Processing

Please wait...

PATENTSCOPE will be unavailable a few hours for maintenance reason on Tuesday 25.01.2022 at 12:00 PM CET
Settings

Settings

Goto Application

Offices all Languages Stemming false Single Family Member true Include NPL false

Save query

A private query is only visible to you when you are logged-in and can not be used in RSS feeds

Query Tree

Refine Options

Offices
All
Specify the language of your search keywords
Stemming reduces inflected words to their stem or root form.
For example the words fishing, fished,fish, and fisher are reduced to the root word,fish,
so a search for fisher returns all the different variations
Returns only one member of a family of patents
Include Non-Patent literature in results

Full Query

IC:A61K39/12

Side-by-side view shortcuts

General
Go to Search input
CTRL + SHIFT +
Go to Results (selected record)
CTRL + SHIFT +
Go to Detail (selected tab)
CTRL + SHIFT +
Go to Next page
CTRL +
Go to Previous page
CTRL +
Results (First, do 'Go to Results')
Go to Next record / image
/
Go to Previous record / image
/
Scroll Up
Page Up
Scroll Down
Page Down
Scroll to Top
CTRL + Home
Scroll to Bottom
CTRL + End
Detail (First, do 'Go to Detail')
Go to Next tab
Go to Previous tab

Analysis

1.WO/2022/015702METHODS AND COMPOSITIONS FOR CRISPR/CAS9 GUIDE RNA EFFICIENCY AND SPECIFICITY AGAINST GENETICALLY DIVERSE HIV-1 ISOLATES
WO 20.01.2022
Int.Class A61K 39/21
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
21Retroviridae, e.g. equine infectious anemia virus
Appl.No PCT/US2021/041385 Applicant HOWELL, Alexandra, L. Inventor HOWELL, Alexandra, L.
Disclosed are guide RNAs (gRNAs) that specifically bind the 5' LTR human immunodeficiency virus -1 (HIV-1) sequence comprising TTGGATGGTGCTTCAAGTTA (SEQ ID NO: 1). Disclosed are gRNAs that specifically bind the 5' LTR HIV-1 sequence comprising CTACAAGGGACTTTCCGCTG (SEQ ID NO:2). Disclosed are gRNAs that specifically bind the 5' LTR HIV-1 sequence comprising TCTACAAGGGACTTTCCGCT (SEQ ID NO: 3). Disclosed are nucleic acid sequences comprising a nucleic acid sequence encoding one or more gRNAs, wherein said one or more gRNAs hybridize with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3. Disclosed are vectors comprising a nucleic acid sequence encoding one or more gRNAs, wherein the one or more gRNA hybridizes with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3. Disclosed are methods for inhibiting the function of a target HIV-1 DNA sequence in a cell or removing a target HIV-1 DNA sequence from a cellular genome comprising contacting a cell comprising a cellular genome and harboring a HIV-1 genome comprising a target HIV-1 DNA sequence integrated into the cellular genome with one or more gRNAs, or nucleic acids encoding said one or more gRNAs, and a Clustered Regularly Interspaced Short Palindromic Repeats-Associated (cas) protein, or nucleic acid sequence encoding a cas protein, wherein the one or more gRNAs uniquely hybridizes with the target HIV-1 DNA sequence, wherein the target HIV-1 DNA sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3; thereby inhibiting the function or presence of the target HIV-1 DNA sequence.
2.WO/2022/013781PEPTIDE EPITOPE VACCINES FOR COVID-19 AND METHOD OF DESIGNING, MAKING AND USING THE SAME
WO 20.01.2022
Int.Class A61K 39/215
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
215Coronaviridae, e.g. avian infectious bronchitis virus
Appl.No PCT/IB2021/056355 Applicant UNIVERSITY OF SOUTHERN CALIFORNIA Inventor BOGDAN, Paul
Computer systems and computer implemented methods are presented for designing and making vaccines to pathogens, particular viral pathogens. Vaccine compositions for COVID-19 are also disclosed, as well as method of using the same.
3.WO/2022/013405SARS-COV-2 IMMUNOGENIC COMPOSITIONS, VACCINES, AND METHODS
WO 20.01.2022
Int.Class A61K 39/12
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
Appl.No PCT/EP2021/069890 Applicant INSTITUT PASTEUR Inventor CHARNEAU, Pierre
A method of inducing a protective immune response against Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2), comprising administering to the upper respiratory tract of a subject an effective amount of an agent that induces a protective immune response against SARS-CoV-2. A dosage form for administration to the upper respiratory tract of a pseudotyped lentiviral vector particle encoding a Severe Acute Respiratory Syndrome beta-coronavirus 2 (SARS-CoV-2) spike (S) protein or a derivative or fragment thereof.
4.WO/2022/014620SARS-CoV-2 VACCINE
WO 20.01.2022
Int.Class A61K 39/215
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
215Coronaviridae, e.g. avian infectious bronchitis virus
Appl.No PCT/JP2021/026368 Applicant BIOCOMO INCORPORATION Inventor FUKUMURA Masayuki
A vaccine that comprises, as an active ingredient, a viral vector which comprises a sequence containing any of the following amino acid sequences (a) to (c) and in which an induced neutralizing antibody presents, on the viral particle envelope, a protein inhibiting the binding of SARS-CoV-2 receptor binding domain (RBD) to human angiotensin-converting enzyme 2 (hACE2). (a) An amino acid sequence represented by SEQ ID NO: 1; (b) an amino acid sequence represented by SEQ ID NO: 1 in which one to several amino acids have been deleted, inserted, substituted or added; and (c) an amino acid sequence having a sequence identity of 80% or more to the amino acid sequence represented by SEQ ID NO: 1.
5.WO/2022/014695PREVENTIVE AGENT FOR JAPANESE ENCEPHALITIS AND JAPANESE ENCEPHALITIS VACCINE
WO 20.01.2022
Int.Class A61K 39/12
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
Appl.No PCT/JP2021/026729 Applicant FUJIFILM CORPORATION Inventor OYAMADA Takayoshi
The present invention addresses the problem of providing a preventive agent for Japanese encephalitis and a Japanese encephalitis vaccine that are capable of giving humans adequate immunity even with a dose smaller than that for a subcutaneously-administered Japanese encephalitis vaccine or with fewer administrations as compared to the number of administrations of a subcutaneously-administered Japanese encephalitis vaccine. The present invention provides a preventive agent for Japanese encephalitis, which includes a microneedle array that comprises a sheet and a plurality of needles disposed on the top surface of said sheet, the needles being configured to either include or carry thereon inactivated Japanese encephalitis virus.
6.WO/2022/012604SUBUNIT VACCINE COMPOSITION FOR AFRICAN SWINE FEVER, AND PREPARATION THEREFOR AND USE THEREOF
WO 20.01.2022
Int.Class C07K 14/01
CCHEMISTRY; METALLURGY
07ORGANIC CHEMISTRY
KPEPTIDES
14Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
005from viruses
01DNA viruses
Appl.No PCT/CN2021/106375 Applicant NOVO BIOTECH CORP. Inventor ZHANG, Qiang
Disclosed are a subunit vaccine composition for African swine fever, and a preparation therefor and the use thereof, which fall within the technical field of animal vaccines and veterinary biological products. The vaccine comprises African swine fever outer envelope protein CD2V and African swine fever outer capsid protein p72 and a pharmaceutically acceptable adjuvant. The method for preparing the vaccine comprises the following steps: 1) preparing the African swine fever outer envelope protein CD2V and the African swine fever outer capsid protein p72; 2) mixing the African swine fever outer envelope protein CD2V with the African swine fever outer capsid protein p72 prepared in step 1), so as to prepare an antigen solution; and 3) emulsifying the antigen solution and ISA 201 VG at a volume ratio of 46:54.
7.WO/2022/013324POST-EXPOSURE VACCINATION AGAINST VIRAL RESPIRATORY INFECTIONS
WO 20.01.2022
Int.Class A61K 39/12
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
Appl.No PCT/EP2021/069673 Applicant RIBOXX GMBH Inventor TER MEULEN, Jan
The present invention relates to pharmaceutical compositions, in particular vaccine compositions, for preventing or at least reducing the severity of, respectively, viral respiratory infections through application of said composition to a human subject post-exposure or at least presumed post-exposure of said subject to a virus causing said viral respiratory infections or pre-exposure of said subject to said virus. More particularly, in specific embodiments, the invention provides pharmaceutical compositions as such comprising at least one antigenic component of the infectious virus and a TLR-3 agonist. The invention also relates to methods of treatment and/or prevention of said viral respiratory infections through administration of the composition to the human subject post exposure or at least presumed post-exposure of said subject to the infectious virus or pre-exposure of said subject to said virus.
8.WO/2022/013609SARS-COV-2 VACCINE COMPOSITIONS AND METHODS OF PREPARATION AND USE
WO 20.01.2022
Int.Class A61K 39/215
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
215Coronaviridae, e.g. avian infectious bronchitis virus
Appl.No PCT/IB2021/000464 Applicant IMMUNOVACCINE TECHNOLOGIES, INC. Inventor STANFORD, Marianne
The present application relates generally to compositions and methods for preventing COVID- 19, and in particular to vaccine compositions comprising at least one epitope on the spike protein of SARS-CoV-2 that can elicit production of antibodies, including neutralizing antibodies and antibodies that inhibit steps of viral infection (e.g., phagocytosis).
9.WO/2022/015124VACCINE COMPOSITION FOR PREVENTING SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 INFECTION
WO 20.01.2022
Int.Class A61K 39/215
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
39Medicinal preparations containing antigens or antibodies
12Viral antigens
215Coronaviridae, e.g. avian infectious bronchitis virus
Appl.No PCT/KR2021/009290 Applicant GENEONE LIFE SCIENCE, INC. Inventor PARK, Young Keun
The present invention relates to a vaccine composition for preventing severe acute respiratory syndrome coronavirus 2 infection. The vaccine composition for preventing severe acute respiratory syndrome coronavirus 2 infection, according to the present invention, comprises spike, ORF3a, or nucleocapsid as an antigen against SARS-CoV-2. The vaccine composition has a significant effect of inducing antibody immune responses and T-cell immune responses by a plurality of co-expressed antigens compared to those comprising one antigen, and thus can be variously used in the field of prevention of severe acute respiratory syndrome coronavirus 2 infection.
10.WO/2022/015514SYSTEMS AND METHODS TO ENHANCE RNA STABILITY AND TRANSLATION AND USES THEREOF
WO 20.01.2022
Int.Class C12N 7/00
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
7Viruses, e.g. bacteriophages; Compositions thereof; Preparation or purification thereof
Appl.No PCT/US2021/040028 Applicant THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY Inventor DAS, Rhiju
Embodiments herein describe systems and methods to enhance RNA translation and stability and uses thereof. Many embodiments generate RNA molecules possessing increased structure and/or reduced free energy over an initial sequence. Such RNA molecules can be used as therapeutics and/or vaccines.