Traitement en cours

Veuillez attendre...

Paramétrages

Paramétrages

Aller à Demande

1. WO1997016563 - SEQUENCES NUCLEOTIDIQUES POUR LA DETECTION DES ERWINIA CAROTOVORA SUBSP. ATROSEPTICA

Numéro de publication WO/1997/016563
Date de publication 09.05.1997
N° de la demande internationale PCT/FR1996/001692
Date du dépôt international 29.10.1996
Demande présentée en vertu du Chapitre 2 11.04.1997
CIB
C12Q 1/68 2006.01
CCHIMIE; MÉTALLURGIE
12BIOCHIMIE; BIÈRE; SPIRITUEUX; VIN; VINAIGRE; MICROBIOLOGIE; ENZYMOLOGIE; TECHNIQUES DE MUTATION OU DE GÉNÉTIQUE
QPROCÉDÉS DE MESURE OU DE TEST FAISANT INTERVENIR DES ENZYMES, DES ACIDES NUCLÉIQUES OU DES MICRO-ORGANISMES; COMPOSITIONS OU PAPIERS RÉACTIFS À CET EFFET; PROCÉDÉS POUR PRÉPARER CES COMPOSITIONS; PROCÉDÉS DE COMMANDE SENSIBLES AUX CONDITIONS DU MILIEU DANS LES PROCÉDÉS MICROBIOLOGIQUES OU ENZYMOLOGIQUES
1Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismes; Compositions à cet effet; Procédés pour préparer ces compositions
68faisant intervenir des acides nucléiques
CPC
C12Q 1/689
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms
68involving nucleic acids
6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
6888for detection or identification of organisms
689for bacteria
Déposants
  • INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE [FR]/[FR] (AllExceptUS)
  • INSTITUT NATIONAL AGRONOMIQUE PARIS-GRIGNON [FR]/[FR] (AllExceptUS)
  • SANOFI DIAGNOSTICS PASTEUR [FR]/[FR] (AllExceptUS)
  • BERTHEAU, Yves [FR]/[FR] (UsOnly)
  • EXBRAYAT, Pascale [FR]/[FR] (UsOnly)
  • FRECHON, Dominique [FR]/[FR] (UsOnly)
  • GALLET, Olivier [FR]/[FR] (UsOnly)
  • GUILLOT, Emanuelle [FR]/[FR] (UsOnly)
  • LAURE, Françoise [FR]/[FR] (UsOnly)
  • LE CLERC, Valérie [FR]/[FR] (UsOnly)
  • PAYET, Nicole [FR]/[FR] (UsOnly)
Inventeurs
  • BERTHEAU, Yves
  • EXBRAYAT, Pascale
  • FRECHON, Dominique
  • GALLET, Olivier
  • GUILLOT, Emanuelle
  • LAURE, Françoise
  • LE CLERC, Valérie
  • PAYET, Nicole
Mandataires
  • DEMACHY, Charles
Données relatives à la priorité
95/1280330.10.1995FR
Langue de publication français (FR)
Langue de dépôt français (FR)
États désignés
Titre
(EN) NUCLEOTIDE SEQUENCES FOR DETECTING ERWINIA CAROTOVORA SUBSP. ATROSEPTICA
(FR) SEQUENCES NUCLEOTIDIQUES POUR LA DETECTION DES ERWINIA CAROTOVORA SUBSP. ATROSEPTICA
Abrégé
(EN)
The use of nucleotide sequence Y45 and/or nucleotide sequence Y46 represented by SEQ ID NO 1: TCACCGGACGCCGAACTGTGGCGT and SEQ ID NO 2: TCGCCAACGTTCAGCAGAACAAGT, respectively, for carrying out a method for detecting and specifically identifying $i(Erwinia carotovora) subsp. $i(atroseptica) ($i(Eca)) in a predetermined sample, particularly soil or water, or in a host thought to be a carrier of such bacteria, particularly plants and seeds, as well as, if necessary, carrying out a method for the early diagnosis of diseases thought to be caused by said $i(Eca) in the above-mentioned host.
(FR)
La présente invention concerne l'utilisation de la séquence nucléotidique Y45 et/ou de la séquence nucléotidique Y46, représentées respectivement par les séquences SEQ ID NO 1 et SEQ ID NO 2 suivantes: SEQ ID NO 1: TCACCGGACGCCGAACTGTGGCGT; SEQ ID NO 2: TCGCCAACGTTCAGCAGAACAAGT pour la mise en oeuvre d'un procédé de détection et d'identification spécifique des $i(Erwinia carotovora) subsp. $i(atroseptica (Eca)), dans un échantillon déterminé, et plus particulièrement dans le sol ou l'eau, ou chez un hôte susceptible d'être porteur de telles bactéries, notamment chez les plantes et les semences, et, le cas échéant, pour la mise en oeuvre d'une méthode de diagnostic précoce des pathologies susceptibles d'être causées par lesdites $i(Eca) chez l'hôte susmentionné.
Également publié en tant que
Dernières données bibliographiques dont dispose le Bureau international