Traitement en cours

Veuillez attendre...

Paramétrages

Paramétrages

Aller à Demande

1. WO2001077346 - UTILISATION DE LA SEQUENCE DE NUCLEOTIDES DU PROMOTEUR DE L'OPERON LACTOSE DE LACTOBACILLUS CASEI POUR REGULER L'EXPRESSION GENIQUE PAR L'INTERMEDIAIRE D'UNE PROTEINE ANTITERMINATRICE

Note: Texte fondé sur des processus automatiques de reconnaissance optique de caractères. Seule la version PDF a une valeur juridique

[ ES ]

TITULO:
USO DE LA SECUENCIA DE NUCLEÓTIDOS DEL PROMOTOR DEL OPERÓN DE LA LACTOSA DE LACTOBACILLUS CASEI PARA REGULAR LA EXPRESIÓN GÉNICA A TRAVÉS DE UNA PROTEÍNA ANTITERMINADORA.

SECTOR DE LA TÉCNICA
El procedimiento de expresión génica que aquí se describe se incluye dentro del sector de Biotecnología. Esta invención va dirigida tanto a la industria de alimentos, por ejemplo la industria láctea, como a industrias farmacéuticas ya que con ella se podrán expresar proteínas en Lactobacillus casei de gran valor nutricional, clínico e inmunológico.

ESTADO DE LA TÉCNICA
En la última década se han desarrollado diferentes sistemas de control de la expresión de fragmentos de DNA para bacterias y en concreto para bacterias del ácido láctico (BAL) de interés industrial [W.M.de Vos, 1999, International Dairy Journal 9:3-10]. Sin embargo, en la mayoría de ellos se ha tomado como modelo de BAL Lactococcus lactis no siendo los resultados siempre transferibles a otras bacterias lácticas como Lactobacillus. Los diferentes sistemas de control de la expresión génica desarrollados están basados en vectores de expresión e integración en los que se utilizan diferentes genes marcadores y elementos reguladores. Sin embargo, en muchas ocasiones dichos vectores carecen de elementos reguladores propios o proceden de otros microorganismos, lo que dificulta la regulación de los genes expresados. Recientemente, se ha desarrollado un vector de expresión basado en los elementos reguladores del gen nisA de Lactococcus lactis que codifica un péptido antimicrobiano, la nisina [Ruyter P.G.G.A., Kuipers O. and de Vos W.M., 1996, Appl. Environm. Microbiol. 62:3662-3667, EP0712935, 1996-05-22, Stichting NL I Zuivelonderzoek]. Este sistema permite aumentar la expresión de cualquier gen más de 1000 veces de forma controlada. Sin embargo, el proceso de inducción ocurre por un mecanismo de transducción de señal del tipo de los sistemas de regulación de dos componentes, necesitando por ello la presencia de los productos de los genes nisK y nisR, por lo tanto este sistema requiere varios pasos de manipulación para transferirse a otros microorganismos que carecen de los genes reguladores. Otro sistema de expresión en Lactococcus lactis es el basado en la RNA polimerasa del fago T7 de E. coli (GB2278358, 1994-11-30, Lynxvale LTD (GB)). Con esta técnica se ha obtenido la expresión de proteínas con carácter inmunológico en L. lactis. Sin embargo, este sistema de expresión supone el uso de DNA heterólogo, como el promotor y gen estructural de la RNA polimerasa del fago T7.
Por otro lado, la utilización de genes marcadores que permiten el metabolismo de azúcares poco utilizados por bacterias ácido lácticas [Leenhouts K, Bolhuis A., Venema G. and Kok J., 1998, Appl. Microbiol and Biotechnol. 49, 417-423] o de aquellos que expresan péptidos con actividad antimicrobiana supone la adición de los respectivos inductores al medio de cultivo para mantener la expresión con el consiguiente coste adicional.
Cualquier bacteria es capaz de utilizar diferentes carbohidratos como única fuente de carbono y energía. Los genes que codifican las enzimas implicadas en el transporte y metabolismo de azúcares se expresan, en la mayoría de los casos, únicamente si el correspondiente carbohidrato está presente en el medio y si éste último carece de azúcares fácilmente metabolizables como la glucosa y fructosa. Este tipo de regulación hace referencia a mecanismos de inducción y de represión catabólica, respectivamente.
Los azúcares de fácil asimilación son siempre consumidos por las células bacterianas de forma preferente, de modo que la expresión de los genes del catabolismo de otras fuentes de carbono queda atenuada o inhibida, a lo que se denomina represión catabólica. Este proceso se ha estudiado extensamente tanto en bacterias Gram-negativas como Gram-positivas, estando en todas ellas implicado el sistema de fosfotransferasa dependiente del fosfoenolpiruvato (PTS). En bacterias Gram-positivas se ha establecido que en presencia de glucosa, la proteína HPr fosforilada en la serina 46 se une a una proteína represora denominada CcpA y el complejo formado reconoce una secuencia de DNA muy conservada (secuencia eré) que se suele localizar en la zona promotora e impide el inicio de la transcripción de los genes afectados.
Por otro lado, los operones del catabolismo de azúcares frecuentemente se regulan mediante proteínas activadoras, represoras o antiterminadoras, de forma que en presencia del inductor se efectúa la transcripción y traducción de sus genes. Existen ejemplos ya estudiados de inducción por anti terminación en bacterias Gram negativas como Escherichia coli, Erwinia chrysanthemi, Klebsiella pneumoniae y Klebsiella oxytoca. Entre las bacterias Gram positivas, Bacillus subtilis es la mejor estudiada habiéndose descrito 7 sistemas de antiterminación diferentes. Este tipo de mecanismo de regulación se ha encontrado también en B. amyloliquefaciens, B. stearothermophilus, Staphylococcus carnosus, Lactococcus lactis y Lactobacillus casei. Los mecanismos de antiterminación se caracterizan por presentar una secuencia RAT de unión al RNA, que es reconocida por la proteína antiterminadora, y una estructura terminadora que se localizan entre el inicio de la transcripción y el de la traducción del operón. En presencia del inductor, la proteína antiterminadora se une a la secuencia RAT, desestabiliza la estructura terminadora y permite la transcripción completa del operón. Todas las proteínas antiterminadoras comparten un grado de similitud elevado, identificándose en ellas tres dominios: uno de unión al RNA (RBD) y dos dominios regulados por los elementos del PTS (PRD-I y PRD-II). También se ha observado una alta homología en las secuencias RAT de los diferentes sistemas e incluso se ha encontrado que las proteínas antiterminadoras de B. subtilis y E. coli son intercambiables, indicando que este sistema de regulación está conservado en los distintos tipos de bacterias [Rutberg B., 1997, Molecular Microbiol. 23:413-421; Stülke J., Arnaud M., Rapoport G. and Martin- Verstraete, I., 1998, Molecular Microbiol. 28:865-874]. El papel que juegan los elementos del PTS, EII y HPr, varia de un sistema a otro pero se basa generalmente en la regulación de la actividad antiterminadora por fosforilación de los dominios PRD-I y PRD-II. Estos dominios PRD, sin embargo, no se requieren para la actividad antiterminadora, pues sólo los 55-60 amino ácidos del extremo amino-terminal son suficientes para deshacer la estructura del terminador y por tanto, inducir la expresión génica [Tortosa P., Aymerich S., Lindner C, Saier M.H.Jr., Reizer J. and D. Le Coq, 1997, J. Biol Chem. 272:17230-17237].
Uno de los sistemas mejor estudiados en BAL es el transporte de lactosa. En Streptococcus thermophilus se ha descrito que este azúcar entra a través de una permeasa de tipo antiporter, LacS, y es hidrolizada por una β-galactosidasa, lacZ, a glucosa y galactosa que es expulsada al medio exterior. Los genes que codifican estas proteínas están formando un operón lacSZ cuya expresión está inducida por galactosa y reprimida por catabolito [Poolman B., Royer T.J., Mainzer S.E. and Schmidt B.F., 1989, J. Bacteriol. 171:244-253; Poolman B., Royer TJ., Mainzer S.E. and Schmidt B.F., 1990, J. Bacteriol. 172:4037-4047, Poolman B., 1993, FEMS Microniol. Rev. 12, 125-147]. Basándose en este sistema se obtuvieron, por integración entre los genes lacS y lacZ, imitantes que expresaban un gen de resistencia a cloranfenicol (caí) con un patrón de expresión similar al del operón. Sin embargo, la actividad β-galactosidasa (LacZ) se veía afectada en las cepas imitantes posiblemente debido a que se perdía el sito de unión al ribosoma del gen lacZ [Mollet B., Knol J., Poolman B., Marciset O., Delley M., 1993, J. Bacteriol. 175: 4315-4324, US5491079, 1996-02-13, Nestec S.A.]. El sistema de utilización de la lactosa en L. lactis ha sido estudiado en detalle

[de Vos W.M. and Vaughan E.E., 1994, FEMS Microbiol. Rev. 15:217-239] y está formado por el operón lacABCDFEG, que codifica las enzimas necesarias para la utilización de la tagatosa y de la lactosa. Como en el caso de los genes de la lactosa de Streptococcus mutans o Staphylococcus aureus, el promotor localizado delante del gen lacA está regulado por la proteína LacR, homologa a represores como GutR, FucR o DeoR de E. coli, siendo el inductor del sistema la tagatosa 6-fosfato [van Rooijen R.J, and de Vos W.M, 1990, J. Biol. Chem. 265:18499-18503]. Este sistema inducible ha sido utilizado en el desarrollo de diferentes vectores de expresión para Lactococcus [MacCormick, C.A., Griffin H.G. and Gasson M.J., 1995, FEMS Microbiol. Lett. 127:105-109; Platteeuw C, van Alen-Boerrigter I., van Schalkwijk S. and de Vos W.M., 1996, Appl. Environ. Microbiol. 62: 1008-1013; EP0355036, 1990-02-21, NL Zuivelonderzoek Inst.].
Sin embargo, el sistema de utilización de lactosa de Lactobacillus casei difiere del utilizado por las dos BAL anteriormente citadas tanto en la estructura génica (lacTEGF) como en el mecanismo de regulación [Chassy, B. and Thompson J., 1983, J. Bacteriol. 154:1195-1203; Alpert, C. -A. and Chassy B. M., 1988, Gene 62:277-288; Porter E. V. and. Chassy B. M., 1988, Gene 62:263-276; Alpert, C. -A. and Chassy B. M., 1990, J. Biol. Chem. 265:22561-22568; Veyrat A., Monedero V. and Pérez-Martínez G, 1994, Microbiology 140, 1141-1149; Gosalbes M.J., Monedero V., Alpert, C.-A. and Pérez-Martínez G., 1997, FEMS Microbiol. Lett. 148: 83-89] ya que se induce gracias a una proteína antiterminadora, LacT, homologa a proteínas que regulan la expresión de promotores de genes de utilización de mono y disacáridos en otras bacterias, como BglG en E. coli o SacY en Bacillus subtilis [Alpert, C. -A. and Siebers U., 1997, J. Bacteriol. 179:1555-1562]. En Lactobacillus casei el inductor es la lactosa, único azúcar presente en la leche y el mayoritario en medios derivados de él, a través de un mecanismo de antiterminación en el que están implicados diferentes elementos reguladores, como la secuencia denominada RAT, que es el sitio de unión al RNA de proteínas antiterminadoras, una estructura terminadora de la transcripción y la proteína antiterminadora [Gosalbes M.J., Monedero V. and Pérez-Martínez G., 1999, J. Bacteriol. 181:3928-3934]. Además existe una fuerte represión por glucosa mediada por la proteína CcpA y elementos del sistema de fosfotransferasa dependiente del fosfoenolpiruvato (PTS) [Monedero V., Gosalbes M.J. and Pérez-Martínez G., 1997, J. Bacteriol. 179: 6657-6664]. Este mecanismo de regulación permite un control estricto y consistente de la expresión de las características deseadas.
El sistema de regulación por antiterminación ha sido descrito tanto en bacterias Gram-negativas como Gram-positivas pudiendo ser, como se ha comentado anteriormente, en ciertos casos intercambiables entre distintos operones, e incluso en otras bacterias [Manival X., Yang Y., Strub, M.P., Kochoyan, M., Steinmetz, M., and Aymerich, S. 1999, EMBO J. 16: 5019-5029]. Sin embargo, es importante señalar que este tipo de elementos reguladores no se ha utilizado previamente en el desarrollo de sistemas de expresión en bacterias.

DESCRIPCIÓN DE LA INVENCIÓN
Breve descripción
El presente invento describe el uso de un método para la expresión de proteínas en bacterias, que se basa en el efecto inductor, por ejemplo, de un carbohidrato sobre la actividad antiterminadora de una proteína de la familia de antiterminadores BlgG/SacY. El procedimiento se ha ensayado con el sistema derivado del operón lacTEGF, inducible por lactosa en Lactobacillus casei, para la expresión de proteínas de diversa naturaleza. En la invención se incluyen ejemplos de expresión en plásmidos multicopia o de integración en el operón cromosómico lαcTEGF consiguiendo así la expresión coordinada de los genes deseados conjuntamente con los que codifican los enzimas del metabolismo de la lactosa.

Descripción detallada
El sistema que se cita por los inventores se basa en la actividad antiterminadora de LacT, que media la inducción por lactosa en Lactobacillus casei.
En la Figura 1 se describe la estructura génica y los elementos reguladores del operón lactosa de Lactobacillus casei CECT5275. En este microorganismo el operón de la lactosa está localizado en el cromosoma y consta de cuatro genes lacTEGF que codifican una proteína antiterminadora LacT, el elemento EIEBC del transporte de lactosa por PTS, la fosfo-β-galactosidasa y el elemento EIIA del transporte PTS, respectivamente. En el extremo 5' de este operón está localizado el promotor con las regiones -35 (TTTACA) y -10 (TACAAC), estableciéndose el inicio de la transcripción en los nucleótidos TG (SEQ ID NO 1). Además, han sido identificadas otras secuencias típicas de promotores de microorganismos Gram-positivos tales como una secuencia TG en la posición -15 y una zona rica en adeninas en la región - 45. Solapándose con la región -35 se ha podido identificar una secuencia ere (5'-ATAAAACGTTTACA) de unión a la proteína reguladora CcpA. A continuación de este promotor se ha identificado una secuencia que actuaría como un terminador r/to-independiente. Precediendo y solapando a esta última estructura existe una secuencia RAT (5'-GGATTGTGACTATTTAATTAGGCGAG), similar al sitio de unión al RNA de proteínas antiterminadoras. Tanto la secuencia nucleotídica del operón lactosa como la de las regiones 5' y 3' flanqueantes fue depositada en la base de datos EMBL bajo el número Z80834.
La regulación del operón lactosa permite un control estricto y consistente de la expresión, utilizando elementos reguladores propios de Lactobacillus. En presencia del inductor del sistema, la lactosa, la proteína antiterminadora LacT, en su forma activa, se une a la secuencia RAT y desestabiliza la estructura terminadora permitiendo la expresión del operón. La utilización de lactosa en L. casei está sujeta a una fuerte represión por glucosa, es decir que no existe expresión del operón cuando dicho azúcar está en el medio. En dichas condiciones, la proteína reguladora CcpA se une a la secuencia ere bloqueando el inicio de la transcripción del operón. Además, en este efecto represor interviene el mecanismo de antiterminación, ya que la proteína LacT, en presencia de glucosa, se encuentra en su forma inactiva y por lo tanto la transcripción se detiene a nivel del terminador.
El uso de elementos reguladores tales como los descritos para el operón lactosa de L. casei, y como se demuestra en los ejemplos posteriores, permite la máxima expresión de la/s característica/s en presencia del inductor, que en el caso del operón anteriormente citado es la lactosa, azúcar mayoritario en la leche y otros productos derivados de ella, como el lactosuero, y forma parte de la presente invención. Actualmente el lactosuero es fácil de obtener por lo que supondría un coste mínimo y además se daría salida comercial a un efluente que en muchos casos se desecha.
Por otro lado, se pueden utilizar un fragmento cualquiera de la secuencia de

DNA que se describe en la presente invención o variantes de ellos obtenidos por mutación que mantengan sustancialmente esta capacidad reguladora de la expresión génica a través de una proteína antiterminadora. Estas variantes pueden ser determinadas fácilmente a través del conocimiento existente de las técnicas de biología molecular, y forman parte de la presente invención.
Estas secuencias reguladoras pueden utilizarse en construcciones génicas en las que se haya integrado una secuencia de nucleótidos codificante de un gen que se desee expresar y posteriormente introducirla en un sistema de expresión recombinante. El sistema de expresión puede ser un plásmido, como el desarrollado en la presente invención, o cualquier otro tipo de vector de los que están descrito en la literatura, como un transposón, un bacteriófago o derivados obtenidos por técnicas moleculares. Los genes que confieren las características deseadas se pueden expresar en multicopia bajo el control de estos elementos reguladores y también se pueden integrar en el cromosoma, en el operón lacTEGF de L. casei mediante un vector de integración desarrollado en esta invención, quedando bajo el control de los elementos reguladores mencionados. Las cepas que se obtienen por este procedimiento son seguras y aplicables en la industria de alimentos. El uso de estas construcciones génicas y de cualquiera de estos sistemas de expresión forma parte de la presente invención.
En los siguientes ejemplos se muestra como el uso de estos vectores permite la regulación de la expresión de genes de interés industrial en células transformadas. En la presente invención se ha expresado el gen gusA de E. coli que codifica la enzima β-glucuronidasa así como los genes (ilvB, ilvN) que codifican las subunidades catalítica y reguladora de la enzima acetohidroxi ácido sintasa de Lactococcus lactis con la sobreproducción de diacetilo por E. casei. Este sistema de regulación de la expresión génica es aplicable a L. casei y otras bacterias con sistemas de antiterminación homólogos. El uso de estas células para la expresión de péptidos o proteínas de interés industrial forma parte de la presente invención.
En resumen, el sistema de expresión génica de esta invención tiene las siguientes características:
Inducción por azúcares en Lactobacillus casei u otras bacterias sin necesidad de introducir ninguna mutación en los elementos del sistema PTS para el transporte de azúcares y/o proteínas reguladoras, como puede ser la proteína

CcpA y reguladores que tengan dominios regulados por elementos del PTS, como por ejemplo, antiterminadores o reguladores transcripcionales .
Uso de un elemento regulador propio de Lactobacillus casei con función de antiterminador que permite un control estricto de la expresión de la/s característica/s deseadas mediante inducción por lactosa.
- Cuando la expresión de los genes de interés no es deseable, se consigue su represión por azúcares de fácil asimilación, como por ejemplo, glucosa o fructosa.

EXPLICACIÓN DETALLADA DE LOS DIBUJOS
Figura 1.- Estructura y elementos reguladores del operón lactosa de L. casei.
Figura 2.- Construcción y mapa físico del vector pIAβ51ac según la invención. Las flechas indican la dirección de la transcripción.
Figura 3.- A) Mapa físico de pMJ67 según la invención. Las flechas indican la dirección de la transcripción. Erm, gen de resistencia a eritromicina; Ap, gen de resistencia a ampicilina. ori, origen de replicación. B) secuencia nucleotídica sintética de la región de 45 pb entre los genes lacG y lacF. RBS, sitio de unión a ribosoma. * codón de parada TAA.
Figura 4.- Mapa físico del plásmido pIAβ51acgus obtenido según la invención.
Figura 5.- Mapa físico del plásmido pMJ70 obtenido según la invención.
Figura 6.- Esquema correspondiente a la película radiográfica del análisis Southern del

DNA genómico del primer integrante del gen gusA (carrera 1), CECT5290 (carrera 2) y L. casei CECT 5276 (carrera 3). Como sonda se ha utilizado un fragmento BarnRl del plásmido pRV300 que porta el gen que confiere resistencia a la eritromicina.
Figura 7.- Mapa físico del plásmido pMJ87 obtenido según la invención.
Figura 8.- Esquema correspondiente a la película radiográfica del análisis Southern del DNA genómico de del primer integrante de los genes ilvBN (carrera 1), CECT5291 (carrera 2) y L. casei CECT 5276 (carrera 3). Como sonda se ha utilizado el mismo fragmento que para el análisis Southern descrito en la Figura 6.
Figura 9.- Determinación de metabolitos finales.

EJEMPLOS
Lactobacillus casei CECT 5275, CECT5276 y Escherichia coli DH5α son las cepas utilizadas en los diferentes experimentos de clonación e integración. Lactobacillus casei CECT 5276 no puede utilizar la lactosa ya que presenta una mutación en el gen lacF. L. casei se ha crecido en medio MRS (Oxoid) (liquido y sólido) y MRS fermentación (Adsa-Micro, Scharlau S:A:, Barcelona, España) (liquido y sólido) con un 0.5% de azúcar, utilizándose el medio LB para el crecimiento de E. coli. La construcción del vector de expresión pIAβ51ac se realizó a partir de los plásmidos pIL253 [Simón D. and Chopin A., 1988, Biochimie 70:559-566], pACYC184 [Chang A.C.Y. and Cohén S.N* 1978, J. Bacteriol. 134:1141-1156] y pJDC9 [Chen J.D. and Morisson DA., 1988, Gene 64:155-164]. El plásmido pRV300 [Leloup L., Ehrlich D., Zagorec M. and Morel-Deville F., 1997, Appl. Environ. Microbiol. 63:2117-2123] se utilizó para construir el vector de integración pMJ67. La concentración de los antibióticos utilizados fue de eritromicina 300 μg/ml, de ampicilina 100 μg/ml y 25 μg/ml de cloranfenicol para E. coli y 5 μg/ml de eritromicina para L. casei. Las técnicas moleculares generales se han llevado a cabo siguiendo los protocolos descritos por Sambrook et al. [Sambrook J., Fritsch E.F. and Maniatis T., 1989, Molecular cloning: a Laboratory Manual.2a ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York]. Las técnicas específicas utilizadas para Lactobacillus, tales como purificación de DNA genómico y transformación, fueron las descritas en J. Bacteriol., 1999, 181:3928-3934. Las manipulaciones de DNA se han realizado de acuerdo con las recomendaciones de los fabricantes de las endonucleasas de restricción y enzimas modificantes. La actividad fosfo-β-galactosidasa y β-glucuronidasa se determinaron en células permeabilizadas de L. casei siguiendo el procedimiento descrito en J. Bacteriol., 1983, 154:1195-1203 y en Appl. Environ. Microbiol., 1994, 60:587-593, respectivamente. Las reacciones de PCR se llevaron a cabo con la DNA polimerasa termostable comercial Dynazyme [Finnzymes Oy, Riihitontuntie, Finlandia] o con el sistema Expand ™ High fidelity PCR (Roche Molecular Biochemicals). DNA genómico de Lactococcus lactis MG1363 [Gasson M.J., 1983, J. Bacteriol. 154:1-9] se purificó siguiendo el procedimiento descrito para Lactobacillus.

EJEMPLO 1.- Expresión del gen gusA en multicopia.
El vector replicativo, denominado pIAβ51ac, es un derivado de pIL253 y consiste en un fragmento de DNA de 295 pares de bases (pb) que contiene el promotor y regiones reguladoras (plac) del operón de la lactosa de L. casei, el origen de replicación para bacterias Gram-negativas (pl5A) del plásmido pACYC184, un sitio de clonaje múltiple, el gen lacZ y dos copias del terminador rrnB del operón ribosomal de Escherichia coli procedentes del plásmido pJDC9 (Figura 2). Este vector permite la expresión, en multicopia, de los genes clonados bajo plac en L. casei y bacterias con sistemas de antiterminación homólogos. Estos genes pueden codificar, por ejemplo, proteasas, peptidasas, mecanismos de resistencia a bacteriófagos, enzimas que intervengan en el metabolismo del citrato, enzimas que intervengan en la producción de bacteriocinas o proteínas que confieran resistencia a bacteriocinas, productos de interés nutricional o inmunológico. La cepa de Escherichia coli DH5α que contiene pIAβ51ac ha sido depositada en CECT con el número 5278.
Se ha utilizado el vector de expresión desarrollado, pIAβ51ac, para expresar en multicopia el gen gusA bajo los elementos reguladores del operón lactosa en L. casei. Este gen codifica la enzima β-glucuronidasa de E. coli. Para ello se ha amplificado por PCR dicho gen, sin zonas reguladoras, tomando como molde el plásmido pNZ272 [Platteeuw C, Simons G. and de Vos W.M., 1994, Appl. Environ. Microbiol. 60:587-593]. Los oligonucleótidos utilizados como cebadores fueron los siguientes: gusl, 5'-AAAACTGCAGTATTATTATCTTAATGAGG y gus2, 5'-CGGAATTCTCATTGTTTGCCTCCC. A estos oligonucleótidos sintéticos se les ha introducido los sitios de reconocimiento de las endonucleasas de restricción (subrayados) Pstl a gusl y EcoRI a gus2. Εl fragmento de DNA de 1847 pb amplificado se trató con el fragmento Klenow de DNA polimerasa I para convertir los extremos protuberantes en romos y se clonó en pUC19/ Smαl. La construcción que portaba la orientación adecuada fue digerida con la endonucleasa Pstl y el inserto se clonó en el vector pIAβ51ac previamente digerido con la enzima Pstl. El plásmido resultante, denominado pIAβ51acgus (Figura 4), se utilizó para transformar L. casei. Se eligió uno de los transformantes para realizar los estudios de actividad β-glucuronidasa. En el transformante elegido se pudo detectar actividad β-glucuronidasa cuando se crece sobre lactosa por lo que se está induciendo la expresión a partir del plac del plásmido. La presencia de glucosa ejerce una fuerte represión. Así pues, el patrón de expresión de la β-glucuronidasa es similar al del operón lactosa (Tablal).

Tabla 1 : Actividad β-glucuronidasa medida en L. casei CECT5275 transformada con los plásmidos pIAβ51ac y pIAβ51acgus.


Los valores representan al menos tres experimentos independientes. R, ribosa; L, lactosa; G+L, glucosa más lactosa. ND, actividad no detectable.

EJEMPLO 2 .-Expresión del gen gusA integrado en el operón lactosa.
Los productos deseados se pueden obtener también insertando los respectivos genes en el cromosoma de la bacteria bajo los elementos reguladores elegidos utilizando técnicas de integración cromosomal. La forma más simple de integración cromosomal se basa en la utilización de un vector no replicativo que porta un fragmento de DNA homólogo a una región del cromosoma de la bacteria huésped a la que se transforma con dicho vector. La integración ocurre por un mecanismo de recombinación tipo Campbell o entrecruzamiento simple. Sin embargo, este último tipo es inestable debiendo ejercer una presión selectiva para mantener la estructura integrada. Ahora bien, si el vector integrativo porta dos regiones homologas, al darse dos recombinaciones, el/los gen/es deseado/s se integra/ n de manera estable y se elimina el vector utilizado para la integración. Estas recombinaciones pueden ocurrir simultáneamente (entrecruzamiento doble) o de manera consecutiva. Para expresar el/los gen/es deseados a partir de los elementos reguladores elegidos es conveniente que la integración no sea al azar, por lo que las zonas homologas del vector deben estar bien caracterizadas. El vector de integración desarrollado en esta invención, pMJ67, permite el uso de los elementos reguladores del operón lactosa de L. casei para expresar genes de interés. Este vector está basado en el plásmido pRV300, al que se le han introducido como zonas homologas, para dirigir las recombinaciones, el extremo 3' del gen lacG y el gen completo lacF del citado operón (Figura 3 A). La región intergénica de 45 pb que existe entre ambos se ha sustituido por un fragmento sintético de DNA que porta un sito de unión a ribosoma típico para Lactobacillus y cuatro sitios de reconocimiento de los enzimas de restricción Pstl, Ndel, Smal y EcoBI (Figura 3B). La cepa de Escherichia coli DH5α que contiene pMJ67 ha sido depositada en la CECT con el número 5277. Las recombinaciones ocurren en L. casei consecutivamente quedando integrado/s el/los gen es en la región de 45 pb que existe entre los dos genes lacG y lacF, expresándose a partir de los elementos reguladores del operón lactosa. Para facilitar la selección de los dobles recombinantes es conveniente utilizar una copia muíante del gen lacF que puede ser la que porta el vector de integración o la copia cromosomal. Si el/los gen/es que se desea integrar proceden de un microorganismo reconocido como seguro ("GRAS"), los mutantes de esta bacteria ácido láctica serán de grado alimentario, ya que por el procedimiento descrito no habrá ningún otro fragmento de DNA integrado salvo el/los gen/es de interés que quedará/n así sujetos al sistema de regulación del operón lactosa. Al ser la lactosa el inductor de este sistema de expresión, el uso de estos elementos reguladores permite la utilización de medios de cultivo baratos como la leche o derivados de ella (suero lácteo) para producir de manera segura productos de interés tecnológico, nutricional o farmacéutico.

Para demostrar la expresión en monocopia de genes a partir de los elementos reguladores del operón lactosa de L. casei se clonó el gen gusA en el vector integrativo pMJ67. Para ello se amplificó, al igual que en el ejemplo anterior, por PCR dicho gen tomando como molde el plásmido pNZ272 y utilizando los mismos oligonucleótidos. En este caso el fragmento amplificado se digirió con las enzimas Pstl y EcoRI y se clonó en el vector integrativo pMJ67 previamente digerido con ambas endonucleasas. Εl plásmido obtenido, denominado pMJ70 (Figura 5), se utilizó para transformar por electroporación L. casei CΕCT5276. Los transformantes se seleccionaron en placas del medio MRS con eritromicina. Por este procedimiento, las colonias que crezcan deberían haber integrado, por recombinación entre zonas homologas, el vector ya que éste porta el gen que codifica la resistencia a dicho antibiótico. Como dijimos anteriormente, pMJ67 porta dos zonas homologas al genoma bacteriano: el extremo 3' del gen l cG y lacF, por lo que el entrecruzamiento simple se dará por una de las dos. Se analizaron diferentes transformantes por PCR y se eligió un primer integrante en el que la recombinación se había dado por lacF, siendo resistente a eritromicina y no pudiendo fermentar la lactosa. Para favorecer el segundo entrecruzamiento, se creció el mencionado integrante en el medio MRS sin eritromicina durante 200 generaciones. Los dobles recombinantes se seleccionaron en placas de MRS de fermentación con lactosa y sin eritromicina. Aquellas colonias en las que se haya reconstituido el operón lactosa quedando el gen gusA integrado en él y hayan perdido el vector integrativo podrán crecer sobre lactosa y serán sensibles a eritromicina. Se eligió uno de estos mutantes, depositado en la CΕCT bajo el número 5290, y se llevó a cabo análisis Southern para comprobar que la resistencia a eritromicina se había perdido con el vector tras la doble recombinación (Figura 6). Para ello se digirieron los DNAs genómicos de L. casei CΕCT5276, del primer integrante y de CΕCT5290 con la endonucleasa Bglü y se utilizó como sonda un fragmento BamHl del plásmido pRV300 que contiene el gen de la eritromicina. Únicamente, se detectó una señal de hibridación en el primer integrante confirmándose que el muíante CΕCT5290 no contiene DNA plasmídico. Los mutantes de L. casei obtenidos únicamente tienen integrado en el cromosoma el gen gusA que se expresa a partir de los elementos reguladores del operón lactosa de L. casei. Como se muestra en la Tabla 2 la actividad β-glucuronidasa se induce por lactosa y se reprime por glucosa al igual que ocurre con la actividad P-β-galactosidasa, enzima codificado en el operón lactosa.

Tabla 2: Actividad P-β-galactosidasa y β-glucuronidasa medida en L. casei CECT5275 y CECT5290.


Los valores representan al menos tres experimentos independientes. R, ribosa; L, lactosa; G+L, glucosa más lactosa.

EJEMPLO 3.- Expresión de los genes ilvBN integrados en el operón lactosa.
El procedimiento descrito permite la integración y expresión de genes a partir de los elementos reguladores del operón lactosa de L. casei. Si los genes que se integran proceden de microrganismos GRAS los mutantes de L. casei que se obtienen son seguros y aplicables en la industria de alimentos.
Los genes ilvBN se amplificaron por PCR tomando como molde el DNA genómico de Lactococcus lactis MG1363 y utilizando como cebadores los oligonucleótidos ilvBNl (5 '- CGATCATATGAAAAAAATAAAGTTAGAAAAACCTACTTCC) y ilvBN2 (5'-CCGAATTCTTAGCCACGCTCAAAACCTGC). Al igual que en el ejemplo anterior se ha introducido los sitios de reconcimiento de las endonucleasas (subrayados) Ndel a ilvBNl y EcoRI a ilvBN2. Estos genes, ilvBN, codifican la subunidad catalítica y reguladora de la enzima acetohidroxi ácido sintasa implicada en la biosíntesis de aminoácidos ramificados como la isoleucina y valina. Esta enzima cataliza la reacción de ácido pirúvico a α-acetolactato, precursor del diacetilo. Este último producto contribuye de manera considerable al desarrollo del aroma y sabor de productos lácteos fermentados. El fragmento de 2212 pb amplificado se clonó en el vector pMJ67 digiriendo ambos tipos de DNA con Ndel y EcoRl y obteniéndose el plásmido pMJ87 (Figura 7). El procedimiento de integración y selección del primer integrante y del doble recombinante fue el mismo que se ha descrito anteriormente. En este ejemplo se obtiene un muíante de grado alimentario de L. casei, depositado en la CECT bajo el número 5291, ya que los genes ilvBN proceden de L. lactis, microorganismo considerado GRAS, y el vector se ha perdido tras el segundo proceso de recombinación. Como se muestra en la Figura 8, únicamente hay hibridación entre la sonda descrita en el ejemplo anterior y el DNA cromosómico digerido con las enzimas de restricción RgtTf y Pstl del primer integrante. En L. casei CEC5291 el plásmido portador de la resistencia a eritromicina se ha perdido tras la segunda recombinación. Con la integración de estos genes se pretendía el aumento de la producción de diacetilo en L. casei en condiciones de inducción, crecimiento en lactosa. Mediante cromatografía de gases acoplada a espectroscopia de masas y siguiendo la técnica de suspensión de células en reposo descrita por Danneau P. and Pérez-Martínez G. [Journal of Chromatography A, 1997, 775:225-230] se cuantificaron los diferentes metabolitos finales, siguiendo los métodos previamente descritos [Danneau P. and Pérez-Martínez G., Journal of Chromatography A, 1997, 775:225-230]. El muíante CECT5291 produce diacetilo y acetoína solo en condiciones de inducción (Figura 9), siendo la producción de eslos metabolitos mínima en la cepa salvaje. Así pues, con la integración de los genes ilvBN en el operón lactosa de L. casei se ha conseguido el aumento de su producción que es máxima en presencia de lactosa y ausencia de glucosa.