la présence de la séquence GATATAGCAGCCCTGGTGTAGTTTCTTCATTTCAGGAAGACTG
États désignés : AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, OM, PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW.
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM)
Office européen des brevets (OEB) (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HU, IE, IT, LU, MC, NL, PT, SE, SI, SK, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)