Certains contenus de cette application ne sont pas disponibles pour le moment.
Si cette situation persiste, veuillez nous contacter àObservations et contact
Note: Texte fondé sur des processus automatiques de reconnaissance optique de caractères. Seule la version PDF a une valeur juridique


Voltage activated calcium channels play important roles including
neuroexcitation, neurotransmitter and hormone secretion, and regulation of gene transcription through Ca-dependent transcription factors. Their functions depend in part on their cellular localization and their gating properties (characteristics of their opening, inactivation, deactivation, and recovery from inactivation). Five general classes of voltage activated calcium channels have been observed in various neuronal and non-neuronal tissues. The complement of channel subunits and the subcellular localization of the expressed voltage activated calcium channels determine the functional cellular properties.

Diversity of voltage-gated Ca channels fall into two major categories: low voltage activated (LVA) and high voltage activated (HVA).

A conserved general structure for all cloned voltage-gated calcium channel alpha subunits (the pore-forming subunit) has been identified. It consists of 4 domains with homology to the domains present in voltage-gated K and Na channels. Each domain contains 6 membrane spanning regions (S1-S6) and a pore region (P) located between S5 and S6. The extracellular loops are generally very short; intracellular loops contain sites that are modulated by phosphorylation and can interact with other effectors. However, there are notable differences in the lengths of the S5-S6 loop of domain I and the intracellular loop between domains I and II among alpha subunits.

Different calcium channels are best distinguished by their pharmacological profiles since their electrophysiological properties differ depending on the cell type or tissue in which they are expressed, presumably because of modulation by cellular proteins, for instance kinases, and also auxiliary calcium channel subunits.

The HVA channel classes are thought to be composed of at least 3 or 4 different subunits: αl (which contains the pore), beta (β) and α2δ. In skeletal muscle a γ subunit also co-precipitates with the skeletal channel complex. Recently two gamma-like subunits have been cloned from brain — one of which is the gene mutated in the stargazer mutant mouse (Black et al., 1999; Letts et al., 1998). The subunit composition has been proved for only the skeletal L-type (αl α2δ β γ) and brain N-type (αl α2δ β) channels (Perez-Reyes and Schneider, 1995). These channels generally require large membrane depolarizations for activation (-30 mV from the resting potential (RP)). Four classes of HVA calcium channels have been identified on the basis of electrophysiological, pharmacological and molecular data. These classes include L-type (encoded by at least 4 genes (including αl subunits αlS (skeletal muscle), αlC, αlD (neuroendocrine), and αlF (retinal)), N-type (αlB; (Williams et al, 1992)), P/Q-type (αl A) and R-type (encoded by at least the αlE gene).

HVA αl families are strongly affected by co-expression of the cytoplasmically localized β subunit, particularly the expression levels of functional cell surface channels and the electrophysiological response of the channel (ie., kinetics), β subunits interact with a specific sequence in the I-II intracellular loop to increase the number of functional channels and alter the activation and inactivation properties of the channel complex (Furukawa et al, 1998). There are at least 4 β genes that are alternatively spliced (βla-c; β2a-c; β3; β4;(Perez-Reyes and Schneider, 1995)); the effect of each of these βs on αl function appears to depend on the αl class. Interestingly, mutants in β (Cchβ4) produce ataxia and seizures in the lethargic (Ih) mouse (Burgess et al, 1997). α2δ subunits also modulate αl function and the known gene co-segregates with malignant hyperthermia phenotype in certain families (lies et al, 1994).

The physiological roles of HVA channels depend on subcellular location of the channel and tissue type. Subcellular location varies among tissues but have been shown to be important in neurotransmitter and hormone release, action potential duration, excitation-contraction coupling in muscle cells, and gene expression (Miller, 1987). There are at least three genes in the T-type family of LVA calcium channels (αlG, αlH, and all) (Perez-Reyes, 1998). Their structure differs from that of the HVA channels in a number of important ways. The I-II intracellular linker is much longer (~400 amino acids) than that of the known HVA channels. The Domain I S5-P extracellular linker is longer than that of the HVA channels and may be a good target for drug interactions with this channel, β does not appear to be associated with αl in this class and they lack the canonical sequence that is known to be crucial for beta subunit binding (Lambert et al, 1997; Leuranguer et al, 1998). Anti-sense experiments directed against all known beta's show a decrease in the expression of HVA calcium channels but not LVA calcium channels in nodose ganglion neurons (Lambert et al, 1997).

Other proteins or cellular environments may be required for robust T-channel expression since αlG expressed in oocytes or HEK293 cells produces dramatically different current magnitudes in these two cell types (Perez-Reyes, 1998).

T-type calcium currents have been observed in vivo in many cell types in the peripheral and central nervous systems including thalamus, inferior olive, cerebellar Purkinje cells, lateral habenular cells, dorsal horn neurons, sensory neurons (DRG, nodose), cholinergic forebrain neurons, hippocampal interneurons, CA1, CA3 dentate gyms pyramidal cells, basal forebrain neurons, amygdaloid neurons (Talley et al, 1999). T-type channels are prominent in the soma and dendrites of neurons that reveal robust Ca-dependent burst firing behaviors such as the thalamic relay neurons and cerebellar Purkinje cells (Huguenard, 1996).

Physiological roles and therapeutic areas.
T-type calcium channels are involved in the generation of low threshold spikes to produce burst firing (Huguenard, 1996). These channels differ from HVA channels in that they have some probability of opening at the resting membrane potential. Because their steady state inactivation curve is shifted toward negative voltages compared to HVA channels (ie., half the channels are not inactivated and are able to be opened by a depolarizing voltage step at voltages more negative than the resting membrane potential (RP)), there is a window current near the RP (ie., a portion of the T-channels are open at RP). Low threshold spikes and rebound burst firing is prominent in neurons from inferior olive, thalamus, hippocampus and neocortex (Huguenard, 1996).

T-type channels promote oscillatory behavior which has important consequences for epilepsy. The ability of a cell to fire low threshold spikes is critical in the genesis of oscillatory behavior and increased burst firing (groups of action potentials separated by about 50-100 ms). T-type calcium channels are thought to play a significant role in absence epilepsy, a type of generalized non-convulsive seizure. The evidence that voltage-gated calcium currents contribute to the epileptogenic discharge, including seizure maintenance and propagation includes 1) a specific enhancement of T-type currents in the reticular thalamic (nRT) neurons which are hypothesized to be involved in the genesis of epileptic seizures in a rat genetic model (GAERS) for absence epilepsy (Tsakiridou et al, 1995); 2) antiepileptics against absence petit mal epilepsy
(ethosuximide and dimethadione) have been shown at physiologically relevant doses to partially depress T-type currents in thalamic (ventrobasal complex) neurons (Coulter et al, 1989; Kostyuk et al, 1992); and 3) T-type calcium channels underlie the intrinsic bursting properties of particular neurons that are hypothesized to be involved in epilepsy (nRT, thalamic relay and hippocampal pyramidal cells) (Huguenard, 1996). The rat αlG is highly expressed in thalamocortical relay cells (TCs) which are capable of generating prominent Ca2+-dependent low-threshold spikes (Talley et al, 1999).

T-type channels play a critical role in thalamic oscillations and cortical synchrony , and their involvement has been directly implicated in the generation of cortical spike waves that are thought to underlie absence epilepsy and the onset of sleep (McCormick and Bal, 1997). Oscillations of neural networks are critical in normal brain function such during sleep-wave cycles. It is widely recognized that the thalamus is intimately involved in cortical rhythmogenesis. Thalamic neurons most frequently exhibit tonic firing (regularly spaced spontaneous firing) in awake animals, whereas phasic burst firing is typical of slow- wave sleep and may account for the accompanying spindling in the cortical EEG. The shift to burst firing occurs as a result of activation of a low threshold Ca2+ spike which is stimulated by synaptically mediated inhibition (ie., activated upon hyperpolarization of the RP). The reciprocal connections between pyramidal neurons in deeper layers of the neocortex, cortical relay neurons in the thalamus, and their respective inhibitory interneurons are believed to form the elementary pacemaking circuit.

T-type channels contribute to synaptic potentiation at the postsynaptic level since small changes in membrane potential (Vm) (either depolarizations (epsps; excitatory postsynaptic potentials) or hyperpolarizations (ipsps (inhibitory postsynaptic potentials);

anode break exhaltation or rebound burst firing) can open T-type calcium channels. At the hyperpolarized Vm during the ipsp more T-type channels become available to open (they have recovered from inactivation) so that upon repolarization to the RP, a larger proportion of T channels are opened and this produces anode break exhaltation, a robust rebound burst firing as the low threshold Ca spike reaches threshold for Na channel activation and action potential generation. A burst of action potentials ride on top of the Ca-dependent depolarization. This phenomenon is particularly prominent in reticular thalamic neurons (Huguenard, 1996).

T-type channels can be involved in transmitter release. In cells where T-channels are located at the presynaptic terminal, they promote neurotransmitter release (Ahnert-Hilger et al, 1996; Amoult et al, 1997)

T-type channels contribute to spontaneous fluctuations in intracellular Ca concentrations [Ca]j. They are important in pacemaker activity and therefore heart rate in the heart, and in vesicle release from non-excitable cells (Ertel et al, 1997).

T-type calcium currents are expressed differentially in different subpopulations of adult rat dorsal root ganglion (DRG) neurons. T-type currents were present at moderate densities in small diameter Type 1 and 3 cells, the former having TTX-resistant Na currents, long duration action potentials and capsaicin sensitivity (consistent with a C type nociceptive neuron) and the latter having short action potential durations, no capsaicin sensitivity (consistent with a Aδ nociceptive or Aα/β neurons) (Cardenas et al, 1995). There appear to be different types of LVA currents expressed in adult rat sensory neurons based on differential sensitivity to nM concentrations of nimodipine (Formenti et al, 1993). Because of the role of the T type calcium channel in contributing to near threshold membrane excitability, selective suppression of the T channels will decrease neuronal hyperexcitability (painful neuropathies) and raise the threshold for the perception of pain (central pain syndromes).
A specific blocker for T-type calcium channels in the pacemaker cells and conduction fibers in the heart might demonstrate "pure" bradycardic (slowing the heart rate) properties since T channels are not usually present in the ventricular myocytes of man. Drugs that block the T-type channel in specific conformational states might allow treatment of tachycardia (by decreasing the heart rate) while having little effect on the inotropic properties of the normal heart (Rousseau et al, 1996). A cardiomyopathic disease (genetic Syrian hamster model) is a result of Ca-overload due to an increased expression of T-type calcium channels in ventricular myocytes (Sen and Smith, 1994). There are increased T-type currents in atrial myocytes from adult rats with growth hormone-secreting tumors (Xu and Best, 1990). A specific T-type calcium channel blocker would act as a cardioprotectant in these cases.
T-type channels in adrenal zona fasciculata cells of the adrenal cortex have been shown to modulate cortisol secretion (Enyeart et al, 1993). Cortisol is the precursor for glucocorticoids and prolonged exposure to glucocorticoids causes breakdown of peripheral tissue protein, increased glucose production by the liver and mobilization of lipid from the fat depots. Furthermore, individuals suffering from anxiety and stress produce too high levels of glucocorticoids and drugs that would regulate these levels are sought after (eg., antagonists to CRF).
T-type calcium channels may be involved in release of nutrients from testis Sertoli cells. T-type calcium channels are expressed on immature rat Sertoli cells (Lalevee et al, 1997). Sertoli cells are testicular cells that are thought to play a major role in sperm production. The intimate juxtaposition of the developing germ cells with the Sertoli cells suggests the latter pay a role in supporting and nurturing the gametes. Sertoli cells secrete a number of proteins including transport proteins, hormones and growth factors, enzymes which regulate germinal cell development and other biological processes related to reproduction (Griswold, 1988). They secrete the peptide hormone inhibin B, an important negative feedback signal to the anterior pituitary. They assist in spermiation (the final detachment of the mature spermatozoa from the Sertoli cell into the lumen) by releasing plasminogen activator which produces proteolytic enzymes. While the role of T channels in not known, they may be important in the release of nutrients, inhibin B, and/or plasminogen activator.
Inhibition of T-type calcium channels in sperm during gamete interaction inhibits zona pellucida-dependent Ca2+ elevations and inhibits acrosome reactions, thus directly linking sperm T-type calcium channels to fertilization (Arnoult et al, 1996).
T-type calcium channels have also been implicated in cellular growth and proliferation, particularly in the cardiovascular system (Katz, 1999; Lijnen and Petrov, 1999; Richard and Nargeot, 1998; Wang et al, 1993).
Tremor can be controlled through the basal ganglia and the thalamus, regions in which T type calcium channels are strongly expressed (Talley et al, 1999). T-type calcium channels have been implicated in the pathophysiology of tremor since the anti-epileptic drug ethosuximide is used for treating tremor, in particular, tremor associated with Parkinson's disease, essential tremor, or cerebellar disease (Patent US4981867; D.A. Prince).

There are no known specific blockers of the T-type class of calcium channel. There are ions (ex. Ni+2) that are more effective toward blocking T-type calcium channels vs. HVA channels, and there are a few drugs that block T channels with higher affinity than HVA channels. A number of pharmacological blockers have differential effects on T type calcium currents expressed in different cell types (see Table 1 from (Todorovic and Lingle, 1998)), however there is a diversity of pharmacological profiles of T-type currents. The differential sensitivity of the currents to antagonists may be due to different subunit structure (Perez-Reyes, 1998) as well as cellular environments. T-type calcium channel alpha subunit genes, like the genes for HVA channels, reveal alternative splicing (Lee et al, 1999 Biophys J 76.A408). Extracellular and intracellular loops of individual T-type calcium channel clones show marked diversity amongst themselves and even less homology to HVA channels.

Mibefradil ((lS,2S)-2-[2-[[3-(lH-benzimidazol-2-yl)propyl]methyl-amino]ethyl]-6-fluoro-l-isopropyl-l,2,3,4-tetrahydronaphthalen-2-yl methoxyacetate) blocks the T-type calcium channel by preferentially intereacting with inactivated state. Thus, in a cell type with a relatively low RP ( — 50 mV) such as the smooth muscle cells, nearly all T channels will be blocked by mibefradil, whereas in cells with a very negative RP such as cardiac myocytes most of the T channels are not inactivated and therefore will not be blocked by mibefradil (Bezprozvanny and Tsien, 1995). Mibefradil had a complex blocking action on the mouse alpha 1G when applied from holding potentials of -60 and could best be fit by fitting to 2 populations of sites (Klugbauer et al, 1999). The high affinity component was reduced at -100 mV. The most prominent (low affinity) site had an IC 0 value for mibefradil of ~400 nM.

Ethosuximide is used to treat absence epilepsy and at therapeutically relevant concentrations (0.25- 0.75 mM) (Sherwin, 1989) partially blocks T-type currents in some preparations (Coulter et al, 1989). Ethosuximide has different affinities for T-type calcium channels in different tissues. The majority of T type currents from guinea pig or rat ventrobasal thalamic neurons revealed an IC50 for mibefradil of ~ 500 μM and a maximal block of- 40% block at 1 mM (Coulter et al, 1989). Interestingly, there was no effect of ethosuximide on T-currents in 25% of the TCs tested (Coulter et al, 1989). In hippocampal CA3 neurons, all components of the LVCC were insensitive to ethosuximide at 250 μM or 1 mM. If T-type calcium channels underlie the LVCC in these cells, then the drug had no effect on these T-type calcium channels (A very and Johnston, 1996). The T-type calcium channels from dorsal root ganglion neurons from one-day-old rats have higher affinity for ethosuximide than thalamic neurons (Kd for T-current is 7 μM vs 15 μM for L-type current) with a maximal block of 100% (Kostyuk et al, 1992). The human alphalH is insensitive to ethosuximide (Williams et al, WO 9928342; Williams et al, 1999).

Ni2+ is thought to act not only at the pore region but also at another unknown location on the channel protein (Zamponi et al, 1996). The mouse alpha 1G has a very low sensitivity to Ni2+ as opposed to other T-type channels (Klugbauer et al, 1999). The human alphalH expressed in oocytes has an IC50 for Ni2+ of about 6 μM (Williams et al, WO 9928342).

Amiloride, an antagonist at numerous receptors, channels and exchangers, is a low affinity antagonist at T-type calcium channels. There are noted differences in sensitivity of T currents to amiloride (Todorovic and Lingle, 1998). The effects of amiloide are highly variable depending on the cell type, with EC50's ranging from 50 to >1000 μM, suggesting that different levels of T-type channel expression in different cells or different channel complexes within different cells (Huguenard, 1996). For instance, the human alphalH expressed in oocytes has an IC50 for amiloride of about 20 μM
(Williams et al, WO 9928342).

NPPB (5-Nitro-2-(3-phenylpropylamino) benzoic acid) has been used to isolate N-type calcium channels (Stea et al, 1999) and was used in studies on the present invention to isolate T-type calcium channels. However, we found NPPB blocked halphalG-c currents. NPPB has been shown to block voltage-sensitive calcium currents (Kirkup et al, 1996), and, more specifically, L-type calcium currents (Doughty et al, 1998). Interestingly, NPPB reduced the Ca2+ resting current and altered the spike frequency of isolated cockroach dorsal unpaired median neurons (Heine and Wicher, 1998). The resting calcium current may be mediated by a T-type calcium channel, but this has yet to be confirmed.


A DNA molecule encoding a novel isoform of the human T-type low voltage activated calcium channel (alpha lG-c) has been cloned and characterized. The biological and structural properties of this protein is disclosed, as is the amino acid and nucleotide sequence. The recombinant protein is useful to identify modulators of the alpha lG-c calcium channel. Modulators identified in the assays disclosed herein are useful as therapeutic agents and are candidates for the treatment disorders that are mediated by human alphalG-c activity. Such activities that may be mediated by human alpha lG-c include, epilepsy, schizophrenia, depression , sleep disorders, stress, endocrine disorders, respiratory disorder, peripheral muscle disorders, muscle excitability, Cushing's disease, fertilization, contraception, disorders involving neuronal firing regulation, respiratory disorders, hypertension, cardiac rhythm, potentiation of synaptic signals, improving arterial compliance in systolic
hypertension, vascular tone such as by decreasing vascular swelling, cellular growth (protein synthesis, cell differentiation, and proliferation), cardiac hypertrophy, cardiac fibrosis, atherosclerosis, cardiovascular disorders, including but not limited to:
myocardial infarct, cardiac arrhythmia, heart failure and angina pectoris. The recombinant DNA molecules, and portions thereof, are useful for isolating homologues of the DNA molecules, identifying and isolating genomic equivalents of the DNA molecules, and identifying, detecting or isolating mutant forms of the DNA molecules.


FIGURE 1 - The nucleotide sequence of coding region of human calcium channel alphalG-c is shown (6822 bp including the stop codon).

FIGURE 2 - The nucleotide sequence of human calcium channel alpha lG-c is shown including 511 bp 5' UT and 397 bp 3'UT.

FIGURE 3 - The amino acid sequence of human calcium channel alpha lG-c is shown (2273 amino acids).

FIGURE 4- Functional expression of human calcium channel alpha lG-c in Xenopus oocytes is shown: activation by depolarizing voltage steps (a,b) and steady state inactivation (c,d). a) An oocyte bathed in 40 mM BaCl2 saline was challenged with a depolarizing voltage protocol from a holding potential of-lOOmV. 40 msec test pulses were applied from -70 to -20 mV in increments of 10 mV. b) The current-voltage relationship obtained from 9 oocytes bathed in ND96. Currents activated near -60 mV and reversed sign near +30 mV. Peak currents were elicited by steps to about -30 mV. c) The voltage-dependence of inactivation of an oocyte bathed in 40 mM BaCl2 was determined using a standard voltage protocol. Four sec voltage steps to -100 to —45 mV (in increments of 5 mV) were followed by a 5 msec step to -100 mV, followed by a step to -30 mV. The currents elicited at -30 mV are shown after the positive-going capacitative transient. The prepulse voltage that inactivated half the channels (Vo.5) was about -70 mV. d) The voltage dependence of inactivation is shown for oocytes bathed in ND96 (n=9 experiments).

FIGURE 5- Pharmacological characterization of human alpha IG-c expressed in Xenopus oocytes: dose dependent block by mibefradil. The responses to the indicated concentrations of mibefradil were bath applied to oocytes expressing human calcium channel alpha IG-c cRNA. Shown are 1-3 concentrations tested on 7 individual oocytes. The IC50 was 2.5 μM with a 95% confidence interval of 1.3 to 4.9 μM. Oocytes were bathed in ND96,

The present invention relates to DNA encoding human calcium channel alpha IG-c that was isolated from a human thalamus cDNA library. Human calcium channel alpha IG-c, as used herein, refers to protein that can specifically function as a low voltage activated calcium channel.

The sequence presented in this invention is a homolog of the rat alpha 1G accession # AF027984 (Perez-Reyes et al, 1998), and is similar to the human alpha 1G "a" isoform (accession # AF 126966) with the exception that the sequence presented herein contains a 23 amino acid insert in the second intracellular loop between domains I and II that is missing in both sequences. The 23 amino acid insert contains a putative CKII phosphorylation site at S971. This 23 amino acid insert is 91 and 87% identical to homologous sequences in rat (AF 125161) and mouse (AJ012569), respectively, two proteins otherwise dissimilar to human alphaG-c since they contain an insert at alphalG amino acid 1575. The putative casein kinase II phosphorylation site in the human alphaG-c insert is not conserved in the equivalent rat or mouse sequences. The previously described human full length cDNA
(AF 126966) produces functional channels (Monteil, a et al, 1999 Cloning and molecular characterization of alG and all isoforms of human T-type Ca2+ channels. Biophys. Abst: A408) but a complete description of its functional and structural characteristics has not been reported. The present invention is thus the first report, to our knowledge, of a detailed characterization of the human alpha IG-c T-type calcium channel. There are 2 partial human sequences that are identical to regions of the present invention submitted by E. Perez-Reyes (AF029229; AF029228). AF029228 begins at alpha IG-c at amino acid 1186 and ends at amino acid 1504; AF029229 begins at amino acid 1827 and ends at the TGA stop codon.

The complete amino acid sequence of human calcium channel alpha 1G has been previously described, however, the present invention is a novel isoform that was not previously known. This is the first reported cloning of a full length DNA molecule encoding the "c" isoform of the human calcium channel alpha 1G. It is predicted that a wide variety of cells and cell types will contain the described channel.

Other cells and cell lines may also be suitable for use to isolate human calcium channel alpha IG-c. Selection of suitable cells may be done by screening for human calcium channel alpha IG-c activity in whole cells or cell extracts. Human calcium channel alpha IG-c activity can be monitored by direct measurement of a low depolarizing voltage-induced Ca influx or Ca currents through the human calcium channel alpha IG-c. Cells that possess human calcium channel alpha IG-c activity in this assay may be suitable for the isolation of human calcium channel alpha IG-c DNA or mRNA.

Any of a variety of procedures known in the art may be used to molecularly clone human calcium channel alpha IG-c. These methods include, but are not limited to, direct functional expression of the human calcium channel alpha IG-c genes following the construction of a human calcium channel alpha IG-c -containing cDNA library in an appropriate expression vector system. Another method is to screen human calcium channel alpha IG-c -containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a labelled oligonucleotide probe designed from the amino acid sequence of the human calcium channel alpha IG-c insert. An additional method consists of screening a human calcium channel alpha lG-c-containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a partial cDNA encoding the human calcium channel alpha IG-c protein. This partial cDNA is obtained by the specific PCR amplification of human calcium channel alpha IG-c DNA fragments through the design of degenerate oligonucleotide primers from the amino acid sequence of the purified human calcium channel alpha IG-c protein.

Another method is to isolate RNA from human calcium channel alpha lG-c-producing cells and translate the RNA into protein via an in vitro or an in vivo translation system. The translation of the RNA into a peptide a protein will result in the production of at least a portion of the human calcium channel alpha IG-c protein which an be identified by, for example, immunological reactivity with an anti-human calcium channel alpha IG-c antibody or by biological activity of human calcium channel alphalG-c protein. In this method, pools of RNA isolated from human calcium channel alpha lG-c-producing cells can be analyzed for the presence of an RNA that encodes at least a portion of the human calcium channel alpha IG-c protein. Further fractionation of the RNA pool can be done to purify the human calcium channel alpha IG-c RNA from non-human calcium channel alpha IG-c RNA. The peptide or protein produced by this method may be analyzed to provide amino acid sequences, which in turn are used to provide primers for production of human calcium channel alpha IG-c cDNA, or the RNA used for translation can be analyzed to provide nucleotide sequences encoding human calcium channel alpha IG-c and produce probes for this production of human calcium channel alpha IG-c cDNA. This method is known in the art and can be found in, for example, Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1989.

It is readily apparent to those skilled in the art that other types of libraries, as well as libraries constructed from other cells or cell types, may be useful for isolating human calcium channel alpha lG-c-encoding DNA. Other types of libraries include, but are not limited to, cDNA libraries derived from other cells and genomic DNA libraries that include YAC (yeast artificial chromosome) and cosmid libraries.

It is readily apparent to those skilled in the art that suitable cDNA libraries may be prepared from cells or cell lines which have human calcium channel alpha 1G-c activity. The selection of cells or cell lines for use in preparing a cDNA library to isolate human calcium channel alpha IG-c cDNA may be done by first measuring cell associated human calcium channel alpha IG-c activity using the measurement of calcium regulated biological activity.

Preparation of cDNA libraries can be performed by standard techniques well known in the art. Well known cDNA library construction techniques can be found for example, in Maniatis, T., Fritsch, E.F., Sambrook, J., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).

It is also readily apparent to those skilled in the art that DNA encoding human calcium channel alpha IG-c may also be isolated from a suitable genomic DNA library. Construction of genomic DNA libraries can be performed by standard techniques well known in the art. Well known genomic DNA library construction techniques can be found in Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).

In order to clone the human calcium channel alpha IG-c gene by the above methods, the amino acid sequence of human calcium channel alpha IG-c may be necessary. To accomplish this, human calcium channel alpha IG-c protein may be purified and partial amino acid sequence determined by automated sequencers. It is not necessary to determine the entire amino acid sequence, but the linear sequence of two regions of 6 to 8 amino acids from the protein is determined for the production of primers for PCR amplification of a partial human calcium channel alpha IG-c DNA fragment.

Once suitable amino acid sequences have been identified, the DNA sequences capable of encoding them are synthesized. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and therefore, the amino acid sequence can be encoded by any of a set of similar DNA
oligonucleotides. Only one member of the set will be identical to the human calcium channel alpha IG-c sequence but will be capable of hybridizing to human calcium channel alpha IG-c DNA even in the presence of DNA oligonucleotides with mismatches. The mismatched DNA oligonucleotides may still sufficiently hybridize to the human calcium channel alpha IG-c DNA to permit identification and isolation of human calcium channel alpha IG-c encoding DNA. DNA isolated by these methods can be used to screen DNA libraries from a variety of cell types, from invertebrate and vertebrate sources, and to isolate homologous genes.

Purified biologically active human calcium channel alpha IG-c may have several different physical forms. Human calcium channel alpha IG-c may exist as a full-length nascent or unprocessed polypeptide, or as partially processed polypeptides or combinations of processed polypeptides. The full-length nascent human calcium channel alpha IG-c polypeptide may be posttranslationally modified by specific proteolytic cleavage events, which result in the formation of fragments of the full-length nascent polypeptide. A fragment, or physical association of fragments may have the full biological activity associated with human calcium channel alpha IG-c, however, the degree of human calcium channel alpha IG-c activity may vary between individual human calcium channel alpha IG-c fragments and physically associated human calcium channel alpha IG-c polypeptide fragments.

The cloned human calcium channel alpha IG-c DNA obtained through the methods described herein may be recombinantly expressed by molecular cloning into an expression vector containing a suitable promoter and other appropriate
transcription regulatory elements, and transferred into prokaryotic or eukaryotic host cells to produce recombinant human calcium channel alpha IG-c protein. Techniques for such manipulations are fully described in Maniatis, T, et al. supra, and are well known in the art.

Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria including E. coli. blue-green algae, plant cells, insect cells, fungal cells including yeast cells, and animal cells.

Specifically designed vectors allow the shuttling of DNA between hosts such as bacteria-yeast or bacteria-animal cells or bacteria-fungal cells or bacteria-invertebrate cells. An appropriately constructed expression vector should contain: an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one that causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.

A variety of mammalian expression vectors may be used to express recombinant human calcium channel alphalG-c in mammalian cells. Commercially available mammalian expression vectors which may be suitable for recombinant human calcium channel alpha IG-c expression, include but are not limited to, pMAMneo (Clontech), pcDNA3 (Invitrogen), pMClneo (Stratagene), pXTl
(Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593) pBPV- 1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dr.fr (ATCC 37146), pUCTag (ATCC 37460), and 1ZD35 (ATCC 37565).

A variety of bacterial expression vectors may be used to express recombinant human calcium channel alpha IG-c in bacterial cells. Commercially available bacterial expression vectors which may be suitable for recombinant human calcium channel alpha IG-c expression include, but are not limited to pET vectors (Novagen) and pQE vectors (Qiagen).

A variety of fungal cell expression vectors may be used to express
recombinant human calcium channel alpha IG-c in fungal cells such as yeast.
Commercially available fungal cell expression vectors which may be suitable for recombinant human calcium channel alpha IG-c expression include but are not limited to pYES2 (InVitrogen) and Pichia expression vector (InVitrogen).

A variety of insect cell expression vectors may be used to express
recombinant human calcium channel alpha IG-c in insect cells. Commercially available insect cell expression vectors that may be suitable for recombinant expression of human calcium channel alpha IG-c include but are not limited to pBlueBacII (InVitrogen).

DNA encoding human calcium channel alpha IG-c may be cloned into an expression vector for expression in a recombinant host cell. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to bacteria such as I coli. fungal cells such as yeast, mammalian cells including but not limited to cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including but not limited to drosophila and silkworm derived cell lines. Cell lines derived from mammalian species which may be suitable and which are commercially available, include but are not limited to, CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-l (ATCC CCL 26), MRC-5 (ATCC CCL 171), L-cells, and HEK-293 (ATCC CRL1573).

The expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, protoplast fusion, lipofection, and electroporation. The expression vector-containing cells are clonally propagated and individually analyzed to determine whether they produce human calcium channel alpha IG-c protein. Identification of human calcium channel alpha IG-c expressing host cell clones may be done by several means, including but not limited to immunological reactivity with anti-human calcium channel alpha IG-c antibodies, and the presence of host cell-associated human calcium channel alpha IG-c activity.

Expression of human calcium channel alpha IG-c DNA may also be performed using in vitro produced synthetic mRNA. Synthetic mRNA or mRNA isolated from human calcium channel alpha IG-c producing cells can be efficiently translated in various cell-free systems, including but not limited to wheat germ extracts and reticulocyte extracts, as well as efficiently translated in cell based systems, including but not limited to microinjection into frog oocytes, with microinjection into frog oocytes being generally preferred.

To determine the human calcium channel alpha IG-c DNA sequence(s) that yields optimal levels of human calcium channel alpha IG-c activity and/or human calcium channel alpha IG-c protein, human calcium channel alpha IG-c DNA molecules including, but not limited to, the following can be constructed: the full-length open reading frame of the human calcium channel alpha IG-c cDNA encoding the approximately 252 kDa protein from approximately base 1 to approximately base 6822 (these numbers correspond to first nucleotide of first methionine and last nucleotide before the first stop codon) and several constructs containing portions of the cDNA encoding human calcium channel alpha IG-c protein. All constructs can be designed to contain none, all or portions of the 5 ' or the 3' untranslated region of human calcium channel alpha IG-c cDNA. Human calcium channel alpha IG-c activity and levels of protein expression can be determined following the
introduction, both singly and in combination, of these constructs into appropriate host cells. Following determination of the human calcium channel alpha IG-c DNA cassette yielding optimal expression in transient assays, this human calcium channel alpha IG-c DNA construct is transferred to a variety of expression vectors, for expression in host cells including, but not limited to, mammalian cells, baculovirus-infected insect cells, coli. and the yeast S. cerevisiae.

Host cell transfectants and microinjected oocytes may be used to assay both the levels of human calcium channel alpha IG-c channel activity and levels of human calcium channel alpha IG-c protein by the following methods. In the case of recombinant host cells, this involves the co-transfection of one or possibly two or more plasmids, containing the human calcium channel alpha IG-c DNA encoding one or more fragments or subunits. In the case of oocytes, this involves the co-injection of synthetic RNAs for human calcium channel alpha IG-c protein. Following an appropriate period of time to allow for expression, cellular protein is metabolically labelled with, for example :55S-methionine for 24 hours, after which cell lysates and cell culture supernatants are harvested and subjected to immunoprecipitation with polyclonal antibodies directed against the human calcium channel alpha IG-c protein.

Other methods for detecting human calcium channel alpha IG-c activity involve the direct measurement of human calcium channel alpha IG-c activity in whole cells transfected with human calcium channel alpha IG-c cDNA or oocytes injected with human calcium channel alphalG-c mRNA. Human calcium channel alpha IG-c activity is measured by biological characteristics of the host cells expressing human calcium channel alpha IG-c DNA. In the case of recombinant host cells expressing human calcium channel alpha IG-c patch voltage clamp techniques can be used to measure receptor activity and quantitate human calcium channel alpha IG-c protein. In the case of oocytes patch clamp as well as two-electrode voltage clamp techniques can be used to measure calcium channel alpha IG-c activity and quantitate human calcium channel alpha IG-c protein by determining single channel and whole cell conductances.

Levels of human calcium channel alpha IG-c protein in host cells are quantitated by immunoaffinity and/or ligand affinity techniques. Cells expressing human calcium channel alpha IG-c can be assayed for the number of human calcium channel alpha IG-c molecules expressed by measuring the amount of radioactive ligand binding to cell membranes. Human calcium channel alpha lG-c-specific affinity beads or human calcium channel alpha lG-c-specific antibodies are used to isolate for example ^^S-methionine labelled or unlabelled human calcium channel alpha IG-c protein. Labelled human calcium channel alpha IG-c protein is analyzed by SDS-PAGE. Unlabelled human calcium channel alpha IG-c protein is detected by Western blotting, ELISA or RIA assays employing human calcium channel alpha 1G-c specific antibodies.

Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and therefore, the amino acid sequence can be encoded by any of a set of similar DNA oligonucleotides. Only one member of the set will be identical to the human calcium channel alpha IG-c sequence but will be capable of hybridizing to human calcium channel alpha IG-c DNA even in the presence of DNA oligonucleotides with mismatches under appropriate conditions. Under alternate conditions, the mismatched DNA oligonucleotides may still hybridize to the human calcium channel alpha IG-c DNA to permit identification and isolation of human calcium channel alpha IG-c encoding DNA.

DNA encoding human calcium channel alpha IG-c from a particular organism may be used to isolate and purify homologues of human calcium channel alpha IG-c from other organisms. To accomplish this, the first human calcium channel alphalG-c DNA may be mixed with a sample containing DNA encoding homologues of human calcium channel alpha IG-c under appropriate hybridization conditions. The hybridized DNA complex may be isolated and the DNA encoding the homologous DNA may be purified therefrom.

It is known that there is a substantial amount of redundancy in the various codons that code for specific amino acids. Therefore, this invention is also directed to those DNA sequences that contain alternative codons that code for the eventual translation of the identical amino acid. For purposes of this specification, a sequence bearing one or more replaced codons will be defined as a degenerate variation. Also included within the scope of this invention are mutations either in the DNA sequence or the translated protein which do not substantially alter the ultimate physical properties of the expressed protein. For example, substitution of valine for leucine, arginine for lysine, or asparagine for glutamine may not cause a change in
functionality of the polypeptide. Such substitutions are well known anre are described, for instance in Molecular Biology of the Gene, 4th Ed. Bengamin
Cummings Pub. Co. by Watson et al.

It is known that DNA sequences coding for a peptide may be altered so as to code for a peptide having properties that are different than those of the naturally occurring peptide. Methods of altering the DNA sequences include, but are not limited to site directed mutagenesis. Examples of altered properties include but are not limited to changes in the affinity of an enzyme for a substrate or a receptor for a ligand.

As used herein, a "functional derivative" of human calcium channel alphalG-c is a compound that possesses a biological activity (either functional or structural) that is substantially similar to the biological activity of human calcium channel alpha IG-c. The term "functional derivatives" is intended to include the "fragments," "variants," "degenerate variants," "analogs" and "homologues" or to "chemical derivatives" of human calcium channel alphalG-c. The term "fragment" is meant to refer to any polypeptide subset of human calcium channel alphalG-c. The term "variant" is meant to refer to a molecule substantially similar in structure and function to either the entire human calcium channel alpha IG-c molecule or to a fragment thereof. A molecule is "substantially similar" to human calcium channel alpha IG-c if both molecules have substantially similar structures or if both molecules possess similar biological activity. Therefore, if the two molecules possess substantially similar activity, they are considered to be variants even if the structure of one of the molecules is not found in the other or even if the two amino acid sequences are not identical. The term "analog" refers to a molecule substantially similar in function to either the entire human calcium channel alpha IG-c molecule or to a fragment thereof. The term "functional" with respect to a calcium channel activity means that the channel is able to provide for and regulate entry of calcium channel selective ions, incuding, but not limited to Ca+2 or Ba+2 or ions that block the flow of Ca+2 or Ba+2, in response to a stimulus and/or bind ligands with affinity for the channel. Preferably such channel activity is distinguishable, such as by electrophysiological, pharmacological and other means known to those of skill in the art, from any endogenous calcium channel activity that is in the host cell.

Following expression of human calcium channel alpha IG-c in a recombinant host cell, human calcium channel alpha IG-c protein may be recovered to provide human calcium channel alpha IG-c in active form. Several human calcium channel alphalG-c purification procedures are available and suitable for use. As described above for purification of human calcium channel alpha IG-c from natural sources, recombinant human calcium channel alpha IG-c may be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography.

In addition, recombinant human calcium channel alpha IG-c can be separated from other cellular proteins by use of an immunoaffinity column made with monoclonal or polyclonal antibodies specific for full length nascent human calcium channel alpha IG-c, polypeptide fragments of human calcium channel alpha IG-c or human calcium channel alpha IG-c subunits.

Monospecific antibodies to human calcium channel alpha IG-c are purified from mammalian antisera containing antibodies reactive against human calcium channel alpha IG-c or are prepared as monoclonal antibodies reactive with human calcium channel alphalG-c using the technique of Kohler and Milstein, Nature 256: 495-497 (1975). Monospecific antibody as used herein is defined as a single antibody species or multiple antibody species with homogenous binding characteristics for human calcium channel alpha IG-c. Homogenous binding as used herein refers to the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with the human calcium channel alpha IG-c, as described above. Human calcium channel alpha IG-c specific antibodies are raised by immunizing animals such as mice, rats, guinea pigs, rabbits, goats, horses and the like, with rabbits being preferred, with an appropriate concentration of human calcium channel alpha IG-c either with or without an immune adjuvant.

Preimmune serum is collected prior to the first immunization. Each animal receives between about 0.1 mg and about 1000 mg of human calcium channel alpha IG-c associated with an acceptable immune adjuvant. Such acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum-precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA. The initial immunization consists of human calcium channel alpha IG-c in, preferably, Freund's complete adjuvant at multiple sites either subcutaneously (SC), intraperitoneally (IP) or both. Each animal is bled at regular intervals, preferably weekly, to determine antibody titer. The animals may or may not receive booster injections following the initial immunization. Those animals receiving booster injections are generally given an equal amount of the antigen in Freund's incomplete adjuvant by the same route. Booster injections are given at about three-week intervals until maximal titers are obtained. At about 7 days after each booster immunization or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about -20°C.

Monoclonal antibodies (mAb) reactive with human calcium channel alpha 1G-c are prepared by immunizing inbred mice, preferably Balb/c, with human calcium channel alphalG-c. The mice are immunized by the IP or SC route with about 0.1 mg to about 10 mg, preferably about 1 mg, of human calcium channel alpha IG-c in about 0.5 ml buffer or saline incoφorated in an equal volume of an acceptable adjuvant, as discussed above. Freund's complete adjuvant is preferred. The mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks. Immunized mice are given one or more booster immunizations of about 0.1 to about 10 mg of human calcium channel alpha IG-c in a buffer solution such as phosphate buffered saline by the intravenous (IV) route. Lymphocytes, from antibody positive mice, preferably splenic lymphocytes, are obtained by removing spleens from immunized mice by standard procedures known in the art. Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner, preferably myeloma cells, under conditions that will allow the formation of stable hybridomas. Fusion partners may include, but are not limited to: mouse myelomas P3/NSl/Ag 4-1; MPC-11; S-194 and Sp 2/0, with Sp 2/0 being generally prefened. The antibody producing cells and myeloma cells are fused in polyethylene glycol, about 1000 mol. wt., at concentrations from about 30% to about 50%. Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art.
Supernatant fluids are collected from growth positive wells on about days 14, 18, and 21 and are screened for antibody production by an immunoassay such as solid phase immunoradioassay (SPIRA) using human calcium channel alpha IG-c as the antigen. The culture fluids are also tested in the Ouchterlony precipitation assay to determine the isotype of the mAb. Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973.

Monoclonal antibodies are produced in vivo by injection of pristane primed

Balb/c mice, approximately 0.5 ml per mouse, with about 2 x 10" to about 6 x 10" hybridoma cells about 4 days after priming. Ascites fluid is collected at
approximately 8-12 days after cell transfer and the monoclonal antibodies are purified by techniques known in the art.

In vitro production of anti -human calcium channel alpha IG-c mAb is carried out by growing the hybridoma in DMEM containing about 2% fetal calf serum to obtain sufficient quantities of the specific mAb. The mAb are purified by techniques known in the art.

Antibody titers of ascites or hybridoma culture fluids are determined by various serological or immunological assays which include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique and radioimmunoassay (RIA) techniques. Similar assays are used to detect the presence of human calcium channel alpha IG-c in body fluids or tissue and cell extracts.

It is readily apparent to those skilled in the art that the above described methods for producing monospecific antibodies may be utilized to produce antibodies specific for human calcium channel alpha IG-c polypeptide fragments, or full-length nascent human calcium channel alpha IG-c polypeptide, or the individual human calcium channel alphalG-c domians. Specifically, it is readily apparent to those skilled in the art that monospecific antibodies may be generated which are specific for human calcium channel alpha IG-c by immunizing an animal with an antigenic peptide derived from the 23 amino acid insert, or fragments thereof.

Human calcium channel alpha IG-c antibody affinity columns are made by adding the antibodies to Affigel-10 (Bio-Rad), a gel support which is activated with N-hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with the spacer arm. The remaining activated esters are then quenched with 1M ethanolamine HCI (pH 8). The column is washed with water followed by 0.23 M glycine HCI (pH 2.6) to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (pH 7.3) and the cell culture supernatants or cell extracts containing human calcium channel alpha IG-c or human calcium channel alpha IG-c subunits are slowly passed through the column. The column is then washed with phosphate buffered saline until the optical density (A280) falls to background, then the protein is eluted with 0.23 M glycine-HCl (pH

2.6). The purified human calcium channel alpha IG-c protein is then dialyzed against phosphate buffered saline.

DNA clones, termed human calcium channel alpha IG-c, are identified which encode proteins that, when expressed in a recombinant host cell, form channels that regulate calcium influx and are sensitive to NPPB (5-Nitro-2-(3-phenylpropylamino) benzoic acid). The expression of human calcium channel alpha IG-c DNA results in the reconstitution of the properties observed in oocytes injected with human calcium channel alpha lG-c-encoding poly (A)+ RNA, including direct activation with the appropriate stimuli.

The present invention is also directed to methods for screening for compounds that modulate the expression of DNA or RNA encoding human calcium channel alpha IG-c as well as the quantity of expressed human calcium channel alpha IG-c protein. The term "compound" refers to small organic or inorganic molecules (including divalent ions), synthetic or natural amino acid polypeptides, proteins, or synthetic or natural nucleic acid sequences. Compounds may modulate by increasing or attenuating the expression of DNA or RNA encoding human calcium channel alpha IG-c, or the quantity of cell surface human calcium channel alpha IG-c protein. Compounds that modulate the expression of DNA or RNA encoding human calcium channel alpha IG-c or the quantity of human calcium channel alpha IG-c protein may be detected by a variety of assays. Assays to meaure changes in the level of expression of alpha IG-c can be accomplished by various means, well known in the art, for example changes in the quantity of mRNA, intracellular protein (newly synthesize protein being processed within the endoplasmic reticulum or Golgi apparatus), or cell surface protein. Levels of mRNA are detected by reverse transcription polymerase chain reaction (RT-PCR) or by differential gene expression (qantitative gene chips). Immunoaffinity quantitates levels of protein both within and on the surface of host cells. Protein-specific affinity beads or specific antibodies are used to isolate for example 35S-methionine labelled or unlabelled protein. Labelled protein is analyzed by SDS-PAGE. Unlabelled protein is detected by Western blotting, cell surface detection by fluorescent cell sorting, ELISA or RIA employing specific antibodies.

Assays that use eukaryotic cells for identifying compounds that modulate human alpha IG-c calcium channel activity are also provided. In practicing these assays the eukaryotic cell that expresses the heterologous human alpha IG-c calcium channel encoded by a DNA sequence described herein, is in a solution containing a test compound and a calcium channel selective ion, the cell membrane is depolarized, and cunent flowing into the cell is detected. If the test compound is one that modulates calcium channel activity, the cunent that is detected is different from that produced by depolarizing the same or a substantially identical cell in the presence of the same calcium channel-selective ion but in the absence of the compound. In prefened embodiments, the cells are mammalian cells, most preferably HEK293 cells, or amphibian oocytes. The assay method comprises the steps of: (a) measuring the activity of the human alpha IG-c in a cell that expresses the human alpha IG-c calcium channel; (b) contacting a compound with the cell; and (c) monitoring changes in the cell. In these assays, an agonist would increase Ca influx with no elevated K depolarizing stimulus, in the presence of concentrations of K that normally are not enough to activate the channels or shift the voltage dependence of inactivation. In these assays, an antagonist would block Ca influx induced by elevated potassium. Assays that measure electrophysiological calcium channel function measure the amount or duration of Ca influx, for example by using Ca sensitive dyes such as Fluo-3 or radioactive ions such as 45Ca or voltage clamp techniques. Voltage sensitive dyes and cunent clamp electrophysiological techniques can be used to measure
depolarizations resulting from Ca influx. Yet another embodiment of the test method measures "downstream" effects of Ca influx by using a transcription based assay under inducible control of a Ca sensitive promotor, as described in PCT International Patent Application No. PCT/US91/5625, filed August 7, 1991.

These assays may be a simple "yes/no" assays to determine whether there is a change in expression or function or they may be made quantitative by comparing the expression or function of a test sample with the levels of expression or function in a standard sample. Modulators identified any of these processes are useful as therapeutic agents.

Modulators identified in the assays disclosed herein are useful candidates as therapeutic agents for the treatment disorders that are mediated by human alpha IG-c activity. Such activities that may be mediated by human alpha IG-c include, epilepsy, schizophrenia, depression , sleep disorders, stress, endocrine disorders, respiratory disorder, peripheral muscle disorders, muscle excitability, Cushing's disease,
fertilization, contraception, disorders involving neuronal firing regulation, respiratory disorders, hypertension, cardiac rhythm, potentiation of synaptic signals, improving arterial compliance in systolic hypertension, vascular tone such as by decreasing vascular swelling, cardiac hypertrophy, cardiac fibrosis, atherosclerosis, cardiovascular disorders, including but not limited to: myocardial infarct, cardiac anhythmia, heart failure and angina pectoris, and cellular growth (protein synthesis, cell differentiation, and proliferation). The compounds that modulate human alpha IG-c calcium channel activity may be useful in regulating vascular smooth muscle tone, either vasodilating or vasoconstricting in: (a) treatments for reestablishing blood pressure control, e.g., following traumatic injury, surgery or cardiopulmonary bypass, and in prophylactic treatments designed to minimize cardiovascular effects of anaesthetic drugs; (b) treatments for improving vascular reflexes and blood pressure control by the autonomic nervous system. The compounds that modulate human alpha IG-c calcium channel activity may also be useful in treatments of urological disorders and reproductive disorders: (a) treating and restoring renal function following surgery, traumatic, injury, uremia and adverse drug reactions; (b) treating bladder dysfunctions; and (c) uremic neuronal toxicity and hypotension in patients on hemodialysis; reproductive disorders; (d) disorders of sexual function including impotence; (e) alcoholic impotence (under autonomic control that may be subject to T-type calcium channel controls); and (f) fertility (via direct action upon Sertoli cells (in males) or the zona pecullicda (for mammalian eggs) or by modulation of hormonal feedback). The compounds that modulate human alpha IG-c calcium channel activity may be useful in treatments of hepatic disorders in treating and reducing neuronal toxicity and autonomic nervous system damage resulting from acute over-consumption of alcohol. The compounds that modulate human alpha IG-c calcium channel activity may be useful treatments for neurologic disorders; (a) epilepsy and diencephalic epilepsy; (b) Parkinson's disease; and (c) abenant temperature control, such as, abnormalities of shivering and sweat gland secretion and peripheral vascular blood supply. The compounds that modulate human alphalG-c calcium channel activity may be useful for treating abnormal respiration, e.g., post-surgical complications of anesthetics and endocrine disorders; (a) abenant pituitary and hypothalamic functions including abnormal secretion of noradrenaline, dopamine and other hormones; and (b) treatments for overproduction of insulin, thyroxine adrenaline and other hormonal imbalances.

Kits containing human calcium channel alpha IG-c DNA or RNA, antibodies to human calcium channel alphalG-c, or human calcium channel alphalG-c protein may be prepared. Such kits are used to detect DNA that hybridizes to human calcium channel alpha IG-c DNA or to detect the presence of human calcium channel
alpha IG-c protein or peptide fragments in a sample. Such characterization is useful for a variety of purposes including but not limited to forensic analyses, diagnostic applications, and epidemiological studies.

The DNA molecules, RNA molecules, recombinant protein and antibodies of the present invention may be used to screen and measure levels of human calcium channel alpha IG-c DNA, human calcium channel alpha IG-c RNA or human calcium channel alpha IG-c protein. The recombinant proteins, DNA molecules, RNA molecules and antibodies lend themselves to the formulation of kits suitable for the detection and typing of human calcium channel alpha IG-c. Such a kit would comprise a compartmentalized carrier suitable to hold in close confinement at least one container. The carrier would further comprise reagents such as recombinant human calcium channel alpha IG-c protein or anti-human calcium channel alpha IG-c antibodies suitable for detecting human calcium channel alpha IG-c. The carrier may also contain a means for detection such as labeled antigen or enzyme substrates or the like.

Nucleotide sequences that are complementary to the human calcium channel alpha IG-c encoding DNA sequence can be synthesized for antisense therapy. These antisense molecules may be DNA, stable derivatives of DNA such as
phosphorothioates or methylphosphonates, RNA, stable derivatives of RNA such as 2'-O-alkylRNA, or other human calcium channel alphalG-c antisense oligonucleotide mimetics. Human calcium channel alpha IG-c antisense molecules may be introduced into cells by microinjection, liposome encapsulation or by expression from vectors harboring the antisense sequence. Human calcium channel alpha IG-c antisense therapy may be particularly useful for the treatment of diseases where it is beneficial to reduce human calcium channel alpha IG-c activity.

Human calcium channel alpha IG-c gene therapy may be used to introduce human calcium channel alpha IG-c into the cells of target organisms. The human calcium channel alpha IG-c gene can be ligated into viral vectors that mediate transfer of the human calcium channel alphalG-c DNA by infection of recipient host cells. Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polio virus and the like. Alternatively, human calcium channel alpha IG-c DNA can be transfened into cells for gene therapy by non-viral techniques including receptor-mediated targeted DNA transfer using ligand-DNA conjugates or adenovirus-ligand-DNA conjugates, lipofection membrane fusion or direct microinjection. These procedures and variations thereof are suitable for ex vivo as well as in vivo human calcium channel alpha IG-c gene therapy. Human calcium channel alpha IG-c gene therapy may be particularly useful for the treatment of diseases where it is beneficial to elevate human calcium channel alpha IG-c activity.

Pharmaceutically useful compositions comprising human calcium channel alpha IG-c DNA, human calcium channel alpha IG-c RNA, or human calcium channel alpha IG-c protein, or modulators of human calcium channel alpha IG-c activity, may be formulated according to known methods such as by the admixture of a
pharmaceutically acceptable canier. Examples of such carriers and methods of formulation may be found in Remington's Pharmaceutical Sciences. To form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the protein, DNA, RNA, or modulator.

Therapeutic or diagnostic compositions of the invention are administered to an individual in amounts sufficient to treat or diagnose disorders in which modulation of human calcium channel alpha IG-c-related activity is indicated. The effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration. The pharmaceutical compositions may be provided to the individual by a variety of routes such as subcutaneous, topical, oral and intramuscular.

The term "chemical derivative" describes a molecule that contains additional chemical moieties that are not normally a part of the base molecule. Such moieties may improve the solubility, half-life, absoφtion, etc. of the base molecule.
Alternatively the moieties may attenuate undesirable side effects of the base molecule or decrease the toxicity of the base molecule. Examples of such moieties are described in a variety of texts, such as Remington's Pharmaceutical Sciences.

Compounds identified according to the methods disclosed herein may be used alone at appropriate dosages defined by routine testing in order to obtain optimal inhibition of the human calcium channel alpha IG-c or its activity while minimizing any potential toxicity. In addition, co-administration or sequential administration of other agents may be desirable.

The present invention also has the objective of providing suitable topical, oral, systemic and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention. The compositions containing compounds or modulators identified according to this invention as the active ingredient for use in the modulation of human calcium channel alpha IG-c receptors can be administered in a wide variety of therapeutic dosage forms in conventional vehicles for
administration. For example, the compounds or modulators can be administered in such oral dosage forms as tablets, capsules (each including timed release and sustained release formulations), pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups and emulsions, or by injection. Likewise, they may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. An effective but non-toxic amount of the compound desired can be employed as a human calcium channel alpha IG-c modulating agent.

The daily dosage of the products may be varied over a wide range from 0.01 to 1 ,000 mg per patient, per day. For oral administration, the compositions are preferably provided in the form of scored or unscored tablets containing 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, and 50.0 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.0001 mg/kg to about 100 mg/kg of body weight per day. The range is more particularly from about 0.001 mg/kg to 10 mg/kg of body weight per day. The dosages of the human calcium channel alpha IG-c modulators are adjusted when combined to achieve desired effects. On the other hand, dosages of these various agents may be independently optimized and combined to achieve a synergistic result wherein the pathology is reduced more than it would be if either agent were used alone.

Advantageously, compounds or modulators of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily. Furthermore, compounds or modulators for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.

For combination treatment with more than one active agent, where the active agents are in separate dosage formulations, the active agents can be administered concunently, or they each can be administered at separately staggered times.

The dosage regimen utilizing the compounds or modulators of the present invention is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound thereof employed. A physician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug required to prevent, counter or anest the progress of the condition. Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug.

In the methods of the present invention, the compounds or modulators herein described in detail can form the active ingredient, and are typically administered in admixture with suitable pharmaceutical diluents, excipients or caniers (collectively refened to herein as "carrier" materials) suitably selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices.

For instance, for oral administration in the form of a tablet or capsule, the active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. Moreover, when desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents can also be incoφorated into the mixture. Suitable binders include, without limitation, starch, gelatin, natural sugars such as glucose or beta-lactose, corn
sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes and the like. Lubricants used in these dosage forms include, without limitation, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum and the like.

For liquid forms the active drug component can be combined in suitably flavored suspending or dispersing agents such as the synthetic and natural gums, for example, tragacanth, acacia, methyl-cellulose and the like. Other dispersing agents that may be employed include glycerin and the like. For parenteral administration, sterile suspensions and solutions are desired. Isotonic preparations, which generally contain suitable preservatives, are employed when intravenous administration is desired.

Topical preparations containing the active drug component can be admixed with a variety of carrier materials well known in the art, such as, eg., alcohols, aloe vera gel, allantoin, glycerine, vitamin A and E oils, mineral oil, PPG2 myristyl propionate, and the like, to form, eg., alcoholic solutions, topical cleansers, cleansing creams, skin gels, skin lotions, and shampoos in cream or gel formulations.

The compounds or modulators of the present invention can also be
administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine or

Compounds of the present invention may also be delivered by the use of monoclonal antibodies as individual caniers to which the compound molecules are coupled. The compounds or modulators of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinyl-pynolidone, pyran copolymer, polyhydroxypropylmethacryl-amidephenol, polyhydroxy-ethylaspartamidephenol, or polyethyl-eneoxidepolylysine substituted with palmitoyl residues. Furthermore, the compounds or modulators of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.

For oral administration, the compounds or modulators may be
administered in capsule, tablet, or bolus form or alternatively they can be mixed in the animals feed. The capsules, tablets, and boluses are comprised of the active ingredient in combination with an appropriate carrier vehicle such as starch, talc, magnesium stearate, or di-calcium phosphate. These unit dosage forms are prepared by intimately mixing the active ingredient with suitable finely-powdered inert ingredients including diluents, fillers, disintegrating agents, and/or binders such that a uniform mixture is obtained. An inert ingredient is one that will not react with the compounds or modulators and which is non-toxic to the animal being treated. Suitable inert ingredients include starch, lactose, talc, magnesium stearate, vegetable gums and oils, and the like. These formulations may contain a widely variable amount of the active and inactive ingredients depending on numerous factors such as the size and type of the animal species to be treated and the type and severity of the infection. The active ingredient may also be
administered as an additive to the feed by simply mixing the compound with the feedstuff or by applying the compound to the surface of the feed. Alternatively the active ingredient may be mixed with an inert canier and the resulting composition may then either be mixed with the feed or fed directly to the animal. Suitable inert caniers include corn meal, citrus meal, fermentation residues, soya grits, dried grains and the like. The active ingredients are intimately mixed with these inert carriers by grinding, stirring, milling, or tumbling such that the final composition contains from 0.001 to 5% by weight of the active ingredient.

The compounds or modulators may alternatively be administered parenterally via injection of a formulation consisting of the active ingredient dissolved in an inert liquid carrier. Injection may be either intramuscular, intraluminal, intratracheal, or subcutaneous. The injectable formulation consists of the active ingredient mixed with an appropriate inert liquid carrier. Acceptable liquid caniers include the vegetable oils such as peanut oil, cotton seed oil, sesame oil and the like as well as organic solvents such as solketal, glycerol formal and the like. As an alternative, aqueous parenteral formulations may also be used. The vegetable oils are the prefened liquid caniers. The formulations are prepared by dissolving or suspending the active ingredient in the liquid canier such that the final formulation contains from 0.005 to 10% by weight of the active ingredient.

Topical application of the compounds or modulators is possible through the use of a liquid drench or a shampoo containing the instant compounds or modulators as an aqueous solution or suspension. These formulations generally contain a suspending agent such as bentonite and normally will also contain an antifoaming agent. Formulations containing from 0.005 to 10% by weight of the active ingredient are acceptable. Prefened formulations are those containing from 0.01 to 5% by weight of the instant compounds or modulators.

The following examples illustrate the present invention without, however, limiting the same thereto.

EXAMPLE 1 Generation of a human thalamus library
cDNA synthesis:
First strand synthesis: Approximately 5 μg of human thalamus mRNA (Clontech) was used to synthesize cDNA using the cDNA synthesis kit (Life Technologies). Two microliters of Not 1 primer adapter was added to 5μl of mRNA and the mixture was heated to 70 ° C for 10 minutes and placed on ice. The following reagents were added on ice: 4μl of 5x first strand buffer (250mM TRIS-HC1 (pH8.3), 375mM KC1, 15mM MgCl2), 2μl of 0.1 M DTT, lOmM dNTP (nucleotide triphosphates) mix and lμl of DEPC treated water. The reaction was incubated at 42 °C for 5minutes. Finally, 5μl of Superscript RT II was added and incubated at 42 °C for 2 more hours. The reaction was terminated on ice.

Second strand synthesis: The first strand product was adjusted to 93 μl with water and the following reagents were added on ice: 30 μl of 5x 2nd strand buffer (5x concentration (in mM): 100 mM TRIS-HC1 (ρH6.9), 450 mM KC1, 23 mM MgCl2,

0.75 mM β-NAD+, 50 mM (NH4)2SO4), 3μl of 10 mM dNTP (nucleotide
triphosphates), lμl IL. coli DNA ligase (lOunits )lμl RNase H (2units), 4 μl DNA pol 1 (10 units)). The reaction was incubated at 16°C for 2 hours. The DNA from second strand synthesis was treated with T4 DNA polymerase and placed at 16°C to blunt the DNA ends. The double stranded cDNA was extracted with 150 μl of a mixture of phenol and chloroform (1:1, v:v) and precipitated with 0.5 volumes of 7.5 M
NH4OAc and 2 volumes of absolute ethanol. The pellet was washed with 70% ethanol and dried down at 37°C to remove the residual ethanol. The double stranded DNA pellet was resuspended in 25 μl of water and the following reagents were added; 10 μl of 5x T4 DNA ligase buffer, 10 μl of Sail adapters and 5 μl of T4 DNA ligase. The ingredients were mixed gently and ligated overnight at 16° C. The ligation mix was extracted with phenol:chloroform:isoamyl alcohol, vortexed thoroughly and centrifuged at room temperature for 5 minutes at 14,000 x g to separate the phases. The aqueous phase was transfened to a new tube and the volume adjusted to 100 ml with water. The purified DNA was size selected on a chromaspin 1000 column (Clontech) to eliminate the smaller cDNA molecules. The double stranded DNA was digested with Notl restriction enzyme for 3-4 hours at 37° C. The restriction digest was electrophoresed on a 0.8 % low melt agarose gel. The cDNA in the range of 1-5 kb was cut out and purified using Gelzyme (Invitrogen). The product was extracted with phenol: chloroform and precipitated with NFLOAc and absolute ethanol. The pellet was washed with 70% ethanol and resuspended in 10 ml of water.

Ligation of cDNA to the Vector: The cDNA was split up into 5 tubes (2μl each) and the ligation reactions were set up by adding 4.5 μl of water, 2 μl of 5x ligation buffer, lμl of p-Sport vector DNA (cut with Sal-1 / Notl and phosphatase treated) and 0.5 μl of T4 DNA ligase. The ligation was incubated at 40° C overnight.

Introduction of Ligated cDNA into E.coli by Electroporation:
The ligation reaction volume was adjusted to a total volume of 20 μl with water. Five milliliters of yeast tRNA, 12.5 ml of 7.5M NJ^OAc and 70 ml of absolute ethanol (-20°C) was added. The mixture was vortexed thoroughly, and immediately centrifuged at room temperature for 20 minutes at 14000 xg. The pellets were washed in 70% ethanol and each pellet was resuspended in 5 ml of water. All 5 ligations (25ml) were pooled and lOOμl of DH10B electro-competent cells (Life Technologies) were electroporated with 1 ml of DNA (total of 20 electroporations), then plated out on ampicillin plates to determine the number of recombinants (cfu) per microliter. The entire library was seeded into 2 liters of Super Broth and maxipreps were made using Promega Maxi Prep kit and purified on cesium chloride gradients.

EXAMPLE 2: Library Screening / human calcium channel alpha IG-c Generation

Human thalamus library screening:
One microliter aliquots of the human thalamus library were electroporated into Electromax DH10B cells (Life Technologies). The volume was adjusted to 1 ml with SOC media and incubated for 60 minutes at 37°C with shaking. The library was then plated out on 150cm2 plates containing LB to a density of 20000 colonies per plate. These cultures were grown overnight at 37°C.
A human calcium channel alpha IG-c probe was generated by polymerase chain reaction using the following primer pair:
SEQ.IN.NO.:2 3' oligo (18747R): 5* _CCATGGCGATGGTGATGCAG

The probe was generated by PCR using regular PCR conditions using 5' and 3' probe oligos (lOOng each) and 10 ng of diluted miniprep DNA. The resulting 274 bp fragment was run on 1% agarose gel and purified using GENECLEAN kit (Bio 101, Inc.). About 100 ng of the purified probe was labeled with alpha 32P using oligolabeling kit from Pharmacia and the labeled DNA was purified with S-200 columns (Pharmacia).

The library colonies were lifted on Protran nitrocellulose filters (Scheicher & Schuel) and the DNA was denatured in 1.5 M NaCl, 0.5 M NaOH. The filter disks were neutralized with 1.5 M NaCl, 0.5 M Tris-HCl, pH 7.5 and then UV crosslinked to the membrane using a UV-Stratalinker (Stratagene). The filters were washed several times in wash solution (50 mM Tris-HCl, pH 8.0; 1 M NaCl; 1 mM EDTA; 0.1% SDS) at room temperature. Then the disks were incubated in lx southern pre-hybridization buffer (5'-3' Inc) containing 50% formamide and 100 ug/ml of sheared salmon sperm DNA (5' - 3' Inc) for 6 hours at 42 C. Finally, hybridization was performed overnight at 42C in lx hybridization buffer (5 '-3') containing 50% formamide, lOOng of sheared salmon sperm DNA in the presence of labeled probe (5xl05 to lxlO6 cpm/ml of hybridization buffer).

The disks were washed once in 2xSSC, 0.2% SDS at room temperature for 30 minutes, once in 0.2xSSC, 0.1%SDS at 50C for 30 minutes, once in 0.2xSSC, 0.1%SDS at 55C for 30 minutes and once in 0.2xSSC, 0.1% SDS at 60C for 15 minutes. The membranes were than placed on sheets of filter paper, wrapped in the Saran Wrap and exposed to the film at -20C overnight.

Positive clones were identified and collected by coring the colonies from the original plate. The colonies were incubated in 2 ml of LB for 2 hours at 37°C.
Dilutions of the cultures were plated onto LB agar plates and the filter-lifting, hybridizing, washing, colony-picking procedure was repeated. Individual clones from the second screen were picked and digested with EcoRI/Notl to determine the size of the inserts, and the inserts were sequenced.

Three different clones between 3-5kb in length were identified with open reading frames. These were digested with EcoRl/Xhol and Xhol/Notl. These two pieces that were 4.2kb and 3.2kb were subjected to a 3 way ligation using an aliquot of pSport-1 vector that was cut with EcoRI and Notl and purified on a low melting point agarose gel .The ligated circular plasmid DNA was transformed into DH5 alpha bacterial cells from Gibco BRL. A few clones were picked and the entire 7.4 kb sequence was reconfirmed. A maxiprep of the plasmid DNA was obtained using the Promega kit. This DNA was further digested with EcoRI and Not 1 and the 7.4 kb was inserted into the expression vector pGEM HE . Large-scale preparation of DNA was done using a MEGA prep kit (Promega.).

EXAMPLE 3- Cloning human calcium channel alphalG-c cDNA into a Mammalian Expression Vector
The human calcium channel alpha IG-c cDNAs (collectively refened to as hCaChalphalG-c) were cloned into the mammalian expression vector
pcDNA3.1/Zeo(+).The plasmid DNA in p-Sport vector was digested with Not I and EcoRI (NEB) to create cohesive ends. The product was purified by a low melting agarose gel electrophoresis. The pcDNA3.1/Zeo(+) vector was digested with EcoRI and Notl enzymes and subsequently purified on a low melt agarose gel. The linear vector was used to ligate to the human calcium channel alpha IG-c cDNA inserts.

EXAMPLE 4- Construction of a stable cell line expressing the human alpha IG-c. Recombinants were isolated, designated human calcium channel alpha IG-c, and are used to transfect mammalian cells (HEK293, COS-7 or CHO-K1 cells) using the Effectene non-liposomal lipid based transfection kit (Quiagen). Stable cell clones are selected by growth in the presence of zeocin. Single zeocin resistant clones are isolated and shown to contain the intact human calcium channel alpha IG-c gene. Clones containing the human calcium channel alpha IG-c cDNAs are analyzed for human calcium channel alpha lG-cprotein expression. Recombinant plasmids containing human calcium channel alpha IG-c encoding DNA are used to transform the mammalian COS or CHO cells or HEK293 cells.

Cells expressing human calcium channel alpha IG-c, stably or transiently, are used to test for expression of human calcium channel alpha IG-c activity. These cells are used to identify and examine other compounds for their ability to modulate, inhibit or activate the human calcium channel alpha IG-c.

Cassettes containing the human calcium channel alpha IG-c cDNA in the positive orientation with respect to the promoter are ligated into appropriate restriction sites 3' of the promoter and identified by restriction site mapping and/or sequencing. These cDNA expression vectors are introduced into fibroblastic host cells for example COS-7 (ATCC# CRL 1651), and CV-1 tat [Sackevitz et al, Science 238: 1575 (1987)], 293, L (ATCC# CRL6362)] by standard methods including but not limited to electroporation, or chemical procedures (cationic liposomes, DEAE dextran, calcium phosphate). Transfected cells and cell culture supernatants are harvested and analyzed for human calcium channel alpha IG-c expression as described herein.

All of the vectors used for mammalian transient expression can be used to establish stable cell lines expressing human calcium channel alpha IG-c. Unaltered human calcium channel alphalG-c receptor cDNA constructs cloned into expression vectors are expected to program host cells to make human calcium channel alphalG-c protein. The transfection host cells include, but are not limited to, CV-l-P [Sackevitz et al. Science 238: 1575 (1987)], tk-L [Wigler, et al Cell 11: 223 (1977)], NS/0, and dHFr- CHO [Kaufman and Shaφ, J. Mol. Biol. 132: 601, (1982)].

Human calcium channel alpha IG-c cDNA constructs are also ligated into vectors containing amplifiable drug-resistance markers for the production of
mammalian cell clones synthesizing the highest possible levels of human calcium channel alpha IG-c. Following introduction of these constructs into cells, clones containing the plasmid are selected with the appropriate agent, and isolation of an over-expressing clone with a high copy number of plasmids is accomplished by selection in increasing doses of the agent.

Co-transfection of any vector containing human calcium channel alpha IG-c cDNA with a drug selection plasmid including, but not limited to G418,
aminoglycoside phosphotransferase; hygromycin, hygromycin-B phospholransferase; APRT, xanthine-guanine phosphoribosyl-transferase or zeocin, will allow for the selection of stably transfected clones. Levels of human calcium channel alpha IG-c are quantitated by the assays described herein (EXAMPLE 6).

The expression of recombinant human calcium channel alpha IG-c is achieved by transfection of full-length human calcium channel alpha IG-c cDNA into a
mammalian host cell.

Characterization of functional protein encoded by pCaChalphalG-c in Xenopus oocytes

Xenopus laevis oocytes were prepared and injected using standard methods previously described and known in the art (Fraser, S.P. et al. (1993)). Ovarian lobes from adult female Xenopus laevis (Nasco, Fort Atkinson, WI) were teased apart, rinsed several times in nominally Ca-free saline containing: 82.5mM NaCl, 2.5mM KCl, ImM MgC^, 5 mM HEPES, adjusted to pH 7.0 with NaOH (OR-2), and gently shaken in OR-2 containing 0.2% collagenase Type 1 (ICN Biomedicals, Aurora, Ohio) for 2-5 hours. When approximately 50% of the follicular layers were removed, Stage V and VI oocytes were selected and rinsed in media consisting of 75% OR-2 and 25% ND-96. The ND-96 contained: 100 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM HEPES, 2.5 mM Na pyruvate, gentamicin (50 ug/ml), adjusted to pH 7.0 with NaOH. The extracellular Ca+2 was gradually increased and the cells were maintained in ND-96 for 2-24 hours before injection. For in vitro transcription, pGEM HE which had been modified to contain the multiple cloning site from pSPORT (Liman, E.R. et al. (1992)) containing human calcium channel alpha IG-c was linearized with Notl and transcribed with T7 RNA polymerase (Promega) in the presence of the cap analog m7G(5')ppp(5')G. The human alpha IG-c contained its natural Kozak sequence. The synthesized cRNA was precipitated with ammonium acetate and isopropanol, and resuspended in 50μl nuclease-free water. cRNA was quantified using formaldehyde gels (1% agarose, lxMOPS , 3% formaldehyde) against RNA markers (Gibco BRL, 0.24 - 9.5 Kb).

Oocytes were injected with 50 nl of the human calcium channel alphalG-c cRNA (about 600 ng). Control oocytes were injected with 50 nl of water. Oocytes were incubated in ND-96 before analysis for expression of the human calcium channel alpha IG-c. Incubations and collagenase digestion were carried out at room temperature. Injected oocytes were maintained in 48 well cell culture clusters (Costar; Cambridge,

MA) at 18°C. Whole cell agonist-induced cunents were measured 3-6 days after injection with a conventional two-electrode voltage clamp (GeneClamp500, Axon Instruments, Foster City, CA) using standard methods previously described and known in the art (Dascal, N. (1987)). The microelectrodes were filled with 3 M KCl, which had resistances of 1 and 2 MΩ. Cells were continuously perfused with ND96 at 2-5 ml/min at room temperature unless indicated. In some experiments, cells were bathed in a 40 mM Ba saline containing (in mM): 40 BaCl2, 2 KCl, 36 TEA-C1, 5 4-AP and 5 HEPES, pH 7.6. Membrane voltage was clamped at -100 mV unless indicated.

Depolarizing voltage steps elicited inward cunents in oocytes that had been injected with RNA transcribed from the cloned human calcium channel alpha IG-c cDNA as shown in FIGURE 4a,b. In some experiments in which oocytes expressed large outward cunents and slowly activating inward cunents at negative potentials (activation of endogenous Ca-activated Cl cunents), oocytes were bathed in 40 mM Ba saline. Due to effects of Ba2+ on surface charge screening (Wilson et al, 1983), we usually used more physiological conditions (2 mM extracellular Ca ; ND96).

Figure 4a shows a representative family of cunent traces elicited by depolarizing pulses applied to the oocyte. Inward Ba2+ cunents activated slowly near threshold potentials and with larger depolarizing voltage pulses, the cunents activated more quickly and inactivated, producing a signature "criss-cross" pattern for classical T-type cunents (Randall and Tsien, 1997). Water-injected oocytes had no detectable inward cunents. Peak cunents recorded in 2 mM extracellular Ca were -380 +/- 170 nA (n=9), similar to that observed with Ba2+ as the charge canier (-240 +/- 20 nA; n=8). The threshold voltage recorded in ND96 was about -59 mV (n=9). The voltage that elicited maximal cunents was -29 +/- 5 mV (n=9). The voltage at which cunents reversed sign was +29 +/- 5 mV (n=4). The time to peak from the onset of the voltage pulse was 5.2 +/- 2 msec (n=9). In 40 mM Ba2+ solution, the voltage dependence of activation was shifted slightly along the voltage axis (Huguenard, 1996; Perez-Reyes et al, 1998). The voltage eliciting peak cunents was -33 +/- 2 mV (n=8). The time to peak response was similar to that recorded in 2 mM Ca2+ (4.8 +/- 0.3 msec).

Steady state inactivation (Figure 4c,d) was studied by applying 4 sec long prepulses followed by a test pulse to -30 mV to measure channel availability. In some experiments a 5 msec repolarization pulse to -100 mV was performed to close any channels still open at the end of the 4 sec pulse. Results were similar and combined. Similar V0.5 for inactivation for the cloned mouse alpha 1G (AJ012569 contains the insert observed in the present invention in intracellular loop II-III as well as an extra 18 amino acid insert in intracellular loop between domains III-IV)
9+ 9-4-expressed in HEK293 cells were obtained in Ca and Ba salines (Klugbauer et al, 1999). Figure 4c shows representative cunent traces recorded during the test pulse. The percent of maximum response was calculated, plotted as a function of the prepulse potential and fit with a Boltzmann equation (Figure 4d). Inactivation of human alpha IG-c occuned at sub-threshold voltages and displayed a steep voltage dependence (slope -4.9 [-6.0 to -3.8], n=7). The voltage dependence of inactivation occuned at -67 mV with 95% confidence interval of -68.3 to -65.8 mV (n=7 experiments; CaSOS). The voltage dependence of inactivation was similar when recorded in 40 mM Ba2+ (-71 +/- 5 mV, n=5).

A defining feature of T-type calcium cunents is that they deactivate relatively slowly compared to HVA calcium cunents, producing slowly decaying tail cunents after a depolarizing pulse. A 5 msec voltage step to -30mV was followed by a step to -100 mV. The tau for cunent deactivation was 2.2 +/- 0.4 msec (n=3), similar to values reported for T-type cunents.

The pharmacological characterization of human alpha IG-c expressed in Xenopus oocytes was determined for mibefradil, Ni2+, Cd2+, amiloride and ethosuximide. The effect of the indicated concentrations of mibefradil on peak T-cunents was determined. Mibefradil was bath applied to oocytes expressing human calcium channel alphalG-c cRNA (Figure 5). Shown are 1-3 concentrations tested on 7 individual oocytes. The IC50 was 2.5 μM with a 95% confidence interval of 1.3 to 4.9 μM. Oocytes were bathed in ND96,

The present invention was relatively insensitive to Ni2+ blockade, similar to that observed for the rat alphalG (AJ027984) (Perez-Reyes et al, 1998). 200 μM NiCl2 blocked the peak cunent by 25 +/- 6% (n=3); in the same cell, 1 mM NiCl2 blocked about twice the cunent blocked by 200 μM Ni . Oocytes were voltage clamped at -100 mV between test pulses. Cd2+ (100 μM) blocked T-cunents by 44 +/- 9 % (n=3).

The present invention was sensitive to amiloride block. 500 μM amiloride blocked peak cunents by only 23 +/- 4 % (n=4), similar to the block observed at rat spinal motoneurons (Huguenard, 1996). This concentration would completely block some T-type calcium cunents (e.g., human alphalH; see Background). Oocytes were maintained at -100 mV between voltage pulses and similar results were obtained for oocytes bathed in ND96 and Ba2+ salines.

The present invention was sensitive to block by the antiepileptic
ethosuximide. 600 μM ethosuximide (Sigma), within the range of therapeutically relevant concentrations for the treatment of absence epilepsy (see Background), reversibly blocked peak cunents by 26 +/- 3 % (n=3). Oocytes were maintained at -100 mV between voltage pulses and similar results were obtained for oocytes bathed in ND96 and Ba2+ salines. Human alphalH cunents are blocked only -7 % by 300 μM ethosuximide (WO 99/28342).

Interestingly, the chloride channel blocker NPPB (5-Nitro-2-(3-phenylpropylamino) benzoic acid) blocked human alpha IG-c cunents expressed in oocytes. 20, 100 and 200 μM NPPB blocked 22 +/- 6 % (n=3), 55 +/- 7 % (n=3), and 89 +/- 7 % (n=3), respectively. Another chloride channel blocker 9-AC (anthracene-9-carboxylic acid, Sigma) was less effective in blocking T-cunents; 100 uM 9-AC blocked peak cunents by 30 +/- 3% (n=4). DIDS (4,4'-diisothiocyanatostilbene-2.2'-disulfonic acid (Sigma); 100 μM) and niflumic acid (lOOμM) had no effect on peak human alphalG-c cunents. DIDS and niflumic acid blocked the cunent by 16 +/-13% (n=3) and 0 +/- 2% (n=3), respectively.

EXAMPLE 6- Characterization of Human calcium channel alpha IG-c in human HEK 293 cell line.
Human HEK293 cells are transfected with human calcium channel alpha IG-c pCaChalphalGc (EXAMPLE 4). Transient transfections 1 μg of pCaChalphalG per 10 cells per 100 mm dish are performed using the Effectene tranfection kit (Quiagen;
301425). Three days after transfection, cells are plated onto 96-well plates (Biocoat, poly-D-lysine coated black/clear plate; Becton Dickinson part # 354640). After one day, wells are rinsed with F12/DMEM, then incubated in Fluo-4 (2 μM) with Pluronic acid (20%, 40μl used in 20 mis total volume) for 1 hour at room temperature. Plates are assayed using the FLIPR (Molecular Devices, FL-101). Cells are challenged with elevated K+ to achieve a final concentrations of 10, 25 and 43 mM K+ (applied in 40 μl added to 80 μl at a velocity of 50 μl/sec). Transfections with vector alone are tested as controls. The basal buffer contains (in mM): 123 NaCl, 2 KCl, 1 MgCl2, 2 CaCl2, 15 glucose and 20 HEPES, pH 7.4.

Cells stably expressing the human alpha IG-c are plated onto 96-well plates (Biocoat, poly-D-lysine coated black/clear plate; Becton Dickinson part # 354640) and grown to confluence. Wells are rinsed with F12/DMEM, then incubated in Fluo-4 (2 μM) with Pluronic acid (20%, 40μl used in 20 mis total volume) for 1 hour at room temperature. Plates are assayed using the FLIPR (Molecular Devices, FL-101). Cells are challenged with elevated K+ (in 40 μl added to 80 μl at a velocity of 50 μl/sec).

The whole cell patch clamp technique (Hamill, O.P. et al. (1981)) is used to record ligand-induced cunents from HEK293 stably expressing human calcium channel alpha 1G-c maintained for >1 day on 12 mm coverslips. Cells are visualized using a Nikon Diaphot 300 with DIC Nomarski optics. Cells are continuously perfused in a physiological saline (-0.5 ml/min) unless otherwise indicated. The standard physiological saline ("CaCh physiological saline (CaChPS") contains: 15 mM BaC12, 150 mM CholineCl, 1 mM MgC12 and 10 mM HEPES (pH 7.3, 325 mOsm as measured using a Wescor 5500 vapor-pressure (Wescor, Inc., Logan, UT). Recording electrodes are fabricated from borosilicate capillary tubing (R6; Garner Glass, Claremont, CA), the tips are coated with dental periphery wax (Miles Laboratories, South Bend, IN), and have resistances of 1-2 MΩ when containing intracellular saline: 135 mM CsCl, 10 mM EGTA, 1 mM MgC_2, 10 mM HEPES (pH 7.4, with TEA-OH, 290 mOsm). Cunent and voltage signals are detected and filtered at 2 kHz with an Axopatch ID patch-clamp amplifier (Axon Instruments, Foster City, CA), digitally recorded with a DigiData 1200B laboratory interface (Axon
Instruments), and PC compatible computer system and stored on magnetic disk for off-line analysis. Data acquisition and analysis are performed with PClamp software.

EXAMPLE 7 -Primary Structure Of The Human calcium channel alpha IG-c Protein

The nucleotide sequences of human calcium channel alpha IG-c revealed single large open reading frame of about 6819 base pairs encoding 2273 amino acids.

The cDNAs have 5' and 3 '-untranslated extensions of about 511 and about 397 nucleotides for human calcium channel alpha IG-c, respectively. The first in-frame methionine was designated as the initiation codon for an open reading frame that predicts a human calcium channel alpha IG-c protein with an estimated molecular mass (Mr) of about 251.8 kDa.

The predicted human calcium channel alpha IG-c protein was aligned with nucleotide and protein databases and found to be similar to the human alpha 1G "a" isoform (accession # API 26966) with the exception that the sequence presented herein contains a 23 amino acid insert in the second intracellular loop between domains I and II. The insert contains a putative CKII phosphorylation site at S971. This 23 amino acid insert is 91 and 87% identical to the homologous sequence in rat (AF125161) and mouse (AJ012569), respectively. However, this insert is not present in another rat alphalG isoform (AF027984) which is the ortholog to the present invention in regard to the remainder of the sequence. The putative casein kinase II phosphorylation site in this insert in the present invention is not conserved in rat or mouse

There are 8, 23, 15 and 12 putative PKA (ie., R K R/K x T/S), PKC (ie., S/T x K/R), casein kinase II (CKII; ie. S/T xx D E) and MGCK (mammary gland casein kinase; ie., S x E) phosphorylation sites, respectively. There are 8 potential N-linked glycosylation sites.. There are no putative tyrosine phosphorylation motifs (i.e., R/K x x x D x x Y) in predicted intracellular domains.

EXAMPLE 8-Cloning human calcium channel alpha IG-c cDNA into E. coli Expression Vectors Recombinant human calcium channel alpha IG-c is produced in I coli following the transfer of the human calcium channel alpha IG-c expression cassette into IL coli expression vectors, including but not limited to, the pET series
(Novagen). The pET vectors place human calcium channel alpha IG-c expression under control of the tightly regulated bacteriophage T7 promoter. Following transfer of this construct into an E. coli host that contain a chromosomal copy of the T7 RNA polymerase gene driven by the inducible lac promoter, expression of human calcium channel alpha IG-c is induced when an appropriate lac substrate (IPTG) is added to the culture. The levels of expressed human calcium channel alpha IG-c are determined by the assays described herein.

The cDNA encoding the entire open reading frame for human calcium channel alpha IG-c is inserted into the Ndel site of pET [16 ]1 la. Constructs in the positive orientation are identified by sequence analysis and used to transform the expression host strain BL21. Transformants are then used to inoculate cultures for the production of human calcium channel alpha IG-c protein. Cultures may be grown in M9 or ZB media, whose formulation is known to those skilled in the art. After growth to an OD600= 1.5, expression of human calcium channel alpha IG-c is induced with 1 mM IPTG for 3 hours at 37°C.

EXAMPLE 9-Cloning human calcium channel alpha IG-c cDNA into a Baculovirus Expression Vector for Expression in Insect Cells
Baculovirus vectors, which are derived from the genome of the AcNPV virus, are designed to provide high level expression of cDNA in the Sf9 line of insect cells (ATCC CRL# 1711). Recombinant baculoviruses expressing human calcium channel alpha IG-c cDNA is produced by the following standard methods (InVitrogen Maxbac Manual): the human calcium channel alphalG-c cDNA constructs are ligated into the polyhedrin gene in a variety of baculovirus transfer vectors, including the pAC360 and the BlueBac vector (InVitrogen). Recombinant baculoviruses are generated by homologous recombination following co-transfection of the baculovirus transfer vector and linearized AcNPV genomic DNA [Kitts, P.A., Nuc. Acid. Res. 18: 5667 (1990)] into Sf9 cells. Recombinant pAC360 viruses are identified by the absence of inclusion bodies in infected cells and recombinant pBlueBac viruses are identified on the basis of β-galactosidase expression (Summers, M. D. and Smith, G. E., Texas Agriculture Exp. Station Bulletin No. 1555). Following plaque purification, human calcium channel alpha IG-c expression is measured by the assays described herein.

The cDNA encoding the entire open reading frame for human calcium channel alpha IG-c is inserted into the BamHI site of pBlueBacII. Constructs in the positive orientation are identified by sequence analysis and used to fransfect Sf9 cells in the presence of linear AcNPV mild type DNA.

Authentic, active human calcium channel alpha IG-c is found in the cytoplasm of infected cells. Active human calcium channel alpha IG-c is extracted from infected cells by hypotonic or detergent lysis.

EXAMPLE 10-Cloning human calcium channel alpha IG-c cDNA into a yeast expression vector
Recombinant human calcium channel alpha IG-c is produced in the yeast S. cerevisiae following insertion of the optimal human calcium channel alpha IG-c cDNA cistron into expression vectors designed to direct the intracellular or extracellular expression of heterologous proteins. In the case of intracellular expression, vectors such as EmBLyex4 or the like are ligated to the human calcium channel alphalG-c cistron [Rinas, U. et al. Biotechnology 8: 543-545 (1990);

Horowitz B. et al. J. Biol. Chem. 265: 4189-4192 (1989)]. For extracellular expression, the human calcium channel alpha IG-c cistron is ligated into yeast expression vectors which fuse a secretion signal (a yeast or mammalian peptide) to the NH terminus of the human calcium channel alpha IG-c protein [Jacobson, M. A.,

Gene 85: 511-516 (1989); Riett L. and Bellon N. Biochem. 28: 2941-2949 (1989)].

These vectors include, but are not limited to pAVEl>6, which fuses the human serum albumin signal to the expressed cDNA [Steep O. Biotechnology 8: 42-46 (1990)], and the vector pL8PL which fuses the human lysozyme signal to the expressed cDNA [Yamamoto, Y., Biochem. 28: 2728-2732)]. In addition, human calcium channel alpha IG-c is expressed in yeast as a fusion protein conjugated to ubiquitin utilizing the vector pVEP [Ecker, D. J., J. Biol. Chem. 264: 7715-7719 (1989), Sabin, E. A., Biotechnology 7: 705-709 (1989), McDonnell D. P., Mol. Cell Biol. 9: 5517-5523 (1989)]. The levels of expressed human calcium channel alpha IG-c are determined by the assays described herein.

EXAMPLE 11 -Purification of Recombinant human calcium channel alpha IG-c
Recombinantly produced human calcium channel alpha IG-c may be purified by antibody affinity chromatography.

Human calcium channel alpha IG-c antibody affinity columns are made by adding the anti -human calcium channel alpha IG-c antibodies to Affigel-10 (Bio-Rad), a gel support that is pre-activated with N-hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with the spacer arm. The remaining activated esters are then quenched with IM ethanolamine HCI (pH 8). The column is washed with water followed by 0.23 M glycine HCI (pH 2.6) to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (pH 7.3) together with appropriate membrane solubilizing agents such as detergents and the cell culture supernatant or cell extract containing solubilized human calcium channel alpha IG-c is slowly passed through the column. The column is then washed with phosphate- buffered saline together with detergents until the optical density (A280) falls to background, then the protein is eluted with 0.23 M glycine-HCl (pH 2.6) together with detergents. The purified human calcium channel alpha IG-c protein is then dialyzed against phosphate buffered saline.

Ahnert-Hilger, G., Stadtbaeumer, A., Struebing, C, Scheruebl, H., Schultz, G., Riecken, E.-O., and Wiedenmann, B. (1996). g-Aminobutyric acid secretion from pancreatic neuroendocrine cells. Gastroenterology 110, 1595-1604.

Arnoult, C, Cardullo, R. A., Lemos, J. R., and Florman, H. M. (1996). Activation of mouse sperm T-type Ca2+ channels by adhesion to the egg zona pellucida. Proc. Natl. Acad. Sci. U. S. A. 93, 13004-13009.

Arnoult, C, Lemos, J. R., and Florman, h. M. (1997). Voltage-dependent modulation of T-type calcium channels by protein tyrosine phosphorylation. Embo J. 16, 1593-1599.

Avery, R. B., and Johnston, D. (1996). Multiple channel types contribute to the low-voltage-activated calcium cunent in hippocampal CA3 pyramidal neurons. J.
Neurosci. 16, 5567-5582.

Black, J.L. Lennon, V.A (1999). Identification and cloning of putative human neuronal voltage-gated calcium channel g-2 and g-3 subunits: neurologic implications Mayo Clin. Proc 74: 357-361.

Burgess, D. L., Jones, J. M., Meisler, M. H., and Noebels, J. L. (1997). Mutation of the Ca2+ channel b subunit gene Cchb4 is associated with ataxia and seizures in the lethargic (lh) mouse. Cell (Cambridge, Mass.) 88, 385-392.

Cardenas, C. G., Mar, L. P. D., and Scroggs, R. S. (1995). Variation in serotonergic inhibition of calcium channel cunents in four types of rat sensory neurons
differentiated by membrane properties. J. Neurophysiol. 74, 1870-9.

Coulter, D. A., Huguenard, j. R., and Prince, D. A. (1989). Characterization of ethosuximide reduction of low-threshold calcium cunent in thalamic neurons. Ann. Neurol. 25, 582-93.

Coulter, D. A., Huguenard, J. R., and Prince, D. A. (1989). Specific petit mal anticonvulsants reduce calcium cunents in thalamic neurons. Neurosci. Lett. 98, 74-8.

Dascal, N. (1987). The use oi Xenopus oocytes for the study of ion channels. CRC Critical Reviews in Biochemistry. 22: 317-387.

Doughty, J. M., Miller, A. L., and Langton, P. D. (1998). Non-specificity of chloride channel blockers in rat cerebral arteries: block of the L-type calcium channel. J.
Physiol. (Cambridge, U. K.) 507, 433-439.

Enyeart, J. J., Milinar, B., and Enyeart, J. A. (1993). T-type calcium channels are required for adrenocorticotropin-stimulated cortisol production by bovine adrenal zona fasciculata cells. Mol. Endocrinol. 7, 1031-40.

Ertel, S. I., Ertel, E. A., and Clozel, J.-P. (1997). T-type Ca2+ channels and pharmacological blockade: potential pathophysiological relevance. In Cardiovasc. Drugs Ther., pp. 723-739.

Formenti, A., Arrigoni, E., and Mancia, M. (1993). Two distinct modulatory effects on calcium channels in adult rat sensory neurons. Biophys. J. 64, 1029-37.

Fraser, S. P., Moon, C, and Djamgoz, M. B. A. (1993). Electrophysiology of Xenopus oocytes: An expression system in molecular neurobiology. In:
Electrophysiology. Wallis, D, ed. IRL, Oxford, UK, pp. 65-86.

Furukawa, T., Nukada, T., Mori, Y., Wakamori, M., Fujita, Y., Ishida, H., Fukuda, K., Kato, S., and Yoshii, M. (1998). Differential interactions of the C terminus and the cytoplasmic I-II loop of neuronal Ca2+ channels with G-protein a and bg subunits. I. Molecular determination. J. Biol. Chem. 273, 17585-17594.

Griswold, M. D. (1988). Protein secretions of Sertoli cells. In Int. Rev. Cytol.. pp. 133-56.

Hamill, OP, Marty, A, Neher, E, Sakmann, B, and Sigworth, FJ (1981). Improved patch-clamp techniques for high-resolution cunent recording from cells and cell-free membrane patches. Pflugers Archives 391: 85-100.

Heine, M., and Wicher, D. (1998). Ca2+ resting cunent and Ca2+-induced Ca2+ release in insect neurosecretory neurons. NeuroReport 9, 3309-3314.

Huguenard, J. R. (1996). Low-threshold calcium cunents in central nervous system neurons. In Annu. Rev. Physiol.. pp. 329-48.

lies, D. E.; Lehmann-Horn, F.; Scherer, S. W.; Tsui, L. C; Olde Weghuis, D.;
Suijkerbuijk, R. F.; Heytens, L.; Mikala, G.; Schwartz, A.; et al. (1994). Localization of the gene encoding the α2/δ-subunits of the L-type voltage-dependent calcium channel to chromosome 7q and analysis of the segregation of flanking markers in malignant hyperthermia susceptible families. Hum. Mol. Genet. 3(6), 969-75.

Katz, A. M. (1999). T-type calcium channels may provide a unique target for cardiovascular therapy. Eur. Heart J. Suppl. 1, H18-H23.

Kirkup, A. J., Edwards, G., and Weston, A. H. (1996). Investigation of the effects of 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB) on membrane cunents in rat portal vein. Br. J. Pharmacol. 117, 175-83.

Klugbauer, N., Marais, E., Lacinova, L., and Hofmann, F. (1999). A T-type calcium channel from mouse brain. Pβuegers Arch. 437, 710-715.

Kostyuk, P. G., Molokanova, E. A., Pronchuk, N. F., Savchenko, A. N., and
Verkhratsky, A. N. (1992). Different action of ethosuximide on low- and high-threshold calcium cunents in rat sensory neurons. Neuroscience (Oxford) 51, 755-8.

Lalevee, N., Pluciermik, F., and Joffre, M. (1997). Voltage-dependent calcium cunent with properties of T-type cunent in Sertoli cells from immature rat testis in primary cultures. Biol. Reprod. 56, 680-687.

Lambert, R. C, Maulet, Y., Mouton, J., Beattie, R., Volsen, S., De Waard, M., and Feltz, A. (1997). T-type Ca2+ cunent properties are not modified by Ca2+ channel b subunit depletion in nodosus ganglion neurons. J. Neurosci. 17, 6621-6628.

Letts, V.A., Felix, R., Biddlecome, G.H., Arikkath, J., Mahaffey, C.L., Valenzuela, A., Bartlett, F.S. II, Mori, Y., Campbell, K.P. and Frankel, W.N. (1998) The mouse stargazer gene encodes a neuronal Ca2+-channel g subunit. Nat. Genet. 19:340.

Leuranguer, V., Bourinet, E., Lory, P., and Nargeot, J. (1998). Antisense depletion of b-subunits fails to affect T-type calcium channels properties in a neuroblastoma cell line. Neuropharmacology 37, 701-708.

Lijnen, P., and Petrov, V. (1999). Proliferation of human peripheral blood
mononuclear cells during calcium entry blockade. Role of protein Kinase C. Methods Find. Exp. Clin. Pharmacol. 21, 253-259.

Liman, Emily R., Tytgat, Jan, Hess, Peter. (1992) Subunit stoichiometry of a mammalian potassium channel determined by construction of multimeric cDNAs. Neuron 9: 861-871.

McCormick, D. A., and Bal, T. (1997). Sleep and arousal: thalamocortical
mechanisms. Annu. Rev. Neurosci. 20, 185-215.

Miller, R. J. (1987). Multiple calcium channels and neuronal function. In Science (Washington, D. C, 1883-), pp. 46-52.

Perez-Reyes, E. (1998). Molecular characterization of a novel family of low voltage-activated, T-type, calcium channels. InJ. Bioenerg. Biomembr., pp. 313-318.

Perez-Reyes, E., Cribbs, L. L., Daud, A., Lacerda, A. E., Barclay, j., Williamson, M. P., Fox, M., Rees, M., and Lee, J.-H. (1998). Molecular characterization of a neuronal low- voltage-activated T-type calcium channel. Nature (London) 391, 896-900.

Perez-Reyes, E., and Schneider, T. (1995). Molecular biology of calcium channels. In Kidney Int.. pp. 1111-24.

Randall, A. D., and Tsien, R. W. (1997). Contrasting biophysical and
pharmacological properties of T-type and R-type calcium channels.
Neuropharmacology 36, 879-893.

Richard, S., and Nargeot, J. (1998). T-type calcium cunents in vascular smooth muscle cells: a role in cellular proliferation? In Low- Voltage-Act. T-type Calcium Channels, Proc. Int. Electrophysiol. Meet., pp. 123-132.

Rousseau, M. F., Hayashida, W., Van Eyll, C, Hess, O. M., Benedict, C. R., Ahn, S., Chapelle, F., Kobrin, I., and Pouleur, H. (1996). Hemodynamic and cardiac effects of the selective T-type and L-type calcium channel blocking agent mibefradil in patients with varying degrees of left ventricular systolic dysfunction. J. Am. Coll. Cardiol. 28, 972-979.

Sen, L., and Smith, T. W. (1994). T-type Ca2+ channels are abnormal in genetically determined cardiomyopathic hamster hearts. Circ. Res. 75, 149-55.

Sherwin, A.L. (1989). Ethosuximide. Clinical use. In Antiepileptic drugs (Levy, R., Matteson, R., Meldrum, Penny JK, Dreifuss FE, eds), pp.685-689. New York:

Stea, A., Dubel, S.J. and Snutch, T.P. (1999). alB N-type calcium channel isoforms with distinct biophysical properties. Ann. N. Y. Acad. Sci. 868: 118-130 Talley, E. M., Cribbs, L. L., Lee, J.-H., Daud, A., Perez-Reyes, E., and Bayliss, D. A. (1999). Differential distribution of three members of a gene family encoding low voltage-activated (T-type) calcium channels. J. Neurosci. 19, 1895-1911.

Todorovic, S. M., and Lingle, C. J. (1998). Pharmacological properties of T-type Ca2+ cunent in adult rat sensory neurons: effects of anticonvulsant and anesthetic agents. J. Neurophysiol. 79, 240-252.

Tsakiridou, E., Bertollini, L., de Curtis, M., Avanzini, G., and Pape, H. C. (1995). Selective increase in T-type calcium conductance of reticular thalamic neurons in a rat model of absence epilepsy. J. Neurosci. 15, 3110-17.

Wang, Z., Estacion, M., and Mordan, L. J. (1993). Calcium influx via T-type channels modulates PDGF-induced replication of mouse fibroblasts. Am. J. Physiol. 265, C1239-C1246.

Williams, M., Stauderman, K., Haφold, M., Hans, M., Urrutia, A., and Washburn, M. S. Low-voltage activated calcium channel proteins and cDNAs encoding them and the development of calcium channel blockers. In PCT Int. Appl. (Wo: (Sibia
Neurosciences, Inc., USA).), pp. 171; WO 9928342

Williams, M. E., Feldman, D. H., McCue, A. F., Brenner, R., Velicelebi, G., Ellis, S. B., and Haφold, M. M. (1992). Structure and functional expression of al, a2, and b subunits of a novel human neuronal calcium channel subtype. Neuron 8, 71-84.

Williams, M. E., Washburn, M. S., Hans, M., Urrutia, A., Brust, P. F., Prodanovich, P., Haφold, M. M., and Stauderman, K. A. (1999). Structure and functional characterization of a novel human low- voltage activated calcium channel. J.
Neurochem. 72, 791-799.

Wilson, D., Morimoto, K., Tsuda, Y., and Brown, A. (1983). Interaction between calcium ions and surface charge as it relates to calcium cunents. J Membr Biol 72, 117-130.

Xu, X., and Best, P. M. (1990). Increase in T-type calcium cunent in atrial myocytes from adult rats with growth hormone-secreting tumors. Proc. Natl. Acad. Sci. U. S. A. 87, 4655-9.

Zamponi, G. W., Bourinet, E., and Snutch, T. P. (1996). Nickel block of a family of neuronal calcium channels: subtype- and subunit-dependent action at multiple sites. J. Membr. Biol. 151, 77-90.




<130> ORT-1057


<160> 5

<170> PATENTIN VER. 2.0

<210> 1
<211> 20
<212> DNA

<400> 1

<210> 2
<211> 20
<212> DNA


<400> 2

<210> 3
<211> 6822
<212> DNA
<213> HOMO SAPIENS <400> 3

<210> 4
<211> 7741
<212> DNA
<213> HOMO SAPIENS <400> 4










A 7741

<210> 5
<211> 2273
<212> PRT

<400> 5
1 5 10 15


50 55 60


85 90 95

100 105 110

115 120 125


165 170 175

180 185 190

195 200 205


210 215 220


225 230 . 235 240

245 250 255

260 265 270



325 330 335

340 345 350

355 360 365




435 440 445



485 490 495

500 505 510

515 520 525


565 570 575

580 585 590

595 600 605



645 650 655




725 730 735

740 745 750

755 760 765


805 810 815

820 825 830

835 840 845



885 890 895

900 905 910


930 935 940


945 950 955 960

965 970 975

980 985 990

995 1000 1005


1010 1015 1020


1025 1030 1035 1040


1075 1080 1085



1125 1130 1135

1140 1145 1150

1155 1160 1165


1205 1210 1215

1220 1225 1230

1235 1240 1245



1285 1290 1295




1365 1370 1375

1380 1385 1390

1395 1400 1405


1445 1450 1455

1460 1465 1470

1475 1480 1485



1525 1530 1535

1540 1545 1550



1605 1610 1615

1620 1625 1630

1635 1640 1645




1700 1705 1710

1715 1720 1725


1730 1735 1740


1745 1750 1755 1760

1765 1770 1775

1780 1785 1790

1795 1800 1805



1825 1830 1835 1840

1845 1850 1855

1860 1865 1870

1875 1880 1885


1890 1895 1900


1905 1910 1915 1920

1925 1930 1935




2005 2010 2015

2020 2025 2030

2035 2040 2045


2085 2090 2095

2100 2105 2110

2115 2120 2125


2130 2135 2140


2145 2150 2155 2160

2165 2170 2175

2180 2185 2190


2210 2215 2220


2225 2230 2235 2240

2245 2250 2255

2260 2265 2270