Recherche dans les collections de brevets nationales et internationales
Une partie du contenu de cette demande n'est pas disponible pour le moment.
Si cette situation persiste, contactez-nous auObservations et contact
1. (WO1993016719) UTILISATION DU FACTEUR DE CROISSANCE D'ORIGINE PLAQUETTAIRE DANS LA CICATRISATION DE LESIONS OPHTALMIQUES
Note: Texte fondé sur des processus automatiques de reconnaissance optique de caractères. Seule la version PDF a une valeur juridique
USE OF PLATELET DERIVED GROWTH FACTOR
IN OPHTHALMIC WOUND HEALING

BACKGROUND OF THE INVENTION

The invention relates to the use' of platelet-derived growth factor (PDGF) to stimulate ophthalmic wound healing, particularly wounds to the cornea.

Corneal wounds frequently arise from trauma t the eye, such as may occur in automobile accidents, industrial accidents, and wounds caused by weapons.
Wounds to the eye also occur as the unavoidable
consequence of surgery, such as cataract surgery, penetrating keratoplasty, glaucoma filtering surgery, retinal surgery such as retinal reattachiiient, and refractive surgery such as laser corneal ablation or radial keratotomy. Non-healing corneal ulcers may also arise from pathological non-traumatic causes, such as diabetes.

The healing of these wounds can frequently be slow and difficult, complicating recovery from trauma o the post-operative course of surgery. There is, therefore, a need for a readily applicable method of accelerating ophthalmic wound healing, particularly of corneal wounds.

Additionally, the quality of healing of corne wounds is frequently poor, leading to scarring and othe vision-impairing consequences. Therefore, there also i a need for a method that can improve the quality of healing of corneal wounds.

Recently, much attention has been paid to the use of growth factors to accelerate wound healing, particularly of skin. Growth factors are agents which cause cells to migrate, differentiate, transform, or mature and divide. These factors are polypeptides which can usually be isolated from many different normal and malignant mammalian cell types. Some growth factors can be produced by genetically-engineered microorganisms such as bacteria fEscherichia coli) and yeasts. See, for example. Chapters 10 and 11 of Molecular and Cellular Biology of Wound Repair (1986) , incorporated herein by reference. Among these growth factors are included epidermal growth factor (EGF) , transforming growth factors alpha and beta (TGFα, TGF/3, , and TGF32) ,
fibroblast growth factor (FGF) , insulin-like growth factor (IGF) , nerve growth factor (NGF) , and platelet- derived growth factor (PDGF) . These are describe in U.S. Patent No. 4, 939, 135" o Robertson et al. ,
incorporated herein by this reference.

The use of PDGF to accelerate wound healing in skin and connective tissue has been studied (Antoniades et al., Proc. Natl. Acad. Sci. USA 88:565-569 (1991); Cromack et al. , . Trauma 30:S129-133 (1990); Ross et al., Philos. Trans. R. Soc. Lond. fBiol.V 327:155-169 (1990) ) . However, conditions in the cornea are
substantially different than those in skin and connective tissue. For example, the corneal epithelium is
continually washed with tear fluid which contains a
' significant quantity of EGF. It is believed that the presence of one growth factor may compete for or
interfere with the response to other growth factors
(Adelman-Grill et al. , Eur. J. Cell. Biol. 51:322-326 (1990)). Thus, there is a need for a growth factor that will work in corneal tissue as opposed to skin or
connective tissue, and that can work to promote corneal wound healing even in the presence of other growth factors.

Additionally, re-innervation of the cornea is highly desirable but frequently is delayed during
healing. Failure of re-innervation can lead to loss of function, such as the failure of maintenance of the corneal epithelium. It is therefore desirable that a treatment that accelerates corneal wound healing also accelerates re-innervation.

SUMMARY

A method of accelerating and/or improving the quality of corneal wound healing in a mammal by the application of PDGF meets these needs. The method comprises:
(1) providing an ophthalmically compatible solution of platelet-derived growth factor; and
(2) applying the solution to the cornea of a mammal at the time of or subsequent to occurrence of a corneal wound in a quantity sufficient to accelerate clinically detectable healing, the healing being
accelerated through proliferation of epithelial cells and/or keratocytes of the cornea stimulated by
application of the platelet-derived growth factor to the cornea.

The platelet-derived growth factor can be selected from the group consisting of the AA isoform, the AB isoform, the BB isoform, and mixtures thereof.

-it-Preferably, the platelet-derived growth factor is the BB isoform.

In one preferred version, the platelet-derived growth factor is a recombinantly-derived refolded B-chain homodimer of 119 amino acids, having the amino acid sequence of S-L-G-S-L-T-I-A-E-P-A-M-I-A-E-C-K-T-R-T-E-V-F-E-I-S-R-R-L-I-D-R-T-N-A-N-F-L-V-W-P-P-C-V-E-V-Q-R-C-S-G-C-C-N-N-R-N-V-Q-C-R-P-T-Q-V-Q-L-R-P-V-Q-V-R-K-I-E-I-V-R-K-K-P-I-F-K-K-A-T-V-T-L-E-D-H-L-A-C-K-C-E-T-V-A-A-A-R-P-V-T-R-S-P-G-G-S-Q-E-Q-R.

The concentration of platelet-derived growth factor in the solution can be from about 10 μg/ml to about 1000 μg/ml. Preferably, the concentration is from about 50 μg/ml to about 500 μg/ml. Most preferably, the concentration is about 100 μg/ml.

The solution can be applied at least once or more to the cornea subsequent to occurrence of the corneal wound. Preferably, the solution is applied from once to three times, e.g., at about 2 hours, at about 8 hours, and at about 24 hours after occurrence of the wound. Alternatively, the solution can be applied to once or more to the cornea, at the time of occurrence of the corneal wound.

The wound can result from the effects of a surgical laser or be a consequence of diabetes.

Clinically detectable healing includes
improvement in the quality of corneal wound healing. The improvement in the quality of corneal wound healing can comprise a clinically detectable decrease in abnormal epithelial sloughing in recurrent corneal ulcers or a clinically detectable decrease in scar formation, or both.

Application of PDGF can also accelerate
clinically detectable re-innervation of the corneal epithelium after occurrence of a corneal wound that denervates at least a portion of the corneal epithelium. The PDGF is applied in a quantity sufficient to
accelerate clinically detectable re-innervation of the corneal epithelium. This represents one of the
unexpected results of PDGF treatment.

Another aspect of the present invention is a pharmaceutical composition for application to the cornea of a mammal for accelerating and/or improving the quality of corneal wound healing comprising:
(1) water;
(2) an ophthalmically compatible solution of platelet-derived growth factor comprising at least about ιo μg/ml of platelet-derived growth factor; and
(3) buffer to adjust the pH to within a range of from about 5 to about 8.
The composition can be in dosage unit form.

Yet another aspect of the present invention is a tablet for preparation of a pharmaceutical composition for application to the cornea of a mammal for
accelerating and/or improving the quality of corneal wound healing comprising:
(1) a quantity of platelet-derived growth factor sufficient to accelerate and/or improve the quality of wound healing; and
(2) non-toxic ophthalmically-acceptable excipients which are suitable for the manufacture of tablets .

BRIEF DESCRIPTION OF THE DRAWINGS

These and other features, aspects, and
advantages of the present invention will become better understood with reference to the following description, appended claims, and accompanying drawings where:

Figure 1 is a diagrammatic depiction of the mammalian cornea, showing the layers making up the cornea and the innervation of the epithelium;
Figure 2 is a graph showing the results of growth factor treatment, including various forms of PDGF and EGF, in promoting corneal reepithelialization, in which the percentage of the wound area remaining is plotted against time (PBS = phosphate buffered saline control (no growth factor) ) ;
Figure 3 is a bar graph depicting the results of Figure 2 at 71 hours following the initial surgery;
Figure 4 is a graph showing the results of treatment with the BB isoform of PDGF at 100 μg/ml and 10 μg/ml in promoting corneal reepithelialization, as in Figure 2;
Figure 5 is a graph showing the results of treatment with 10 μg/ml of various isoforms of PDGF or EGF in promoting corneal reepithelialization, as in
Figure 2;
Figure- 6 is a graph showing the results of treatment with various isoforms of PDGF and EGF in promoting healing after anterior keratectomy, in which the percentage of the wound area remaining is plotted against time;
Figure 7 is a similar graph depicting the results of treatment with the BB isoform of PDGF at 100 μg/ml in promoting healing after anterior keratectomy;
Figure 8 is a bar graph depicting the results of Figure 6 at 71 hours following the initial surgery;

Figure 9 is a bar graph depicting the results of PDGF treatment in increasing tensile strength in corneas;
Figure 10 is a bar graph depicting the results of PDGF treatment in increasing the breaking time of corneal tissue, another measure of the tensile strength of the cornea;
Figure 11 is a bar graph depicting the results of PDGF and EGF treatment in increasing the ability of corneal tissue to withstand stress and strain;
Figure 12A is a light photomicrograph of a section of control cornea nine days after surgery;
Figure 12B is a light photomicrograph of a section of cornea nine days after surgery that had been dosed three times after' the first 24 hours after surgery with 100 μg/ml of the BB isoform of PDGF;
Figure 13 is a bar graph depicting the results of treatment with various doses of PDGF in an in vitro gel contraction assay to determine the effects of PDGF on activating fibroblasts to cause collagen contraction; and

Figure 14 is a diagram of the DNA sequence used to express rPDGF B„9 in the Escherichia coli expression vector pCFM1156, as set forth in Example 1, and the resulting protein sequence of rPDGF Bπ9.

DESCRIPTION

We have discovered that platelet-derived growth factor (PDGF) , when applied to wounds in the mammalian cornea, can substantially accelerate healing of the wounds .

Natural human PDGF is comprised of two
polypeptide chains forming a di er . The two chains . are the A chain, composed of 124 amino acids, and the B chain, composed of 160 amino acids. Each chain has a cysteine residue; the chains are joined through disulfide bonding. The separate chains have been identified and sequenced (Waterfield et al. , Nature 304:35-39 (1983); Doolittle et al. , Science 221:275-277 (1983); Betsholtz et al.. Nature 320:695-699 (1986); Weich et al. , FEBS

Lett. 198:344-348 (1986); Hoppe et al. , FEBS Lett.
223:234-246 (1987)). The active growth factor can be assembled as any combination of the two chains, the AA or the BB homodimers or the AB heterodimer. These different combinations are referred to as isoforms.

The different isoforms bind' to different classes of PDGF receptor (Bowen-Pope et al. , J. Biol. Chem. 264:2502-2508, (1989)) and exert different effects on the cells on which they act (Sachinidis et al. , J. Biol. Chem. 265:10238-10243 (1990)). Each of the
receptors binds one and only one subunit, so one dimeric PDGF molecuie can bind two receptor molecules (Sachinidis et al. , . supra) .

The basic method of accelerating wound healing- comprises: (1) providing an ophthalmically compatible solution of platelet-derived growth factor (PDGF) ; and (2) applying the solution to the cornea of a mammal at the time of or. subsequent to occurrence of a corneal wound in a quantity sufficient to accelerate clinically detectable healing, the healing being accelerated through proliferation of epithelial cells and/or keratocytes of the cornea stimulated- by application of the platelet- derived growth factor to the cornea.

The application of PDGF to the cornea can also improve the quality of wound h aling. Due to the fact that PDGF induces epithelial secretion of basement membrane components, the quality of healing would be improved as measured by a decrease in abnormal epithelial sloughing in recurrent corneal ulcers after healing. In addition, corneal histology after incision shows an increase in the rate of collagen repair as indicated by the presence of large numbers of activated keratocytes around the incision, which could result in a decrease in resulting scar formation. The term "quality of wound healing" is therefore defined herein as either a
clinically detectable decrease in abnormal epithelial sloughing in recurrent corneal ulcers, a clinically detectable decrease in scar formation, or both.

Of particular importance is the fact that the application of PDGF can also accelerate re-innervation of the corneal epithelium, which is crucial to preserving the structural integrity and function of the cornea. The return of corneal innervation and sensation to the ocular surface after a wound is important to the maintenance of the corneal epithelium. Re-innervation of an area of the ocular surface after an epithelial wound is. thought to be linked sequentially to the repair of the epithelial defect. Therefore, corneal innervation would be restored faster to the cornea in which the epithelium healed faster.

A diagram of the cornea is shown in Figure 1, including the, nerves innervating the corneal epithelium.

If these nerves are severed as occurs whenever the epithelium is removed, the healing of the cornea can be greatly impaired.

I. THE OPHTHALMICALLY COMPATIBLE SOLUTION

A. The Platelet-Derived Growth Factor

The term "platelet-derived growth factor"
(PDGF) is used herein to mean any polypeptide or complex of polypeptideε having substantially the same
physiological activity as any of the isoforms of natural human PDGF, regardless of the origin of the polypeptide. The PDGF can be produced by any method practiced in the art, including, but not limited to: isolation from human or animal tissue; chemical synthesis, such as solid-phase peptide synthesis; and production by bacteria, yeast, or cultured cell lines that have been genetically engineered to produce PDGF. The term PDGF also includes, but is not limited to, the following variants: (1) variants of PDGF that differ in glycosylation from naturally-occurring PDGF; (2) chemically-modified derivatives of PDGF; (3) genetically engineered molecules having PDGF activity with one or more a ino-acid substitutions, additions, or deletions when their sequences are compared to natural-human PDGF, including muteins in which cysteine residues are converted into other amino acid residues, and
including molecules having different numbers of amino acid residues than natural human PDGF; and (4) fusion proteins in which the polypeptide responsible for PDGF is fused with another heterologous protein, such as a bacterial or yeast protein. In particular, the following recombinant molecules are included within the definition of PDGF used herein:
(1) a variant of the AA isoform in which each chain has 110 amino acid residues, the so-called
11endothelial form," produced by yeast using the
expression system previously used to express v-sis (Kelly et al., EMBO J. 4:3399-3405 (1985); Collins et al. , Nature 328:621-624 (1987); Tong et al.. Nature 328:619- 621 (1987));
(2) a recombinantly-derived refolded B-chain homodimer of 119 amino acids, produced by Escherichia coli as described in Examples 1 and 2 below and in PCT Application No. WO 91/08761 by Thomason, incorporated herein in its entirety by this reference; and
(3) a variant of the BB isoform in which each chain has 109 amino acid residues, produced by
genetically-engineered yeast (Kelly et al., supra.).

The PDGF can be of the AA isoform, the BB isoform, AB isoform, or mixtures thereof. Preferably, the PDGF is of the BB isoform.

A particularly preferred form of PDGF is a recombinantly-derived refolded B-chain homodimer of 119 amino acids having the sequence S-L-G-S-L-T-I-A-E-P-A-M-I-A-E-C-K-T-R-T-E-V-F-E-I-S-R-R-L-I-D-R-T-N-A-N-F-L-V-W-P-P-C-V-E-V-Q-R-C-S-G-C-C-N-N-R-N-V-Q-C-R-P-T-Q-V-Q-L-R- P-V-Q-V-R-K-I-E-I-V-R-K-K-P-I-F-K-K-A-T-V-T-L-E-D-H-L-A- C-K-C-E-T-V-A-A-A-R-P-V-T-R-S-P-G-G-S-Q-E-Q-R. This form of PDGF, referred to generally below as "rPDGF B119, " is produced by expression of v-sis that has undergone in vitro mutagenesis. The in vitro mutagenesis converts the amino acid residues at positions 6, 7, 101, 107, and 114 from the amino acids found in the v-sis protein to the amino acids found in the B human chain of human PDGF and inserts a stop codon at position 120. The resulting mutated gene is then inserted into an expression vector for Escherichia coli, pCFMH56, for expression of the rPDGF Bn9. The expressed PDGF is then refolded into a dimer using glutathione as blocking agent. Further details of the preparation of rPGDF B119 are given in Examples 1 an 2, below.

Genetic constructions to obtain the desired rPDGF Bπ9 can be prepared using a modification of any one of a number of methods for the recombinant production of

PDGF B known to those skilled in the art. For example, one can first modify the v-sis gene to obtain the human counterpart c-sis, or use the c-sis as a starting
material and then transfect the desired host cell
following placement of the stop codon at any of amino acid positions 111 through 160. The stop codon is
preferably placed in the c-sis or modified v-sis
precursor protein coding sequence by site-directed
mutagenesis of a pre-existing codon.

Alternatively, one can either synthesize the precursor protein coding sequence, or first cut back the c-sis gene or modified v-sis gene, at a appropriate restriction site near the carboxy terminus, and then rebuild the carboxy terminus of the precursor protein coding sequence to the desired end position (about 111 to about 160) , using preferred codons for particular vector ' and host cell systems being employed. Thee c-sis gene or modified v-sis gene can also be cut back at an
appropriate restriction site near the amino terminus, with the amino terminus being cut back to the desired starting position (preferably amino acid 1) , again using preferred codons for the selected vector and host cell systems. Regardless of whether naturally occurring or synthesized starting materials, or a combination thereof, are used, a stop codon must be placed after the desired carboxy terminal amino acid of the precursor protein coding sequence; i.e., at any one of amino acid positions at about 111 to 160.

In a preferred method for obtaining the
recombinant PDGF, the v-sis gene is modified to obtain the c-sis gene, after which, or concurrently therewith, a stop codon is placed at the desired location of the modified gene. The c-sis precursor protein coding sequence containing the stop codon is then inserted into a vector, which is used to transfect the desired
prokaryotic host cell.

More preferably, the precursor protein coding sequence used to obtain the recombinant PDGF is an analog of the c-sis gene. The c-sis analog precursor protein coding sequence may be constructed to contain preferred codons for expression in an E. coli host cell. The analog of the c-sis gene may be obtained by both site-directed mutagenesis and ligation of the c-sis with synthetic carboxy and amino termini following proteolytic cleavage of the existing termini at appropriate
proteolytic cleavage sites.

The v-sis gene provides an excellent starting material for obtaining a precursor protein coating sequence for obtaining recombinant PDGF. For example, in the region coding for amino acids 1-119 , there are only five amino acid differences between the protein
incorporated by the v-sis gene and the c-sis encoded PDGF 119 precursor protein. Two of these five amino acids in the v-sis gene can be altered by in vitro mutagenesis techniques to generate a DNA sequence coding for a protein in which the two amino acids are the same as the corresponding residues in the PDGF B119 precursor protein. A number of methods for in vitro mutagenesis of DNA can be utilized for introducing the desired changes at codons 101 and 107. Such methor.% are well-known to those skilled in the art. For .-cample, the method of Eckstein and co-workers (Taylor, ■", al.,, Nucl. Acids Res. 13:8764- 8785 (1985) ; Nakamaye & Eckstein, Nucl. Acids Res.
14:967-969 (1986) as described in the instrucrion booklet for the Amersham (Arlington Heights, Illinois) -li-"Oligonucleotide-Directed In Vitro Mutagenesis System" kit, is particularly useful in converting the isoleucine residue at amino acid 101 to a threonine residue and the alanine residue of amino acid 107 to a proline residue.

Following in vitro mutagenesis of amino acids 101 and 107, the altered v-sis DNA may then be cut back at the amino terminus with the restriction enzyme BgJ.II, which cuts at a position corresponding to amino acid 24. The upstream portion of the gene, including the first 24 amino acids, may be restored by ligation of the
downstream BgJ-II-cut mutagenized v-sis DNA with a
synthetic DNA fragment encoding; (1) an ATG translation initiation codon; (2) a serine residue at amino acid 1; and (3) the remainder of the first 24 amino acids of the c-sis encoded precursor protein. In this way, two of the other three variant amino acids, i.e., the serine residue at amino acid 6 and the valine residue of amino acid 7, are converted to the amino acids occurring in human PDGF B at these positions (threonine and isoleucine,
respectively) , with the upstream precursor amino acids encoded by v-sis being removed.

Cutting back from the carboxy terminus in a similar manner enables replacement of the carboxy
terminus with a synthetic fragment which simultaneously alters amino acid 114 and replaces amino acid 120 with a stop codon. Preferably, mutagenized v-sis DNA is cut with the restriction enzyme S al, which cuts at a
position corresponding to amino' acid 112. A synthetic DNA fragment coding for amino acids 112-119 of the PDGF B119 precursor protein, and a translation stop codon at position 120, may then be ligated to the Smal-cut
mutagenized v-sis DNA. The synthetic DNA also encodes a glycine residue, instead of a threonine residue, at amino acid 114 accompanying the conversion of the fifth variant amino acid to the corresponding amino acid in PDGF Bn9 precursor protein.

The final DNA construct of the precursor protein coding sequence calls for amino acids 1-119 of PDGF B plus an additional ethionine residue at the N terminus. This PDGF Bn9 gene may be ligated into an appropriate expression vector, such as pCFM1156, and then transformed or transfected into an appropriate host cell system, preferably a prokaryote such as an E. coli host cell, with the N-terminal methionine being removed in vivo following biosynthesis in the host cell. (It is possible that some E. coli strains will fail to remove the N-terminal methionine, thereby producing a
recombinant product containing an additional amino acid residue at the amino terminus.)

The preferred expression systems for the production of such recombinant PDGF B comprise
procaryotic cell culture systems as discussed above, preferably E. coli.

Genetic engineering methods for the cloning and expression of recombinant PDGF analogues are disclosed in U.S. Patent Applications Serial Nos. 454,794, filed
December 19, 1989, and 624,451, filed December 13, 1990, both of which are incorporated herein by this reference.

The rPDGF B analogues useful in the present invention may be isolated, refolded, and purified from the resulting host cell culture paste by any one of a number of methods known to those skilled in the art. A preferred method for refolding is described in U.S.
Patent Application Serial No. 451,485, which is
incorporated herein by this reference.

In accordance with the preferred refolding method, a disulfide blocking agent is employed to generate a monomeric mixed disulfide intermediate, such that the free sulfhydryls of the reduced, unfolded monomeric rPDGF become blocked. This prevents the sulfhydryl groups of reduced rPDGF from prematurely forming disulfide bonds during isolation and
purification. At the same time, this modification also renders the rPDGF intermediate soluble in aqueous solutions. As a consequence of this solubility, forces present in a selected aqueous environment can be used to coax the blocked monomeric intermediate into its
biologically active conformation, after, which unblocking may occur. Typically, unblocking results in the
formation of a dimeric form of PDGF, wherein the dimeric structure is now "locked" in place by the formation of the desired intrachain and interchain disulfide bonds. This dimeric form is a homodimer.

B. Concentration

The concentration of the PDGF in the
ophthalmically compatible solution can be from about 10 μg/ml to about 100 μg/ml. Preferably, the concentration is about from 50 μg/ml to about 500 μg/ml. Most
preferably, the concentration of PDGF is 100 μg/ml.

C. Other Ingredients of the Solution

The ophthalmically compatible solution
containing PDGF is preferably prepared in water. The solution can also contain a physiologically-acceptable surface active agent, either ionic or non-ionic, as well as conventional preservatives, anti-bacterial, or anti- fungal agents. For example, the solution can contain ethanol, glycerol, hydroxymethylcellulose, propylene glycol, polyethylene glycol, polyoxyethylenesorbitan, or vegetable oils. The conventional anti-bacterial, anti-fungal or preservative agents can include parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. All of these components are present in
concentrations that are ophthalmically acceptable to the eye. In addition, buffers may be used to maintain the composition at physiological pH or at slightly lower pH, i.e, within a pH range of from about 5 to about 8. The buffers can be conventional buffers such as borate, citrate, phosphate, bicarbonate, or Tris-HCl. The solutions can be made isotonic by the addition of
conventional osmotically active materials, such as sodium chloride and/or sugars. The solution can include other solubilizing agents including proteinaceous carriers or εolubilizers, such as albumin. The solutions can further guarantee emollients such as lanolin derivatives and/or other oils for convenience and ease in application, as well as for greater tolerability. The solution can further comprise antibiotics to control infection.

Another aspect of this application is
pharmaceutical compositions for application to the cornea of a mammal to accelerate and/or improve the quality of . wound healing. These compositions comprise either ophthalmically compatible solutions, as described above, or tablets containing the active ingredient or
ingredients, i.e., a quantity of platelet-derived growth factor sufficient to accelerate and/or improve the quality of wound healing, in a mixture with non-toxic ophthalmically-acceptable excipients which are suitable for the manufacture of tablets. The solutions can be prepared in dosage unit form. For the tablets, the excipients can be inert diluents, such as calcium
carbonate, sodium carbonate or bicarbonate, lactose, or calcium phosphate; or binding agents, such as starch, gelatin, or acacia; or lubricating agents such as
magnesium stearate, stearic acid, or talc, along with the

PDGF and other ingredients. These tablets can be
preformulated so that ophthalmically compatible solutions of PDGF suitable for application to the cornea can be prepared by dissolving the tablets in water, water mixed with ethanol, or other suitable liquids. The
concentration of PDGF in the tablets is such that when the tablets are dissolved to produce the solution, the concentration of PDGF in the solution is within the concentration limits disclosed above.

II. APPLICATION OF THE PDGF SOLUTION

In performing the method of accelerating corneal wound healing in the present invention, the solution is applied to the cornea of a mammal at the time of or subsequently to occurrence of a corneal wound in a quantity sufficient to accelerate clinically detectable healing. The healing is accelerated through
proliferation of epithelial cells and/or keratocytes of the cornea stimulated by application of the platelet- derived growth factor to the cornea. Preferably, the application of the ophthalmically compatible solution of PDGF also acts to accelerate re-innervation of the cornea. Typically, the solution is applied directly to the cornea at a quantity of about 10 to about 500 μl, preferably about 50 μl. The quantity of solution applied and the concentration of PDGF in the solution can readily be determined by one of ordinary skill in the art, such as by examination of the eye and photography with a slit lamp, as well as clinical observation of the patient. Multiple applications of the solution to the cornea can be made. Preferably, one or more applications are made; more preferably, from one to three applications are made. These applications can occur at about 2 hours, about 8 hourε, and at about 24 hours after occurrence of the wound or the surgical procedure.

The procedure of the present invention can be employed in cases of epithelial denudement in which the basement membrane is left intact, as well as after anterior keratectomy in which the basement membrane is removed. The method of the present invention can further be used in treatment of εtromal wounds such as incisions.

In particular, the procedure of the present invention can be employed to accelerate and/or improve the quality of wound healing of wounds resulting from trauma to the eye, as well as wounds resulting from surgical treatment, such as the application of surgical lasers. These treatments include cataract surgery, penetrating keratoplasty, glaucoma filtering surgery, retinal surgery such as retinal reattachment, and
refractive surgery such as radial keratotomy and laser corneal ablation. The procedure of the present invention can also be used to accelerate and/or improve the quality of wound healing of lesions arising from pathological non-traumatic causes, such as the non-healing corneal ulcers of. diabetes.

The presence or absence of the basement
membrane and the degree of damage or wounding of the cornea may require adjustment of the dose of PDGF. This can be accomplished according to the techniques described above, and is within the skill of persons of ordinary skill in the art. Similarly, clinically detectable re- innervation of the corneal epithelium can be accelerated subsequent to occurrence of a corneal wound that
denervates at least a portion of the corneal epithelium by treatment of the cornea with PDGF according to the techniques described above.

The invention is illustrated by the following examples. The examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any manner.

Example 1

Production of rPDGF Buo

A PDGF B119-encoding precursor protein coding
sequence, shown in Figure 14, was constructed using the v-sis gene as a starting material.

Conversion of Amino Acids 101 and 107

one μg of the plasmid pC60, a clone of the simian sarcoma virus retroviral gene (Wong-Staal et al. , Science, 213:226-228 (1981)), was digested with
restriction endonucleaseε Sail and Xbal, with the
resulting 1183 base pair fragment then being purified by electrophoretic separation in a low-melting temperature agarose gel, in accordance with the procedure described by Maniatis et al. , Molecular Cloning - A Laboratory Manual. Cold Spring Harbor Laboratory (1982) . The purified fragment was then excised from the gel. At the same time, 0.2 μg of M13mpl9 DNA was also digested with Sail and Xbal. with the large 7245 base pair band being similarly, excised from a low-melting gel. Both excised gel slices were melted at 65°C, and then cooled to 370C. All of the gel with the 7245 base pair M13mpl9 fragment and one-fourth of the gel with the 1183 base pair v-sis fragment were mixed and ligated according to Struhl,
Biotechnigues , 3:452-453 (1985). The ligated DNA was transformed into E_^ coli K12 strain PG1, and a clear plaque of the M13 vector was selected and grown in liquid culture. The presence of the 1183 base pair v-sis fragment in the M13mρl9 vector was confirmed by preparation of the double-stranded replicative form (RF) of the phage DNA and restriction map analysis. (Messing et al., Nucl. Acids Res. 9:309-321 (1981)).

The M13mpl9/v-sis phage thus obtained was grown in liquid culture, and the single-stranded DNA isolated (Messing et al., supra.) This DNA was used as a template for oligonucleotide-directed in vitro mutagenesis to convert the amino acids at residues 101 and 107 to the corresponding amino acids of human PDGF B. In the first stage of this process, the ATA codon coding for isoleucine 101 was converted to ACA, coding for threonine, and the GCT codon coding for alanine 107 was converted to CCT, coding for proline.

10 μg of the M13mpl9/v^-sis single-stranded

DNA was annealed with 8 pmol of a phosphorylated oligonucleotide having the sequence:
5 GGTCACAGG.CCGTGCAGCTGCCACTG.TCTCACAC3 '

The sequence is homologous to nucleotides 4283 to 4316 of the v-sis gene using the number system of Devare et al., Proc. Natl. Acad. Sci. USA, Vol. 79, pp. 3179-3182, 1982. The underlined bases of this oligonucleotide denote the change from the v-sis
sequence to the human PDGF B sequence. DNA synthesis was initiated on the mutant oligonucleotide, with the complete mutant strand being synthesized with the-Klenow fragment of E . coli DNA polymerase I using thionucleotide triphosphates, followed by ligation with T4 DNA ligase. Any remaining single-stranded template M13mpl9/v-sis DNA was removed by filtration on nitrocellulose filters. The non-mutant strand was nicked by incubation with restriction endonuclease
Hind III. The nicked non-mutant strand was then repolymerized with the deoxynucleotide triphosphates, using the mutant strand as a template. As a result, both

DNA strands in the final product contained the desired mutations. The DNA was transformed into E^ coli K12 strain TGI. Plaques were selected, grown in liquid culture, and single-stranded DNA isolated. The DNA was sequenced by the dideoxynucleoside triphosphate method of

Sanger et al. , Proc. Natl. Acad. Sci. USA, 74:5463-5467

(1977) , to confirm that the desired mutants had been obtained.

Conversion of Amino Acids 6 and 7

In the next step, the 5' portion of the mutated v-sis gene was replaced with a synthetic DNA fragment which changed amino acids 6 and 7 from the amino acids present at those positions in the v-sis protein to the amino acids in present in human PDGF B. This synthetic fragment also provided a translation-initiating ATG codon immediately preceding the codon for serine 1 of human PDGF B, as well as providing sequences for binding to E. coli ribosomes and a restriction site for ligation into the desired ∑L. coli expression vector as described below. The synthetic DNA fragment was located to the BJLII . site located at nucleotide 4061 of the v-sis gene in the numbering system of Devare et al. , supra.

Because a Bglll site that is present within the M13mpl9 vector would complicate and interfere with this step, the mutated v-sis gene was first moved to the commercially available plasmid vector pUC18 , which does not contain a BgJLII site. The M13mpl9 /v-sis mutant RF DNA was restricted with Sail and BamHl, and the resulting 1193 base pair fragment was isolated by electrophoresis using a low-meltinσ temperature agarose gel. This fragment was ligated to the plasmid pUC18 which had previously also been restricted with Sail and BamHl. The ligated DNA was transformed into commercially available

E. coli K12 strain DH5 and transformants were selected by growth in the presence of ampicillin. Colonies were selected and grown in liquid culture. Isolated plasmid

DNA was analyzed by restriction mapping for the presence of the v-sis insert.

The pUCJ8 /v-sis mutant DNA was restricted with Hindlll, which cuts in the polylinker of pUClδ just upstream of the mutated v-sis insert, and with BJLII, which cuts within the v-sis DNA at nucleotide 4061 in the numbering system of Devare et al., corresponding to amino acid number 24 of the mature protein product. The large 3565 base pair fragment resulting from this reaction was isolated by electrophoresis in a low-melting temperature agarose gel. This fragment was linked to a synthetic double-stranded DNA fragment with the following sequence.

5'AGCTTCTAGAAGGAGGAATAACATATGTCTCTGGGTTCGTTAACCAATTGCG- 3' AGATCTTCCTCCTTATTGTATACAGAGACCCAAGCAATTGGTAACGC- -GAACCGGCTATAGATTGCCGAGTGCAAGACACGAACCGAGGTGTTCGA 3' -CTTGGCCGATACTAACGGCTCACGTTCTGTGTTGGCTCCACAAGCTCTAG 5'

This synthetic DNA fragment contains a Hindlll
"sticky" end at its upstream (left) end and a BgJLII
"sticky" end at its downstream (right) end. In addition, an Xbal site (TCTAGA) is present within the synthetic DNA just downstream of the Hindlll "sticky" end, which allows subsequent restriction with Xbal for ligation into the Xbal site of an expression vector, as described below.

The ligated DNA was transformed into E___ coli K12 strain DH5, with transformants being selected by growth on ampicillin-containing medium. The plasmid DNAs from resulting colonies were analyzed by restriction .

-2k-endonuclease mapping for the presence of the synthetic

DNA fragment. At this point, the pUC18/v-sis
construction contained a mutated v-sis gene, with amino acid numbers 6, 7, 101, and 107 changed to the amino acids present in human PDGF, and its 5' end altered to begin translation with an ATG codon immediately preceding serine 1.

Conversion of Amino Acid 114 and Placement of Stop Codon at Amino Acid 120

In the next step, the codon for amino acid number 114 was changed from ACT to GGT, resulting in the substitution of glycine for threonine in the final protein product. In addition, codon number 120, in which GCC codes for alanine in v-sis, was changed to TAA, a translation termination codon. The resulting protein product of this construction ends with the arginine at residue 119. Both of these changes were accomplished in one step by insertion of a synthetic DNA fragment after a Smal site located within codon number 112.

The PUC18 /v-sis mutant DNA generated above was restricted with Smal, which cuts at nucleotide 4324 in the v-sis sequence in the numbering system of Devare et al. , supra, and with EcoRl, which cuts in the polylinker of pUC18 just downstream of the v-sis insert.

A small fragment (510 base pairs) between the Smal and EcoRl sites, coding for the C-terminal portion of the v-sis protein and a 3'-untranslated sequence, was removed by electrophoresis on a low-melting agaroεe gel. The large fragment (about 3530 base pairs) was ligated to a synthetic DNA fragment having the following sequence.
5'GGGGGGTTCCCAGGAGCAGCGATAAG 2 '
3'CCCCCCAAGGGTCCTCGTCGCTATTCTTAA 5' The GGT codon coding for the new glycine residue at position 114 and the TAA termination codon introduced at position 120 are underlined above. The synthetic DNA fragment contains a blunt end at its upεtream (left) end for ligating to the blunt end created by restriction of the v-sis mutant sequence with Smal, and an EcoRl "sticky" end at its downstream (right) and for ligating to the EcoRl end created by restriction of the pUC18 polylinker with EcoRl. The ligated DNA was transformed into Ej_ coli K12 strain DH5, with
transformants being selected by growth on ampicillin-containing medium. The plasmid DNAs from resulting colonies were analyzed for the presence . of the synthetic DNA fragment by restriction mapping.

Expresεion of PDGF BnP

In the final step, the completed mutated v-sis gene was removed from pUClδ and ligated into the expression vector pCFMH56. The plasmid pCFM1156 was prepared from a known plasmid, pCFM836. The preparation of plasmid PCFM836 is described in U.S. Patent No. 4,710,473; this patent is hereby incorporated by reference, including relevant portions in the specification, particularly Examples 1 through 7. To prepare pCFM1156 from pCFM836, the two endogenous Ndel restriction sites are cut, the exposed ends are filled with T4 poly erase, and the filled ends are blunt-end ligated.

The resulting plasmid is then digested with Clal and Kpnl and the excised DNA fragment is replaced with a DNA oligonucleotide of the following sequence:

Cla Kpnl
'CGATTTGATTCTAGAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGGTAC 3' ' TAAACTAAGATCTTCCTCCTTATTGTATACCAATTGCGCAACCTTAAGC 5'

5 The pCFM1156 vector contains a region for -insertion of foreign genes between an upstream Xbal site and one of a number of downstream restriction sites. In this case, the- downstream EcoRl site was utilized. The pUC18 /v-sis mutant DNA generated above was restricted with Xbal and

10 EcoRl . with the small 383 base pair fragment being
isolated by electrdphoresis on a low-melting temperature agarose gel. This fragment was ligated to pCFM1156 DNA which had also been restricted with Xbal and EcoRl. The ligated DNA was transformed into E_^ coli K12 strain FM5

15 (ATCC #67545) , with transformants being selected by
growth on kanamycin-containing medium. The plasmid DNAs from the resulting colonies were analyzed for the
presence of the inserted DNA fragment by restriction
mapping.
20
The final expression plasmid contained an
inserted DNA sequence which codes for a protein which
begins with an initiating methionine, followed by amino acids 1-119 of the human PDGF B chain sequence. The

25 procaryotic E^. coli host cells removed the N-terminal
methionine after synthesis, so that the final protein
produced corresponds to amino acids 1-119 of human PDGF
B.

30 Expression of the 119-amino acid PDGF protein was confirmed by growing bacterial cells containing the expression plasmid at 28-30°C until the desired optical density of the culture was reached, and then shifting the culture to growth at 42°C for several hours. Samples of

35 the cultured cells were taken prior to shifting to 42 °C, and at several time points thereafter. It was observed, upon SDS-polyacrylamide gel electrophoretic analysis of the bacterial proteins, that a prominent band of apparent molecular weight 14.6 kd was present in temperature-inducted bacterial cells but not present in cells prior to induction. This protein was present at an approximate level of 25-40 mg per liter of bacterial culture grown to an optical density at 600 nm of 1.0.

Confirmation of Primary Structure of E. coli rPDGF B1]D

In order to confirm the expected amino acid sequence and homogeneity of the E_^ coli-produced PDGF Bn9, the recombinant product from three different lots was purified from the inclusion bodies using known
techniques, as more fully described in Example 2, and then analyzed by analytical gel electrophoresis and by protein sequencing.

Amino acid sequence analysis was performed by a combination of sequence analysis of the intact rPDGF B, and sequence analysis of tryptic and SV8 protease
peptides obtained by digestion of reduced rPDGF B which had been derivatized with 4-vinylpyridine. The sequence determinations were performed using 470A and 477A
sequencers (Applied Biosystems, Inc., Foster City,
California.) This analysis confirmed that the rPDGF Bu9 product from the E^_ coli host cells exhibited the
expected sequence, which is shown in Figure 14.

The purified E coli rPDGF B119 from Example 1 was also subjected to SDS-PAGE analysis under both reduced (5% 2-mercaptoethanol with heating) and unreduced (without heating) conditions. Electrophoretic analysis was carried out on a 3 to 27% SDS polyacrylamide gel alongside molecular weight standards obtained from Bio Rad Laboratories (Richmond, California) . Protein on the gels was detected after staining with Coomassie Brilliant

Blue. At sample loads of 3 to 24 μg, the only bands detected were those attributable to the £____ coli rPDGF Bu9; a band was observed at approximately 30,000 mw
corresponding to a dimer. Upon reduction, a band was observed with an apparent molecular weight of
approximately 15 , 000, corresponding to a monomer.

Example 2
Refolding of rPDGF B Chain Homodimer from E. coli Inclusion Bodies Using Glutathione as Blocking Agent

Approximately 1.5 to 1.6 kg of harvested (i.e., concentrated) E_t- coli paste from Example 1, containing rPDGF Bn9, was removed for refolding. The X coli paste was suspended in 9 volumes (v/w) of 20 nM disodium ethylenediaminetetraacetic acid (EDTA) , with the
temperature being maintained at 4°C. The suspended cell paste was lysed using a Manton-Gaulin homogenizer at a pressure of 14,000 psi and a temperature of 12 °C. The lyεate was immediately centrifuged at 3,600 X C for 60 minutes at 4°C and the supernatant discarded, with the inclusion body rPDGF-containing pellet being saved..

The pellet was suspended in 14 volumes (v/w) of

8.5 M urea, 0.1 M glycine, pH 3.0, and stirred for 30 minutes. Meanwhile, SE-Sepharose® (Pharmacia, Uppsala, Sweden) chromatography resin was drained by placing the commercially available resin in a sintered glass funnel, allowing the resin to drain by gravity, washing the resin with deionized water, and allowing the resin to drain once again. With continued stirring of the resuspended pellet, 2.4 kg of the drained resin was added to the pellet suspension. Stirring was stopped after 30
minutes. The resin was allowed to settle and the
supernatant discarded. Five liters of 8.5 M urea, 0.1 M glycine, pH 3.5, was added to the settled resin. The mixture was stirred for an additional five minutes, with the resin again being allowed to settle, and the
supernatant being discarded.

Five liters of 8.5 M urea, 20 nM phosphoric acid, pH 3.0, were then added to then added to the resin. The resulting mixture was again stirred for five minutes, with the resin again being allowed to settle and the supernatant being discarded. A second 5-liter volume of 8.5 M urea, 20 nM phosphoric acid, pH 3.0 was added to the settled resin. This mixture, with stirring, was subjected to a vacuum equal to 25 inches of mercury for. 30 minutes. The vacuum was then broken and the mixture was made 5 nM in dithiothreitol (DTT) , with the pH- being adjusted to 7.7 with 10 M sodium hydroxide (NaOH) .

The vacuum was restored and the mixture stirred for 30 minutes. Still under vacuum, with, stirring discontinued, the resin was allowed to settle and 90% of the supernatant discarded. The resin was immediately • slurried with the residual liquid and poured' into a 25- cm-dia eter column (batch column) , a flow adapter ■ attached, and the resin packed at 100 cm/hour for 10 minutes with 8.5 M urea, 20 nM sodium phosphate (Na2HP04) , pH 7.7 that had been and was being sparged with N2 gas (Buffer A) . The flow adapter was lowered to the surface of the resin aNd the column was washed with additional buffer A.at a flow rate of 25 cm/hour until the effluent absorbance at 280 nm was constant.

The outlet of the batch column was then
connected to the inlet of a second 25 cm x 20 cm column (resolving column) packed with fresh SE-Sepharose®
(Pharmacia) and equilibrated with buffer A. The batch and resolving columns were then resolved at a flow late of 25 cm/hour with an 80-liter linear gradient from 100% buffer A to 100% buffer B (8.5 M urea, 20 nM Na2HP04, 0.4

M NaCl, pH 7.7) which had been and was being sparged with

N2 gas. The appropriate fractions were immediately pooled r and placed under vacuum as they came off the column. The yield was between 0.45 and 0.90 gem per liter of
fermentation broth.

The denatured rPDGF Bu9-containing solution was
° diluted, if necessary, to an absorbance of between 0.4 and 0.5 OD.. The monomeric protein solution was then made 0.1 M in oxidized glutathione and the pH adjusted to 8.0 with 10 M NaOH. The solution was again placed under vacuum and stirred for 18 to 24 hours. The vacuum was 5 broken and the pH of the now derivatized monomeric rPDGF mixed disulfide intermediate was lowered to 3.0 with HC1. The resultant solution was concentrated to 1/2 its initial volume, and then diafiltered first against four volumes of 8.5 M urea, 0.1 M acetic acid, and then o followed by four volumes o 0.1 M acetic acid using, an Amicon® YM 10 (Amicon Inc.', Danvers, Massachusetts) ultrafiltration membrane. The final protein
concentration was between 1.5 and 2.0 mg/mL (κ1%2i Bm ~ 0.46) with rPDGF-S-S-G purity >85%, and a yield of
5 between 0.45 and 0.90 gm per liter of fermentation broth.

Refolding was effected by dilution of the rPDGF-S-S-G solution to 0.1 mg/mL with 20 mM Tris.
Subsequently, l M cysteine in 0.1 M acetic acid was added 30 to this solution, to a final concentration of 1 mM, and the pH adjusted to 8.0 with NaOH. The solution was stirred for 16 hours in order to unblock the derivatized monomeric rPDGF-S-S-G intermediate and initiate formation of intrachain and interchain disulfide bonds of the
35 desired dimeric end product, and then made 0.1 M in acetic acid. The yield was 0.32 to 0.63 g per liter of fermentation broth.

The refolded dimeric rPDGF solution was loaded, at a flow rate of 100 cm/hr, onto a 11.3 x 5 cm column of controlled pore glass (CPG, pg-350-400 96 M2/g, 382 A mean diameter, Signal Chemical Company, St. Louis,
Missouri), equilibrated in either 0.5 M glycine, pH 3.5 (Buffer C) or 0.05 M glycine, 0.4 M NaCl, pH 3.5 (buffer D) . Following the loading of the rPDGF post-oxidation solution onto the column, the column was washed with the equilibration buffer at a flow rate of 40 cm/hour. The purified rPDGF Bn9 homodimer was then eluted from the column, again at a flow rate of 40 cm/hr, by the
application of a 5 liter gradient starting with either buffer C or D and finishing with either 2 M guanidinium chloride in buffer C or 8 M urea in buffer D. The appropriate fractions of pure rPDGF Bn9 homodimer were pooled. The yield was between 0.25 and 0.5 g per liter of fermentation broth.

Example 3

Corneal Reepithelialization

Example 3 evaluates the ability of a substance to enhance the rate of corneal epithelial mitosis and migration as a surface defect is closed. These results are indicative of the efficacy of PDGF when used in non- healing corneal ulcers or abrasions.

New Zealand Albino (NZA) rabbits were
anesthetized systemically using 6 mg/kg of ketamine and 30 mg/kg of xylazine administered by subcutaneous
injection. Topical ophthalmic anesthesia was also performed with one drop of proparacaine (Opthezic) . The entire corneal epithelium was gently removed using a corneal Gil knife. Care was taken to insure that the basement membrane was not compromised. Fifty microliters of sodium fluorescein was instilled into the eye to stain the defect, and the wound was photographed with a slit lamp equipped with a cobalt blue exciter filter. The rabbit eyes were dosed with 50 μl of PDGF at 100 μg/ml at 2 hours, 8 hours and 24 hours after surgery. The PDGF used was the rPDGF Bn9 prepared in Example 2, above. The wound was photographed at intervals up to 84 hours after surgery, and the photographs of the eyes were subjected to computer image analysis to determine the area of the wound to generate a "healing curve" that represents the percent of the wound area remaining. The smaller this percentage, the greater is the degree of healing that has occurred.

The results are shown in Figures 2 through 5. At 100 μg/ml PDGF, an increase in the rate of healing detectable by 24 hours and continuing until wound closure was seen. (Fig. 2 arid Fig. 3) . The BB homodimer of PDGF appeared somewhat more effective than the other two isoforms in this study. (Fig. 3) . At 10 μg/ml, the effect was variable, and some experiments showed
substantial wound healing activity of the BB isoform of PDGF (Fig. 4) , while other experiments showed little or no effect of any of the PDGF isoforms at that low
concentration (Fig. 5) . The conclusion from the
experimental results at low dosages (Figs. 4 and 5) is that the BB isoform of PDGF at 10 μg/ml had either no effect or an enhancement of the rate of corneal
epithelial wound healing. The results varied in
individual experiments. It may be possible to correlate these results with the level of inflammation present on the ocular surface after surgery. The rate of proteolysis and inflammation of the PDGF peptide would be increased in a more inflamed eye.

r Example 4

Healing After Anterior Keratectomy

The experiments of Example 4 evaluate the
0 ability of the epithelium to heal without the presence of a basement membrane. In the clinical situation this may be indicative of healing after a bacterial corneal ulcer where the ulcer itself has invaded the corneal stro a. Also, this type of healing occurs after clinical
5 keratectomy. The anterior keratectomy is a more severe test of corneal healing because the epithelial cells must migrate across the stromal collagen while forming a basement membrane and proliferating.

0 Rabbits were anesthetized as in Example 3. A

6.0 mm shielded corneal trephine was used to mark the corneal surface and outline an area bound to mid-corneal depth. Using a platformed forceps, the portion of the epithelium and anterior stroma within the marked area was 5 removed along a stromal lamellar boundary. Dosing and wound evaluation were performed using the same techniques as in the corneal reepithelialization experiments
(Example 3) . The PDGF used was the rPDGF B119 prepared in Example 2 , above
0
The results are shown in Figures 6, 7, and 8. ;_,- 100 μg/ml, all of the growth factor groups (AA, AB and B'i, isoforms of PDGF and EGF) healed faster than the control (0.1% bovine serum albumin in phosphate buff ted 5 saline, Figures 6 and 7) . The BB isoform of PDGF showed the most dramatic increase in healing both visually on examining the eyes as well as graphically as can be seen in the bar graph of the 71 hour time point (Fig. 8) .

Example 5

Tensile Strength Experiments

The tensile strength experiments of Example 5 evaluate the effects of substances on the healing of the corneal stroma. The stroma composes a central 89% of the corneal thickness and is made up of type I collagen lamellae with fibrils separated in a regular array by . less than 1/2 the wavelength of light. .These fibrils are surrounded by glycosaminoglycan ground substance. This is important to confer transparency to the cornea as well to provide the majority of corneal structural strength.

The clinical importance of these techniques is if they are indicative of healing after intra-ocular surgery

(i.e., cataract), while refractive surgery, as well as corneal trauma.

Rabbits were anesthetized as in Example 3. For the tensile strength tests, a 9.0 mm incision was placed at from 12:00 to 6:00 in the central corne . The
incision was closed with four interrupted 10.0 nylon sutures. The eye was dosed with 50 μl of test solution at 2 hours, 8 hours and 24 hours after therapy. The PDGF used in the test solution was the rPDGF B119 prepared in Example 2, above. At the end of the healing period, 21 days, the rabbit was sacrificed and the cornea was isolated. A 4.0 mm strip was cut from the central cornea perpendicular to the incision. The tissue strip was then clamped into an Instron materials testing machine and the force of "stress" required to pull the tissue apart was measured. The increase in force applied by the machine was ramped up using a computer program. Therefore, in the first study both the force required to pull the incision apart and the time it took to do this was recorded.

In the second study a comparison was made between PDGF, EGF, and control. In this study, the force required to pull the incision apart was expressed as a "stress sum" as a percent of control. The ability of the cornea to deform before the incision fails is called "strain sum" and is also expressed as a percentage of the control. The "strain sum" is thought to be indicative of the presence of glycosaminoglycans, the ground substance of the stroma.

The results of the tensile strength experiments are shown in Figures 9-11. Both studies show that there is an increase in corneal and incision strength for the PDGF-treated cornea versus the control. In the first study there was a 36% increase in the tensile strength required (Fig. 9) and a 50% increase in the breaking time (Fig. 10) .

In addition, the second experiment indicated that PDGF treatment resulted in a 32% greater wound strength than EGF treatment. The PDGF-treated cornea also exhibited a 30% greater ability to ..withstand strain than the EGF-treated cornea (Fig. 11) .

Light micrographs of corneas from these studies are shown in Figures 12A and 12B. Figure 12A is a light micrograph of a section of a control cornea, nine days after incision. The corneal epithelium has thickened and formed a plug into the incision. Few activated
keratocytes are seen in this section. This is indicative of an early stage of wound healing.

Figure 12B is a light micrograph of a section of a cornea nine days after surgery which was dosed three times over the first 24 hours after surgery with 100 μg/ml of the BB isoform of PDGF. The epithelial plug has been displaced to the surface and the incision- area is filled with large numbers of activated keratocytes, This is indicative of a much further advanced stage of wound healing, showing the effectiveness of PDGF in advancing the course of wound healing when applied shortly after surgery, by both accelerating the rate of healing and improving the quality of healing.

Example 6

Gel Contraction Assay

The gel contraction assay of Example 6 is an in vitro assay to determine the effects of a substance on activating fibroblasts to cause collagen contraction.. This type 'of interaction may be indicative of activity within the corneal stroma.

In the performance of this assay, a tissue culture well was coated on the bottom with agarose. A mixture of type 1 collagen and fibroblasts was placed on the agarose surface. This mixture was allowed to form a matrix. The medium on top of the matrix was supplemented with. the test substance (PDGF at from 0.01 to 100 mg/ml) . The PDGF used was the rPDGF B119 prepared in Example 2, above. At two time points (3 days and 6 days) , the retraction of the collagen matrix away from the wall of the 'well was measured by determination of the residual gel or matrix area.

The results are shown in Figure 13. There was a dose-response relationship between the dose of PDGF and the amount of concentration at days 3 and 6 , up to a dose of 10 mg/ml. At 100 mg/ml, the effect was slightly less than at 10 mg/ml, possibly indicating saturation of the receptors .

This assay indicates activation of fibroblasts to cause collagen contraction within the corneal stroma.

ADVANTAGES OF THE INVENTION

The method of accelerating corneal wound
healing according to the present invention is effective in accelerating clinically detectable healing through proliferation and activation of epithelial cells and/or keratocytes of the cornea. The method requires
relatively few components and is easy to perform. Most significantly, the method promotes re-innervation of the corneal epithelium, a critical factor in restoring
corneal function and structure. The method is effective in both healing of corneal surface defects in the
presence of a basement membrane and the healing of the corneal epithelium in the absence of a basement membrane, as well as promoting the healing of the corneal stroma after intra-o.cular surgery, penetrating keratoplasty, refractive surgery,' or corneal trauma. The method is also effective for treatment of non-traumatic
pathological lesions of the cornea, such as non-healing corneal ulcers caused by diabetes. The method is
compatible with other corneal or intra-ocular treatments used after surgery.

The examples cited herein demonstrate the effectiveness of PDGF in accelerating wound healing even though corneal epithelium in its normal state was not known to possess receptors specific for PDGF. This is an indication of unexpected results resulting from the use of PDGF to stimulate corneal wound healing.

Although the present invention has been
described in considerable detail with reference to certain preferred versions thereof, other versions are possible. Therefore the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained herein.