WIPO logo
Mobile | Deutsch | English | Español | 日本語 | 한국어 | Português | Русский | 中文 | العربية |
PATENTSCOPE

Recherche dans les collections de brevets nationales et internationales
World Intellectual Property Organization
Recherche
 
Options de navigation
 
Traduction
 
Options
 
Quoi de neuf
 
Connexion
 
Aide
 
Traduction automatique
1. (WO2002079513) PROCEDE DE DETECTION DE STACHYBOTRYS CHARTARUM DANS UNE CULTURE PURE ET DES ECHANTILLONS DU MILIEU ETUDIE VIA UNE REACTION EN CHAINE PAR POLYMERASE QUANTITATIVE
Dernières données bibliographiques dont dispose le Bureau international   

N° de publication :    WO/2002/079513    N° de la demande internationale :    PCT/US2002/006335
Date de publication : 10.10.2002 Date de dépôt international : 28.02.2002
CIB :
C12Q 1/68 (2006.01)
Déposants : UNIVERSITY OF NEVADA - LAS VEGAS [US/US]; 4505 Maryland Parkway, Las Vegas, NV 89154 (US)
Inventeurs : CRUZ-PEREZ, Patricia; (US).
BUTTNER, Mark, P.; (US)
Mandataire : PHILIPS, Rob, L.; Quirk & Tratos, Suite 500 N, 3773 Howard Hughes Pkwy., Las Vegas, NV 89109 (US)
Données relatives à la priorité :
60/280,712 29.03.2001 US
Titre (EN) METHOD FOR THE DETECTION AND QUANTIFICATION OF THE FUNGUS STACHYBOTRYS CHARTARUM USING QUANTITATIVE PCR
(FR) PROCEDE DE DETECTION DE STACHYBOTRYS CHARTARUM DANS UNE CULTURE PURE ET DES ECHANTILLONS DU MILIEU ETUDIE VIA UNE REACTION EN CHAINE PAR POLYMERASE QUANTITATIVE
Abrégé : front page image
(EN)A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
(FR)L'invention concerne un procédé de détection du champignon Stachybotrys chartarum, consistant d'abord à isoler l'ADN d'un échantillon présumé contenir le champignon Stachybotrys chartarum. Ce procédé consiste ensuite à soumettre l'ADN à une amplification par réaction en chaîne par polymérase utilisant au moins l'une des nombreuses amorces, lesquelles contiennent l'une des séquences de base suivantes : 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', et 5'GCGTTTGCCACTCAGAGAATACT3'. Ce procédé consiste également à détecter le champignon Stachybotrys chartarum en visualisant le produit de la réaction en chaîne par polymérase.
États désignés : AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, OM, PH, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TN, TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZM, ZW.
Organisation régionale africaine de la propriété intellectuelle (ARIPO) (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZM, ZW)
Office eurasien des brevets (OEAB) (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM)
Office européen des brevets (OEB) (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR)
Organisation africaine de la propriété intellectuelle (OAPI) (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG).
Langue de publication : anglais (EN)
Langue de dépôt : anglais (EN)