Processing

Please wait...

Settings

Settings

Goto Application

1. WO2020227642 - COMPOSITIONS FOR SKIN AND WOUNDS AND METHODS OF USE THEREOF

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ EN ]

COMPOSITIONS FOR SKIN AND WOUNDS AND METHODS OF USE

THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority benefit of U.S. Provisional Application

No. 62/845,134, filed May 8, 2019, the content of which is incorporated by reference in its entirety herein.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 6, 2020, is named 45817-0054W01_SL.txt and is 720,012 bytes in size.

BACKGROUND

[0003] Wound healing is a complex, multicellular process resulting in epithelium restoration after injury. There are several stages of wound healing: inflammation, formation of granulation tissue, reepithelialization, matrix formation, and remodeling. Scar formation is a major part of wound healing. Scars are areas of fibrous tissue that form during the wound healing process in place of the normal skin that was present prior to the wound formation. A scar exhibits an altered extracellular matrix and has a reduced level of elastin fibers relative to normal skin. Nearly every wound results in some degree of scarring.

[0004] Wounds may be acute or chronic. Acute wounds are typically the result of an injury to the skin that occurs suddenly rather than over time (e.g., a surgical wound or a traumatic wound (e.g., a cut)). In normal subjects, acute wounds typically heal at predictable and expected rates according to the normal wound healing process. In contrast, chronic wounds are wounds that fail to progress through the phases of wound healing in an orderly and timely fashion (e.g., showing no significant progress towards healing in 30 days). Nonlimiting examples of chronic wounds include venous ulcers, diabetic foot ulcers, and pressure ulcers.

[0005] Wounds may be healed by primary intention, by secondary intention, or by tertiary intention. Wounds heal by primary intention when there is little tissue loss such that the wound edges are directly next to each other. Wounds healed by primary intention are also referred to as“closed wounds.” Wounds heal by secondary intention when the tissue loss at the wound is too great for the wound edges to be in close proximity with each other. Wounds healed by secondary intention are also referred to as“open wounds”. Open wounds may require skin grafts for healing to occur. Finally, wounds healed by tertiary intention are initially cleaned and debrided and then left open for several days before closure.

[0006] Nonhealing wounds present a major healthcare burden. Nonhealing wounds can result in prolonged hospital stays, diminished quality of life, increased risk of mortality, need for amputation, and increased likelihood of being discharged to a long-term care facility. For example, an estimated 71,000 patients with diabetic foot ulcers undergo limb or digit amputations each year in the US. Pressure ulcers have a high mortality rate and incur large costs for hospitals.

[0007] Numerous classes of polypeptides, such as, e.g., growth factors, cytokines, chemokines, protease inhibitors, and collagens play a central role in the wound healing process. Many of these polypeptides are also involved in scar formation and modulation of their activity has been shown to reduce scar formation. In addition, certain rare diseases involve skin pathology and some of these same polypeptides that promote wound healing may be lacking in some patients. For example, epidermolysis bullosa is a group of rare diseases that causes fragile, blistering skin, which may appear in response to injury, heat, rubbing, scratching, or adhesive tape. In some cases, blisters may even occur inside the body.

[0008] These classes of polypeptides may be deregulated in nonhealing acute and chronic wounds; however, it remains challenging to deliver agents to increase expression or activity of these polypeptides for potential therapeutic effects such as promoting or improving wound healing in a subject. Accordingly, there remains a need for compositions and methods for promoting or improving wound healing, reducing scar formation and treating certain rare diseases in a subject.

SUMMARY

[0009] The present disclosure provides methods for promoting and/or improving wound healing in a subject in need thereof comprising intradermal (e.g., using microneedles) or topical administration of messenger RNA (mRNA) therapeutics,

wherein the mRNA comprises an open reading frame (ORF) encoding a wound healing polypeptide (see, e.g., Table 1).

[0010] The present disclosure also provides methods for preventing and/or reducing scar formation at a wound in a subject in need thereof comprising intradermal (e.g., using microneedles) or topical administration of mRNA therapeutics, wherein the mRNA comprises an ORF encoding a wound healing polypeptide (see, e.g., Table 1).

[0011] The present disclosure also provides methods for reducing the visibility of a scar in a subject in need thereof comprising intradermal (e.g., using microneedles) or topical administration of mRNA therapeutics, wherein the mRNA comprises an ORF encoding a wound healing polypeptide (see, e.g., Table 1).

[0012] The present disclosure also provides methods for treating epidermolysis

bullosa in a subject in need thereof comprising intradermal (e.g., using microneedles) or topical administration of mRNA therapeutics, wherein the mRNA comprises an ORF encoding a wound healing polypeptide (see, e.g., Table 1) (e.g., collagen).

[0013] The present disclosure provides mRNA therapeutics for: (i) the promotion and/or improvement of wound healing; (ii) the prevention and/or reduction of scar formation at a wound; (iii) the reduction of the visibility of a scar; and/or (iv) the treatment of epidermolysis bullosa. The mRNA therapeutics of the invention are particularly well-suited for these applications as the technology provides for the intradermal (e.g., using microneedles) or topical delivery of mRNA encoding a wound healing polypeptide (see, e.g., Table 1) followed by de novo synthesis of functional wound healing polypeptide within target cells. The instant disclosure encompasses the incorporation of modified nucleotides within therapeutic mRNAs to (1) minimize unwanted immune activation (e.g., the innate immune response associated with the in vivo introduction of foreign nucleic acids) and (2) optimize the translation efficiency of mRNA to protein. Exemplary aspects of the disclosure feature a combination of nucleotide modification to reduce the innate immune response and sequence optimization, in particular, within the open reading frame (ORF) of therapeutic mRNAs encoding a wound healing polypeptide to enhance protein expression.

[0014] In further embodiments, the mRNA therapeutic technology of the instant disclosure also features intradermal (e.g., using microneedles) or topical delivery of mRNA encoding a wound healing polypeptide via a lipid nanoparticle (LNP) delivery system. The instant disclosure features ionizable lipid-based LNPs, which have improved properties when combined with mRNA encoding a wound healing

polypeptide and administered in vivo, for example, cellular uptake, intracellular transport and/or endosomal release or endosomal escape. The LNP formulations of the disclosure also demonstrate reduced immunogenicity associated with the in vivo intradermal (e.g., using microneedles) or topical administration of LNPs.

[0015] In certain aspects, the disclosure relates to compositions and delivery

formulations comprising a polynucleotide, e.g., a ribonucleic acid (RNA), e.g., a mRNA, encoding a wound healing polypeptide and methods for: (i) promoting and/or improving wound healing in a human subject in need thereof by intradermally (e.g., using microneedles) or topically administering the same; (ii) preventing and/or reducing scar formation at a wound in a human subject in need thereof by

intradermally (e.g., using microneedles) or topically administering the same; (iii) reducing the visibility of a scar in a human subject in need thereof by intradermally (e.g., using microneedles) or topically administering the same; and/or (iv) treating epidermolysis bullosa in a human subject in need thereof by intradermally (e.g., using microneedles) or topically administering the same.

[0016] The present disclosure provides a pharmaceutical composition comprising a lipid nanoparticle encapsulated mRNA that comprises an ORF encoding a wound healing polypeptide, wherein the composition is suitable for intradermal (e.g., using microneedles) or topical administration to a human subject in need of: (i) promotion and/or improvement of wound healing; (ii) prevention and/or reduction of scar formation at a wound; (iii) reduction of the visibility of a scar; and/or (iv) treatment of epidermolysis bullosa.

[0017] The present disclosure further provides a pharmaceutical composition

comprising: (a) a mRNA that comprises (i) an open reading frame (ORF) encoding a wound healing polypeptide, wherein the ORF comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof and (ii) an untranslated region (UTR) comprising a microRNA (miRNA) binding site; and (b) a delivery agent, wherein the pharmaceutical composition is suitable for intradermal (e.g., using microneedles) or topical administration to a human subject in need of: (i) promotion and/or improvement of wound healing; (ii) prevention and/or reduction of scar formation at a wound; (iii) reduction of the visibility of a scar; and/or (iv) treatment of epidermolysis bullosa.

[0018] In some embodiments, the wound healing polypeptide comprises the amino acid sequence set forth in any one of SEQ ID NOs: 9-38, 45-84, 197-211, and 213- 255 or a mature form thereof.

[0019] The pharmaceutical composition comprising the polynucleotide is

administered intradermally (e.g., using microneedles) or topically to the wound of the subject in need thereof. In some instances, the pharmaceutical composition is intradermally (e.g., using microneedles) or topically administered at a dose of 0.01 mg/kg to about 10 mg/kg of polynucleotide per subject body weight (mg/kg). In some instances, the pharmaceutical composition or polynucleotide is intradermally (e.g., using microneedles) or topically administered at a dose of 0.1 mg/kg to 2.0 mg/kg. In some instances, the pharmaceutical composition or polynucleotide is intradermally (e.g., using microneedles) or topically administered at a dose of 0.1 mg/kg to 1.5 mg/kg. In some instances, the pharmaceutical composition or polynucleotide is intradermally (e.g., using microneedles) or topically administered at a dose of 0.1 mg/kg to 1.0 mg/kg. In some instances, the pharmaceutical composition or polynucleotide is intradermally (e.g., using microneedles) or topically administered at a dose of 0.1 mg/kg to 0.5 mg/kg.

[0020] In one aspect, the disclosure features a method for promoting and/or

improving wound healing in a human subject in need thereof, comprising

intradermally or topically administering to a wound of the subject an effective amount of a pharmaceutical composition comprising a messenger RNA (mRNA) comprising an open reading frame (ORF) encoding a wound healing polypeptide.

[0021] In another aspect, the disclosure features a method for preventing and/or

reducing scar formation at a wound in a human subject in need thereof, comprising intradermally or topically administering to the wound of the subject an effective amount of a pharmaceutical composition comprising a mRNA comprising an ORF encoding a wound healing polypeptide.

[0022] In some embodiments of the foregoing methods, the wound is a surgical

wound, a bum, an abrasive wound, a skin biopsy site, a chronic wound, an injury, a graft wound, a diabetic wound, a diabetic ulcer, a pressure ulcer, a bed sore, or combinations thereof. In some instances, the injury is a traumatic injury wound. In some instances, the diabetic ulcer is a diabetic foot ulcer. In some embodiments, the the wound is a nonhealing wound. In some instances, the nonhealing wound is a diabetic foot ulcer, a pressure ulcer, or a chronic venous leg ulcer. In some instances, the wound is an open wound. In some instances, the wound is a closed wound. In some instances, the wound is an abraded wound.

[0023] In some embodiments of the foregoing methods, the subject has diabetes.

[0024] In another aspect, the disclosure features a method for reducing the visibility of a scar in a human subject in need thereof, comprising intradermally or topically administering to the scar of the subject an effective amount of a pharmaceutical composition comprising a mRNA comprising an ORF encoding a wound healing polypeptide.

[0025] In some embodiments of the foregoing methods, the wound healing

polypeptide is selected from the group consisting of a growth factor, a cytokine, a chemokine, a protease inhibitor, and a collagen. In some instances, the wound healing polypeptide is a growth factor selected from the group consisting of amphiregulin, connective tissue growth factor (CTGF), epidermal growth factor (EGF), epigen, epiregulin, fibroblast growth factor 2 (FGF2), fibroblast growth factor 7 (FGF7), fibroblast growth factor 10 (FGF10), heparin binding epidermal growth factor-like growth factor (HB-EGF), insulin-like growth factor 1 (IGF1), insulin-like growth factor 2 (IGF2), neuregulin 1 (NRG-1), placental growth factor (PLGF), a platelet derived growth factor (PDGF) (e g., PGDF-AA, PGDF-BB, or PGDF-AB), transforming growth factor a (TGF-a), transforming growth factor b (TGF-b), and vascular endothelial growth factor C (VEGF-C). In some instances, the wound healing polypeptide is a cytokine selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM-CSF), hepatocyte growth factor (HGF), interleukin 1 (IL-1), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), and tumor necrosis factor a (TNF-a). In some instances, the wound healing polypeptide is a chemokine selected from the group consisting of macrophage chemo-attractant protein (MCP-1) and stromal cell- derived factor 1 (SDF-1). In some instances, the wound healing polypeptide is protease inhibitor secretory leukocyte protease inhibitor (SLPI).

[0026] In another aspect, the disclosure features a method for treating epidermolysis bullosa in a human subject in need thereof, comprising intradermally or topically administering to a blister or skin erosion of the subject an effective amount of a pharmaceutical composition comprising a mRNA comprising an ORF encoding a collagen. In some instances, the collagen is selected from the group consisting of collagen type III, collagen type IV, collagen type V, collagen type VI, collagen type VII, collagen type VIII, collagen type XII, collagen type XIII, collagen type XIV, collagen type XVI, collagen type XVII, collagen type XVIII, collagen type XIX, and collagen type XXVIII.

[0027] In some embodiments of the foregoing methods, the wound healing

polypeptide comprises the amino acid sequence set forth in any one of SEQ ID NOs: 9-38, 45-84, 197-211, or 213-255. In some instances, the wound healing polypeptide does not comprise VEGF-A.

[0028] In some embodiments of the foregoing methods, the method comprises

topically administering to the subject the effective amount of the pharmaceutical composition. In some embodiments of the foregoing methods, the method comprises intradermally administering to the subject the effective amount of the pharmaceutical composition. In some instances, the intradermally administering is microneedle intradermal administering.

[0029] In some embodiments of the foregoing methods, the mRNA comprises a

microRNA (miR) binding site. In some instances, the microRNA is expressed in an immune cell of hematopoietic lineage or a cell that expresses TLR7 and/or TLR8 and secretes pro-inflammatory cytokines and/or chemokines. In some instances, the microRNA binding site is for a microRNA selected from the group consisting of miR- 126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27, miR-26a, or any combination thereof. In some instances, the microRNA binding site is for a microRNA selected from the group consisting of miR126-3p, miR-142-3p, miR-142-5p, miR-155, or any combination thereof. In some instances, the microRNA binding site is a miR-142-3p binding site. In some instances, the microRNA binding site is located in the 3' UTR of the mRNA.

[0030] In some embodiments of the foregoing methods, the mRNA comprises a 3'

UTR, said 3' UTR comprising a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a 3' UTR sequence of SEQ ID NO: l l l.

[0031] In some embodiments of the foregoing methods, the mRNA comprises a 5'

UTR, said 5' UTR comprising a nucleic acid sequence at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a 5' UTR sequence of SEQ ID NO:3.

[0032] In some embodiments of the foregoing methods, the mRNA comprises a 5' terminal cap. In some instances, the 5' terminal cap comprises a CapO, Capl, ARC A, inosine, Nl-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methylG cap, or an analog thereof.

[0033] In some embodiments of the foregoing methods, the mRNA comprises a poly- A region. In some instances, the poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length. In some instances, the poly-A region has about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides in length.

[0034] In some embodiments of the foregoing methods, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some instances, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (y), N1 methylpseudouracil (hi ΐ y). 1- ethylpseudouracil, 2-thiouracil (s2U), 4’-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof. In some instances, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are chemically modified to 5-methoxyuracil.

[0035] In some embodiments of the foregoing methods, the pharmaceutical

composition further comprises a delivery agent. In some instances, the delivery agent comprises a lipid nanoparticle. In some instances, the lipid nanoparticle comprises:

(a) (i) Compound II, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (b) (i) Compound VI, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (c) (i)

Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG-DMG or

Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG-DMG or Compound I; (e) (i) Compound II, (ii) Cholesterol, and (iii) Compound I; or (f) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I.

BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG. 1: Study timeline for the assessment of wound healing following

intradermal injection of a wound healing polypeptide, modified VEGF-A RNA, in mouse.

[0037] FIG. 2: Effect of intradermal administration (injection) of a wound healing polypeptide, modified VEGF-A RNA, formulated with MC3 (mRNA VEGF 3 pg MC3), a non-translatable VEGF-A RNA formulated with MC3 (mRNA VEGF NT (3 pg) MC3), and a saline/ citrate composition on wound healing.

[0038] FIG. 3: Study timeline for the assessment of wound healing following topical administration of a wound healing polypeptide, modified VEGF-A RNA, in mouse.

[0039] FIG. 4: Effect of topical administration of a wound healing polypeptide, modified VEGF-A RNA, formulated with MC3 (mRNA VEGF (3 pg) MC3), and a saline/citrate composition on wound healing.

[0040] FIG. 5A: Expression of a wound healing polypeptide, human VEGF-A

(hVEGF-A) protein, in pig tissue 5-6 hours after topical administration of a modified VEGF-A RNA formulated with Compound II, topical administration of modified VEGF-A RNA formulated in saline/citrate, topical administration of a modified VEGF-A RNA formulated with MC3, and intradermal (single injection)

administration of modified VEGF-A formulated with MC3.

[0041] FIG. 5B: Picture of a wound on pig skin, with drawn circles indicating sites of topical administration.

DETAILED DESCRIPTION

[0042] The present disclosure provides mRNA therapeutics for the promotion and/or improvement of wound healing in a subject in need thereof. In particular, the present disclosure provides a method for promoting and/or improving wound healing in a subject in need thereof, comprising contacting a wound with a pharmaceutical composition or formulation comprising an mRNA comprising an ORF encoding a wound healing polypeptide or functional portion thereof, e.g., by contacting the skin, e.g., intradermally (e.g., using microneedles) or topically with the composition or formulation.

[0043] The present disclosure also provides mRNA therapeutics for the prevention and/or reduction in scar formation at a wound in a subject in need thereof. In particular, the present disclosure provides a method for preventing and/or reducing scar formation at a wound in a subject in need thereof, comprising intradermally (e.g., using microneedles) or topically administering to the subject a pharmaceutical composition comprising an mRNA comprising an ORF encoding a wound healing polypeptide.

[0044] The present disclosure also provides mRNA therapeutics for reducing the visibility of a scar in a subject in need thereof. In particular, the present disclosure provides a method for reducing the visibility of a scar in a subject in need thereof, comprising intradermally (e.g., using microneedles) or topically administering to the subject a pharmaceutical composition comprising an mRNA comprising an ORF encoding a wound healing polypeptide.

[0045] The present disclosure also provides mRNA therapeutics for treating

epidermolysis bullosa in a subject in need thereof. In particular, the present disclosure provides a method for treating epidermolysis bullosa in a subject in need thereof, comprising intradermally (e.g., using microneedles) or topically

administering to the subject a pharmaceutical composition comprising an mRNA comprising an ORF encoding a wound healing polypeptide (e.g., collagen).

[0046] Wound healing is a complex, multicellular process resulting in epithelium restoration after injury. There are several stages of wound healing: inflammation, formation of granulation tissue, reepithelialization, matrix formation, and remodeling. Scar formation is a major part of wound healing. Scars are areas of fibrous tissue that form during the wound healing process in place of the normal skin that was present prior to the wound formation. A scar exhibits an altered extracellular matrix and has a reduced level of elastin fibers relative to normal skin. Nearly every wound results in some degree of scarring.

[0047] Wounds may be acute or chronic. Acute wounds are typically the result of an injury to the skin that occurs suddenly rather than over time (e.g., a surgical wound or a traumatic wound (e.g., a cut)). Acute wounds typically heal at predictable and expected rates according to the normal wound healing process. In contrast, chronic wounds are wounds that fail to progress through the phases of wound healing in an orderly and timely fashion (e.g., showing no significant progress towards healing in 30 days). Nonlimiting examples of chronic wounds include venous ulcers, diabetic foot ulcers, and pressure ulcers. Numerous classes of polypeptides are involved in promoting wound healing, such as, e.g., growth factors (e.g., amphiregulin, connective tissue growth factor (CTGF), epidermal growth factor (EGF), epigen, epiregulin, fibroblast growth factor 2 (FGF2), fibroblast growth factor 7 (FGF7), fibroblast growth factor 10 (FGF10), heparin binding epidermal growth factor-like growth factor (HB-EGF), insulin-like growth factor 1 (IGF1), insulin-like growth factor 2 (IGF2), neuregulin 1 (NRG-1), placental growth factor (PLGF), a platelet

derived growth factor (PDGF) (e g., PGDF-AA, PGDF-BB, or PGDF-AB), transforming growth factor a (TGF-a), transforming growth factor b (TGF-b), and vascular endothelial growth factor C (VEGF-C)), cytokines (e.g., granulocyte colony- stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM- CSF), hepatocyte growth factor (HGF), interleukin 1 (IL-1), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), and tumor necrosis factor a (TNF-a)), chemokines (e.g., macrophage chemo-attractant protein (MCP-1) and stromal cell- derived factor 1 (SDF-1)), protease inhibitors (e.g., secretory leukocyte protease inhibitor (SLPI)), and collagens (e.g., collagen type I, collagen type III, collagen type IV, collagen type V, collagen type VI, collagen type VII, collagen type VIII, collagen type XII, collagen type XIII, collagen type XIV, collagen type XVI, collagen type XVII, collagen type XVIII, collagen type XIX, or collagen type XXVIII). See Table 1 below for exemplary polypeptides involved in promoting wound healing (i.e., wound healing polypeptides). Deregulation of these factors may be observed in nonhealing acute and chronic wounds.

[0048] mRNA therapeutics are particularly well-suited for (i) the promotion and/or improvement of wound healing, (ii) prevention and/or reduction of scar formation at a wound, (iii) reduction of the visibility of a scar, and (iv) treatment of epidermolysis bullosa as the technology provides for the intradermal (e.g., using microneedles) or topical, intracellular delivery of mRNA encoding a wound healing polypeptide followed by de novo synthesis of functional wound healing protein within target cells. Surprisingly, after local delivery of mRNA to the target cells of the skin, the desired wound healing protein is expressed by the cells’ own translational machinery, and hence, fully functional wound healing protein replaces the diminished, defective, or missing protein.

[0049] One challenge associated with delivering nucleic acid-based therapeutics

(e.g., mRNA therapeutics) in vivo stems from the innate immune response, which can occur when the body’s immune system encounters foreign nucleic acids. Foreign mRNAs can activate the immune system via recognition through toll-like receptors (TLRs), in particular TLR7/8, which is activated by single-stranded RNA (ssRNA). In nonimmune cells, the recognition of foreign mRNA can occur through the retinoic acid-inducible gene I (RIG-I). Immune recognition of foreign mRNAs can result in unwanted cytokine effects including interleukin- 1b (IL-Ib) production, tumor necrosis factor-a (TNF-a) distribution and a strong type I interferon (type I IFN)

response. This disclosure features the incorporation of different modified nucleotides within therapeutic mRNAs to minimize the immune activation and optimize the translation efficiency of mRNA to protein. Particular aspects feature a combination of nucleotide modification to reduce the innate immune response and sequence optimization, in particular, within the open reading frame (ORF) of therapeutic mRNAs encoding a wound healing polypeptide to enhance protein expression.

[0050] Certain embodiments of the mRNA therapeutic technology of the instant disclosure also feature intradermal (e.g., using microneedles) or topical delivery of mRNA encoding a wound healing polypeptide via a lipid nanoparticle (LNP) delivery system. Lipid nanoparticles (LNPs) are an ideal platform for the safe and effective intradermal (e.g., using microneedles) or topical delivery of mRNAs to target cells. LNPs have the unique ability to intradermally (e.g., using microneedles) or topically deliver nucleic acids by a mechanism involving cellular uptake, intracellular transport and endosomal release or endosomal escape. The instant invention features ionizable lipid-based LNPs combined with mRNA encoding a wound healing polypeptide which have improved properties when administered in vivo. Without being bound in theory, it is believed that the ionizable lipid-based LNP formulations of the invention have improved properties, for example, cellular uptake, intracellular transport and/or endosomal release or endosomal escape.

1. Wound Healing and Wound Healing Polypeptides

[0051] Wound healing is a complex, multicellular process resulting in epithelium restoration after injury. Wounds may be acute or chronic. Acute wounds are typically the result of an injury to the skin that occurs suddenly rather than over time (e.g., a surgical wound or a traumatic wound (e.g., a cut or scrape)). Acute wounds typically heal at predictable and expected rates according to the normal wound healing process. In contrast, chronic wounds are wounds that fail to progress through the phases of wound healing in an orderly and timely fashion (e.g., showing no significant progress towards healing in 30 days). Nonlimiting examples of chronic wounds include venous ulcers, diabetic foot ulcers, and pressure ulcers. Nonhealing wounds can lead to significant morbidities (e.g., necessity of amputation) and, in serious cases, death.

[0052] There are several stages of wound healing: inflammation, formation of

granulation tissue, reepithelialization, matrix formation, and remodeling. Scar

formation is a major part of wound healing. Scars are areas of fibrous tissue that form during the wound healing process in place of the normal skin that was present prior to the wound formation. A scar exhibits an altered extracellular matrix and has a reduced level of elastin fibers relative to normal skin. Nearly every wound results in some degree of scarring.

[0053] Numerous classes of polypeptides, such as, e.g., growth factors, cytokines, chemokines, protease inhibitors, and collagens play a central role in the wound healing process, including scar formation. The wild type canonical protein sequences corresponding to various wound healing polypeptides (and their various isoforms) are described in Table 1 below. These polypeptides may be deregulated (e.g., have reduced expression) in wounds, e.g., nonhealing acute and chronic wounds.

[0054] In certain embodiments, a wound healing polypeptide of a composition or method described herein is a growth factor wound healing polypeptide. Nonlimiting examples of growth factor wound healing polypeptides include amphiregulin, connective tissue growth factor (CTGF), epidermal growth factor (EGF), epigen, epiregulin, fibroblast growth factor 2 (FGF2), fibroblast growth factor 7 (FGF7), fibroblast growth factor 10 (FGF10), heparin binding epidermal growth factor-like growth factor (HB-EGF), insulin-like growth factor 1 (IGF1), insulin-like growth factor 2 (IGF2), neuregulin 1 (NRG-1), placental growth factor (PLGF), a platelet derived growth factor (PDGF) (e.g., PGDF-AA, PGDF-BB, or PGDF-AB), transforming growth factor a (TGF-a), transforming growth factor b (TGF-b), and vascular endothelial growth factor C (VEGF-C). In certain embodiments, the growth factor wound healing polypeptide is a member of the EGF family of proteins.

Nonlimiting examples of wound healing EGF family proteins include amphiregulin, EGF, epigen, epiregulin, HB-EGF, and NRG-1. In certain embodiments, the growth factor wound healing polypeptide is a member of the FGF family of proteins.

Nonlimiting examples of wound healing FGF family proteins include FGF2, FGF7, and FGF10. In certain embodiments, the growth factor wound healing polypeptide is a member of the TGF family of proteins. Nonlimiting examples of wound healing TGF family proteins include TGF-a and TGF-b. In certain embodiments, the growth factor wound healing polypeptide is a member of the VEGF family of proteins. Nonlimiting examples of wound healing VEGF family proteins include VEGF-C and PLGF. In certain embodiments, the growth factor wound healing polypeptide is a PDGF, which is a hetero- (PDGF-AB) or homo- (PDGF-AA or PDGF-BB) dimeric

protein. Nonlimiting examples of wound healing PGDF family proteins include PDGF-AA, PDGF-BB, and PDGF-AB.

[0055] In certain embodiments, a wound healing polypeptide of a composition or method described herein is a cytokine wound healing polypeptide. Nonlimiting examples of cytokine wound healing polypeptides include granulocyte colony- stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM- CSF), hepatocyte growth factor (HGF), interleukin 1 (IL-1), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), and tumor necrosis factor a (TNF-a). In certain embodiments, the cytokine wound healing polypeptide is a member of the interleukin family of proteins. Nonlimiting examples of wound healing interleukin family proteins include IL-1, IL-6, IL-8, and IL-10.

[0056] In certain embodiments, a wound healing polypeptide of a composition or method described herein is a chemokine wound healing polypeptide. Nonlimiting examples of chemokine wound healing polypeptides include macrophage chemo attractant protein (MCP-1) and stromal cell-derived factor 1 (SDF-1).

[0057] In certain embodiments, a wound healing polypeptide of a composition or method described herein is a protease inhibitor wound healing polypeptide. A nonlimiting example of a protease inhibitor wound healing polypeptide is secretory leukocyte protease inhibitor (SLPI).

[0058] In certain embodiments, a wound healing polypeptide of a composition or method described herein is a collagen wound healing polypeptide. Nonlimiting examples of collagen wound healing polypeptides include collagen type I, collagen type III, collagen type IV, collagen type V, collagen type VI, collagen type VII, collagen type VIII, collagen type XII, collagen type XIII, collagen type XIV, collagen type XVI, collagen type XVII, collagen type XVIII, collagen type XIX, and collagen type XXVIII.

[0059] Table 1. Exemplary wound healing polypeptides




























[0060] The compositions comprising a wound healing polypeptide(s) described herein and the methods of intradermal (e.g., using microneedles) or topical administration of the compositions described herein are useful in promoting and/or increasing wound healing in a subject in need thereof.

[0061] The compositions comprising a wound healing polypeptide(s) described herein and the methods of intradermal (e.g., using microneedles) or topical administration of the compositions described herein are also useful in preventing and/or reducing scar formation at a wound in a subject in need thereof.

[0062] The wound treated in accordance with a composition comprising a wound healing polypeptide(s) described herein and/or the methods of intradermal (e.g., using microneedles) or topical administration of the compositions described herein may be any type of wound. In certain embodiments, the wound is a wound healed by primary intention. In certain embodiments, the wound is an open wound. In certain embodiments, the wound is a wound healed by secondary intention. In certain embodiments, the wound is a closed wound. In certain embodiments, the wound is a wound healed by tertiary intention. In certain embodiments, the wound is an abrasive wound, a bed sore, a bum, a chronic wound, a diabetic ulcer (e.g., a diabetic foot ulcer), a diabetic wound, an injury, a graft wound, a pressure ulcer, a skin biopsy site, a surgical wound, a venous ulcer, or combinations thereof. In certain embodiments, the wound is an acute wound. In certain embodiments, the wound is a chronic wound. In certain embodiments, the wound is a diabetic ulcer (e.g., a diabetic foot ulcer). In certain embodiments, the wound is a venous ulcer. In certain embodiments, the wound is a pressure ulcer. In certain embodiments, the wound is abraded prior to intradermal (e.g., using microneedles) or topical administration of a composition described herein. In certain embodiments, the subject intradermally (e.g., using microneedles) or topically administered a composition described herein has diabetes.

[0063] The compositions comprising a wound healing polypeptide(s) described herein and the methods of intradermal (e.g., using microneedles) or topical administration of the compositions described herein are also useful in reducing the visibility of a scar in a subject in need thereof. In certain embodiments, the scar is a scar selected from the group consisting of an atrophic scar, a depressed scar, a fineline scar, a

hyperpigmented scar, a hypopigmented scar, a hypertrophic scar, an ice-pick scar, a keloid scar, a scar contracture, a spread scar, a widespread scar, or any other type of scar. See, e.g., Bayat et al., 2003, BMJ 326:88-92 for nonlimiting examples of types of scars.

[0064] The compositions comprising a wound healing polypeptide(s) described herein and the methods of intradermal (e.g., using microneedles) or topical administration of the compositions described herein are also useful in treating epidermolysis bullosa. In certain embodiments, the wound healing polypeptide is a collagen (see, e.g., Table 1).

[0065] In certain aspects, the disclosure provides a polynucleotide (e.g., a RNA, e.g., a mRNA) comprising a nucleotide sequence (e.g., an open reading frame (ORF)) encoding a wound healing polypeptide. In some embodiments, the wound healing polypeptide of the invention is a wild type full length human growth factor protein (e.g., amphiregulin, CTGF, EGF, epigen, epiregulin, FGF2, FGF7, FGF10, HB-EGF,

IGF1, IGF2, NRG-1, PLGF, a PDGF (e g., PGDF-AA, PGDF-BB, or PGDF-AB), TGF-a, TGF-b, or VEGF-C) (see Table 1). In some embodiments, the wild type full length human growth factor wound healing polypeptide is a member of the EGF family of proteins (e.g., amphiregulin, EGF, epigen, epiregulin, HB-EGF, or NRG-1) (see Table 1). In some embodiments, the wild type full length human growth factor wound healing polypeptide is a member of the FGF family of proteins (e.g., FGF2, FGF7, or FGF10) (see Table 1). In some embodiments, the wild type full length human growth factor wound healing polypeptide is a member of the TGF family of proteins (e.g., TGF-a or TGF-b) (see Table 1). In some embodiments, the wild type full length human growth factor wound healing polypeptide is a member of the VEGF family of proteins (e.g., VEGF-C or PLGF) (see Table 1). In some embodiments, the wild type full length human growth factor wound healing polypeptide is a PDGF (e.g., PDGF-AA, PDGF-BB, or PDGF-AB) (see Table 1). In some embodiments, the wound healing polypeptide of the invention is a wild type full length human cytokine protein (e.g., G-CSF, GM-CSF, HGF, IL-1, IL-6, IL-8, IL-10, and TNF-a) (see Table 1). In some embodiments, the wild type full length human cytokine wound healing polypeptide is a member of the interleukin family of proteins (e.g., IL-1, IL-6, IL-8, or IL-10) (see Table 1). In some embodiments, the wound healing polypeptide of the invention is a wild type full length human chemokine protein (e.g., MCP-1 or SDF-1) (see Table 1). In some embodiments, the wound healing polypeptide of the invention is a wild type full length human protease inhibitor protein (e.g., SLPI) (see Table 1).

In some embodiments, the wound healing polypeptide of the invention is a wild type full length human collagen protein (e.g., collagen type I, collagen type III, collagen type IV, collagen type V, collagen type VI, collagen type VII, collagen type VIII, collagen type XII, collagen type XIII, collagen type XIV, collagen type XVI, collagen type XVII, collagen type XVIII, collagen type XIX, or collagen type XXVIII) (see Table 1). In some embodiments, the wound healing polypeptide of the invention is a variant, a peptide or a polypeptide containing a substitution, and insertion and/or an addition, a deletion and/or a covalent modification with respect to the wild-type wound healing polypeptide sequence. In some embodiments, sequence tags or amino acids, can be added to the sequences encoded by the polynucleotides of the invention (e.g., at the N-terminal or C-terminal ends), e.g., for localization. In some

embodiments, amino acid residues located at the carboxy, amino terminal, or internal regions of a polypeptide of the invention can optionally be deleted providing for fragments.

[0066] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a nucleotide sequence (e.g., an ORF) of the invention encodes a substitutional variant of a human wound healing polypeptide sequence, which can comprise one, two, three or more than three substitutions. In some embodiments, the substitutional variant can comprise one or more conservative amino acids substitutions. In other embodiments, the variant is an insertional variant. In other embodiments, the variant is a deletional variant.

[0067] Wound healing protein fragments, functional protein domains, variants, and homologous proteins (orthologs) are also within the scope of the wound healing polypeptides of the disclosure. Nonlimiting examples of wound healing polypeptides encoded by the polynucleotides of the invention are described in Table 1.

2. Polynucleotides and Open Reading Frames (ORFs)

[0068] The instant invention features mRNAs for use in: (i) promoting and/or

improving wound healing, (ii) preventing and/or reducing scar formation at a wound, and (iii) reducing the visibility of a scar in a subject in need thereof. The mRNAs featured for use in the invention are administered to subjects and encode a human wound healing protein(s) in vivo. Accordingly, the invention relates to

polynucleotides, e.g., mRNA, comprising an open reading frame of linked nucleosides encoding a human wound healing polypeptide (see, e.g., Table 1), isoforms thereof, functional fragments thereof, and fusion proteins comprising the wound healing polypeptide. In certain instances, the functional fragment thereof is a mature wound healing polypeptide lacking, e.g., a signal sequence. In particular, the invention provides sequence-optimized polynucleotides comprising nucleotides encoding the polypeptide sequence of a human wound healing polypeptide, or sequence having high sequence identity with those sequence optimized

polynucleotides.

[0069] In certain aspects, the invention provides polynucleotides (e.g., a RNA such as an mRNA) that comprise a nucleotide sequence (e.g., an ORF) encoding one or more wound healing polypeptides. In some embodiments, the encoded wound healing polypeptide of the invention can be selected from:

(i) a full length wound healing polypeptide (e.g., having the same or essentially the same length as the wild-type wound healing peptide (e.g., see Table i));

(ii) a mature, processed form of a wound healing polypeptide (e.g., a mature, processed form of a wound healing polypeptide depicted in Table 1);

(iii) a functional fragment of a wound healing polypeptide described herein (e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than the wound healing polypeptide, but still retaining the wound healing polypeptide’s wound healing activity);

(iv) a variant thereof (e.g., full length or truncated wound healing proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the wound healing activity of the polypeptide with respect to a reference protein (such as, e.g., any natural or artificial variants known in the art); or

(v) a fusion protein comprising (i) a full length wound healing protein (e.g., a protein described in Table 1), an isoform thereof, or a variant thereof, and (ii) a heterologous protein.

[0070] In certain embodiments, the encoded wound healing polypeptide is a

mammalian growth factor wound healing polypeptide, such as a human growth factor wound healing polypeptide, a functional fragment or a variant thereof. Nonlimiting examples of growth factor wound healing polypeptides include

[0071] amphiregulin, CTGF, EGF, epigen, epiregulin, FGF2, FGF7, FGF10, HB- EGF, IGF1, IGF2, NRG-1, PLGF, a PDGF (e.g, PGDF-AA, PGDF-BB, or PGDF- AB), TGF-a, TGF-b, and VEGF-C (e.g., see Table 1). In some embodiments, the growth factor wound healing polypeptide is a member of the EGF family of proteins (e.g., amphiregulin, EGF, epigen, epiregulin, HB-EGF, or NRG-1). In certain embodiments, the growth factor wound healing polypeptide is a member of the FGF family of proteins (e.g., FGF2, FGF7, or FGF10). In certain embodiments, the growth factor wound healing polypeptide is a member of the TGF family of proteins (e.g., TGF-a or TGF-b). In certain embodiments, the growth factor wound healing polypeptide is a member of the VEGF family of proteins (e.g, VEGF-C or PLGF). In certain embodiments, the growth factor wound healing polypeptide is a PDGF (e.g, PDGF-AA, PDGF-BB, or PDGF-AB).

[0072] In certain embodiments, the encoded wound healing polypeptide is a

mammalian cytokine wound healing polypeptide, such as a human cytokine wound

healing polypeptide, a functional fragment or a variant thereof. Nonlimiting examples of cytokine wound healing polypeptides include G-CSF, GM-CSF, HGF, IL-1, IL-6, IL-8, IL-10, and TNF-a (e.g., see Table 1). In some embodiments, the cytokine wound healing polypeptide is an interleukin wound healing polypeptide (e.g., IL-1, IL-6, IL-8, or IL-10).

[0073] In certain embodiments, the encoded wound healing polypeptide is a

mammalian chemokine wound healing polypeptide, such as a human chemokine wound healing polypeptide, a functional fragment or a variant thereof. Nonlimiting examples of chemokine wound healing polypeptides include MCP-1 and SDF-1 (e.g., see Table 1).

[0074] In certain embodiments, the encoded wound healing polypeptide is a

mammalian protease inhibitor wound healing polypeptide, such as a human protease inhibitor wound healing polypeptide, a functional fragment or a variant thereof. A nonlimiting example of a protease inhibitor wound healing polypeptide is SLPI (e.g., see Table 1).

[0075] In certain embodiments, the encoded wound healing polypeptide is a

mammalian collagen wound healing polypeptide, such as a human collagen wound healing polypeptide, a functional fragment or a variant thereof. Nonlimiting examples of a collagen wound healing polypeptides include collagen type I, collagen type III, collagen type IV, collagen type V, collagen type VI, collagen type VII, collagen type VIII, collagen type XII, collagen type XIII, collagen type XIV, collagen type XVI, collagen type XVII, collagen type XVIII, collagen type XIX, and collagen type XXVIII (e.g., see Table 1).

[0076] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention increases expression levels and/or detectable activity levels of the wound healing polypeptide in cells when introduced in those cells, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%, compared to expression levels and/or detectable activity levels of the wound healing polypeptide in the cells prior to the intradermal (e.g., using microneedles) or topical administration of the polynucleotide of the invention. Wound healing protein expression levels and/or activity can be measured according to methods know in the art. In some

embodiments, the polynucleotide is introduced to the cells in vitro. In some embodiments, the polynucleotide is introduced to the cells in vivo.

[0077] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence (e.g., an ORF) that encodes a wild-type human wound healing polypeptide (e.g., a polypeptide described in Table 1) or an isoform thereof.

[0078] The polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a codon optimized nucleic acid sequence, wherein the open reading frame (ORF) of the codon optimized nucleic acid sequence is derived from a wild-type wound healing sequence (e.g., wild-type ORF encoding a wound healing polypeptide described in Table 1). For example, for polynucleotides of invention comprising a sequence optimized ORF encoding GM-CSF, the corresponding wild type sequence is the native human GM-CSF. Similarly, for a sequence optimized mRNA encoding a functional fragment of human GM-CSF, the corresponding wild type sequence is the corresponding fragment from human GM-CSF. As another example, for

polynucleotides of invention comprising a sequence optimized ORF encoding PDGF, the corresponding wild type sequence is the native human PDGF. Similarly, for a sequence optimized mRNA encoding a functional fragment of human PDGF, the corresponding wild type sequence is the corresponding fragment from human PDGF. As yet another example, for polynucleotides of invention comprising a sequence optimized ORF encoding FGF2, the corresponding wild type sequence is the native human FGF2. Similarly, for a sequence optimized mRNA encoding a functional fragment of human FGF2, the corresponding wild type sequence is the corresponding fragment from human FGF2.

[0079] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence encoding a wound healing polypeptide having the full length sequence of a human wound healing polypeptide (e.g., a wound healing polypeptide described in Table 1).

[0080] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence (e.g., an ORF) encoding a mutant wound healing polypeptide. In some embodiments, the polynucleotides of the invention comprise an ORF encoding a wound healing polypeptide that comprises at least one point mutation in the wound healing polypeptide amino acid sequence and retains an activity of the wound healing polypeptide. In some embodiments, the mutant wound healing polypeptide has a wound healing activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the wound healing activity of the corresponding wild-type wound healing. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprising an ORF encoding a mutant wound healing polypeptide is sequence optimized.

[0081] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) that encodes a wound healing polypeptide with mutations that do not alter the wound healing polypeptide’s activity. Such mutant wound healing polypeptides can be referred to as function- neutral. In some embodiments, the polynucleotide comprises an ORF that encodes a mutant wound healing polypeptide comprising one or more function-neutral point mutations.

[0082] In some embodiments, the mutant wound healing polypeptide has higher

wound healing activity than the corresponding wild-type wound healing polypeptide. In some embodiments, the mutant wound healing polypeptide has a wound healing activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the activity of the corresponding wild-type wound healing polypeptide (i.e., the same wound healing polypeptide but without the mutation(s)).

[0083] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence (e.g., an ORF) encoding a functional wound healing polypeptide fragment, e.g., where one or more fragments correspond to a polypeptide subsequence of the wild type wound healing polypeptide and retain wound healing activity. In some embodiments, the wound healing polypeptide fragment has a wound healing activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the wound healing activity of the corresponding full length wound healing polypeptide. In some embodiments,

the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprising an ORF encoding a functional wound healing polypeptide fragment is sequence optimized.

[0084] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide fragment that has higher wound healing activity than the corresponding full length wound healing polypeptide. Thus, in some embodiments the wound healing polypeptide fragment has a wound healing activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the wound healing activity of the corresponding full length wound healing polypeptide.

[0085] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide fragment that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% shorter than the wild-type wound healing polypeptide.

[0086] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises from about 900 to about 100,000 nucleotides (e.g., from 900 to 1,000, from 900 to 1,100, from 900 to 1,200, from 900 to 1,300, from 900 to 1,400, from 900 to 1,500, from 1,000 to 1,100, from 1,000 to 1,100, from 1,000 to 1,200, from 1,000 to 1,300, from 1,000 to 1,400, from 1,000 to 1,500, from 1,187 to 1,200, from 1,187 to 1,400, from 1,187 to 1,600, from 1,187 to 1,800, from 1,187 to 2,000, from 1,187 to 3,000, from 1,187 to 5,000, from 1,187 to 7,000, from 1,187 to 10,000, from 1,187 to 25,000, from 1,187 to 50,000, from 1,187 to 70,000, or from 1,187 to

100,000).

[0087] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the length of the nucleotide sequence (e.g., an ORF) is at least 500 nucleotides in length (e.g., at least or greater than about 500, 600, 700, 80, 900, 1,000,

1,050, 1,100, 1,187, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000,

2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 3,000, 3,100, 3,200,

3,300, 3,400, 3,500, 3,600, 3,700, 3,800, 3,900, 4,000, 4,100, 4,200, 4,300, 4,400,

4,500, 4,600, 4,700, 4,800, 4,900, 5,000, 5,100, 5,200, 5,300, 5,400, 5,500, 5,600, 5,700, 5,800, 5,900, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000,

50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).

[0088] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereol) further comprises at least one nucleic acid sequence that is noncoding, e.g., a microRNA binding site. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention further comprises a 5'-UTR (e.g., selected from the sequences of SEQ ID NO:3, 88-102, and 165-167 or selected from the sequences of SEQ ID NO:3, SEQ ID NO:193, SEQ ID NO:39, and SEQ ID NO: 194) and a 3'UTR (e.g., selected from the sequences of SEQ ID NO: 104-112, 150, 151, and l78 or selected from the sequences of SEQ ID NO: 150, SEQ ID NO:175, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO:4, SEQ ID NO: 177, SEQ ID NO: 111, and SEQ ID NO: 178). In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 5' terminal cap (e.g., CapO, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA- guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methylG cap, or an analog thereol) and a poly-A-tail region (e.g., about 100 nucleotides in length). In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 111, 112, 150, 151, and 178 or any combination thereof. In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO:4, SEQ ID NO: 177, SEQ ID NO: 111, or SEQ ID NO: 178 or any combination thereof. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 111.

In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 151. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 150. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 178.

In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 175. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 195. In some embodiments, the

mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 196.

In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO:4. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 177. In some embodiments, the mRNA comprises a polyA tail. In some instances, the poly A tail is 50-150 (SEQ ID NO:265), 75-150 (SEQ ID NO:266), 85-150 (SEQ ID NO:267), 90-150 (SEQ ID NO:268), 90-120 (SEQ ID NO:269), 90-130 (SEQ ID NO:270), or 90-150 (SEQ ID NO:268) nucleotides in length. In some instances, the poly A tail is 100 nucleotides in length (SEQ ID NO:272).

[0089] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide is single stranded or double stranded.

[0090] In some embodiments, the polynucleotide of the invention comprising a

nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof) is DNA or RNA. In some embodiments, the polynucleotide of the invention is RNA. In some embodiments, the polynucleotide of the invention is, or functions as, an mRNA. In some embodiments, the mRNA comprises a nucleotide sequence (e.g., an ORF) that encodes at least one wound healing polypeptide, and is capable of being translated to produce the encoded wound healing polypeptide in vitro, in vivo, in situ or ex vivo.

[0091] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof, see e.g., the wound healing polypeptides of Table 1), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., Nl-methylpseudouracil or 5-methoxyuracil. In certain embodiments, all uracils in the polynucleotide are Nl-methylpseudouracils. In other embodiments, all uracils in the polynucleotide are 5-methoxyuracils. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 and/or a miRNA binding site that binds to miR-126.

[0092] In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA)

disclosed herein is formulated with a delivery agent comprising, e.g., a compound having the Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having the Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233- 342, e.g., Compound VI; or a compound having the Formula (VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio in the range of about 30 to about 60 mol% Compound II or VI (or related suitable amino lipid) (e.g., 30-40, 40-45, 45- 50, 50-55 or 55-60 mol% Compound II or VI (or related suitable amino lipid)), about 5 to about 20 mol% phospholipid (or related suitable phospholipid or“helper lipid”) (e.g., 5-10, 10-15, or 15-20 mol% phospholipid (or related suitable phospholipid or “helper lipid”)), about 20 to about 50 mol% cholesterol (or related sterol or“non- cationic” lipid) (e.g., about 20-30, 30-35, 35-40, 40-45, or 45-50 mol% cholesterol (or related sterol or“non-cationic” lipid)) and about 0.05 to about 10 mol% PEG lipid (or other suitable PEG lipid) (e.g., 0.05-1, 1-2, 2-3, 3-4, 4-5, 5-7, or 7-10 mol% PEG lipid (or other suitable PEG lipid)). An exemplary delivery agent can comprise mole ratios of, for example, 47.5: 10.5:39.0:3.0 or 50: 10:38.5: 1.5. In certain instances, an exemplary delivery agent can comprise mole ratios of, for example, 47.5: 10.5:39.0:3; 47.5: 10:39.5:3; 47.5: 11:39.5:2; 47.5: 10.5:39.5:2.5; 47.5: 11:39:2.5; 48.5: 10:38.5:3; 48.5: 10.5:39:2; 48.5: 10.5:38.5:2.5; 48.5: 10.5:39.5: 1.5; 48.5: 10.5:38.0:3;

47: 10.5:39.5:3; 47: 10:40.5:2.5; 47: 11:40:2; 47: 10.5:39.5:3; 48: 10.5:38.5:3;

48: 10:39.5:2.5; 48: 11 :39:2; or 48: 10.5:38.5:3. In some embodiments, the delivery agent comprises Compound II or VI, DSPC, Cholesterol, and Compound I or PEG- DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound II or VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 50: 10:38.5: 1.5.

[0093] In some embodiments, the polynucleotide of the disclosure is an mRNA that comprises a 5'-terminal cap (e.g., Cap 1), a 5'UTR (e.g., SEQ ID NO:3), the ORF sequence encodes a wound healing polypeptide (e.g., as described in Table 1), a 3'UTR (e.g., SEQ ID NO: 111), and a poly A tail (e.g., about 100 nucleotides in length), wherein all uracils in the polynucleotide are Nl-methylpseudouracils. In some embodiments, the delivery agent comprises Compound II or Compound VI as the ionizable lipid and PEG-DMG or Compound I as the PEG lipid.

3. Signal Sequences

[0094] The polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites. One such feature that aids in protein trafficking is the signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a wound healing polypeptide described herein.

[0095] In some embodiments, the "signal sequence" or "signal peptide" is a

polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.

[0096] In some embodiments, the polynucleotide of the invention comprises a

nucleotide sequence encoding a wound healing polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a heterologous signal peptide.

4. Fusion Proteins

[0097] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) can comprise more than one nucleic acid sequence (e.g., an ORF) encoding a polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a wound healing polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding a wound healing polypeptide (a first polypeptide of interest), a functional fragment, or a variant thereof, and a second ORF expressing a second polypeptide of interest. In

some embodiments, two or more polypeptides of interest can be genetically fused, i.e., two or more polypeptides can be encoded by the same ORF. In some

embodiments, the polynucleotide can comprise a nucleic acid sequence encoding a linker (e.g., a G4S (SEQ ID NO:86) peptide linker or another linker known in the art) between two or more polypeptides of interest.

[0098] In some embodiments, a polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) can comprise two, three, four, or more ORFs, each expressing a polypeptide of interest.

[0099] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) can comprise a first nucleic acid sequence (e.g., a first ORF) encoding a wound healing polypeptide and a second nucleic acid sequence (e.g., a second ORF) encoding a second polypeptide of interest (e.g., a second wound healing polypeptide). Linkers and Cleavable Peptides

[0100] In certain embodiments, the mRNAs of the disclosure encode more than one wound healing polypeptide domain or a heterologous domain, referred to herein as multimer constructs. In certain embodiments of the multimer constructs, the mRNA further encodes a linker located between each domain. The linker can be, for example, a cleavable linker or protease-sensitive linker. In certain embodiments, the linker is selected from the group consisting of F2A linker, P2A linker, T2A linker, E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see for example, Kim, J.H. et al. (2011) PLoS ONE 6:el8556). In certain embodiments, the linker is an F2A linker. In certain embodiments, the linker is a GGGS (SEQ ID NO: 8) linker. In certain embodiments, the linker is a (GGGS)n (SEQ ID NO: 190) linker, wherein n =2, 3,4, or 5. In certain embodiments, the multimer construct contains three domains with intervening linkers, having the structure: domain-linker-domain-linker-domain e.g., wound healing polypeptide domain-linker-wound healing polypeptide domain-linker- wound healing polypeptide domain.

[0101] In one embodiment, the cleavable linker is an F2A linker (e.g., having the amino acid sequence GSGVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 186)).

In other embodiments, the cleavable linker is a T2A linker (e.g., having the amino acid sequence GSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 187)), a P2A linker (e.g., having the amino acid sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID

NO: 188)) or an E2A linker (e.g., having the amino acid sequence GSGQCTNYALLKLAGDVESNPGP (SEQ ID NO: 189)). The skilled artisan will appreciate that other art-recognized linkers may be suitable for use in the constructs of the invention (e.g., encoded by the polynucleotides of the invention). The skilled artisan will likewise appreciate that other multicistronic constructs may be suitable for use in the invention. In exemplary embodiments, the construct design yields approximately equimolar amounts of intrabody and/or domain thereof encoded by the constructs of the invention.

[0102] In one embodiment, the self-cleaving peptide may be, but is not limited to, a

2A peptide. A variety of 2A peptides are known and available in the art and may be used, including e.g., the foot and mouth disease virus (FMDV) 2A peptide, the equine rhinitis A virus 2A peptide, the Thosea asigna virus 2A peptide, and the porcine teschovirus-1 2A peptide. 2A peptides are used by several viruses to generate two proteins from one transcript by ribosome-skipping, such that a normal peptide bond is impaired at the 2A peptide sequence, resulting in two discontinuous proteins being produced from one translation event. As a non-limiting example, the 2A peptide may have the protein sequence of SEQ ID NO: 188, fragments or variants thereof. In one embodiment, the 2A peptide cleaves between the last glycine and last proline. As another non-limiting example, the polynucleotides of the present invention may include a polynucleotide sequence encoding the 2A peptide having the protein sequence of fragments or variants of SEQ ID NO: 188. One example of a

polynucleotide sequence encoding the 2A peptide

is : GGAAGCGGAGCUACUAACUUC AGCCUGCUGAAGC AGGCUGGAGACGU GGAGGAGAACCCUGGACCU (SEQ ID NO: 191). In one illustrative embodiment, a 2A peptide is encoded by the following sequence: 5'- UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAAACAA ACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAU CCAGGTCCACUC-3' (SEQ ID NO: 192). The polynucleotide sequence of the 2A peptide may be modified or codon optimized by the methods described herein and/or are known in the art.

[0103] In one embodiment, this sequence may be used to separate the coding regions of two or more polypeptides of interest. As a non-limiting example, the sequence encoding the F2A peptide may be between a first coding region A and a second coding region B (A-F2Apep-B). The presence of the F2A peptide results in the

cleavage of the one long protein between the glycine and the proline at the end of the F2A peptide sequence (NPGP (SEQ ID NO:256) is cleaved to result in NPG and P) thus creating separate protein A (with 21 amino acids of the F2A peptide attached, ending with NPG) and separate protein B (with 1 amino acid, P, of the F2A peptide attached). Likewise, for other 2A peptides (P2A, T2A and E2A), the presence of the peptide in a long protein results in cleavage between the glycine and proline at the end of the 2A peptide sequence (NPGP (SEQ ID NO:256) is cleaved to result in NPG and P). Protein A and protein B may be the same or different peptides or polypeptides of interest.

5. Sequence Optimization of Nucleotide Sequence Encoding Wound Healing Polypeptide

[0104] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention is sequence optimized. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide, optionally, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, the 5' UTR or 3' UTR optionally comprising at least one microRNA binding site, optionally a nucleotide sequence encoding a linker, a polyA tail, or any combination thereof), in which the ORF(s) are sequence optimized.

[0105] A sequence-optimized nucleotide sequence, e.g., a codon-optimized mRNA sequence encoding a wound healing polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding a wound healing polypeptide).

[0106] A sequence-optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence. For example, a reference sequence encoding polyserine uniformly encoded by UCU codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, U in position 1 replaced by A, C in position 2 replaced by G, and U in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGC codons. The percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence- optimized polyserine nucleic acid sequence would be 0%. However, the protein products from both sequences would be 100% identical.

[0107] Some sequence optimization (also sometimes referred to codon optimization) methods are known in the art (and discussed in more detail below) and can be useful to achieve one or more desired results. These results can include, e.g., matching codon frequencies in certain tissue targets and/or host organisms to ensure proper folding; biasing G/C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing/adding post translation

modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and/or reducing or eliminating problem secondary structures within the polynucleotide. Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.

[0108] Codon options for each amino acid are given in TABLE 2.

TABLE 2. Codon Options



[0109] In some embodiments, a polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide, a functional fragment, or a variant thereof, wherein the wound healing polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a wound healing polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after intradermal (e.g., using microneedles) or topical administration in vivo. Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.

[0110] In some embodiments, the sequence-optimized nucleotide sequence (e.g., an

ORF) is codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid- based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio responses such as the immune response and/or degradation pathways.

[0111] In some embodiments, the polynucleotides of the invention comprise a

nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence-optimized according to a method comprising:

(i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a wound healing polypeptide) with an alternative codon to increase or decrease uridine content to generate a uridine-modified sequence;

(ii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a wound healing polypeptide) with an alternative codon having a higher codon frequency in the synonymous codon set;

(iii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a wound healing polypeptide) with an alternative codon to increase G/C content; or

(iv) a combination thereof.

[0112] In some embodiments, the sequence-optimized nucleotide sequence (e.g., an

ORF encoding a wound healing polypeptide) has at least one improved property with respect to the reference nucleotide sequence.

[0113] In some embodiments, the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and/or other optimization methods known in the art.

[0114] Features, which can be considered beneficial in some embodiments of the invention, can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the wound healing polypeptide. These regions can be incorporated into the polynucleotide before and/or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have Xbal recognition.

[0115] In some embodiments, the polynucleotide of the invention comprises a 5'

UTR, a 3' UTR and/or a microRNA binding site. In some embodiments, the polynucleotide comprises two or more 5' UTRs and/or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA binding sites, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and/or microRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and/or after sequence optimization.

[0116] In some embodiments, after optimization, the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.

6. Sequence-Optimized Nucleotide Sequences Encoding Wound Healing

Polypeptides

[0117] In some embodiments, the polynucleotide of the invention comprises a

sequence-optimized nucleotide sequence encoding a wound healing polypeptide disclosed herein. In some embodiments, the polynucleotide of the invention comprises an open reading frame (ORF) encoding a wound healing polypeptide, wherein the ORF has been sequence optimized. In some embodiments, the sequence optimized wound healing sequences, fragments, and variants thereof are used to practice the methods disclosed herein.

[0118] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a wound healing polypeptide, comprises from 5' to 3' end:

(i) a 5' cap provided herein, for example, Capl;

(ii) a 5' UTR, such as the sequences provided herein, for example, SEQ ID

NO:3;

(iii) an open reading frame encoding a wound healing polypeptide, e.g., a sequence optimized nucleic acid sequence encoding a wound healing polypeptide described in Table 1;

(iv) at least one stop codon (if not present at 5' terminus of 3'UTR);

(v) a 3' UTR, such as the sequences provided herein, for example, SEQ ID NO: l l l; and

(vi) a poly -A tail provided above.

In certain embodiments, all uracils in the polynucleotide are N1 -methylpseudouracil (G5). In certain embodiments, all uracils in the polynucleotide are 5-methoxyuracil (G6).

[0119] The sequence-optimized nucleotide sequences disclosed herein are distinct from the corresponding wild type nucleotide acid sequences and from other known

sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.

[0120] In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence (e.g., encoding a wound healing polypeptide, a functional fragment, or a variant thereof) is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence- optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence of the invention is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild- type sequence.

[0121] Methods for optimizing codon usage are known in the art. For example, an

ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites;

modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.

7. Characterization of Sequence Optimized Nucleic Acids

[0122] In some embodiments of the invention, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a sequence optimized nucleic acid disclosed herein encoding a wound healing polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.

[0123] As used herein, "expression property" refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after intradermal (e.g., using microneedles) or topical administration to a subject in need thereol) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system). Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a wound healing polypeptide after intradermal (e.g., using microneedles) or topical administration, and the amount of soluble or otherwise functional protein produced. In some embodiments, sequence optimized nucleic acids disclosed herein can be evaluated according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a wound healing polypeptide disclosed herein.

[0124] In a particular embodiment, a plurality of sequence optimized nucleic acids disclosed herein (e.g., a RNA, e.g., an mRNA) containing codon substitutions with respect to the non-optimized reference nucleic acid sequence can be characterized functionally to measure a property of interest, for example an expression property in an in vitro model system, or in vivo in a target tissue or cell.

a. Optimization of Nucleic Acid Sequence Intrinsic Properties

[0125] In some embodiments of the invention, the desired property of the

polynucleotide is an intrinsic property of the nucleic acid sequence. For example, the nucleotide sequence (e.g., a RNA, e.g., an mRNA) can be sequence optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence optimized for expression in a particular target tissue or cell. In some embodiments, the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.

[0126] In other embodiments, the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.

[0127] In other embodiments, the sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation.

b. Nucleic Acids Sequence Optimized for Protein Expression

[0128] In some embodiments of the invention, the desired property of the

polynucleotide is the level of expression of a wound healing polypeptide encoded by a sequence optimized sequence disclosed herein. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components. In other embodiments, the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.

[0129] In some embodiments, protein expression in solution form can be desirable.

Accordingly, in some embodiments, a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form. Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).

c. Optimization of Target Tissue or Target Cell Viability

[0130] In some embodiments, the expression of heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.

[0131] Accordingly, in some embodiments of the invention, the sequence

optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding a wound healing polypeptide, can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.

[0132] Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation.

Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reaction can be measured according to methods known in the art.

L Reduction of Immune and/or Inflammatory Response

[0133] In some cases, the administration of a sequence optimized nucleic acid

encoding a wound healing polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a wound healing polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the wound healing polypeptide encoded by the mRNA), or (iv) a combination thereof. Accordingly, in some embodiments of the present disclosure the sequence optimization of nucleic acid sequence (e.g., an mRNA) disclosed herein can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a wound healing polypeptide or by the expression product of the wound healing polypeptide encoded by such nucleic acid.

[0134] In some aspects, an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to cytokines that are elevated in an inflammatory response. Examples of inflammatory cytokines include

interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1; also known as GROa, interferon-g (IFNy), tumor necrosis factor a (TNFa), interferon g-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF). The term inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin- 12 (IL-12), interleukin- 13 (11-13), interferon a (IFN-a), etc.

8. Modified Nucleotide Sequences Encoding Wound Healing Polypeptides

[0135] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, Nl-methylpseudouracil, 5 -methoxy uracil, or the like. In some embodiments, the mRNA is a uracil-modified sequence comprising an ORF encoding a wound healing polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, Nl-methylpseudouracil, or 5-methoxyuracil.

[0136] In certain aspects of the invention, when the modified uracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as modified uridine. In some embodiments, uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In one embodiment, uracil in the polynucleotide is at least 95% modified uracil. In another embodiment, uracil in the polynucleotide is 100% modified uracil.

[0137] In embodiments where uracil in the polynucleotide is at least 95% modified uracil overall uracil content can be adjusted such that an mRNA provides suitable protein expression levels while inducing little to no immune response. In some embodiments, the uracil content of the ORF is between about 100% and about 150%, between about 100% and about 110%, between about 105% and about 115%, between about 110% and about 120%, between about 115% and about 125%, between about 120% and about 130%, between about 125% and about 135%, between about 130% and about 140%, between about 135% and about 145%, between about 140% and about 150% of the theoretical minimum uracil content in the corresponding wild-type ORF (%UTM). In other embodiments, the uracil content of the ORF is between about 121% and about 136% or between 123% and 134% of the %UTM. In some

embodiments, the uracil content of the ORF encoding a wound healing polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %UTM. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.

[0138] In some embodiments, the uracil content in the ORF of the mRNA encoding a wound healing polypeptide of the invention is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 10% and about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 10% and about 25% of the total nucleobase content in the ORF. In one embodiment, the uracil content in the ORF of the mRNA encoding a wound healing polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.

[0139] In further embodiments, the ORF of the mRNA encoding a wound healing polypeptide having modified uracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine/Cytosine (G/C) content (absolute or relative). In some embodiments, the overall increase in C, G, or G/C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G/C content (absolute or relative) of the wild-type ORF. In some embodiments, the G, the C, or the G/C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G/C content of the corresponding wild type nucleotide sequence encoding the wound healing polypeptide (%GTMX; %CTMX, or %G/CTMX). In some embodiments, the increases in G and/or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G/C content with synonymous codons having higher G, C, or G/C content. In other embodiments, the increase in G and/or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.

[0140] In further embodiments, the ORF of the mRNA encoding a wound healing polypeptide of the invention comprises modified uracil and has an adjusted uracil content containing less uracil pairs (UU) and/or uracil triplets (UUU) and/or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the wound healing polypeptide. In some embodiments, the ORF of the mRNA encoding a wound healing polypeptide of the invention contains no uracil pairs and/or uracil triplets and/or uracil quadruplets. In some embodiments, uracil pairs and/or uracil triplets and/or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the wound healing polypeptide. In a particular embodiment, the ORF of the mRNA encoding the wound healing polypeptide of the invention contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-phenylalanine uracil pairs and/or triplets. In another embodiment, the ORF of the mRNA encoding the wound healing polypeptide contains no non-phenylalanine uracil pairs and/or triplets.

[0141] In further embodiments, the ORF of the mRNA encoding a wound healing polypeptide of the invention comprises modified uracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the wound healing polypeptide. In some embodiments, the ORF of the mRNA encoding the wound healing polypeptide of the invention contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the wound healing polypeptide.

[0142] In further embodiments, alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the wound healing polypeptide-encoding ORF of the modified uracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. The ORF also has adjusted uracil content, as described above. In some embodiments, at least one codon in the ORF of the mRNA encoding the wound healing polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

[0143] In some embodiments, the adjusted uracil content, wound healing polypeptide encoding ORF of the modified uracil-comprising mRNA exhibits expression levels of the wound healing polypeptide when administered to a mammalian cell that are higher than expression levels of the wound healing polypeptide from the corresponding wild- type mRNA. In some embodiments, the mammalian cell is a mouse cell, a rat cell, or a rabbit cell. In other embodiments, the mammalian cell is a monkey cell or a human cell. In some embodiments, the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC). In some embodiments, the wound healing polypeptide is expressed at a level higher than expression levels of the wound healing polypeptide from the corresponding wild-type mRNA when the mRNA is administered to a mammalian cell in vivo. In some embodiments, the mRNA is administered to mice, rabbits, rats, monkeys, or humans. In one embodiment, mice are null mice. In some embodiments, the mRNA is administered to mice in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, or 0.2 mg/kg or about 0.5 mg/kg. In other embodiments, the wound healing polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro. In some embodiments, the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10- fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold. In other embodiments, the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.

[0144] In some embodiments, adjusted uracil content, wound healing polypeptide encoding ORF of the modified uracil-comprising mRNA exhibits increased stability. In some embodiments, the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and/or increased stabilization of secondary structure. In some embodiments, increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and/or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if the half-life and/or the AUC is greater than the half-life and/or the AUC of a corresponding wild-type mRNA under the same conditions.

[0145] In some embodiments, the mRNA of the present invention induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a wound healing polypeptide but does not comprise modified uracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a wound healing polypeptide and that comprises modified uracil but that does not have adjusted uracil content under the same conditions. The innate immune response can be manifested by increased expression of pro-inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and/or termination or reduction in protein translation. In some embodiments, a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-a, IFN-b, IFN-K, IFN-d, IFN-e, IFN-x, IFN-co, and IFN-z) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and/or by decreased cell death following one or more administrations of the mRNA of the invention into a cell.

[0146] In some embodiments, the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a wound healing polypeptide but does not comprise modified uracil, or to an mRNA that encodes a wound healing polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the interferon is IFN-b. In some embodiments, cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a wound healing polypeptide but does not comprise modified uracil, or an mRNA that encodes for a wound healing polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the mammalian cell is a BJ fibroblast cell. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is that of a mouse or a rat. In other embodiments, the mammalian cell is that of a human. In one embodiment, the mRNA of the present disclosure does not

substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.

9. Methods for Modifying Polynucleotides

[0147] The disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a wound healing polypeptide). The modified polynucleotides can be chemically modified and/or structurally modified. When the polynucleotides of the present invention are chemically and/or structurally modified the polynucleotides can be referred to as "modified polynucleotides."

[0148] The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding a wound healing polypeptide. A "nucleoside" refers to a compound containing a sugar molecule (e.g, a pentose or ribose) or a derivative thereof in combination with an organic base (e.g, a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A“nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.

[0149] The modified polynucleotides disclosed herein can comprise various distinct modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.

[0150] In some embodiments, a polynucleotide of the present invention (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) is structurally modified. As used herein, a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide.

[0151] Therapeutic compositions of the present disclosure comprise, in some

embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding a wound healing polypeptide, wherein the nucleic acid comprises nucleotides and/or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and/or nucleoside as are recognized in the art.

[0152] In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0153] In some embodiments, a non-naturally occurring modified nucleotide or

nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published US application Nos.

PCT/US2012/058519; PCT/US2013/075177; PCT/US2014/058897;

PCT/US2014/058891; PCT/US2014/070413; PCT/US2015/36773;

PCT/US2015/36759; PCT/US2015/36771; or PCT/IB2017/051367 all of which are incorporated by reference herein.

[0154] In some embodiments, at least one RNA (e.g., mRNA) of the present

disclosure is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In some

embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).

[0155] Hence, nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA

nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof.

[0156] Nucleic acids of the disclosure (e.g, DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and/or modified nucleotides and nucleosides.

[0157] In some embodiments, a modified RNA nucleic acid (e.g. , a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0158] In some embodiments, a modified RNA nucleic acid (e.g. , a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced

immunogenicity in the cell or organism, respectively (e.g, a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0159] Nucleic acids (e.g, RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on intemucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.

[0160] The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g, RNA nucleic acids, such as mRNA nucleic acids). A“nucleoside” refers to a compound containing a sugar molecule (e.g, a pentose or ribose) or a derivative thereof in combination with an organic base (e.g, a purine or pyrimidine) or a derivative thereof (also referred to herein as“nucleobase”). A“nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.

[0161] Modified nucleotide base pairing encompasses not only the standard

adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/ sugar or linker may be incorporated into nucleic acids of the present disclosure.

[0162] In some embodiments, modified nucleobases in nucleic acids (e.g., RNA

nucleic acids, such as mRNA nucleic acids) comprise N1 -methyl-pseudouridine (ml y). 1 -ethyl-pseudouridine (e h|i). 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and/or pseudouridine (y). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5- methoxy methyl uridine, 5-methylthio uridine, 1 -methoxymethyl pseudouridine, 5- methyl cytidine, and/or 5-methoxy cytidine. In some embodiments, the

polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.

[0163] In some embodiments, a RNA nucleic acid of the disclosure comprises Nl- methyl-pseudouridine (hi ΐ y) substitutions at one or more or all uridine positions of the nucleic acid.

[0164] In some embodiments, a RNA nucleic acid of the disclosure comprises Nl- methyl-pseudouridine (hi ΐ y) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

[0165] In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid.

[0166] In some embodiments, a RNA nucleic acid of the disclosure comprises

pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

[0167] In some embodiments, a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.

[0168] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with N1 -methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1 -methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

[0169] The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0170] The nucleic acid may contain from about 1% to about 100% modified

nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%,

from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

[0171] The nucleic acids may contain at a minimum 1% and at maximum 100%

modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted

cytosine). The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).

10. Untranslated Regions (UTRs)

[0172] Translation of a polynucleotide comprising an open reading frame encoding a polypeptide can be controlled and regulated by a variety of mechanisms that are provided by various cis-acting nucleic acid structures. For example, naturally- occurring, cis-acting RNA elements that form hairpins or other higher-order (e.g., pseudoknot) intramolecular mRNA secondary structures can provide a translational regulatory activity to a polynucleotide, wherein the RNA element influences or modulates the initiation of polynucleotide translation, particularly when the RNA element is positioned in the 5' UTR close to the 5'-cap structure (Pelletier and Sonenberg (1985) Cell 40(3):515-526; Kozak (1986) Proc Natl Acad Sci 83:2850- 2854).

[0173] Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the invention comprising an open reading frame (ORF) encoding a wound healing polypeptide further comprises UTR (e.g., a 5' UTR or functional fragment thereof, a 3' UTR or functional fragment thereof, or a combination thereof).

[0174] Cis-acting RNA elements can also affect translation elongation, being

involved in numerous frameshifting events (Namy et al, (2004) Mol Cell 13(2): 157- 168). Internal ribosome entry sequences (IRES) represent another type of cis-acting RNA element that are typically located in 5' UTRs, but have also been reported to be found within the coding region of naturally-occurring mRNAs (Holcik et al. (2000) Trends Genet 16(10):469-473). In cellular mRNAs, IRES often coexist with the 5'- cap structure and provide mRNAs with the functional capacity to be translated under conditions in which cap-dependent translation is compromised (Gebauer et al, (2012) Cold Spring Harb Perspect Biol 4(7):a012245). Another type of naturally-occurring cis-acting RNA element comprises upstream open reading frames (uORFs).

Naturally-occurring uORFs occur singularly or multiply within the 5' UTRs of numerous mRNAs and influence the translation of the downstream major ORF, usually negatively (with the notable exception of GCN4 mRNA in yeast and ATF4 mRNA in mammals, where uORFs serve to promote the translation of the downstream major ORF under conditions of increased eIF2 phosphorylation

(Hinnebusch (2005) Annu Rev Microbiol 59:407-450)). Additional exemplary translational regulatory activities provided by components, structures, elements, motifs, and/or specific sequences comprising polynucleotides (e.g., mRNA) include, but are not limited to, mRNA stabilization or destabilization (Baker & Parker (2004) Curr Opin Cell Biol 16(3):293-299), translational activation (Villalba et al, (2011) Curr Opin Genet Dev 21(4):452-457), and translational repression (Blumer et al., (2002) Mech Dev 110(l-2):97-l 12). Studies have shown that naturally-occurring, cis-acting RNA elements can confer their respective functions when used to modify, by incorporation into, heterologous polynucleotides (Goldberg-Cohen et al., (2002) J Biol Chem 277(16): 13635-13640).

Modified Polynucleotides Comprising Functional RNA Elements

[0175] The present disclosure provides synthetic polynucleotides comprising a

modification (e.g., an RNA element), wherein the modification provides a desired translational regulatory activity. In some embodiments, the disclosure provides a polynucleotide comprising a 5' untranslated region (UTR), an initiation codon, a full open reading frame encoding a polypeptide, a 3' UTR, and at least one modification, wherein the at least one modification provides a desired translational regulatory activity, for example, a modification that promotes and/or enhances the translational fidelity of mRNA translation. In some embodiments, the desired translational regulatory activity is a cis-acting regulatory activity. In some embodiments, the desired translational regulatory activity is an increase in the residence time of the 43 S pre-initiation complex (PIC) or ribosome at, or proximal to, the initiation codon. In some embodiments, the desired translational regulatory activity is an increase in the initiation of polypeptide synthesis at or from the initiation codon. In some embodiments, the desired translational regulatory activity is an increase in the amount of polypeptide translated from the full open reading frame. In some embodiments, the desired translational regulatory activity is an increase in the fidelity of initiation codon decoding by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is inhibition or reduction of leaky scanning by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is a decrease in the rate of decoding the initiation codon by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is inhibition or reduction in the initiation of polypeptide synthesis at any codon within the mRNA other than the initiation codon. In some embodiments, the desired translational regulatory activity is inhibition or reduction of the amount of polypeptide translated from any open reading frame within the mRNA other than the full open reading frame. In some

embodiments, the desired translational regulatory activity is inhibition or reduction in the production of aberrant translation products. In some embodiments, the desired translational regulatory activity is a combination of one or more of the foregoing translational regulatory activities.

[0176] Accordingly, the present disclosure provides a polynucleotide, e.g., an mRNA, comprising an RNA element that comprises a sequence and/or an RNA secondary structure(s) that provides a desired translational regulatory activity as described

herein. In some aspects, the mRNA comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that promotes and/or enhances the translational fidelity of mRNA translation. In some aspects, the mRNA comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that provides a desired translational regulatory activity, such as inhibiting and/or reducing leaky scanning. In some aspects, the disclosure provides an mRNA that comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that inhibits and/or reduces leaky scanning thereby promoting the translational fidelity of the mRNA.

[0177] In some embodiments, the RNA element comprises natural and/or modified nucleotides. In some embodiments, the RNA element comprises of a sequence of linked nucleotides, or derivatives or analogs thereof, that provides a desired translational regulatory activity as described herein. In some embodiments, the RNA element comprises a sequence of linked nucleotides, or derivatives or analogs thereof, that forms or folds into a stable RNA secondary structure, wherein the RNA secondary structure provides a desired translational regulatory activity as described herein. RNA elements can be identified and/or characterized based on the primary sequence of the element (e.g., GC-rich element), by RNA secondary structure formed by the element (e.g. stem-loop), by the location of the element within the RNA molecule (e.g., located within the 5' UTR of an mRNA), by the biological function and/or activity of the element (e.g.,“translational enhancer element”), and any combination thereof.

[0178] In some aspects, the disclosure provides an mRNA having one or more

structural modifications that inhibits leaky scanning and/or promotes the translational fidelity of mRNA translation, wherein at least one of the structural modifications is a GC-rich RNA element. In some aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5' UTR of the mRNA. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5' UTR of the mRNA. In another embodiment, the GC-rich RNA element is located 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream of a Kozak consensus sequence. In another embodiment, the GC-rich RNA

element is located immediately adjacent to a Kozak consensus sequence in the 5' UTR of the mRNA.

[0179] In any of the foregoing or related aspects, the disclosure provides a GC-rich

RNA element which comprises a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6 or about 3 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%-60% cytosine, 40-50% cytosine, 30-40% cytosine bases. In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6 or about 3 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.

[0180] In any of the foregoing or related aspects, the disclosure provides a GC-rich

RNA element which comprises a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11,

10, 9, 8, 7, 6, 5, 4, or 3 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%- 60% cytosine, 40-50% cytosine, or 30-40% cytosine. In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.

[0181] In some embodiments, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5' UTR of the mRNA, wherein the GC- rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, and wherein the GC-rich RNA element comprises a sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is >50% cytosine. In some embodiments, the sequence

composition is >55% cytosine, >60% cytosine, >65% cytosine, >70% cytosine, >75% cytosine, >80% cytosine, >85% cytosine, or >90% cytosine.

[0182] In other aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5' UTR of the mRNA, wherein the GC- rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5' UTR of the mRNA, and wherein the GC-rich RNA element comprises a sequence of about 3-30, 5-25, 10-20, 15-20 or about 20, about 15, about 12, about 10, about 6 or about 3 nucleotides, or derivatives or analogues thereof, wherein the sequence comprises a repeating GC-motif, wherein the repeating GC- motif is [CCG]n, wherein n = 1 to 10 (SEQ ID NO:257), n= 2 to 8 (SEQ ID NO:258), n= 3 to 6 (SEQ ID NO:259), or n= 4 to 5 (SEQ ID NO:260). In some embodiments, the sequence comprises a repeating GC-motif [CCG]n, wherein n = 1, 2, 3, 4 or 5 (SEQ ID NO:261). In some embodiments, the sequence comprises a repeating GC- motif [CCG]n, wherein n = 1, 2, or 3. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n, wherein n = 1. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n, wherein n = 2. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n, wherein n = 3. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n, wherein n = 4 (SEQ ID NO:262). In some embodiments, the sequence comprises a repeating GC- motif [CCG]n, wherein n = 5 (SEQ ID NO:263).

[0183] In another aspect, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5' UTR of the mRNA, wherein the GC- rich RNA element comprises any one of the sequences set forth in Table 3. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5' UTR of the mRNA. In another embodiment, the GC-rich RNA element is located about 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream of a Kozak consensus sequence. In another embodiment, the

GC-rich RNA element is located immediately adjacent to a Kozak consensus sequence in the 5' UTR of the mRNA.

[0184] In other aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence VI [CCCCGGCGCC (SEQ ID NO:43)] as set forth in Table

3, or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence VI as set forth in Table 3 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence VI as set forth in Table 3 located 1, 2, 3,

4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence VI as set forth in Table 3 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA.

[0185] In other aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence V2 [CCCCGGC (SEQ ID NO:44)] as set forth in Table 3, or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 3 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 3 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 3 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA.

[0186] In other aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence EK [GCCGCC (SEQ ID NO:42)] as set forth in Table 3, or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence EK as set forth in Table 3 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence EK as set forth in Table 3 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence EK as set forth in Table 3 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA.

[0187] In yet other aspects, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence VI [CCCCGGCGCC (SEQ ID NO:43)] as set forth in Table 3, or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5' UTR of the mRNA, wherein the 5' UTR comprises the following sequence shown in Table 3:

[0188] GGGAAAUA AGAGAGAAAAGAAGAGU AAGAAGAAAU AU AAGA

(SEQ ID NO: 85). The skilled artisan will of course recognize that all Us in the RNA sequences described herein will be Ts in a corresponding template DNA sequence, for example, in DNA templates or constructs from which mRNAs of the disclosure are transcribed, e.g., via IVT.

[0189] In some embodiments, the GC-rich element comprises the sequence VI as set forth in Table 3 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5' UTR sequence shown in Table 3. In some embodiments, the GC- rich element comprises the sequence VI as set forth in Table 3 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA, wherein the 5' UTR comprises the following sequence shown in Table 3:

[0190] GGGAAAUA AGAGAGAAAAGAAGAGU AAGAAGAAAU AU AAGA

(SEQ ID NO:85).

[0191] In other embodiments, the GC-rich element comprises the sequence VI as set forth in Table 3 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5' UTR of the mRNA, wherein the 5' UTR comprises the following sequence shown in Table 3:

[0192] GGGAAAU AAGAGAGAAAAGAAGAGU AAGAAGAAAU AU AAGA

(SEQ ID NO: 85).

[0193] In some embodiments, the 5' UTR comprises the following sequence set forth in Table 3:

[0194] GGGAAAU AAGAGAGAAAAGAAGAGU AAGAAGAAAU AUAAGACC

CCGGCGCCGCCACC (SEQ ID N0 39)

Table 3

[0195] In another aspect, the disclosure provides a modified mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a stable RNA secondary structure comprising a sequence of nucleotides, or derivatives or analogs thereof, linked in an order which forms a hairpin or a stem- loop. In one embodiment, the stable RNA secondary structure is upstream of the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 20, about 15, about 10 or about 5 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 5, about 4, about 3, about 2, about 1 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located about 15-30, about 15-20, about 15-25, about 10-15, or about 5-10 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the stable RNA secondary structure is located 12-15 nucleotides upstream of the Kozak consensus sequence. In another embodiment, the stable RNA

secondary structure has a deltaG of about -30 kcal/mol, about -20 to -30 kcal/mol, about -20 kcal/mol, about -10 to -20 kcal/mol, about -10 kcal/mol, about -5 to -10 kcal/mol.

[0196] In another embodiment, the modification is operably linked to an open reading frame encoding a polypeptide and wherein the modification and the open reading frame are heterologous.

[0197] In another embodiment, the sequence of the GC-rich RNA element is

comprised exclusively of guanine (G) and cytosine (C) nucleobases.

[0198] RNA elements that provide a desired translational regulatory activity as

described herein can be identified and characterized using known techniques, such as ribosome profiling. Ribosome profiling is a technique that allows the determination of the positions of PICs and/or ribosomes bound to mRNAs (see e.g., Ingolia et al., (2009) Science 324(5924):218-23, incorporated herein by reference). The technique is based on protecting a region or segment of mRNA, by the PIC and/or ribosome, from nuclease digestion. Protection results in the generation of a 30-bp fragment of RNA termed a‘footprint’. The sequence and frequency of RNA footprints can be analyzed by methods known in the art (e.g., RNA-seq). The footprint is roughly centered on the A-site of the ribosome. If the PIC or ribosome dwells at a particular position or location along an mRNA, footprints generated at these position would be relatively common. Studies have shown that more footprints are generated at positions where the PIC and/or ribosome exhibits decreased processivity and fewer footprints where the PIC and/or ribosome exhibits increased processivity (Gardin et al, (2014) eLife 3:e03735). In some embodiments, residence time or the time of occupancy of the PIC or ribosome at a discrete position or location along a polynucleotide comprising any one or more of the RNA elements described herein is determined by ribosome profiling.

[0199] A UTR can be homologous or heterologous to the coding region in a

polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the wound healing polypeptide. In some embodiments, the UTR is heterologous to the ORF encoding the wound healing polypeptide. In some embodiments, the polynucleotide comprises two or more 5' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.

[0200] In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.

[0201] In some embodiments, the 5 'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., Nl-methylpseudouracil or 5-methoxyuracil.

[0202] UTRs can have features that provide a regulatory role, e.g., increased or

decreased stability, localization and/or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.

[0203] Natural 5 'UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG (SEQ ID NO: 87), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another O'. 5' UTRs also have been known to form secondary structures that are involved in elongation factor binding.

[0204] By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5' UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5'UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C/EBP, AML1, G-CSF, GM-CSF, CDl lb, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD 18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A/B/C/D).

[0205] In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide.

[0206] In some embodiments, the 5' UTR and the 3' UTR can be heterologous. In some embodiments, the 5' UTR can be derived from a different species than the 3' UTR. In some embodiments, the 3' UTR can be derived from a different species than the 5' UTR.

[0207] Co-owned International Patent Application No. PCT/US2014/021522 (Publ.

No. WO/2014/164253, incorporated herein by reference in its entirety) provides a listing of exemplary UTRs that can be utilized in the polynucleotide of the present invention as flanking regions to an ORF.

[0208] Exemplary UTRs of the application include, but are not limited to, one or more 5'UTR and/or 3'UTR derived from the nucleic acid sequence of: a globin, such as an a- or b-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 a polypeptide); an albumin (e.g., human albumin7); a HSD17B4 (hydroxysteroid (17-b)

dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUTl (human glucose transporter 1)); an actin (e.g., human a or b actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5'UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the b subunit of mitochondrial FU-ATP synthase); a growth hormone e (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 al (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a b-Fl-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (CollA2), collagen type I, alpha 1 (CollAl), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (C0I6AI)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nntl); calreticulin (Calr); a procollagen- lysine, 2-oxoglutarate 5-dioxygenase 1 (Plodl); and a nucleobindin (e.g., Nucbl).

[0209] In some embodiments, the 5' UTR is selected from the group consisting of a b-globin 5' UTR; a 5'UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 a polypeptide (CYBA) 5' UTR; a hydroxysteroid (17-b) dehydrogenase (HSD17B4) 5' UTR; a Tobacco etch virus (TEV) 5' UTR; a

Venezuelen equine encephalitis virus (TEEV) 5' UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5' UTR; a heat shock protein 70 (Hsp70) 5' UTR; a eIF4G 5' UTR; a GLUT1 5' UTR; functional fragments thereof and any combination thereof.

[0210] In some embodiments, the 3' UTR is selected from the group consisting of a b-globin 3' UTR; a CYBA 3' UTR; an albumin 3' UTR; a growth hormone (GH) 3' UTR; a VEEV 3' UTR; a hepatitis B virus (HBV) 3' UTR; a-globin 3'UTR; a DEN 3' UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3' UTR; an elongation factor 1 al (EEF1 Al) 3' UTR; a manganese superoxide dismutase (MnSOD) 3' UTR; a b subunit of mitochondrial H(+)-ATP synthase (b-mRNA) 3' UTR; a GLUT1 3' UTR; a MEF2A 3' UTR; a b-Fl-ATPase 3' UTR; functional fragments thereof and combinations thereof.

[0211] Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides of the invention. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5' or 3' UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.

[0212] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety.

[0213] UTRs or portions thereof can be placed in the same orientation as in the

transcript from which they were selected or can be altered in orientation or location. Hence, a 5' and/or 3' UTR can be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.

[0214] In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5' UTR or 3' UTR. For example, a double UTR

comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3'UTR can be used (see US2010/0129877, the contents of which are incorporated herein by reference in its entirety).

[0215] In certain embodiments, the polynucleotides of the invention comprise a 5'

UTR and/or a 3' UTR selected from any of the UTRs disclosed herein. In some embodiments, the 5' UTR comprises:

5' UTR-001 (Upstream UTR)

(GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 3);

5' UTR-002 (Upstream UTR)

(GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 89);

5' UTR-003 (Upstream UTR) (See W02016/100812);

5' UTR-004 (Upstream UTR)

(GGGAGAC AAGCUU GGC AUUCC GGU ACU GUU GGU AAAGC C AC C) (SEQ ID NO:90);

5' UTR-005 (Upstream UTR)

(GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:91);

5' UTR-006 (Upstream UTR) (See W02016/100812);

5' UTR-007 (Upstream UTR)

(GGGAGAC AAGCUU GGC AUUCC GGU ACU GUU GGU AAAGC C AC C) (SEQ ID NO:92);

5' UTR-008 (Upstream UTR)

(GGGAAUUAACAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:93);

5' UTR-009 (Upstream UTR)

(GGGAAAUUAGACAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:94);

5' UTR-010, Upstream

(GGGAAAUAAGAGAGUAAAGAACAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:95);

5' UTR-011 (Upstream UTR)

(GGGAAAAAAGAGAGAAAAGAAGACUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:96);

5' UTR-012 (Upstream UTR)

(GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAUAUAUAAGAGCCACC) (SEQ ID NO:97);

5' UTR-013 (Upstream UTR)

(GGGAAAUAAGAGACAAAACAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:98);

5' UTR-014 (Upstream UTR)

(GGGAAAUUAGAGAGUAAAGAACAGUAAGUAGAAUUAAAAGAGCCACC) (SEQ ID NO:99);

5' UTR-015 (Upstream UTR)

(GGGAAAUAAGAGAGAAUAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO: 100);

5' UTR-016 (Upstream UTR)

(GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAAUUAAGAGCCACC) (SEQ ID NO: 101);

5' UTR-017 (Upstream UTR); or

(GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUUUAAGAGCCACC) (SEQ ID NO: 102);

5' UTR-018 (Upstream UTR) 5' UTR

(UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAA AUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO:88).

[0216] In some embodiments, the 3' UTR comprises:

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCC AUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACC CGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 104);

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCUCCAUAAAGUAGGAAACACUACAC AUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACC CGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 105); or

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUCCAUAAA GUAGGAAACACUACAUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCAC CCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 106);

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUC CCCCCAGUCCAUAAAGUAGGAAACACUACACCCCUCCUCCCCUUCCUGCAC CCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 107);

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUC CCCCCAGCCCCUCCUCCCCUUCUCCAU AAAGU AGGAAACACUACACUGCAC CCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) (SEQ ID NO: 108);

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUC CCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCUCCAUAAAGUAGGA AAC ACU AC AGU GGU CUUU GAAU AAAGU CU GAGU GGGCGGC) (SEQ ID

NO: 109).

142-3p 3' UTR (UTR including miR142-3p binding site)

(UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUC CCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUA AAGUU C C AU AAAGUAGGAAAC ACU AC ACUGAGU GGGC GGC) (SEQ ID

NO: 110);

3' UTR-018 (See SEQ ID NO: 150);

3' UTR (miR142 and miR126 binding sites variant 1)

(UGAUAAUAGUCCAU AAAGU AGGAAACACUACAGCUGGAGCCUCGGUGGCC AUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACC CGUACCCCCCGCAUUAUUACUCACGGUACGAGUGGUCUUUGAAUAAAGUCU GAGUGGGCGGC) (SEQ ID NO: 111)

3' UTR (miR142 and miR126 binding sites variant 2)

(UGAUAAUAGUCCAU AAAGU AGGAAACACUACAGCUGGAGCCUCGGUGGCC UAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACC CGUACCCCCCGCAUUAUUACUCACGGUACGAGUGGUCUUUGAAUAAAGUCU GAGUGGGCGGC) (SEQ ID NO: 112); or

3 'UTR (miR142-3p binding site variant 3)

UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCC CCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCUCCAU AAAGU AGGAA AC ACU AC AGU GGU CUUU GAAU AAAGU CU GAGU GGGCGGC (SEQ ID NO: 4).

[0217] In certain embodiments, the 5' UTR and/or 3' UTR sequence of the invention comprises a nucleotide sequence at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 5' UTR sequences comprising any of SEQ ID NOs:3, 88- 102, or 165-167 and/or 3' UTR sequences comprises any of SEQ ID NOs: 104-112, 150, 151, or 178, and any combination thereof.

[0218] In certain embodiments, the 5' UTR and/or 3' UTR sequence of the invention comprises a nucleotide sequence at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 5' UTR sequences comprising any of SEQ ID NO:3,

SEQ ID NO: 193, SEQ ID NO:39, or SEQ ID NO: 194 and/or 3' UTR sequences comprises any of SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO:4, SEQ ID NO: 177, SEQ ID NO: 111, or SEQ ID NO: 178, and any combination thereof.

[0219] In some embodiments, the 5' UTR comprises an amino acid sequence set forth in Table 5B (SEQ ID NO:3, SEQ ID NO: 193, SEQ ID NO:39, or SEQ ID NO: 194).

In some embodiments, the 3' UTR comprises an amino acid sequence set forth in Table 5B (SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 195, SEQ ID NO: 196,

SEQ ID NO:4, SEQ ID NOT77, SEQ ID NO: l l l, or SEQ ID NO: 178). In some embodiments, the 5' UTR comprises an amino acid sequence set forth in Table 5B (SEQ ID NO:3, SEQ ID NO: 193, SEQ ID NO:39, or SEQ ID NO: 194) and the 3'

UTR comprises an amino acid sequence set forth in Table 5B (SEQ ID NO: 150, SEQ ID NOT75, SEQ ID NOT95, SEQ ID NOT96, SEQ ID NO:4, SEQ ID NOT77, SEQ ID NO: 111, or SEQ ID NO: 178).

[0220] The polynucleotides of the invention can comprise combinations of features.

For example, the ORF can be flanked by a 5'UTR that comprises a strong Kozak translational initiation signal and/or a 3'UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5'UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different UTRs (see, e.g., US2010/0293625, herein incorporated by reference in its entirety).

[0221] Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the invention. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the invention. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of the invention comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al, Biochem. Biophys. Res. Commun. 2010 394(1): 189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide comprises an IRES instead of a 5' UTR sequence.

In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5' UTR in combination with a non-synthetic 3' UTR.

[0222] In some embodiments, the UTR can also include at least one translation

enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, "TEE," which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5' UTR comprises a TEE.

[0223] In one aspect, a TEE is a conserved element in a UTR that can promote

translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation.

11. MicroRNA (miRNA) Binding Sites

[0224] Polynucleotides of the invention can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and/or motifs, artificial binding sites engineered to act as pseudo receptors for endogenous nucleic acid binding molecules, and combinations thereof.

In some embodiments, polynucleotides including such regulatory elements are referred to as including“sensor sequences”.

[0225] In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the invention comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of polynucleotides of the invention, and in turn, of the polypeptides encoded therefrom, based on tissue-specific and/or cell-type specific expression of naturally-occurring miRNAs.

[0226] The present invention also provides pharmaceutical compositions and

formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.

[0227] In some embodiments, the composition or formulation can contain a

polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds

[0228] A miRNA, e.g., a natural-occurring miRNA, is a 19-25 nucleotide long

noncoding RNA that binds to a polynucleotide and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a“seed” region, i.e., a sequence in the region of positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2- 7 of the mature miRNA.

[0229] microRNAs derive enzymatically from regions of RNA transcripts that fold back on themselves to form short hairpin structures often termed a pre-miRNA (precursor-miRNA). A pre-miRNA typically has a two-nucleotide overhang at its 3' end, and has 3' hydroxyl and 5' phosphate groups. This precursor-mRNA is processed in the nucleus and subsequently transported to the cytoplasm where it is further processed by DICER (a RNase III enzyme), to form a mature microRNA of approximately 22 nucleotides. The mature microRNA is then incorporated into a ribonuclear particle to form the RNA-induced silencing complex, RISC, which mediates gene silencing. Art-recognized nomenclature for mature miRNAs typically designates the arm of the pre-miRNA from which the mature miRNA derives; "5p" means the microRNA is from the 5 prime arm of the pre-miRNA hairpin and "3p" means the microRNA is from the 3 prime end of the pre-miRNA hairpin. A miR referred to by number herein can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (e.g., either the 3p or 5p microRNA). All miRs referred to herein are intended to include both the 3p and 5p arms/sequences, unless particularly specified by the 3p or 5p designation.

[0230] As used herein, the term“microRNA (miRNA or miR) binding site” refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including in the 5'UTR and/or 3'UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a polynucleotide of the invention comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5' UTR and/or 3' UTR of the polynucleotide (e.g., a

ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises the one or more miRNA binding site(s).

[0231] A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In exemplary aspects of the invention, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RlSC)-mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide long miRNA sequence, to a 19-23 nucleotide long miRNA sequence, or to a 22 nucleotide long miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally-occurring miRNA sequence, or to a portion less than 1, 2, 3, or 4 nucleotides shorter than a naturally-occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally-occurring miRNA) is preferred when the desired regulation is mRNA degradation.

[0232] In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1, 2, or 3 nucleotide substitutions, terminal additions, and/or truncations.

[0233] In some embodiments, the miRNA binding site is the same length as the

corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5' terminus, the 3' terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5' terminus, the 3' terminus, or both. The miRNA

binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation.

[0234] In some embodiments, the miRNA binding site binds the corresponding

mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the polynucleotide comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the polynucleotide comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the polynucleotide comprising the miRNA binding site.

[0235] In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA.

[0236] In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA.

[0237] By engineering one or more miRNA binding sites into a polynucleotide of the invention, the polynucleotide can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the polynucleotide. For example, if a polynucleotide of the invention is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5' UTR and/or

3' UTR of the polynucleotide. Thus, in some embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure may reduce the hazard of off-target effects upon nucleic acid molecule delivery and/or enable tissue-specific regulation of expression of a polypeptide encoded by the mRNA. In yet other embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate immune responses upon nucleic acid delivery in vivo. In further embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate accelerated blood clearance (ABC) of lipid- comprising compounds and compositions described herein.

[0238] Conversely, miRNA binding sites can be removed from polynucleotide

sequences in which they naturally occur in order to increase protein expression in specific tissues. For example, a binding site for a specific miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA.

[0239] Regulation of expression in multiple tissues can be accomplished through introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision whether to remove or insert a miRNA binding site can be made based on miRNA expression patterns and/or their profilings in tissues and/or cells in development and/or disease. Identification of miRNAs, miRNA binding sites, and their expression patterns and role in biology have been reported (e.g., Bonauer et al, Curr Drug Targets 2010 11 :943-949; Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038/leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129: 1401-1414; Gentner and Naldini, Tissue Antigens.

2012 80:393-403 and all references therein; each of which is incorporated herein by reference in its entirety).

[0240] Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR- 142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0241] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific miRNAs are involved in immunogenicity, autoimmunity, the immune-response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue/organ transplantation. Immune cells specific miRNAs also regulate many aspects of development, proliferation, differentiation and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, particularly abundant in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be shut-off by adding miR-142 binding sites to the 3'-UTR of the polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al, blood, 2009, 114, 5152-5161; Brown BD, et al, Nat med. 2006, 12(5), 585-591; Brown BD, et al, blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety).

[0242] An antigen-mediated immune response can refer to an immune response

triggered by foreign antigens, which, when entering an organism, are processed by the antigen presenting cells and displayed on the surface of the antigen presenting cells.

T cells can recognize the presented antigen and induce a cytotoxic elimination of cells that express the antigen.

[0243] Introducing a miR-142 binding site into the 5' UTR and/or 3'UTR of a

polynucleotide of the invention can selectively repress gene expression in antigen presenting cells through miR-142 mediated degradation, limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing antigen- mediated immune response after the delivery of the polynucleotide. The

polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic elimination.

[0244] In one embodiment, binding sites for miRNAs that are known to be expressed in immune cells, in particular, antigen presenting cells, can be engineered into a polynucleotide of the invention to suppress the expression of the polynucleotide in antigen presenting cells through miRNA mediated RNA degradation, subduing the antigen-mediated immune response. Expression of the polynucleotide is maintained in non-immune cells where the immune cell specific miRNAs are not expressed. For example, in some embodiments, to prevent an immunogenic reaction against a liver

specific protein, any miR-122 binding site can be removed and a miR-142 (and/or mirR-146) binding site can be engineered into the 5' UTR and/or 3' UTR of a polynucleotide of the invention.

[0245] To further drive the selective degradation and suppression in APCs and

macrophage, a polynucleotide of the invention can include a further negative regulatory element in the 5' UTR and/or 3' UTR, either alone or in combination with miR-142 and/or miR-146 binding sites. As a non-limiting example, the further negative regulatory element is a Constitutive Decay Element (CDE).

[0246] Immune cell specific miRNAs include, but are not limited to, hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa- let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let- 7f-l— 3p, hsa-let-7f-2— 5p, hsa-let-7f-5p, miR-125b-l-3p, miR-125b-2-3p, miR-125b- 5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR- 150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-l-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR- 181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR- 21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-l-5p,miR-24-2-5p, miR-24-3p, miR- 26a-l-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR- 27a-5p, miR-27b-3p,miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-l-5p, miR-29b-2-5p, miR-29c-3p, miR-29c-5p„ miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR- 346, miR-34a-3p, miR-34a-5p, , miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR- 548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cell through micro-array hybridization and microtome analysis (e.g., Jima DD et al, Blood, 2010, 116:el l8-el27; Vaz C et al., BMC Genomics,

2010, 11,288, the content of each of which is incorporated herein by reference in its entirety.)

[0247] miRNAs that are known to be expressed in the liver include, but are not

limited to, miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-

1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p, and miR-939-5p. miRNA binding sites from any liver specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the liver. Liver specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0248] miRNAs that are known to be expressed in the lung include, but are not

limited to, let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127-3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, miR-134, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-1- 5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296-5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p, and miR-381-5p. miRNA binding sites from any lung specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the lung. Lung specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0249] miRNAs that are known to be expressed in the heart include, but are not

limited to, miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR- 451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR-499b-5p, miR-744-3p, miR- 744-5p, miR-92b-3p, and miR-92b-5p. miRNA binding sites from any heart specific microRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the heart. Heart specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0250] miRNAs that are known to be expressed in the nervous system include, but are not limited to, miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-l-3p, miR-125b- 2-3p, miR-125b-5p,miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a- 3p, miR-135a-5p, miR-135b-3p, miR-135b-5p, miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, miR-183-3p, miR- 183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-l-3p, miR-219-2- 3p, miR-23a-3p, miR-23a-5p,miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-l-3p, miR-30c-2-3p, miR-30c-5p, miR-30d-3p, miR-30d-5p, miR-329, miR-342-3p, miR-

3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR-425-3p, miR- 425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR-7-l-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p, and miR-9-5p. miRNAs enriched in the nervous system further include those specifically expressed in neurons, including, but not limited to, miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR- 325, miR-326, miR-328, miR-922 and those specifically expressed in glial cells, including, but not limited to, miR-1250, miR-219-l-3p, miR-219-2-3p, miR-219-5p, miR-23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p, and miR-657. miRNA binding sites from any CNS specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the nervous system. Nervous system specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0251] miRNAs that are known to be expressed in the pancreas include, but are not limited to, miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a- 3p, miR-196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a- 3p, miR-33a-3p, miR-33a-5p, miR-375, miR-7-l-3p, miR-7-2-3p, miR-493-3p, miR- 493-5p, and miR-944. miRNA binding sites from any pancreas specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the pancreas. Pancreas specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g. APC) miRNA binding sites in a polynucleotide of the invention.

[0252] miRNAs that are known to be expressed in the kidney include, but are not limited to, miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR- 194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, miR-216a-5p, miR-296-3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-l-3p, miR-30c-2-3p, miR30c-5p, miR-324-3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p, and miR-562. miRNA binding sites from any kidney specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the kidney. Kidney specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0253] miRNAs that are known to be expressed in the muscle include, but are not limited to, let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR-143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR- 206, miR-208a, miR-208b, miR-25-3p, and miR-25-5p. MiRNA binding sites from any muscle specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the muscle. Muscle specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRNA binding sites in a polynucleotide of the invention.

[0254] miRNAs are also differentially expressed in different types of cells, such as, but not limited to, endothelial cells, epithelial cells, and adipocytes.

[0255] miRNAs that are known to be expressed in endothelial cells include, but are not limited to, let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101- 5p, miR-126-3p, miR-126-5p, miR-1236-3p, miR-1236-5p, miR-130a-3p, miR-130a- 5p, miR-17-5p, miR-17-3p, miR-18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-l-5p, miR-19b-2-5p, miR-19b-3p, miR-20a-3p, miR-20a-5p, miR-217, miR-210, miR-21-3p, miR-21-5p, miR-221-3p, miR-221-5p, miR-222-3p, miR-222- 5p, miR-23a-3p, miR-23a-5p, miR-296-5p, miR-361-3p, miR-361-5p, miR-421, miR- 424-3p, miR-424-5p, miR-513a-5p, miR-92a-l-5p, miR-92a-2-5p, miR-92a-3p, miR- 92b-3p, and miR-92b-5p. Many novel miRNAs are discovered in endothelial cells from deep-sequencing analysis (e.g., Voellenkle C et al, RNA, 2012, 18, 472-484, herein incorporated by reference in its entirety). miRNA binding sites from any endothelial cell specific miRNA can be introduced to or removed from a

polynucleotide of the invention to regulate expression of the polynucleotide in the endothelial cells.

[0256] miRNAs that are known to be expressed in epithelial cells include, but are not limited to, let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR-200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR- 451b, miR-494, miR-802 and miR-34a, miR-34b-5p, miR-34c-5p, miR-449a, miR- 449b-3p, miR-449b-5p specific in respiratory ciliated epithelial cells, let-7 family, miR-133a, miR-133b, miR-126 specific in lung epithelial cells, miR-382-3p, miR- 382-5p specific in renal epithelial cells, and miR-762 specific in comeal epithelial cells. miRNA binding sites from any epithelial cell specific miRNA can be introduced to or removed from a polynucleotide of the invention to regulate expression of the polynucleotide in the epithelial cells.

[0257] In addition, a large group of miRNAs are enriched in embryonic stem cells, controlling stem cell self-renewal as well as the development and/or differentiation of various cell lineages, such as neural cells, cardiac, hematopoietic cells, skin cells, osteogenic cells and muscle cells (e.g., Kuppusamy KT et al., Curr. Mol Med, 2013, 13(5), 757-764; Vidigal JA and Ventura A, Semin Cancer Biol. 2012, 22(5-6), 428- 436; Goff LA et al, PLoS One, 2009, 4:e7192; Morin RD et al, Genome

Res, 2008, 18, 610-621; Yoo JK et al., Stem Cells Dev. 2012, 21(11), 2049-2057, each of which is herein incorporated by reference in its entirety). miRNAs abundant in embryonic stem cells include, but are not limited to, let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p, miR-103a-5p, miR-106b-3p, miR-106b-5p, miR- 1246, miR-1275, miR-138-l-3p, miR-138-2-3p, miR-138-5p, miR-154-3p, miR-154- 5p, miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a- 3p, miR-302a-5p, miR-302b-3p, miR-302b-5p, miR-302c-3p, miR-302c-5p, miR- 302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367-5p, miR-369-3p, miR-369- 5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486- 5p, miR-520c-3p, miR-548e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR- 548k, miR-5481, miR-548m, miR-548n, miR-548o-3p, miR-548o-5p, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR-885-3p, miR-885-5p,miR-93-3p, miR-93-5p, miR-941,miR-96-3p, miR-96-5p, miR-99b-3p and miR-99b-5p. Many predicted novel miRNAs are discovered by deep sequencing in human embryonic stem cells (e.g., Morin RD et al, Genome

Res,2008,18, 610-621; Goff LA et al, PLoS One, 2009, 4:e7192; Bar M et al, Stem cells, 2008, 26, 2496-2505, the content of each of which is incorporated herein by reference in its entirety).

[0258] In some embodiments, miRNAs are selected based on expression and

abundance in immune cells of the hematopoietic lineage, such as B cells, T cells, macrophages, dendritic cells, and cells that are known to express TLR7/ TLR8 and/or able to secrete cytokines such as endothelial cells and platelets. In some embodiments, the miRNA set thus includes miRs that may be responsible in part for the

immunogenicity of these cells, and such that a corresponding miR-site incorporation in polynucleotides of the present invention (e.g., mRNAs) could lead to

destabilization of the mRNA and/or suppression of translation from these mRNAs in the specific cell type. Non-limiting representative examples include miR-142, miR- 144, miR-150, miR-155 and miR-223, which are specific for many of the

hematopoietic cells; miR-142, miR150, miR-16 and miR-223, which are expressed in B cells; miR-223, miR-451, miR-26a, miR-16, which are expressed in progenitor hematopoietic cells; and miR-126, which is expressed in plasmacytoid dendritic cells, platelets and endothelial cells. For further discussion of tissue expression of miRs see e.g., Teruel-Montoya, R. et al. (2014) PLoS One 9:el02259; Landgraf, P. et al. (2007) Cell 129: 1401-1414; Bissels, U. et al. (2009) RNA 15:2375-2384. Any one miR-site incorporation in the 3' UTR and/or 5' UTR may mediate such effects in multiple cell types of interest (e.g., miR-142 is abundant in both B cells and dendritic cells).

[0259] In some embodiments, it may be beneficial to target the same cell type with multiple miRs and to incorporate binding sites to each of the 3p and 5p arm if both are abundant (e.g., both miR-142-3p and miR142-5p are abundant in hematopoietic stem cells). Thus, in certain embodiments, polynucleotides of the invention contain two or more (e.g., two, three, four or more) miR bindings sites from: (i) the group consisting of miR-142, miR-144, miR-150, miR-155 and miR-223 (which are expressed in many hematopoietic cells); or (ii) the group consisting of miR-142, miR150, miR-16 and miR-223 (which are expressed in B cells); or the group consisting of miR-223, miR- 451, miR-26a, miR-16 (which are expressed in progenitor hematopoietic cells).

[0260] In some embodiments, it may also be beneficial to combine various miRs such that multiple cell types of interest are targeted at the same time (e.g., miR-142 and miR-126 to target many cells of the hematopoietic lineage and endothelial cells).

Thus, for example, in certain embodiments, polynucleotides of the invention comprise two or more (e.g., two, three, four or more) miRNA bindings sites, wherein: (i) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR- 144, miR-150, miR-155 or miR-223) and at least one of the miRs targets

plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (ii) at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (iii) at least one of the miRs targets progenitor hematopoietic cells (e.g., miR-223, miR-451, miR-26a or miR-16) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR- 126); or (iv) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223), at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or any other possible combination of the foregoing four classes of miR binding sites (i.e., those targeting the hematopoietic lineage, those targeting B cells, those targeting progenitor hematopoietic cells and/or those targeting plasmacytoid dendritic cells/platelets/endothelial cells).

[0261] In one embodiment, to modulate immune responses, polynucleotides of the present invention can comprise one or more miRNA binding sequences that bind to one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells) reduces or inhibits immune cell activation (e.g., B cell activation, as measured by frequency of activated B cells) and/or cytokine production (e.g., production of IL-6, IFN-g and/or TNFa). Furthermore, it has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells) can reduce or inhibit an anti-drug antibody (ADA) response against a protein of interest encoded by the mRNA.

[0262] In another embodiment, to modulate accelerated blood clearance of a

polynucleotide delivered in a lipid-comprising compound or composition, polynucleotides of the invention can comprise one or more miR binding sequences that bind to one or more miRNAs expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miR binding sites reduces or inhibits accelerated blood clearance (ABC) of the lipid-comprising compound or composition for use in delivering the mRNA. Furthermore, it has now been discovered that incorporation of one or more miR binding sites into an mRNA reduces serum levels of anti-PEG anti-

IgM (e.g., reduces or inhibits the acute production of IgMs that recognize polyethylene glycol (PEG) by B cells) and/or reduces or inhibits proliferation and/or activation of plasmacytoid dendritic cells following administration of a lipid- comprising compound or composition comprising the mRNA.

[0263] In some embodiments, miR sequences may correspond to any known

microRNA expressed in immune cells, including but not limited to those taught in US Publication US2005/0261218 and US Publication US2005/0059005, the contents of which are incorporated herein by reference in their entirety. Non-limiting examples of miRs expressed in immune cells include those expressed in spleen cells, myeloid cells, dendritic cells, plasmacytoid dendritic cells, B cells, T cells and/or

macrophages. For example, miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24 and miR-27 are expressed in myeloid cells, miR-155 is expressed in dendritic cells, B cells and T cells, miR-146 is upregulated in macrophages upon TLR stimulation and miR-126 is expressed in plasmacytoid dendritic cells. In certain embodiments, the miR(s) is expressed abundantly or preferentially in immune cells. For example, miR- 142 (miR-142-3p and/or miR-142-5p), miR-126 (miR-126-3p and/or miR-126-5p), miR-146 (miR-146-3p and/or miR-146-5p) and miR-155 (miR- 155-3p and/or miR155-5p) are expressed abundantly in immune cells. These microRNA sequences are known in the art and, thus, one of ordinary skill in the art can readily design binding sequences or target sequences to which these microRNAs will bind based upon Watson-Crick complementarity.

[0264] Accordingly, in various embodiments, polynucleotides of the present

invention comprise at least one microRNA binding site for a miR selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR- 223, miR-24 and miR-27. In another embodiment, the mRNA comprises at least two miR binding sites for microRNAs expressed in immune cells. In various

embodiments, the polynucleotide of the invention comprises 1-4, one, two, three or four miR binding sites for microRNAs expressed in immune cells. In another embodiment, the polynucleotide of the invention comprises three miR binding sites. These miR binding sites can be for microRNAs selected from the group consisting of miR-142, miR-146, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24, miR-27, and combinations thereof. In one embodiment, the polynucleotide of the invention comprises two or more (e.g., two, three, four) copies of the same miR binding site expressed in immune cells, e.g., two or more copies of a miR binding site selected from the group of miRs consisting of miR-142, miR-146, miR-155, miR-126, miR- 16, miR-21, miR-223, miR-24, miR-27.

[0265] In one embodiment, the polynucleotide of the invention comprises three

copies of the same miRNA binding site. In certain embodiments, use of three copies of the same miR binding site can exhibit beneficial properties as compared to use of a single miRNA binding site. Non-limiting examples of sequences for 3' UTRs containing three miRNA bindings sites are shown in SEQ ID NO: 155 (three miR-142 - 3p binding sites) and SEQ ID NO: 157 (three miR-142-5p binding sites).

[0266] In another embodiment, the polynucleotide of the invention comprises two or more (e.g., two, three, four) copies of at least two different miR binding sites expressed in immune cells. Non-limiting examples of sequences of 3' UTRs containing two or more different miR binding sites are shown in SEQ ID NO: 152 (one miR-142-3p binding site and one miR-126-3p binding site), SEQ ID NO: 158 (two miR-142-5p binding sites and one miR-142-3p binding sites), and SEQ ID NO: 161 (two miR-155-5p binding sites and one miR-142-3p binding sites).

[0267] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-142-3p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-142-3p and miR-155 (miR-155-3p or miR-155-5p), miR-142-3p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-3p and miR-126 (miR-126-3p or miR-126-5p).

[0268] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-126-3p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-126-3p and miR-155 (miR-155-3p or miR-155-5p), miR-126-3p and miR-146 (miR-146-3p or miR-146-5p), or miR-126-3p and miR-142 (miR-142-3p or miR-142-5p).

[0269] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-142-5p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-142-5p and miR-155 (miR-155-3p or miR-155-5p), miR-142-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-5p and miR-126 (miR-126-3p or miR-126-5p).

[0270] In yet another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-155-5p. In various embodiments, the

polynucleotide of the invention comprises binding sites for miR-155-5p and miR-142 (miR-142-3p or miR-142-5p), miR-155-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-155-5p and miR-126 (miR-126-3p or miR-126-5p).

[0271] miRNA can also regulate complex biological processes such as angiogenesis

(e.g., miR- 132) (Anand and Cheresh Curr Opin Hematol 2011 18: 171-176). In the polynucleotides of the invention, miRNA binding sites that are involved in such processes can be removed or introduced, in order to tailor the expression of the polynucleotides to biologically relevant cell types or relevant biological processes. In this context, the polynucleotides of the invention are defined as auxotrophic polynucleotides.

[0272] In some embodiments, a polynucleotide of the invention comprises a miRNA binding site, wherein the miRNA binding site comprises one or more nucleotide sequences selected from Table 4, including one or more copies of any one or more of the miRNA binding site sequences. In some embodiments, a polynucleotide of the invention further comprises at least one, two, three, four, five, six, seven, eight, nine, ten, or more of the same or different miRNA binding sites selected from Table 4, including any combination thereof.

[0273] In some embodiments, the miRNA binding site binds to miR-142 or is

complementary to miR-142. In some embodiments, the miR-142 comprises SEQ ID NO: 114. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142-3p binding site comprises SEQ ID NO: 116. In some embodiments, the miR-142-5p binding site comprises SEQ ID NO: 118. In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 116 or SEQ ID NO: 118.

[0274] In some embodiments, the miRNA binding site binds to miR-126 or is

complementary to miR-126. In some embodiments, the miR-126 comprises SEQ ID NO: 119. In some embodiments, the miRNA binding site binds to miR-126-3p or miR-126-5p. In some embodiments, the miR-126-3p binding site comprises SEQ ID NO: 121. In some embodiments, the miR-126-5p binding site comprises SEQ ID NO: 123. In some embodiments, the miRNA binding site comprises a nucleotide

sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 121 or SEQ ID NO: 123.

[0275] In one embodiment, the 3' UTR comprises two miRNA binding sites, wherein a first miRNA binding site binds to miR-142 and a second miRNA binding site binds to miR-126. In a specific embodiment, the 3' UTR binding to miR-142 and miR-126 comprises, consists, or consists essentially of the sequence of SEQ ID NO: 98 or 163.

TABLE 4. miR-142, miR-126, and miR-142 and miR-126 binding sites


[0276] In some embodiments, a miRNA binding site is inserted in the polynucleotide of the invention in any position of the polynucleotide (e.g., the 5' UTR and/or 3'

UTR). In some embodiments, the 5' UTR comprises a miRNA binding site. In some embodiments, the 3' UTR comprises a miRNA binding site. In some embodiments, the 5' UTR and the 3' UTR comprise a miRNA binding site. The insertion site in the polynucleotide can be anywhere in the polynucleotide as long as the insertion of the miRNA binding site in the polynucleotide does not interfere with the translation of a functional polypeptide in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site in the polynucleotide and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing the translation of the polynucleotide.

[0277] In some embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention comprising the ORF. In some embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention. In some embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention.

[0278] In some embodiments, a miRNA binding site is inserted within the 3' UTR immediately following the stop codon of the coding region within the polynucleotide of the invention, e.g., mRNA. In some embodiments, if there are multiple copies of a stop codon in the construct, a miRNA binding site is inserted immediately following the final stop codon. In some embodiments, a miRNA binding site is inserted further downstream of the stop codon, in which case there are 3' UTR bases between the stop codon and the miR binding site(s). In some embodiments, three non-limiting examples of possible insertion sites for a miR in a 3' UTR are shown in SEQ ID NOs: 162, 163, and 164, which show a 3' UTR sequence with a miR-142-3p site inserted in one of three different possible insertion sites, respectively, within the 3' UTR.

[0279] In some embodiments, one or more miRNA binding sites can be positioned within the 5' UTR at one or more possible insertion sites. For example, three non limiting examples of possible insertion sites for a miR in a 5' UTR are shown in SEQ ID NOs: 165, 166, or 167, which show a 5' UTR sequence with a miR-142-3p site inserted into one of three different possible insertion sites, respectively, within the 5' UTR.

[0280] In one embodiment, a codon optimized open reading frame encoding a

polypeptide of interest comprises a stop codon and the at least one microRNA binding site is located within the 3' UTR 1-100 nucleotides after the stop codon. In one embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR 30-50 nucleotides after the stop codon. In another embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR at least 50 nucleotides after the stop codon. In other embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR immediately after the stop codon, or within the 3' UTR 15-20 nucleotides after the stop codon or within the 3' UTR 70-80 nucleotides after the stop codon. In other embodiments, the 3' UTR comprises more than one miRNA bindingsite (e.g., 2-4 miRNA binding sites), wherein there can be a spacer region (e.g., of 10-100, 20-70 or 30-50 nucleotides in length) between each miRNA bindingsite. In another embodiment, the 3' UTR comprises a spacer region between the end of the miRNA bindingsite(s) and the poly A tail nucleotides. For example, a spacer region of 10-100, 20-70 or 30-50 nucleotides in length can be situated between the end of the miRNA bindingsite(s) and the beginning of the poly A tail.

[0281] In one embodiment, a codon optimized open reading frame encoding a

polypeptide of interest comprises a start codon and the at least one microRNA binding site is located within the 5' UTR 1-100 nucleotides before (upstream ol) the start codon. In one embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5' UTR 10-50 nucleotides before (upstream ol) the start codon. In another embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5' UTR at least 25 nucleotides before (upstream ol) the start codon. In other embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5' UTR immediately before the start codon, or within the 5' UTR 15-20 nucleotides before the start codon or within the 5' UTR 70-80 nucleotides before the start codon. In other embodiments, the 5' UTR comprises more than one miRNA binding site (e.g., 2-4 miRNA binding sites), wherein there can be a spacer region (e.g., of 10-100, 20-70 or 30-50 nucleotides in length) between each miRNA binding site.

[0282] In one embodiment, the 3' UTR comprises more than one stop codon, wherein at least one miRNA binding site is positioned downstream of the stop codons. For example, a 3' UTR can comprise 1, 2 or 3 stop codons. Non-limiting examples of triple stop codons that can be used include: UGAUAAUAG (SEQ ID NO: 124), UGAUAGUAA (SEQ ID NO: 125), UAAUGAUAG (SEQ ID NO: 126),

UGAUAAUAA (SEQ ID NO: 127), UGAUAGUAG (SEQ ID NO: 128),

UAAUGAUGA (SEQ ID NO: 129), UAAUAGUAG (SEQ ID NO: 130),

UGAUGAUGA (SEQ ID NO: 131), UAAUAAUAA (SEQ ID NO: 132), and

UAGUAGUAG (SEQ ID NO: 133). Within a 3' UTR, for example, 1, 2, 3 or 4 miRNA binding sites, e.g., miR-142-3p binding sites, can be positioned immediately adjacent to the stop codon(s) or at any number of nucleotides downstream of the final stop codon. When the 3' UTR comprises multiple miRNA binding sites, these binding sites can be positioned directly next to each other in the construct (i.e., one after the other) or, alternatively, spacer nucleotides can be positioned between each binding site.

[0283] In one embodiment, the 3' UTR comprises three stop codons with a single miR-142-3p binding site located downstream of the 3rd stop codon. Non-limiting examples of sequences of 3' UTR having three stop codons and a single miR-142-3p binding site located at different positions downstream of the final stop codon are shown in SEQ ID NOs: 151, 162, 163, and 164.

TABLE 5A. 5' UTRs, 3'UTRs, miR sequences, and miR binding sites






Stop codon = bold

miR 142-3p binding site = underline

miR 126-3p binding site = bold underline

miR 155-5p binding site = shaded

miR 142-5p binding site = shaded and bold underline

TABLE 5B. Exemplary Preferred UTRs



[0284] In one embodiment, the polynucleotide of the invention comprises a 5' UTR, a codon optimized open reading frame encoding a polypeptide of interest, a 3' UTR comprising the at least one miRNA binding site for a miR expressed in immune cells, and a 3' tailing region of linked nucleosides. In various embodiments, the 3' UTR comprises 1-4, at least two, one, two, three or four miRNA binding sites for miRs expressed in immune cells, preferably abundantly or preferentially expressed in immune cells.

[0285] In one embodiment, the at least one miRNA expressed in immune cells is a miR-142-3p microRNA binding site. In one embodiment, the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 116. In one embodiment, the 3' UTR of the mRNA comprising the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 134.

[0286] In one embodiment, the at least one miRNA expressed in immune cells is a miR-126 microRNA binding site. In one embodiment, the miR-126 binding site is a miR-126-3p binding site. In one embodiment, the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 121. In one embodiment, the 3' UTR of the mRNA of the invention comprising the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 149.

[0287] Non-limiting exemplary sequences for miRs to which a microRNA binding site(s) of the disclosure can bind include the following: miR-142-3p (SEQ ID

NO: 115), miR-142-5p (SEQ ID NO: 117), miR-146-3p (SEQ ID NO: 135), miR-146- 5p (SEQ ID NO: 136), miR-155-3p (SEQ ID NO: 137), miR-155-5p (SEQ ID

NO: 138), miR-126-3p (SEQ ID NO: 120), miR-126-5p (SEQ ID NO: 122), miR-16-3p (SEQ ID NOT39), miR-16-5p (SEQ ID NO: 140), miR-21-3p (SEQ ID NOT41), miR-21-5p (SEQ ID NO: 142), miR-223-3p (SEQ ID NO: 143), miR-223-5p (SEQ ID NO: 144), miR-24-3p (SEQ ID NO: 145), miR-24-5p (SEQ ID NO: 146), miR-27-3p (SEQ ID NO: 147) and miR-27-5p (SEQ ID NO: 148). Other suitable miR sequences expressed in immune cells (e.g., abundantly or preferentially expressed in immune cells) are known and available in the art, for example at the University of

Manchester’s microRNA database, miRBase. Sites that bind any of the

aforementioned miRs can be designed based on Watson-Crick complementarity to the miR, typically 100% complementarity to the miR, and inserted into an mRNA construct of the disclosure as described herein.

[0288] In another embodiment, a polynucleotide of the present invention (e.g., and mRNA, e.g., the 3' UTR thereol) can comprise at least one miRNA bindingsite to thereby reduce or inhibit accelerated blood clearance, for example by reducing or inhibiting production of IgMs, e.g., against PEG, by B cells and/or reducing or inhibiting proliferation and/or activation of pDCs, and can comprise at least one miRNA bindingsite for modulating tissue expression of an encoded protein of interest.

[0289] miRNA gene regulation can be influenced by the sequence surrounding the miRNA such as, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence and/or structural elements in the surrounding sequence. The miRNA can be influenced by the 5'UTR and/or 3'UTR.

As a non-limiting example, a non-human 3'UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3' UTR of the same sequence type.

[0290] In one embodiment, other regulatory elements and/or structural elements of the 5' UTR can influence miRNA mediated gene regulation. One example of a regulatory element and/or structural element is a structured IRES (Internal Ribosome Entry Site) in the 5' UTR, which is necessary for the binding of translational elongation factors to initiate protein translation. EIF4A2 binding to this secondarily structured element in the 5'-UTR is necessary for miRNA mediated gene expression (Meijer HA et al, Science, 2013, 340, 82-85, herein incorporated by reference in its entirety). The polynucleotides of the invention can further include this structured 5' UTR in order to enhance microRNA mediated gene regulation.

[0291] At least one miRNA binding site can be engineered into the 3' UTR of a

polynucleotide of the invention. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into a 3' UTR of a polynucleotide of the invention. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding sites can be engineered into the 3'UTR of a polynucleotide of the invention. In one embodiment, miRNA binding sites incorporated into a

polynucleotide of the invention can be the same or can be different miRNA sites. A combination of different miRNA binding sites incorporated into a polynucleotide of the invention can include combinations in which more than one copy of any of the different miRNA sites are incorporated. In another embodiment, miRNA binding sites incorporated into a polynucleotide of the invention can target the same or different tissues in the body. As a non-limiting example, through the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites in the 3'-UTR of a polynucleotide of the invention, the degree of expression in specific cell types (e.g., myeloid cells, endothelial cells, etc.) can be reduced.

[0292] In one embodiment, a miRNA binding site can be engineered near the 5' terminus of the 3'UTR, about halfway between the 5' terminus and 3' terminus of the 3'UTR and/or near the 3' terminus of the 3' UTR in a polynucleotide of the invention.

As a non-limiting example, a miRNA binding site can be engineered near the 5' terminus of the 3'UTR and about halfway between the 5' terminus and 3' terminus of the 3'UTR. As another non-limiting example, a miRNA binding site can be engineered near the 3' terminus of the 3'UTR and about halfway between the 5' terminus and 3' terminus of the 3' UTR. As yet another non-limiting example, a miRNA binding site can be engineered near the 5' terminus of the 3' UTR and near the 3' terminus of the 3' UTR.

[0293] In another embodiment, a 3'UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to a miRNA, miRNA seed sequence, and/or miRNA sequences flanking the seed sequence.

[0294] In some embodiments, the expression of a polynucleotide of the invention can be controlled by incorporating at least one sensor sequence in the polynucleotide and formulating the polynucleotide for administration. As a non-limiting example, a polynucleotide of the invention can be targeted to a tissue or cell by incorporating a miRNA binding site and formulating the polynucleotide in a lipid nanoparticle comprising an ionizable lipid, including any of the lipids described herein.

[0295] A polynucleotide of the invention can be engineered for more targeted

expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in the different tissues, cell types, or biological conditions. Through introduction of tissue-specific miRNA binding sites, a polynucleotide of the invention can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition.

[0296] In some embodiments, a polynucleotide of the invention can be designed to incorporate miRNA binding sites that either have 100% identity to known miRNA seed sequences or have less than 100% identity to miRNA seed sequences. In some embodiments, a polynucleotide of the invention can be designed to incorporate miRNA binding sites that have at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to known miRNA seed sequences. The miRNA seed sequence can be partially mutated to decrease miRNA binding affinity and as such result in reduced downmodulation of the polynucleotide. In essence, the degree of match or mis-match between the miRNA binding site and the miRNA seed can act as a rheostat to more finely tune the ability of the miRNA to modulate protein expression. In addition, mutation in the non-seed region of a miRNA binding site can also impact the ability of a miRNA to modulate protein expression.

[0297] In one embodiment, a miRNA sequence can be incorporated into the loop of a stem loop.

[0298] In another embodiment, a miRNA seed sequence can be incorporated in the loop of a stem loop and a miRNA binding site can be incorporated into the 5' or 3' stem of the stem loop.

[0299] In one embodiment the miRNA sequence in the 5' UTR can be used to

stabilize a polynucleotide of the invention described herein.

[0300] In another embodiment, a miRNA sequence in the 5' UTR of a polynucleotide of the invention can be used to decrease the accessibility of the site of translation initiation such as, but not limited to a start codon. See, e.g., Matsuda et al, PLoS One. 2010 1 l(5):el5057; incorporated herein by reference in its entirety, which used antisense locked nucleic acid (LNA) oligonucleotides and exon-junction complexes (EJCs) around a start codon (-4 to +37 where the A of the AUG codons is +1) in order to decrease the accessibility to the first start codon (AUG). Matsuda showed that altering the sequence around the start codon with an LNA or EJC affected the efficiency, length and structural stability of a polynucleotide. A polynucleotide of the invention can comprise a miRNA sequence, instead of the LNA or EJC sequence described by Matsuda et al, near the site of translation initiation in order to decrease the accessibility to the site of translation initiation. The site of translation initiation can be prior to, after or within the miRNA sequence. As a non-limiting example, the site of translation initiation can be located within a miRNA sequence such as a seed sequence or binding site.

[0301] In some embodiments, a polynucleotide of the invention can include at least one miRNA in order to dampen the antigen presentation by antigen presenting cells. The miRNA can be the complete miRNA sequence, the miRNA seed sequence, the miRNA sequence without the seed, or a combination thereof. As a non-limiting example, a miRNA incorporated into a polynucleotide of the invention can be specific to the hematopoietic system. As another non-limiting example, a miRNA

incorporated into a polynucleotide of the invention to dampen antigen presentation is miR-142-3p.

[0302] In some embodiments, a polynucleotide of the invention can include at least one miRNA in order to dampen expression of the encoded polypeptide in a tissue or cell of interest. As a non-limiting example a polynucleotide of the invention can include at least one miR-142-3p binding site, miR-142-3p seed sequence, miR-142-3p

binding site without the seed, miR-142-5p binding site, miR-142-5p seed sequence, miR-142-5p binding site without the seed, miR-146 binding site, miR-146 seed sequence and/or miR-146 binding site without the seed sequence.

[0303] In some embodiments, a polynucleotide of the invention can comprise at least one miRNA binding site in the 3'UTR in order to selectively degrade mRNA therapeutics in the immune cells to subdue unwanted immunogenic reactions caused by therapeutic delivery. As a non-limiting example, the miRNA binding site can make a polynucleotide of the invention more unstable in antigen presenting cells. Non-limiting examples of these miRNAs include miR-142-5p, miR-142-3p, miR- 146a-5p, and miR-146-3p.

[0304] In one embodiment, a polynucleotide of the invention comprises at least one miRNA sequence in a region of the polynucleotide that can interact with a RNA binding protein.

[0305] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprising (i) a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereol) and (ii) a miRNA binding site (e.g., a miRNA binding site that binds to miR-142) and/or a miRNA binding site that binds to miR-126.

12. 3' UTRs

[0306] In certain embodiments, a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide of the invention) further comprises a 3' UTR.

[0307] 3'-UTR is the section of mRNA that immediately follows the translation termination codon and often contains regulatory regions that post-transcriptionally influence gene expression. Regulatory regions within the 3'-UTR can influence polyadenylation, translation efficiency, localization, and stability of the mRNA. In one embodiment, the 3'-UTR useful for the invention comprises a binding site for regulatory proteins or microRNAs.

[0308] In certain embodiments, the 3' UTR useful for the polynucleotides of the invention comprises a 3' UTR selected from the group consisting of SEQ ID NO: 151 and 104 to 112, or any combination thereof. In certain embodiments, the 3' UTR useful for the polynucleotides of the invention comprises a 3' UTR selected from the group consisting of SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 195, SEQ ID

NO: 196, SEQ ID NO:4, SEQ ID NO: 177, SEQ ID NO: 111, or SEQ ID NO: 178, or any combination thereof. In some embodiments, the 3' UTR comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 111, 112, or any combination thereof. In some embodiments, the 3' UTR comprises a nucleic acid sequence of SEQ ID NO: 111. In some embodiments, the 3' UTR comprises a nucleic acid sequence of SEQ ID NO: 112. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 150. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 151. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 178. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 175. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 195. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID

NO: 196. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO:4. In some embodiments, the 3’UTR comprises a nucleic acid sequence of SEQ ID NO: 177.

[0309] In certain embodiments, the 3' UTR sequence useful for the invention

comprises a nucleotide sequence at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 3' UTR sequences selected from the group consisting of SEQ ID NO: 104 to 112, 150, 151, and 178, or any combination thereof.

[0310] In certain embodiments, the 3' UTR sequence useful for the invention

comprises a nucleotide sequence at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 3' UTR sequences selected from the group consisting of SEQ ID NO: 150, SEQ ID NO: 175, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO:4, SEQ ID NO: 177, SEQ ID NO: 111, and SEQ ID NO: 178, or any combination thereof.

13. Regions having a 5' Cap

[0311] The disclosure also includes a polynucleotide that comprises both a 5' Cap and a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide).

[0312] The 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5' proximal introns during mRNA splicing.

[0313] Endogenous mRNA molecules can be 5 '-end capped generating a 5'-ppp-5'- triphosphate linkage between a terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5' end of the mRNA can optionally also be 2'-0-methylated. 5 '-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation.

[0314] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) incorporate a cap moiety.

[0315] In some embodiments, polynucleotides of the present invention (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5'-ppp-5' phosphorodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with a-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional modified guanosine nucleotides can be used such as a-methyl- phosphonate and seleno-phosphate nucleotides.

[0316] Additional modifications include, but are not limited to, 2'-0-methylation of the ribose sugars of 5'-terminal and/or 5'-anteterminal nucleotides of the

polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5 '-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e.. endogenous, wild-type or physiological) 5 '-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e.. non-enzymatically) or enzymatically synthesized and/or linked to the polynucleotides of the invention.

[0317] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two

guanines linked by a 5 '-5 '-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-0-methyl group (i.e.. N7.3'-0-dimethyl-guanosine-5'- triphosphate-5'-guanosine (m7G-3'mppp-G; which can equivalently be designated 3' 0-Me-m7G(5')ppp(5')G). The 3'-0 atom of the other, unmodified, guanine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-0- methlyated guanine provides the terminal moiety of the capped polynucleotide.

[0318] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-0- methyl group on guanosine (i.e.. N7.2'-0-dimethyl-guanosine-5'-triphosphate-5'- guanosine, m7Gm-ppp-G).

[0319] In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety.

[0320] In another embodiment, the cap is a cap analog is aN7-(4- chlorophenoxy ethyl) substituted dinucleotide form of a cap analog known in the art and/or described herein. Non-limiting examples of aN7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog include a N7-(4-chlorophenoxyethyl)- G(5')ppp(5')G and aN7-(4-chlorophenoxyethyl)-m3’°G(5')ppp(5')G cap analog (See, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574; the contents of which are herein incorporated by reference in its entirety). In another embodiment, a cap analog of the present invention is a 4-chloro/bromophenoxy ethyl analog.

[0321] While cap analogs allow for the concomitant capping of a polynucleotide or a region thereof, in an in vitro transcription reaction, up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5 '-cap structures of nucleic acids produced by the endogenous, cellular transcription machinery, can lead to reduced translational competency and reduced cellular stability.

[0322] Polynucleotides of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) can also be capped post manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and/or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5 'cap structures of the present invention are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5' endonucleases and/or reduced 5 'decapping, as compared to synthetic 5 'cap structures known in the art (or to a wild-type, natural or physiological 5'cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-0- methyltransferase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5 '-terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-0-methyl. Such a structure is termed the Capl structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), and 7mG(5')- ppp(5')NlmpN2mp (cap 2).

[0323] As a non-limiting example, capping chimeric polynucleotides post

manufacture can be more efficient as nearly 100% of the chimeric polynucleotides can be capped. This is in contrast to -80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction.

[0324] According to the present invention, 5' terminal caps can include endogenous caps or cap analogs. According to the present invention, a 5' terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

14. Poly-A Tails

[0325] In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly- A tail comprises des-3' hydroxyl tails.

[0326] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to free a 3' hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including

approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210,

220, 230, 240 or 250 residues long. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO:272).

[0327] PolyA tails can also be added after the construct is exported from the nucleus.

[0328] According to the present invention, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present invention can include des-3' hydroxyl tails. They can also include structural moieties or 2'-Omethyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety).

[0329] The polynucleotides of the present invention can be designed to encode

transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication- dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3' poly(A) tail, the function of which is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs"

(Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013;

doi: 10.1038/nrm3645) the contents of which are incorporated herein by reference in its entirety.

[0330] Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present invention. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50,

55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900

2,000, 2,500, and 3,000 nucleotides).

[0331] In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides ( e.g from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000).

[0332] In some embodiments, the poly -A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides.

[0333] In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or

100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression.

[0334] Additionally, multiple distinct polynucleotides can be linked together via the

PABP (Poly-A binding protein) through the 3'-end using modified nucleotides at the

3'-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post-transfection.

[0335] In some embodiments, the polynucleotides of the present invention are

designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides (SEQ ID NO:273) alone.

15. Start codon region

[0336] The invention also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide). In some embodiments, the polynucleotides of the present invention can have regions that are analogous to or function like a start codon region.

[0337] In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG,

CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al.

Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of which are herein incorporated by reference in its entirety).

[0338] As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG.

[0339] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and/or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide.

[0340] In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 2010 5: 11); the contents of which are herein incorporated by reference in its entirety).

[0341] In another embodiment, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon.

[0342] In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and/or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide.

[0343] In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the

polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and/or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and/or the structure of the polynucleotide.

16. Stop Codon Region

[0344] The invention also includes a polynucleotide that comprises both a stop codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide). In some embodiments, the polynucleotides of the present invention can include at least two stop codons before the 3' untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case or DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further embodiment the addition stop codon can be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more.

17. Polynucleotide Comprising an mRNA Encoding a Wound Healing

Polypeptide

[0345] In certain embodiments, a polynucleotide of the present disclosure, for

example a polynucleotide comprising an mRNA nucleotide sequence encoding a wound healing polypeptide, comprises from 5' to 3' end:

(i) a 5' cap provided above;

(ii) a 5' UTR, such as the sequences provided above;

(iii) an ORF encoding a human wound healing polypeptide (e.g., a wound healing polypeptide described in Table 1);

(iv) at least one stop codon;

(v) a 3' UTR, such as the sequences provided above; and

(vi) a poly -A tail provided above.

[0346] In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miRNA-142. In some embodiments, the 5' UTR comprises the miRNA binding site. In some embodiments, the 3' UTR comprises the miRNA binding site.

[0347] In some embodiments, a polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the protein sequence of a wild type human wound healing polypeptide.

[0348] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5' cap provided above, for example, CAP1, (2) a 5' UTR, (3) a nucleotide sequence encoding a human wound healing polypeptide, (3) a stop codon, (4) a 3'UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of about 100 residues.

[0349] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a wound healing polypeptide, comprises (1) a 5' cap provided above, for example, CAP1, (2) a nucleotide sequence encoding a wound healing polypeptide (e.g., a wound healing polypeptide described in Table 1), and (3) a poly-A tail provided above, for example, a poly A tail of -100 residues. In certain embodiments, all uracils in the mRNA sequence encoding the wound healing polypeptide are replaced by 5-methoxyuracil.

18. Methods of Making Polynucleotides

[0350] The present disclosure also provides methods for making a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) or a complement thereof.

[0351] In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a wound healing polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a wound healing polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer.

[0352] In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a wound healing polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a wound healing polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0353] Naturally occurring nucleosides, non-naturally occurring nucleosides, or

combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence- optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a wound healing polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and/or produce a therapeutic outcome.

a. In vitro Transcription /Enzymatic Synthesis

[0354] The polynucleotides of the present invention disclosed herein (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) can be transcribed using an in vitro transcription (IVT) system. The system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase. The NTPs can be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs. The polymerase can be selected from, but is not limited to, T7 RNA polymerase, T3 RNA polymerase and mutant polymerases such as, but not limited to, polymerases able to incorporate polynucleotides disclosed herein. See U.S. Publ. No. US20130259923, which is herein incorporated by reference in its entirety.

[0355] Any number of RNA polymerases or variants can be used in the synthesis of the polynucleotides of the present invention. RNA polymerases can be modified by inserting or deleting amino acids of the RNA polymerase sequence. As a non-limiting example, the RNA polymerase can be modified to exhibit an increased ability to incorporate a 2'-modified nucleotide triphosphate compared to an unmodified RNA polymerase (see International Publication W02008078180 and U.S. Patent 8,101,385; herein incorporated by reference in their entireties).

[0356] Variants can be obtained by evolving an RNA polymerase, optimizing the RNA polymerase amino acid and/or nucleic acid sequence and/or by using other methods known in the art. As a non-limiting example, T7 RNA polymerase variants

can be evolved using the continuous directed evolution system set out by Esvelt et al. (Nature 472:499-503 (2011); herein incorporated by reference in its entirety) where clones of T7 RNA polymerase can encode at least one mutation such as, but not limited to, lysine at position 93 substituted for threonine (K93T), I4M, A7T, E63V, V64D, A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L,

Y178H, F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T243N, G259D, M267I, G280C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C, D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H523L, H524N, G542V, E565K, K577E, K577M, N601S, S684Y, L699I, K713E, N748D, Q754R, E775K, A827V, D851N or L864F. As another non-limiting example, T7 RNA polymerase variants can encode at least mutation as described in U.S. Pub. Nos. 20100120024 and 20070117112; herein incorporated by reference in their entireties. Variants of RNA polymerase can also include, but are not limited to, substitutional variants, conservative amino acid substitution, insertional variants, and/or deletional variants.

[0357] In one aspect, the polynucleotide can be designed to be recognized by the wild type or variant RNA polymerases. In doing so, the polynucleotide can be modified to contain sites or regions of sequence changes from the wild type or parent chimeric polynucleotide.

[0358] Polynucleotide or nucleic acid synthesis reactions can be carried out by

enzymatic methods utilizing polymerases. Polymerases catalyze the creation of phosphodi ester bonds between nucleotides in a polynucleotide or nucleic acid chain. Currently known DNA polymerases can be divided into different families based on amino acid sequence comparison and crystal structure analysis. DNA polymerase I (pol I) or A polymerase family, including the Klenow fragments of E. coli, Bacillus DNA polymerase I, Thermus aquaticus (Taq) DNA polymerases, and the T7 RNA and DNA polymerases, is among the best studied of these families. Another large family is DNA polymerase a (pol a) or B polymerase family, including all eukaryotic replicating DNA polymerases and polymerases from phages T4 and RB69. Although they employ similar catalytic mechanism, these families of polymerases differ in substrate specificity, substrate analog-incorporating efficiency, degree and rate for primer extension, mode of DNA synthesis, exonuclease activity, and sensitivity against inhibitors.

[0359] DNA polymerases are also selected based on the optimum reaction conditions they require, such as reaction temperature, pH, and template and primer

concentrations. Sometimes a combination of more than one DNA polymerases is employed to achieve the desired DNA fragment size and synthesis efficiency. For example, Cheng et al. increase pH, add glycerol and dimethyl sulfoxide, decrease denaturation times, increase extension times, and utilize a secondary thermostable DNA polymerase that possesses a 3' to 5' exonuclease activity to effectively amplify long targets from cloned inserts and human genomic DNA. (Cheng et al., PNAS 91 :5695-5699 (1994), the contents of which are incorporated herein by reference in their entirety). RNA polymerases from bacteriophage T3, T7, and SP6 have been widely used to prepare RNAs for biochemical and biophysical studies. RNA polymerases, capping enzymes, and poly-A polymerases are disclosed in the co pending International Publication No. WO2014/028429, the contents of which are incorporated herein by reference in their entirety.

[0360] In one aspect, the RNA polymerase which can be used in the synthesis of the polynucleotides of the present invention is a Syn5 RNA polymerase (see Zhu et al. Nucleic Acids Research 2013, doi: 10.1093/nar/gktl l93, which is herein incorporated by reference in its entirety). The Syn5 RNA polymerase was recently characterized from marine cyanophage Syn5 by Zhu et al. where they also identified the promoter sequence (see Zhu et al. Nucleic Acids Research 2013, the contents of which is herein incorporated by reference in its entirety). Zhu et al. found that Syn5 RNA polymerase catalyzed RNA synthesis over a wider range of temperatures and salinity as compared to T7 RNA polymerase. Additionally, the requirement for the initiating nucleotide at the promoter was found to be less stringent for Syn5 RNA polymerase as compared to the T7 RNA polymerase making Syn5 RNA polymerase promising for RNA synthesis.

[0361] In one aspect, a Syn5 RNA polymerase can be used in the synthesis of the polynucleotides described herein. As a non-limiting example, a Syn5 RNA polymerase can be used in the synthesis of the polynucleotide requiring a precise 3'- ter minus.

[0362] In one aspect, a Syn5 promoter can be used in the synthesis of the

polynucleotides. As a non-limiting example, the Syn5 promoter can be 5'- ATTGGGCACCCGTAAGGG-3 ' (SEQ ID NO: 185 as described by Zhu et al.

(Nucleic Acids Research 2013).

[0363] In one aspect, a Syn5 RNA polymerase can be used in the synthesis of

polynucleotides comprising at least one chemical modification described herein

and/or known in the art (see e.g., the incorporation of pseudo-UTP and 5Me-CTP described in Zhu et al. Nucleic Acids Research 2013).

[0364] In one aspect, the polynucleotides described herein can be synthesized using a Syn5 RNA polymerase which has been purified using modified and improved purification procedure described by Zhu et al. (Nucleic Acids Research 2013).

[0365] Various tools in genetic engineering are based on the enzymatic amplification of a target gene which acts as a template. For the study of sequences of individual genes or specific regions of interest and other research needs, it is necessary to generate multiple copies of a target gene from a small sample of polynucleotides or nucleic acids. Such methods can be applied in the manufacture of the polynucleotides of the invention. For example, polymerase chain reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), also called transcription mediated amplification (TMA), and/or rolling-circle amplification (RCA) can be utilized in the manufacture of one or more regions of the

polynucleotides of the present invention. Assembling polynucleotides or nucleic acids by a ligase is also widely used.

b. Chemical synthesis

[0366] Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide). For example, a single DNA or RNA oligomer containing a codon-optimized nucleotide sequence coding for the particular isolated polypeptide can be synthesized. In other aspects, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. In some aspects, the individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.

[0367] A polynucleotide disclosed herein (e.g., a RNA, e.g., an mRNA) can be

chemically synthesized using chemical synthesis methods and potential nucleobase substitutions known in the art. See, for example, International Publication Nos.

WO2014093924, WO2013052523; WO2013039857, WO2012135805,

WO2013151671; U.S. Publ. No. US20130115272; or U.S. Pat. Nos. US8999380 or US8710200, all of which are herein incorporated by reference in their entireties. c. Purification of Polynucleotides Encoding a Wound Healing

Polypeptide

[0368] Purification of the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) can include, but is not limited to, polynucleotide clean-up, quality assurance and quality control. Clean-up can be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNA™ oligo-T capture probes (EXIQON® Inc., Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC).

[0369] The term "purified" when used in relation to a polynucleotide such as a

"purified polynucleotide" refers to one that is separated from at least one contaminant. As used herein, a "contaminant" is any substance that makes another unfit, impure or inferior. Thus, a purified polynucleotide (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method.

[0370] In some embodiments, purification of a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) removes impurities that can reduce or remove an unwanted immune response, e.g., reducing cytokine activity.

[0371] In some embodiments, the polynucleotide of the invention (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) is purified prior to administration using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)).

[0372] In some embodiments, the polynucleotide of the invention (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) purified using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC, hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) presents increased expression of the encoded wound healing protein compared to the expression level obtained with the

same polynucleotide of the present disclosure purified by a different purification method.

[0373] In some embodiments, a column chromatography (e.g., strong anion exchange

HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) purified polynucleotide comprises a nucleotide sequence encoding a wound healing polypeptide comprising one or more of the point mutations known in the art.

[0374] In some embodiments, the use of RP-HPLC purified polynucleotide increases protein expression levels of the wound healing polypeptide in cells when introduced into those cells, e.g., by 10-100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% with respect to the expression levels of the wound healing protein in the cells before the RP-HPLC purified polynucleotide was introduced in the cells, or after a non-RP-HPLC purified polynucleotide was introduced in the cells.

[0375] In some embodiments, the use of RP-HPLC purified polynucleotide increases functional wound healing protein expression levels in cells when introduced into those cells, e.g., by 10-100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% with respect to the functional expression levels of wound healing protein in the cells before the RP-HPLC purified polynucleotide was introduced in the cells, or after a non-RP-HPLC purified polynucleotide was introduced in the cells.

[0376] In some embodiments, the use of RP-HPLC purified polynucleotide increases detectable would healing polypeptide activity in cells when introduced into those cells, e.g., by 10-100%, i.e., at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% with respect to the activity levels of functional wound

healing polypeptide in the cells before the RP-HPLC purified polynucleotide was introduced in the cells, or after a non-RP-HPLC purified polynucleotide was introduced in the cells.

[0377] In some embodiments, the purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure.

[0378] A quality assurance and/or quality control check can be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC. In another embodiment, the polynucleotide can be sequenced by methods including, but not limited to reverse-transcriptase-PCR.

L Quantification of Expressed Polynucleotides Encoding a Wound

Healing Polypeptide

[0379] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide), their expression products, as well as degradation products and metabolites can be quantified according to methods known in the art.

[0380] In some embodiments, the polynucleotides of the present invention can be quantified in exosomes or when derived from one or more bodily fluid. As used herein "bodily fluids" include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes can be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0381] In the exosome quantification method, a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion

chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.

[0382] The assay can be performed using construct specific probes, cytometry, qRT- PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes can be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes can also be isolated by size exclusion chromatography, density gradient

centrifugation, differential centrifugation, nanomembrane ultrafiltration,

immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.

[0383] These methods afford the investigator the ability to monitor, in real time, the level of polynucleotides remaining or delivered. This is possible because the polynucleotides of the present invention differ from the endogenous forms due to the structural or chemical modifications.

[0384] In some embodiments, the polynucleotide can be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis). A non-limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed in order to determine if the polynucleotide can be of proper size, check that no degradation of the polynucleotide has occurred. Degradation of the polynucleotide can be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).

19. Pharmaceutical Compositions and Formulations

[0385] The present invention provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.

[0386] In some embodiments, the composition or formulation can contain a

polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a wound healing polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a wound healing polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds miR- 126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27 and miR-26a.

[0387] Pharmaceutical compositions or formulation can optionally comprise one or more additional active substances, e.g., therapeutically and/or prophylactically active substances. Pharmaceutical compositions or formulation of the present invention can be sterile and/or pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers to polynucleotides to be delivered as described herein.

[0388] Formulations and pharmaceutical compositions described herein can be

prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.

[0389] A pharmaceutical composition or formulation in accordance with the present disclosure can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0390] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure can vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.

[0391] In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the invention. As a non-limiting example, the composition or formulation can contain 1, 2, 3, 4 or 5 polynucleotides of the invention. In some embodiments, the compositions or formulations described herein can comprise more than one type of polynucleotide. In some embodiments, the composition or formulation can comprise a polynucleotide in linear and circular form. In another embodiment, the composition or formulation can comprise a circular polynucleotide and an in vitro transcribed (IVT) polynucleotide. In yet another embodiment, the composition or formulation can comprise an IVT polynucleotide, a chimeric polynucleotide and a circular polynucleotide.

[0392] Although the descriptions of pharmaceutical compositions and formulations provided herein are principally directed to pharmaceutical compositions and formulations that are suitable for intradermal (e.g., using microneedles) or topical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for intradermal (e.g., using microneedles) or intradermal (e.g., using microneedles) or topical administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.

[0393] The present invention provides pharmaceutical formulations that comprise a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide). The polynucleotides described herein can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the polynucleotide); (4) alter the biodistribution (e.g., target the polynucleotide to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and/or (6) alter the release profile of encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery agent comprising, e.g., a compound having the Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having the Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233-342, e.g., Compound VI; or a compound having the Formula (VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about

50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0.

[0394] A pharmaceutically acceptable excipient, as used herein, includes, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersion or suspension aids, diluents, granulating and/or dispersing agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oil, coloring, sweetening or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers, chelants, cyoprotectants, and/or bulking agents, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety).

[0395] Exemplary diluents include, but are not limited to, calcium or sodium

carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and/or combinations thereof.

[0396] Exemplary granulating and/or dispersing agents include, but are not limited to, starches, pregelatinized starches, or microcrystalline starch, alginic acid, guar gum, agar, poly(vinyl-pyrrolidone), (providone), cross-linked poly(vinyl-pyrrolidone) (crospovidone), cellulose, methylcellulose, carboxymethyl cellulose, cross-linked

sodium carboxymethyl cellulose (croscarmellose), magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, etc., and/or combinations thereof.

[0397] Exemplary surface active agents and/or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether

[BRIJ®30]), PLUORINC®F 68, POLOXAMER®188, etc. and/or combinations thereof.

[0398] Exemplary binding agents include, but are not limited to, starch, gelatin,

sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethylcellulose, hydroxy ethylcellulose, hydroxypropyl methylcellulose, etc., and combinations thereof.

[0399] Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations. In order to prevent oxidation, antioxidants can be added to the formulations. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated

hydroxyanisole, m-cresol, methionine, butylated hydroxy toluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof.

[0400] Exemplary chelating agents include, but are not limited to,

ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof.

[0401] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof.

[0402] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisol,

ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof.

[0403] In some embodiments, the pH of polynucleotide solutions is maintained

between pH 5 and pH 8 to improve stability. Exemplary buffers to control pH can include, but are not limited to sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and/or combinations thereof.

[0404] Exemplary lubricating agents include, but are not limited to, magnesium

stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, etc., and combinations thereof.

[0405] The pharmaceutical composition or formulation described here can contain a cryoprotectant to stabilize a polynucleotide described herein during freezing.

Exemplary cryoprotectants include, but are not limited to mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof.

[0406] The pharmaceutical composition or formulation described here can contain a bulking agent in lyophibzed polynucleotide formulations to yield a "pharmaceutically elegant" cake, stabilize the lyophibzed polynucleotides during long term (e.g., 36 month) storage. Exemplary bulking agents of the present invention can include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose, raffmose, and combinations thereof.

[0407] In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. The delivery agent of the present disclosure can include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof.

20. Delivery Agents

a. Lipid Compound

[0408] The present disclosure provides pharmaceutical compositions with

advantageous properties. The lipid compositions described herein may be

advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example,

the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

[0409] In certain embodiments, the present application provides pharmaceutical compositions comprising:

(a) a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide; and

(b) a delivery agent.

Lipid Nanoparticle Formulations

[0410] In some embodiments, nucleic acids of the invention (e.g., mRNA encoding a wound healing polypeptide) are formulated in a lipid nanoparticle (LNP). Lipid nanoparticles typically comprise ionizable cationic lipid, non-cationic lipid, sterol and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles of the invention can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551; PCT/US2015/027400;

PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280;

PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077;

PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610;

PCT/US2017/027492; PCT/US2016/059575 and PCT/US2016/069491 all of which are incorporated by reference herein in their entirety.

[0411] Nucleic acids of the present disclosure (e.g., mRNA encoding a wound healing polypeptide) are typically formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non- cationic lipid, at least one sterol, and/or at least one polyethylene glycol (PEG)- modified lipid.

[0412] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20- 60% ionizable cationic lipid. For example, the lipid nanoparticle may comprise a

molar ratio of 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, 30-40%, 40-60%, 40- 50%, or 50-60% ionizable cationic lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 20%, 30%, 40%, 50, or 60% ionizable cationic lipid.

[0413] In some embodiments, the lipid nanoparticle comprises a molar ratio of 5-25% non-cationic lipid. For example, the lipid nanoparticle may comprise a molar ratio of 5-20%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, or 20-25% non- cationic lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 5%, 10%, 15%, 20%, or 25% non-cationic lipid.

[0414] In some embodiments, the lipid nanoparticle comprises a molar ratio of 25- 55% sterol. For example, the lipid nanoparticle may comprise a molar ratio of 25- 50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30- 35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45- 50%, or 50-55% sterol. In some embodiments, the lipid nanoparticle comprises a molar ratio of 25%, 30%, 35%, 40%, 45%, 50%, or 55% sterol.

[0415] In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5- 15% PEG-modified lipid. For example, the lipid nanoparticle may comprise a molar ratio of 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15%. In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-modified lipid.

[0416] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20- 60% ionizable cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid.

Ionizable Lipids

[0417] In some aspects, the ionizable lipids of the present disclosure may be one or more of compounds of Formula (I):


or their N-oxides, or salts or isomers thereof, wherein:

Ri is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, -R*YR”, -YR”, and -R”M’R’;

R2 and R3 are independently selected from the group consisting of H, Ci-14 alkyl, C2-14 alkenyl, -R*YR”, -YR”, and -R*OR”, or R2 and R3, together with the atom to which they are attached, form a heterocycle or carbocycle;

R4 is selected from the group consisting of hydrogen, a C3-6

carbocycle, -(CH2)nQ, -(CH2)nCHQR,

-CHQR, -CQ(R)2, and unsubstituted Ci-6 alkyl, where Q is selected from a carbocycle, heterocycle, -OR, -0(CH2)nN(R)2, -C(0)0R, -0C(0)R, -CX3, -CX2H, -CXH2, -CN,

-N(R)2, -C(0)N(R)2, -N(R)C(0)R, -N(R)S(0)2R, -N(R)C(0)N(R)2, -N(R)C(S)N(R)2, -N(R)R

8,

-N(R)S(0)2R8, -0(CH2)nOR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -0C(0)N(R)2, -N(R)C(0)0R, -N(0R)C(0)R, -N(0R)S(0)2R, -N(0R)C(0)0R, -N(0R)C(0)N(R)2, -N(0R)C(S)N(R)2, -N(0R)C(=NR9)N(R)2, -N(0R)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(0)N(R)0R, and -C(R)N(R)2C(0)0R, and each n is independently selected from 1, 2, 3, 4, and 5;

each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are independently selected

from -C(0)0-, -OC(O)-, -0C(0)-M”-C(0)0-, -C(0)N(R’)-,

-N(R’)C(0)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(0)(0R’)0-, -S(0)2-, -S-S-, an aryl group, and a heteroaryl group, in which M” is a bond, Ci-13 alkyl or C2-13 alkenyl;

R7 is selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H;

Re is selected from the group consisting of C3-6 carbocycle and heterocycle;

R9 is selected from the group consisting of H, CN, NO2, Ci-6 alkyl, -OR, -S(0)2R,

-S(0)2N(R)2, C2-6 alkenyl, C3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R’ is independently selected from the group consisting of Ci-ie alkyl, C2-18

alkenyl, -R*YR”, -YR”, and H;

each R” is independently selected from the group consisting of C3-15 alkyl and

C3-15 alkenyl;

each R* is independently selected from the group consisting of Ci-12 alkyl and

C2-12 alkenyl;

each Y is independently a C3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; and wherein when R4

is -(CH2)nQ, -(CH2)nCHQR, -CHQR, or -CQ(R)2, then (i) Q is not -N(R)2 when n is 1, 2, 3, 4 or 5, or (ii) Q is not 5, 6, or 7-membered heterocycloalkyl when n is 1 or 2.

[0418] In certain embodiments, a subset of compounds of Formula (I) includes those of Formula (IA):


or its N-oxide, or a salt or isomer thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; Mi is a bond or M’; R.4 is hydrogen, unsubstituted C1-3 alkyl, or -(CH2)nQ, in which Q is

OH, -NHC(S)N(R)2, -NHC(0)N(R)2, -N(R)C(0)R, -N(R)S(0)2R, -N(R)RB,

-NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -0C(0)N(R)2, -N(R)C(0)0R, heteroaryl or heterocycloalkyl; M and M’ are independently selected from -C(0)0-, -OC(O)-, -0C(0)-M”-C(0)0-, -C(0)N(R’)-, -P(0)(0R’)0-, -S-S-, an aryl group, and a heteroaryl group,; and R2 and R3 are independently selected from the group consisting of H, Ci-14 alkyl, and C2-i4 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(0)N(R)2. For example, Q is -N(R)C(0)R, or -N(R)S(0)2R.

[0419] In certain embodiments, a subset of compounds of Formula (I) includes those of Formula (IB):


(IB), or its N-oxide, or a salt or isomer thereof in which all variables are as defined herein. For example, m is selected from 5, 6, 7, 8, and 9; R4 is hydrogen, unsubstituted C1-3 alkyl, or -(CH2)nQ, in which Q is OH, -NHC(S)N(R)2, -NHC(0)N(R)2, -N(R)C(0)R, -N(R)S(0)2R, -N(R)RB,

-NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -0C(0)N(R)2, -N(R)C(0)0R, heteroaryl or heterocycloalkyl; M and M’ are independently selected from -C(0)0-, -OC(O)-, -0C(0)-M”-C(0)0-, -C(0)N(R’)-, -P(0)(0R’)0-, -S-S-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from the group

consisting of H, Ci-14 alkyl, and C2-i4 alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(0)N(R)2. For example, Q is -N(R)C(0)R, or -N(R)S(0)2R.

[0420] In certain embodiments, a subset of compounds of Formula (I) includes those of Formula (II):


(II), or its N-oxide, or a salt or isomer thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; Mi is a bond or M’; R.4 is hydrogen, unsubstituted Ci-3 alkyl, or -(CH2)nQ, in which n is 2, 3, or 4, and Q is

OH, -NHC(S)N(R)2, -NHC(0)N(R)2, -N(R)C(0)R, -N(R)S(0)2R, -N(R)RS,

-NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -0C(0)N(R)2, -N(R)C(0)0R, heteroaryl or heterocycloalkyl; M and M’ are independently selected from -C(0)0-, -OC(O)-, -0C(0)-M”-C(0)0-, -C(0)N(R , -P(0)(0R’)0-, -S-S-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from the group consisting of H, Ci-14 alkyl, and C2-i4 alkenyl.

[0421] In one embodiment, the compounds of Formula (I) are of Formula (Ila),


or their N-oxides, or salts or isomers thereof, wherein R4 is as described herein.

[0422] In another embodiment, the compounds of Formula (I) are of Formula (lib),


or their N-oxides, or salts or isomers thereof, wherein R4 is as described herein.

[0423] In another embodiment, the compounds of Formula (I) are of Formula (lie) or

(He):

(lie) (He) or their N-oxides, or salts or isomers thereof, wherein R.4 is as described herein.

[0424] In another embodiment, the compounds of Formula (I) are of Formula (Ilf):


(Ilf) or their N-oxides, or salts or isomers thereof, wherein M is -C(0)0- or -OC(O)-, M” is Ci-6 alkyl or C2-6 alkenyl, R2 and R3 are independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl, and n is selected from 2, 3, and 4.

[0425] In a further embodiment, the compounds of Formula (I) are of Formula (II d),


(lid),

or their N-oxides, or salts or isomers thereof, wherein n is 2, 3, or 4; and m, R’, R”, and R2 through R6 are as described herein. For example, each of R2 and R3 may be independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl.

[0426] In a further embodiment, the compounds of Formula (I) are of Formula (Ilg),


(Ilg), or their N-oxides, or salts or isomers thereof, wherein 1 is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; Mi is a bond or M’; M and M’ are independently selected from

-C(0)0-, -OC(O)-, -0C(0)-M”-C(0)0-, -C(0)N(R’)-, -P(0)(0R’)0-, -S-S-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from the group consisting

of H, C i-14 alkyl, and C2-14 alkenyl. For example, M” is Ci-6 alkyl (e.g., C1-4 alkyl) or C2-6 alkenyl (e.g. C2-4 alkenyl). For example, R2 and R3 are independently selected from the group consisting of C5-14 alkyl and C5-14 alkenyl.

[0427] In some embodiments, the ionizable lipids are one or more of the compounds described in U.S. Application Nos. 62/220,091, 62/252,316, 62/253,433, 62/266,460, 62/333,557, 62/382,740, 62/393,940, 62/471,937, 62/471,949, 62/475,140, and 62/475,166, and PCT Application No. PCT/US2016/052352.

[0428] In some embodiments, the ionizable lipids are selected from Compounds 1- 280 described in U.S. Application No. 62/475,166.

[0429] In some embodiments, the ionizable lipid is


[0431] In some embodiments, the ionizable lipid is


[0432] In some embodiments, the ionizable lipid is


[0433] The central amine moiety of a lipid according to Formula (I), (I A), (IB), (II),

(Ila), (lib), (lie), (lid), (He), (Ilf), or (Ilg) may be protonated at a physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino)lipids. Lipids may also be zwitterionic, i.e., neutral molecules having both a positive and a negative charge.


or salts or isomers thereof, wherein


t is 1 or 2;

Ai and A2 are each independently selected from CH or N;

Z is CH2 or absent wherein when Z is CH2, the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent;

Ri, R2, R3, R4, and R5 are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”;

Rxi and Rx2 are each independently H or C 1-3 alkyl;

each M is independently selected from the group consisting

of -C(0)0-, -OC(O)-, -0C(0)0-, -C(0)N(R , -N(R’)C(0)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)

-CH(OH)-, -P(0)(0R’)0-, -S(0)2-, -C(0)S-, -SC(O)-, an aryl group, and a heteroaryl group;

M* is C1-C6 alkyl,

W1 and W2 are each independently selected from the group consisting

of -O- and -N(R6)-;

each R6 is independently selected from the group consisting of H and C 1-5 alkyl;

X1, X2, and X3 are independently selected from the group consisting of a bond, -CH2-,

-(CH 2)2-, -CHR-, -CHY-, -C(O)-, -C(0)0-, -OC(O)-, -(CH2)n-C(0)-, -C(0)-(CH2)n-, -(CH2)n-C(0)0-, -0C(0)-(CH2)n-, -(CH2)n-0C(0)-, -C(0)0-(CH2)n-, -CH(OH)-, -C(S)-, and -CH(SH)-;

each Y is independently a C3-6 carbocycle;

each R* is independently selected from the group consisting of Ci-i2 alkyl and C2-i2 alkenyl;

each R is independently selected from the group consisting of C1-3 alkyl and a C3-6 carbocycle;

each R’ is independently selected from the group consisting of Ci-i2 alkyl, C2-i2 alkenyl, and H;

each R” is independently selected from the group consisting of C3-i2 alkyl, C 3 - 12 alkenyl and -R*MR’; and

n is an integer from 1-6;


i) at least one of X1, X2, and X3 is not -CH2-; and/or

ii) at least one of Ri, R2, R3, R4, and R5 is -R”MR\

[0435] In some embodiments, the compound is of any of formulae (IIIal)-(IIIa8):



[0436] In some embodiments, the ionizable lipids are one or more of the compounds described in U.S. Application Nos. 62/271,146, 62/338,474, 62/413,345, and

62/519,826, and PCT Application No. PCT/US2016/068300.

[0437] In some embodiments, the ionizable lipids are selected from Compounds 1- 156 described in U.S. Application No. 62/519,826.

[0438] In some embodiments, the ionizable lipids are selected from Compounds 1-16, 42-66, 68-76, and 78-156 described in U.S. Application No. 62/519,826.

[0439] In some embodiments, the ionizable lipid is

thereof.

[0440] In some embodiments, the ionizable lipid is

(Compound

VII), or a salt thereof.

[0441] The central amine moiety of a lipid according to Formula (III), (Illal), (IIIa2),

(IIIa3), (IIIa4), (IIIa5), (IIIa6), (IIIa7), or (IIIa8) may be protonated at a physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino)lipids. Lipids may also be zwitterionic, i.e., neutral molecules having both a positive and a negative charge.

Phospholipids

[0442] The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.

[0443] A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.

[0444] A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0445] Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-

containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.

[0446] Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).

[0447] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines,

phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.

[0448] In some embodiments, a phospholipid of the invention comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC),

1.2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-sn-gly cero-phosphocholine (DUPC), 1 -palmitoyl-2-oleoyl-sn-gly cero- 3-phosphocholine (POPC), l,2-di-0-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine,l,2-diarachidonoyl-sn-glycero-3- phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2- diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1.2-distearoyl-sn- glycero-3-phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine,

1.2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero- 3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine,

1.2-dioleoyl-sn-glycero-3-phospho-rac-(l-glycerol) sodium salt (DOPG),

sphingomyelin, and mixtures thereof.

[0449] In certain embodiments, a phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV):


(IV),

or a salt thereof, wherein:

each R1 is independently optionally substituted alkyl; or optionally two R1 are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1 are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl;

n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;


each instance of L2 is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with O, N(RN), S, etc»), C(0)N(Rn), NRNC(0), C(0)0, 0C(0), 0C(0)0, 0C(0)N(Rn), -NRNC(0)0, or NRNC(0)N(RN);

each instance of R2 is independently optionally substituted C i-30 alkyl, optionally substituted Ci-30 alkenyl, or optionally substituted Ci-30 alkynyl; optionally wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(0)N(RN), NRNC(0), -NRNC(0)N(Rn), C(0)0, 0C(0), 0C(0)0, OC(0)N(Rn), NRNC(0)0, C(0)S, SC(0), - C(=NRN), C(=NRN)N(Rn), NRNC(=NRn), NRNC(=NRN)N(Rn), CCS), C(S)N(Rn), NRNC(S),


each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and

p is 1 or 2;

provided that the compound is not of the formula:


wherein each instance of R2 is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.

[0450] In some embodiments, the phospholipids may be one or more of the

phospholipids described in U.S. Application No. 62/520,530.

i) Phospholipid Head Modifications

[0451] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IV), at least one of R1 is not methyl. In certain embodiments, at least one of R1 is not hydrogen or methyl. In certain embodiments, the compound of Formula (IV) is of one of the following formulae:


or a salt thereof, wherein:

each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and

each v is independently 1, 2, or 3.

In certain embodiments, a compound of Formula (IV) is of Formula (IV-a):


(IV-a),

or a salt thereof.

[0452] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present invention is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IV) is of Formula (IV-b):


or a salt thereof.

(ii) Phospholipid Tail Modifications

[0453] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present invention is DSPC, or analog thereof, with a modified tail. As described herein, a“modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is of Formula (IV-a), or a salt thereof, wherein at least one instance of R2 is each instance of R2 is optionally substituted Ci- 30 alkyl, wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(0)N(RN), NRNC(0), NRNC(0)N(Rn), C(0)0, 0C(0), 0C(0)0, - OC(0)N(RN), NRNC(0)0, C(0)S, seif)), C(=NRn), C(=NRN)N(Rn), NRNC(=NRn),

NRNC(=NRN)N(Rn), CCS), C(S)N(Rn), NRNC(S), NRNC(S)N(Rn), SCO), 0S(0), - S(0)0, 0S(0)0, 0S(0)2, S(0)20, 0S(0)20, N(RN)S(0), S(0)N(Rn), - N(RN)S(0)N(Rn), 0S(0)N(Rn), N(RN)S(0)0, S(0)2, N(RN)S(0)2, S(0)2N(Rn), - N(RN)S(0)2N(Rn), 0S(0)2N(Rn), or N(RN)S(0)20.

[0454] In certain embodiments, the compound of Formula (IV) is of Formula (IV-c):


(IV-c), or a salt thereof, wherein:

each x is independently an integer between 0-30, inclusive; and

each instance is G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(0)N(RN), NRNC(0), -NRNC(0)N(Rn), C(0)0, 0C(0), 0C(0)0, OC(0)N(Rn), NRNC(0)0, C(0)S, SC(0), -C(=NRN), C(=NRN)N(Rn), NRNC(=NRn), NRNC(=NRN)N(Rn), CCS), C(S)N(Rn), NRNC(S), NRNC(S)N(Rn), SCO), 0S(0), S(0)0, 0S(0)0, OS(0)2, S(0)20, 0S(0)20, N(RN)S(0), -S(0)N(RN), N(RN)S(0)N(Rn), OS(0)N(Rn), N(RN)S(0)0, S(0)2, N(RN)S(0)2, S(0)2N(Rn), N(RN)S(0)2N(Rn), OS(0)2N(Rn), or N(RN)S(0)20. Each possibility represents a separate embodiment of the present invention.

[0455] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, a compound of Formula (IV) is of one of the following formulae:


or a salt thereof.

Alternative Lipids

[0456] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g, n is not 2). Therefore, in certain embodiments, a phospholipid useful.

[0457] In certain embodiments, an alternative lipid is used in place of a phospholipid of the present disclosure.

[0458] In certain embodiments, an alternative lipid of the invention is oleic acid.

[0459] In certain embodiments, the alternative lipid is one of the following:


Structural Lipids

[0460] The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term "structural lipid" refers to sterols and also to lipids containing sterol moieties.

[0461] Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha- tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol.

[0462] In some embodiments, the structural lipids may be one or more of the

structural lipids described in U.S. Application No. 62 /520,530.

Polyethylene Glycol (PEG)-Lipids

[0463] The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid.

[0464] As used herein, the term“PEG-lipid” refers to polyethylene glycol (PEG)- modified lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g.,

PEG-CerC14 or PEG-CerC20), PEG-modified dialk lamines and PEG-modified 1,2- diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0465] In some embodiments, the PEG-bpid includes, but not limited to 1,2- dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[amino(poly ethylene glycol)] (PEG-DSPE), PEG- disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), or PEG-1, 2-dimyristyloxlpropyl-3-amine (PEG-c-DMA).

[0466] In one embodiment, the PEG-bpid is selected from the group consisting of a

PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.

[0467] In some embodiments, the lipid moiety of the PEG-lipids includes those

having lengths of from about CM to about C22, preferably from about C to about Ci6. In some embodiments, a PEG moiety, for example an mPEG-NEh, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In one embodiment, the PEG- lipid is PEG2k-DMG.

[0468] In one embodiment, the lipid nanoparticles described herein can comprise a

PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0469] PEG-lipids are known in the art, such as those described in U.S. Patent No.

8158601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety.

[0470] In general, some of the other lipid components (e.g., PEG lipids) of various formulae, described herein may be synthesized as described International Patent Application No. PCT/US2016/000129, filed December 10, 2016, entitled

“Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety.

[0471] The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE,

PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0472] In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure:


[0473] In one embodiment, PEG lipids useful in the present invention can be

PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid.

As generally defined herein, a“PEG-OH lipid” (also referred to herein as“hydroxy - PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present invention.

[0474] In certain embodiments, a PEG lipid useful in the present invention is a

compound of Formula (V). Provided herein are compounds of Formula (V):


(V), or salts thereof, wherein:

R3 is -OR0;

R° is hydrogen, optionally substituted alkyl, or an oxygen protecting group;

r is an integer between 1 and 100, inclusive;

L1 is optionally substituted Ci-io alkylene, wherein at least one methylene of the optionally substituted Ci-io alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), C(0)N(RN), NRNC(0), C(0)0, -OC(O), 0C(0)0, OC(0)N(RN), NRNC(0)0, or NRNC(0)N(Rn);

D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions;

m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;


each instance of L2 is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with O, N(RN), S, etc)), C(0)N(Rn), NRNC(0), C(0)0, 0C(0), 0C(0)0, 0C(0)N(Rn), -NRNC(0)0, or NRNC(0)N(RN);

each instance of R2 is independently optionally substituted Ci-30 alkyl, optionally substituted Ci-30 alkenyl, or optionally substituted Ci-30 alkynyl; optionally wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(0)N(RN), NRNC(0), -NRNC(0)N(Rn), C(0)0, 0C(0), 0C(0)0, OC(0)N(Rn), NRNC(0)0, C(0)S, SC(0), - C(=NRN), C(=NRN)N(Rn), NRNC(=NRn), NRNC(=NRN)N(Rn), CCS), C(S)N(Rn), NRNC(S),

NRNC(S)N(Rn), SCO) , OS(O), S(0)0, 0S(0)0, OS(0)2, S(0)20, 0S(0)20, N(RN)S(0), -S(0)N(RN), N(RN)S(0)N(Rn), OS(0)N(Rn), N(RN)S(0)0, S(0)2, N(RN)S(0)2, S(0)2N(Rn),

N(RN)S(0)2N(Rn), 0S(0)2N(Rn), or N(RN)S(0)20;

each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and

p is 1 or 2.

[0475] In certain embodiments, the compound of Fomula (V) is a PEG-OH lipid (i.e.,

R3 is -OR0, and R° is hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH):


(V-OH), or a salt thereof.

[0476] In certain embodiments, a PEG lipid useful in the present invention is a

PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VI). Provided herein are compounds of Formula (VI):


(VI), or a salts thereof, wherein:

R3 is-OR°;

R° is hydrogen, optionally substituted alkyl or an oxygen protecting group;

r is an integer between 1 and 100, inclusive;

R5 is optionally substituted C 10-40 alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted Cio-40 alkynyl; and optionally one or more methylene groups of R5 are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), -C(0)N(RN), NRNC(0), NRNC(0)N(Rn), C(0)0, 0C(0), 0C(0)0, 0C(0)N(Rn), -NRNC(0)0, C(0)S, SC(0), C(=NRn), C(=NRN)N(Rn), NRNC(=NRn), NRNC(=NRN)N(Rn), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(Rn), SCO), 0S(0), S(0)0, 0S(0)0, 0S(0)2, -S(0)20, 0S(0)20, N(RN)S(0), S(0)N(Rn), N(RN)S(0)N(Rn), 0S(0)N(Rn), N(RN)S(0)0, S(0)2, N(RN)S(0)2, S(0)2N(Rn), N(RN)S(0)2N(Rn), 0S(0)2N(Rn), or N(RN)S(0)20; and each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

[0477] In certain embodiments, the compound of Formula (VI) is of Formula (VI- OH):


(VI-OH), or a salt thereof. In some embodiments, r is 45.

[0478] In yet other embodiments the compound of Formula (VI) is:


or a salt thereof.

[0479] In one embodiment, the compound of Formula (VI) is

(Compound I).

[0480] In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.

[0481] In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. 62/520,530.

[0482] In some embodiments, a PEG lipid of the invention comprises a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.

[0483] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.

[0484] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

[0485] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.

[0486] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.

[0487] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

[0488] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of


and a PEG lipid comprising Formula VI.

[0489] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of


and an alternative lipid comprising oleic acid.

[0490] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of


an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.

[0491] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of


a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.

[0492] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of

a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VII.

[0493] In some embodiments, a LNP of the invention comprises an N:P ratio of from about 2: 1 to about 30: 1.

[0494] In some embodiments, a LNP of the invention comprises an N:P ratio of about

6: 1.

[0495] In some embodiments, a LNP of the invention comprises an N:P ratio of about

3: 1.

[0496] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10: 1 to about 100: 1.

[0497] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20: 1.

[0498] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10: 1.

[0499] In some embodiments, a LNP of the invention has a mean diameter from about

50nm to about 150nm.

[0500] In some embodiments, a LNP of the invention has a mean diameter from about

70nm to about 120nm.

[0501] In some embodiments, a LNP of the invention has a mean diameter from about

70 nm to about 85 nm.

[0502] As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "Cl-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1 14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.

[0503] As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three,

four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2 14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, Cl 8 alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a bnoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.

[0504] As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2 14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, Cl 8 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.

[0505] As used herein, the term "carbocycle" or "carbocycbc group" means an

optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon- carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.

[0506] As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings.

Heterocycles may include one or more double or triple bonds and may be non aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.

[0507] As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalky nyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or

heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted

heteroalkyls, heteroalkenyls, or heteroalkynyls.

[0508] As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(0)0-, -OC(O)-, -C(0)N(R')-, -N(R')C(0)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(0)(0R')0-, -S(0)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings.

Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl,

thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non- limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.

[0509] Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(0)0R OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(0)R, alternatively represented by C=0), an acyl halide (e.g., C(0)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g.,

C(OR)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(0)43-), a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfmic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(0)20H), a thial (e.g., C(S)H), a sulfate (e.g., S(0)42-), a sulfonyl (e.g., S(0)2 ), an amide (e.g., C(0)NR2, or N(R)C(0)R), an azido (e.g., N3), a nitro (e.g., N02), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., 0C(0)NR2, 0C(0)NRH, or

0C(0)NH2), a sulfonamide (e.g., S(0)2NR2, S(0)2NRH, S(0)2NH2,

N(R)S(0)2R, N(H)S(0)2R, N(R)S(0)2H, or N(H)S(0)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a Cl 6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.

[0510] Compounds of the disclosure that contain nitrogens can be converted to N- oxides by treatment with an oxidizing agent (e.g., 3 -chi oroperoxy benzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when

allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as NDO or N+-0-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N- hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA.

All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N- hydroxy (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted Cl-C 6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives.

(vi) Other Lipid Composition Components

[0511] The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No. 2005/0222064. Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereol).

[0512] A polymer can be included in and/or used to encapsulate or partially

encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and/or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates,

polyacrylonitriles, and polyarylates.

[0513] The ratio between the lipid composition and the polynucleotide range can be from about 10: 1 to about 60: 1 (wt/wt).

[0514] In some embodiments, the ratio between the lipid composition and the

polynucleotide can be about 10: 1, 11 : 1, 12: 1, 13: 1, 14: 1, 15: 1, 16: 1, 17: 1, 18: 1, 19: 1, 20:1, 21 : 1, 22: 1, 23: 1, 24: 1, 25: 1, 26: 1, 27: 1, 28: 1, 29: 1, 30: 1, 31: 1, 32: 1, 33: 1, 34: 1, 35:1, 36: 1, 37: 1, 38: 1, 39: 1, 40: 1, 41: 1, 42: 1, 43: 1, 44: 1, 45: 1, 46: 1, 47: 1, 48: 1, 49: 1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1 (wt/wt). In some embodiments, the wt/wt ratio of the lipid composition to the polynucleotide encoding a therapeutic agent is about 20:1 or about 15:1.

[0515] In some embodiments, the pharmaceutical composition disclosed herein can contain more than one polypeptides. For example, a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA).

[0516] In one embodiment, the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid: polynucleotide weight ratio of 5:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1 or 70:1, or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1, from about 5:1 to about 15:1, from about 5:1 to about 20: 1, from about 5: 1 to about 25: 1, from about 5:1 to about 30: 1, from about 5:1 to about 35: 1, from about 5: 1 to about 40: 1, from about 5:1 to about 45:1, from about 5:1 to about 50:1, from about 5:1 to about 55:1, from about 5:1 to about 60:1, from about 5:1 to about 70:1, from about 10:1 to about 15:1, from about 10: 1 to about 20: 1, from about 10: 1 to about 25: 1, from about 10: 1 to about 30: 1, from about 10:1 to about 35:1, from about 10:1 to about 40:1, from about 10:1 to about 45:1, from about 10:1 to about 50:1, from about 10:1 to about 55:1, from about 10:1 to about 60:1, from about 10:1 to about 70:1, from about 15:1 to about 20:1, from about 15:1 to about 25:1, from about 15:1 to about 30:1, from about 15:1 to about 35:1, from about 15:1 to about 40:1, from about 15:1 to about 45:1, from about 15:1 to about 50:1, from about 15:1 to about 55:1, from about 15:1 to about 60:1 or from about 15:1 to about 70:1.

[0517] In one embodiment, the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1.0 mg/ml, 1.1 mg/ml, 1.2 mg/ml, 1.3 mg/ml, 1.4 mg/ml, 1.5 mg/ml, 1.6 mg/ml, 1.7 mg/ml, 1.8 mg/ml, 1.9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml.

(vii) Nanoparticle Compositions

[0518] In some embodiments, the pharmaceutical compositions disclosed herein are formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide

encoding a wound healing polypeptide. In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide encoding a wound healing polypeptide.

[0519] Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less.

[0520] Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In certain embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers can be functionalized and/or crosslinked to one another. Lipid bilayers can include one or more ligands, proteins, or channels.

[0521] In one embodiment, a lipid nanoparticle comprises an ionizable lipid, a

structural lipid, a phospholipid, and mRNA. In some embodiments, the LNP comprises an ionizable lipid, a PEG-modified lipid, a sterol and a structural lipid. In some embodiments, the LNP has a molar ratio of about 20-60% ionizable lipid: about 5-25% structural lipid: about 25-55% sterol; and about 0.5-15% PEG-modified lipid.

[0522] In some embodiments, the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm.

[0523] As generally defined herein, the term“lipid” refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids,

glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media.

[0524] In some embodiments, a lipid nanoparticle (LNP) may comprise an ionizable lipid. As used herein, the term“ionizable lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable lipid may be positively charged or negatively charged. An ionizable lipid may be positively charged, in which case it can be referred to as “cationic lipid”. In certain embodiments, an ionizable lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipid. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and/or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively- charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and/or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.

[0525] It should be understood that the terms“charged” or“charged moiety” does not refer to a“partial negative charge" or“partial positive charge" on a molecule. The terms“partial negative charge" and“partial positive charge" are given its ordinary meaning in the art. A“partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way.

[0526] In some embodiments, the ionizable lipid is an ionizable amino lipid,

sometimes referred to in the art as an“ionizable cationic lipid”. In one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.

[0527] In addition to these, an ionizable lipid may also be a lipid including a cyclic amine group.

[0528] In one embodiment, the ionizable lipid may be selected from, but not limited to, an ionizable lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety.

[0529] In yet another embodiment, the ionizable lipid may be selected from, but not limited to, formula CLI-CLXXXXII of US Patent No. 7,404,969; each of which is herein incorporated by reference in their entirety.

[0530] In one embodiment, the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety. In one embodiment, the lipid may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety.

[0531] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.

[0532] The size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the

polynucleotide.

[0533] As used herein,“size” or“mean size” in the context of nanoparticle

compositions refers to the mean diameter of a nanoparticle composition.

[0534] In one embodiment, the polynucleotide encoding a wound healing polypeptide are formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm.

[0535] In one embodiment, the nanoparticles have a diameter from about 10 to 500 nm. In one embodiment, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.

[0536] In some embodiments, the largest dimension of a nanoparticle composition is

1 pm or shorter (e.g., 1 pm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter).

[0537] A nanoparticle composition can be relatively homogenous. A polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some

embodiments, the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20.

[0538] The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about

0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.

[0539] In some embodiments, the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10 mV to about 30 mV, from about 10 mV to about 20 mV, from about 20 mV to about 100 mV, from about 20 mV to about 90 mV, from about 20 mV to about 80 mV, from about 20 mV to about 70 mV, from about 20 mV to about 60 mV, from about 20 mV to about 50 mV, from about 20 mV to about 40 mV, from about 20 mV to about 30 mV, from about 30 mV to about 100 mV, from about 30 mV to about 90 mV, from about 30 mV to about 80 mV, from about 30 mV to about 70 mV, from about 30 mV to about 60 mV, from about 30 mV to about 50 mV, from about 30 mV to about 40 mV, from about 40 mV to about 100 mV, from about 40 mV to about 90 mV, from about 40 mV to about 80 mV, from about 40 mV to about 70 mV, from about 40 mV to about 60 mV, and from about 40 mV to about 50 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV.

[0540] The term“encapsulation efficiency” of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. As used herein,“encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.

[0541] Encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents.

[0542] Fluorescence can be used to measure the amount of free polynucleotide in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.

[0543] The amount of a polynucleotide present in a pharmaceutical composition

disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide.

[0544] For example, the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA. The relative amounts of a polynucleotide in a nanoparticle composition can also vary.

[0545] The relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability. For compositions including an mRNA as a polynucleotide, the N:P ratio can serve as a useful metric.

[0546] As the N:P ratio of a nanoparticle composition controls both expression and tolerability, nanoparticle compositions with low N:P ratios and strong expression are desirable. N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition.

[0547] In general, a lower N:P ratio is preferred. The one or more RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2: 1 to about 30: 1, such as 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 12: 1, 14: 1, 16: 1, 18: 1, 20: 1, 22: 1, 24:1, 26: 1, 28: 1, or 30: 1. In certain embodiments, the N:P ratio can be from about 2: 1 to about 8: 1. In other embodiments, the N:P ratio is from about 5: 1 to about 8:1. In certain embodiments, the N:P ratio is between 5: 1 and 6: 1. In one specific aspect, the N:P ratio is about is about 5.67: 1.

[0548] In addition to providing nanoparticle compositions, the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide. Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev. 87:68- 80; Silva et al. (2015)“Delivery Systems for Biopharmaceuticals. Part I:

Nanoparticles and Microparticles” Curr. Pharm. Technol. 16: 940-954; Naseri et al. (2015)“Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application” Adv. Pharm. Bull. 5:305-13; Silva et al. (2015)“Lipid nanoparticles for the delivery of biopharmaceuticals” Curr. Pharm. Biotechnol.

16:291-302, and references cited therein.

21. Other Delivery Agents

a. Liposomes, Lipoplexes, and Lipid Nanoparticles

[0549] In some embodiments, the compositions or formulations of the present

disclosure comprise a delivery agent, e.g., a liposome, a lioplexes, a lipid

nanoparticle, or any combination thereof. The polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. Liposomes, lipoplexes, or lipid nanoparticles can be used to improve the efficacy of the polynucleotides directed protein production as these formulations can increase cell transfection by the polynucleotide; and/or increase the translation of encoded protein. The liposomes, lipoplexes, or lipid nanoparticles can also be used to increase the stability of the polynucleotides.

[0550] Liposomes are artificially -prepared vesicles that can primarily be composed of a lipid bilayer and can be used as a delivery vehicle for the intradermal (e.g., using microneedles) or topical administration of pharmaceutical formulations. Liposomes can be of different sizes. A multilamellar vesicle (MLV) can be hundreds of nanometers in diameter, and can contain a series of concentric bilayers separated by narrow aqueous compartments. A small unicellular vesicle (SUV) can be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) can be between 50 and 500 nm in diameter. Liposome design can include, but is not limited to, opsonins or ligands to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes can contain a low or a high pH value in order to improve the delivery of the pharmaceutical formulations.

[0551] The formation of liposomes can depend on the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and/or delivery of the vesicles, the optimal size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and scale up production of safe and efficient liposomal products, etc.

[0552] As a non-limiting example, liposomes such as synthetic membrane vesicles can be prepared by the methods, apparatus and devices described in U.S. Pub. Nos. US20130177638, US20130177637, US20130177636, US20130177635,

US20130177634, US20130177633, US20130183375, US20130183373, and

US20130183372. In some embodiments, the polynucleotides described herein can be encapsulated by the liposome and/or it can be contained in an aqueous core that can then be encapsulated by the liposome as described in, e.g., Inti. Pub. Nos.

W02012031046, W02012031043, W02012030901, W02012006378, and

WO2013086526; and U.S. Pub.Nos. US20130189351, US20130195969 and

US20130202684. Each of the references in herein incorporated by reference in its entirety.

[0553] In some embodiments, the polynucleotides described herein can be formulated in a cationic oil-in-water emulsion where the emulsion particle comprises an oil core and a cationic lipid that can interact with the polynucleotide anchoring the molecule to the emulsion particle. In some embodiments, the polynucleotides described herein can be formulated in a water-in-oil emulsion comprising a continuous hydrophobic phase in which the hydrophilic phase is dispersed. Exemplary emulsions can be made by the methods described in Inti. Pub. Nos. W02012006380 and W0201087791, each of which is herein incorporated by reference in its entirety.

[0554] In some embodiments, the polynucleotides described herein can be formulated in a lipid-poly cation complex. The formation of the lipid-poly cation complex can be accomplished by methods as described in, e.g., U.S. Pub. No. US20120178702. As a non-limiting example, the poly cation can include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyomithine and/or polyarginine and the cationic peptides described in Inti. Pub. No. WO2012013326 or U.S. Pub. No.

US20130142818. Each of the references is herein incorporated by reference in its entirety.

[0555] In some embodiments, the polynucleotides described herein can be formulated in a lipid nanoparticle (LNP) such as those described in Inti. Pub. Nos.

WO2013123523, W02012170930, WO2011127255 and W02008103276; and U.S. Pub. No. US20130171646, each of which is herein incorporated by reference in its entirety.

[0556] Lipid nanoparticle formulations typically comprise one or more lipids. In some embodiments, the lipid is an ionizable lipid ( e.g ., an ionizable amino lipid), sometimes referred to in the art as an“ionizable cationic lipid”. In some

embodiments, lipid nanoparticle formulations further comprise other components, including a phospholipid, a structural lipid, and a molecule capable of reducing particle aggregation, for example a PEG or PEG-modified lipid.

[0557] Exemplary ionizable lipids include, but not limited to, any one of Compounds

1-342 disclosed herein, DLin-MC3 -DMA (MC3), DLin-DMA, DLenDMA, DLin-D- DMA, DLin-K-DMA, DLin-M-C2-DMA, DLin-K-DMA, DLin-KC2-DMA, DLin- KC3-DMA, DLin-KC4-DMA, DLin-C2K-DMA, DLin-MP-DMA, DODMA, 98N12- 5, Cl 2-200, DLin-C-DAP, DLin-DAC, DLinDAP, DLinAP, DLin-EG-DMA, DLin- 2-DMAP, KL10, KL22, KL25, Octyl-CLinDMA, Octyl-CLinDMA (2R), Octyl- CLinDMA (2S), and any combination thereof. Other exemplary ionizable lipids include, (13Z, 16Z)-N,N-dimethy 1-3 -nony ldocosa- 13,16-dien- 1 -amine (L608), (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N- dimemylhexacosa-17,20-dien-9-amine, (16Z,19Z)-N5N-dimethylpentacosa-16,19- dien-8-amine, (13Z, 16Z)-N,N-dimethyldocosa- 13,16-dien-5 -amine, (12Z, 15Z)-N,N- dimethy lhenicosa- 12, 15 -dien-4-amine, (14Z, 17Z)-N,N-dimethy ltricosa- 14,17 -dien-6- amine, (15Z,18Z)-N,N-dimethyltetracosa-15,l 8-dien-7-amine, (18Z,21Z)-N,N- dimethylheptacosa- 18,21 -dien- 10-amine, (15Z, 18Z)-N,N-dimethyltetracosa- 15,18- dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N- dimeihyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21- dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)- N,N-dimethylpentacosa- 16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta- 22,25 -dien- 10-amine, (2 lZ,24Z)-N,N-dimethy ltriaconta-21 ,24-dien-9-amine, ( 18Z)- N,N-dimetylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine,

(19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonylicosa-l l,14-dien-l-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyl eptacos-15 -en- 10-amine, (14Z)-N,N-dimethylnonacos-14-en- 10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en- 10-amine, (20Z)-N,N-dimethylnonacos-20-en- 10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-l-amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl] eptadecan-8-amine, l-[(lS,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-l-[(l S,2R)-2-octylcyclopropyl]nonadecan- 10-amine, N,N-dimethyl-21-[(lS,2R)-2-octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-l-[(lS,2S)-2-{[(lR,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-l-[(l S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(lR,2S)-2-undecyIcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(lS,2R)-2-octylcyclopropyl]heptyl}dodecan-l -amine, l-[(lR,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecan-9-amine, l-[(lS,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-l-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-l-[(9Z,12Z)-octadeca-9, 12-dien- 1 -y loxy ] -3 -(octy loxy )propan-2-amine, 1 - {2-[(9Z, 12Z)-octadeca-9, 12-dien-1 -y loxy ] - 1 - [(octy loxy )methy 1] ethyl } pyrrolidine, (2S)-N,N-dimethy 1- 1 -[(9Z, 12Z)-octadeca-9,12-dien-l-yloxy]-3-[(5Z)-oct-5-en-l-yloxy]propan-2-amine, l-{2-[(9Z, 12Z)-octadeca-9, 12-dien- 1 -y loxy ] - 1 - [(octy loxy )methy 1] ethyl } azetidine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, (2S)-l-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, N,N-dimethyl-l -(nony loxy )-3-[(9Z, 12Z)-octadeca-9, 12-dien- 1 -y loxy] propan-2-amine, N,N-dimethyl-l-[(9Z)-octadec-9-en-l-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-l-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-l-yloxy]-3-(octyloxy)propan-2-amine, (2S)-l-[(l lZ,14Z)-icosa-l l,14-dien-l-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-l-(hexyloxy)-3-[(l lZ,14Z)-icosa-l 1,14-dien-l-yloxy]-N,N-dimethylpropan-2-amine, 1-[(1 lZ,14Z)-icosa-l 1,14-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, l-[(13Z,16Z)-docosa-13,16-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z, 16Z)-docosa-13,16-

dien-l-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-l-[(13Z)-docos-13- en-l-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, l-[(13Z)-docos-13-en-l- y loxy ] -N,N-dimethy 1-3 -(octy loxy )propan-2-amine, 1 - [(9Z)-hexadec-9-en- 1 -y loxy] - N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(l - metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, (2R)-1- [(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l- yloxy]propan-2-amine, N,N-dimethyl-l-(octyloxy)-3-({8-[(lS,2S)-2-{[(lR,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-l- {[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine, and (11E,20Z,23Z)- N, N-dimethylnonacosa- 11, 20, 2-trien- 10-amine, and any combination thereof.

[0558] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines,

phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. In some embodiments, the phospholipids are DLPC, DMPC, DOPC, DPPC, DSPC, DUPC, 18:0 Diether PC, DLnPC, DAPC, DHAPC, DOPE, 4ME 16:0 PE, DSPE, DLPE,DLnPE, DAPE, DHAPE, DOPG, and any combination thereof. In some embodiments, the phospholipids are MPPC, MSPC, PMPC, PSPC, SMPC, SPPC, DHAPE, DOPG, and any combination thereof. In some embodiments, the amount of phospholipids (e.g., DSPC) in the lipid composition ranges from about 1 mol% to about 20 mol%.

[0559] The structural lipids include sterols and lipids containing sterol moieties. In some embodiments, the structural lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the amount of the structural lipids (e.g., cholesterol) in the lipid composition ranges from about 20 mol% to about 60 mol%.

[0560] The PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG- CerC20), PEG-modified dialkylamines and PEG-modified l,2-diacyloxypropan-3- amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG DMPE, PEG-DPPC, or a PEG- DSPE lipid. In some embodiments, the PEG-lipid are 1,2-dimyristoyl-sn-glycerol methoxypoly ethylene glycol (PEG-DMG), l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[amino(poly ethylene glycol)] (PEG-DSPE), PEG-disteryl

glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), or PEG-1, 2-dimyristyloxlpropy 1-3 -amine (PEG-c-DMA). In some embodiments, the PEG moiety has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some embodiments, the amount of PEG-lipid in the lipid composition ranges from about 0 mol% to about 5 mol%.

[0561] In some embodiments, the LNP formulations described herein can additionally comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in U.S. Pub. No. US20050222064, herein incorporated by reference in its entirety.

[0562] The LNP formulations can further contain a phosphate conjugate. The

phosphate conjugate can increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle. Phosphate conjugates can be made by the methods described in, e.g., Inti. Pub. No. WO2013033438 or U.S. Pub. No. US20130196948. The LNP formulation can also contain a polymer conjugate (e.g., a water soluble conjugate) as described in, e.g., U.S. Pub. Nos. US20130059360, US20130196948, and US20130072709. Each of the references is herein incorporated by reference in its entirety.

[0563] The LNP formulations can comprise a conjugate to enhance the delivery of nanoparticles of the present invention in a subject. Further, the conjugate can inhibit phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate can be a "self peptide designed from the human membrane protein CD47 (e.g., the "self particles described by Rodriguez et al, Science 2013 339, 971-975, herein incorporated by reference in its entirety). As shown by Rodriguez et al. the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles.

[0564] The LNP formulations can comprise a carbohydrate carrier. As a non-limiting example, the carbohydrate carrier can include, but is not limited to, an anhydride- modified phytoglycogen or glycogen-type material, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin (e.g.,

Inti. Pub. No. W02012109121, herein incorporated by reference in its entirety).

[0565] The LNP formulations can be coated with a surfactant or polymer to improve the delivery of the particle. In some embodiments, the LNP can be coated with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge as described in U.S. Pub. No. US20130183244, herein incorporated by reference in its entirety.

[0566] The LNP formulations can be engineered to alter the surface properties of particles so that the lipid nanoparticles can penetrate the mucosal barrier as described in U.S. Pat. No. 8,241,670 or Inti. Pub. No. WO2013110028, each of which is herein incorporated by reference in its entirety.

[0567] The LNP engineered to penetrate mucus can comprise a polymeric material

(i.e., a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co polymer. The polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes,

polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.

[0568] LNP engineered to penetrate mucus can also include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example

dimethyldioctadecy 1-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin b4 domase alfa, neltenexine, erdosteine) and various DNases including rhDNase.

[0569] In some embodiments, the mucus penetrating LNP can be a hypotonic

formulation comprising a mucosal penetration enhancing coating. The formulation can be hypotonic for the epithelium to which it is being delivered. Non-limiting examples of hypotonic formulations can be found in, e.g., Inti. Pub. No.

WO2013110028, herein incorporated by reference in its entirety.

[0570] In some embodiments, the polynucleotide described herein is formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA-lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al, Gene Ther 2006 13: 1222-1234; Santel et al., Gene Ther 2006 13: 1360-1370; Gutbier et al, Pulm Pharmacol. Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293Weide et al. J

Immunother. 2009 32:498-507; Weide et al. J Immunother. 2008 31 : 180-188; Pascolo Expert Opin. Biol. Ther. 4: 1285-1294; Fotin-Mleczek et al, 2011 J. Immunother. 34: 1-15; Song et al, Nature Biotechnol. 2005, 23:709-717; Peer et al, Proc Natl Acad Sci U S A. 2007 6;104:4095-4100; deFougerolles Hum Gene Ther. 2008 19: 125-132; all of which are incorporated herein by reference in its entirety).

[0571] In some embodiments, the polynucleotides described herein are formulated as a solid lipid nanoparticle (SLN), which can be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers.

Exemplary SLN can be those as described in Inti. Pub. No. W02013105101, herein incorporated by reference in its entirety.

[0572] In some embodiments, the polynucleotides described herein can be formulated for controlled release and/or targeted delivery. As used herein, "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. In one embodiment, the polynucleotides can be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term "encapsulate" means to enclose, surround or encase. As it relates to the formulation of the compounds of the invention, encapsulation can be substantial, complete or partial. The term "substantially encapsulated" means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or greater than 99% of the

pharmaceutical composition or compound of the invention can be enclosed, surrounded or encased within the delivery agent. "Partially encapsulation" means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or compound of the invention can be enclosed, surrounded or encased within the delivery agent.

[0573] Advantageously, encapsulation can be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the invention using fluorescence and/or electron micrograph. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, or greater than 99% of the pharmaceutical composition or compound of the invention are encapsulated in the delivery agent.

[0574] In some embodiments, the polynucleotides described herein can be

encapsulated in a therapeutic nanoparticle, referred to herein as "therapeutic

nanoparticle polynucleotides." Therapeutic nanoparticles can be formulated by methods described in, e.g., Inti. Pub. Nos. W02010005740, W02010030763, W02010005721, W02010005723, and WO2012054923; and U.S. Pub. Nos.

US20110262491, US20100104645, US20100087337, US20100068285,

US20110274759, US20100068286, US20120288541, US20120140790,

US20130123351 and US20130230567; and U.S. Pat. Nos. 8,206,747, 8,293,276, 8,318,208 and 8,318,211, each of which is herein incorporated by reference in its entirety.

[0575] In some embodiments, the therapeutic nanoparticle polynucleotide can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time can include, but is not limited to, hours, days, weeks, months and years. As a non-limiting example, the sustained release nanoparticle of the polynucleotides described herein can be formulated as disclosed in Inti. Pub. No. W02010075072 and U.S. Pub. Nos. US20100216804,

US20110217377, US20120201859 and US20130150295, each of which is herein incorporated by reference in their entirety.

[0576] In some embodiments, the therapeutic nanoparticle polynucleotide can be formulated to be target specific, such as those described in Inti. Pub. Nos.

WO2008121949, W02010005726, W02010005725, WO2011084521 and

WO2011084518; and U.S. Pub. Nos. US20100069426, US20120004293 and US20100104655, each of which is herein incorporated by reference in its entirety.

[0577] The LNPs can be prepared using microfluidic mixers or micromixers.

Exemplary microfluidic mixers can include, but are not limited to, a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (see Zhigaltsevet al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing," Langmuir 28:3633-40 (2012); Belliveau et al, "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy -Nucleic Acids. I:e37 (2012); Chen et al, "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation," J. Am. Chem. Soc. 134(16):6948-51 (2012); each of which is herein incorporated by reference in its entirety). Exemplary micromixers include Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM,) from the Institut fur Mikrotechnik Mainz GmbH, Mainz Germany. In some embodiments, methods of making LNP using SHM further comprise mixing at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA). According to this method, fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other. This method can also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling. Methods of generating LNPs using SHM include those disclosed in U.S. Pub. Nos. US20040262223 and US20120276209, each of which is incorporated herein by reference in their entirety.

[0578] In some embodiments, the polynucleotides described herein can be formulated in lipid nanoparticles using microfluidic technology (see Whitesides, George M., "The Origins and the Future of Microfluidics," Nature 442: 368-373 (2006); and Abraham et al, "Chaotic Mixer for Microchannels," Science 295: 647-651 (2002); each of which is herein incorporated by reference in its entirety). In some embodiments, the polynucleotides can be formulated in lipid nanoparticles using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). A micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism.

[0579] In some embodiments, the polynucleotides described herein can be formulated in lipid nanoparticles having a diameter from about 1 nm to about 100 nm such as, but not limited to, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm.

[0580] In some embodiments, the lipid nanoparticles can have a diameter from about

10 to 500 nm. In one embodiment, the lipid nanoparticle can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.

[0581] In some embodiments, the polynucleotides can be delivered using smaller

LNPs. Such particles can comprise a diameter from below 0.1 pm up to 100 nm such as, but not limited to, less than 0.1 pm, less than 1.0 pm, less than 5pm, less than 10 pm, less than 15 um, less than 20 um, less than 25 um, less than 30 um, less than 35 um, less than 40 um, less than 50 um, less than 55 um, less than 60 um, less than 65 um, less than 70 um, less than 75 um, less than 80 um, less than 85 um, less than 90 um, less than 95 um, less than 100 um, less than 125 um, less than 150 um, less than 175 um, less than 200 um, less than 225 um, less than 250 um, less than 275 um, less than 300 um, less than 325 um, less than 350 um, less than 375 um, less than 400 um, less than 425 um, less than 450 um, less than 475 um, less than 500 um, less than 525 um, less than 550 um, less than 575 um, less than 600 um, less than 625 um, less than 650 um, less than 675 um, less than 700 um, less than 725 um, less than 750 um, less than 775 um, less than 800 um, less than 825 um, less than 850 um, less than 875 um, less than 900 um, less than 925 um, less than 950 um, or less than 975 um.

[0582] The nanoparticles and microparticles described herein can be geometrically engineered to modulate macrophage and/or the immune response. The geometrically engineered particles can have varied shapes, sizes and/or surface charges to incorporate the polynucleotides described herein for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., Inti. Pub. No. W02013082111, herein incorporated by reference in its entirety). Other physical features the geometrically engineering particles can include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge that can alter the interactions with cells and tissues.

[0583] In some embodiment, the nanoparticles described herein are stealth

nanoparticles or target-specific stealth nanoparticles such as, but not limited to, those described in U.S. Pub. No. US20130172406, herein incorporated by reference in its entirety. The stealth or target-specific stealth nanoparticles can comprise a polymeric matrix, which can comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids,

polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), poly cyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, poly cyanoacrylates, or combinations thereof.

b. Lipidoids

[0584] In some embodiments, the compositions or formulations of the present

disclosure comprise a delivery agent, e.g., a lipidoid. The polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) can be formulated with lipidoids. Complexes, micelles, liposomes or particles can be prepared containing these lipidoids and therefore to achieve an effective delivery of the polynucleotide, as judged by the production of an encoded protein, following the injection of a lipidoid formulation via localized (e.g., intradermal (e.g., using microneedles) or topical) and/or systemic routes of administration. Lipidoid complexes of polynucleotides can be administered by various means including, but not limited to, intradermal (e.g., using microneedles), topical, intravenous, intramuscular, or subcutaneous routes.

[0585] The synthesis of lipidoids is described in literature (see Mahon et al,

Bioconjug. Chem. 2010 21: 1448-1454; Schroeder et al, J Intern Med. 2010 267:9-21; Akinc et al, Nat Biotechnol. 2008 26:561-569; Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869; Siegwart et al., Proc Natl Acad Sci U S A. 2011 108: 12996- 3001; all of which are incorporated herein in their entireties).

[0586] Formulations with the different lipidoids, including, but not limited to penta[3- (l-laurylaminopropionyl)]-triethylenetetramine hydrochloride (TETA-5LAP; also known as 98N12-5, see Murugaiah et al, Analytical Biochemistry, 401 :61 (2010)),

Cl 2-200 (including derivatives and variants), and MD1, can be tested for in vivo activity. The lipidoid "98N12-5" is disclosed by Akinc et al., Mol Ther. 2009 17:872- 879. The lipidoid "C12-200" is disclosed by Love et al., Proc Natl Acad Sci U S A. 2010 107: 1864-1869 and Liu and Huang, Molecular Therapy. 2010 669-670. Each of the references is herein incorporated by reference in its entirety.

[0587] In one embodiment, the polynucleotides described herein can be formulated in an aminoalcohol lipidoid. Aminoalcohol lipidoids can be prepared by the methods described in U.S. Patent No. 8,450,298 (herein incorporated by reference in its entirety).

[0588] The lipidoid formulations can include particles comprising either 3 or 4 or more components in addition to polynucleotides. Lipidoids and polynucleotide formulations comprising lipidoids are described in Inti. Pub. No. WO 2015051214 (herein incorporated by reference in its entirety.

c. Hyaluronidase

[0589] In some embodiments, the polynucleotides described herein (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) and hyaluronidase for injection (e.g., intramuscular or subcutaneous injection). Hyaluronidase catalyzes the hydrolysis of hyaluronan, which is a constituent of the interstitial barrier. Hyaluronidase lowers the viscosity of hyaluronan, thereby increases tissue permeability (Frost, Expert Opin. Drug Deliv. (2007) 4:427-440). Alternatively, the hyaluronidase can be used to increase the number of cells exposed to the polynucleotides administered intramuscularly, or subcutaneously.

L Nanoparticle Mimics

[0590] In some embodiments, the polynucleotides described herein (e.g., a

polynucleotide comprising a nucleotide sequence encoding a wound healing

polypeptide) is encapsulated within and/or absorbed to a nanoparticle mimic. A nanoparticle mimic can mimic the delivery function organisms or particles such as, but not limited to, pathogens, viruses, bacteria, fungus, parasites, prions and cells. As a non-limiting example, the polynucleotides described herein can be encapsulated in a non-viron particle that can mimic the delivery function of a virus (see e.g., Inti. Pub. No. W02012006376 and U.S. Pub. Nos. US20130171241 and US20130195968, each of which is herein incorporated by reference in its entirety).

e. Self-Assembled Nanoparticles, or Self-Assembled Macromolecules

[0591] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) in self- assembled nanoparticles, or amphiphilic macromolecules (AMs) for delivery. AMs comprise biocompatible amphiphilic polymers that have an alkylated sugar backbone covalently linked to poly(ethylene glycol). In aqueous solution, the AMs self- assemble to form micelles. Nucleic acid self-assembled nanoparticles are described in Inti. Appl. No. PCT/US2014/027077, and AMs and methods of forming AMs are described in U.S. Pub. No. US20130217753, each of which is herein incorporated by reference in its entirety.

f Cations and Anions

[0592] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) and a cation or anion, such as Zn2+, Ca2+, Cu2+, Mg2+ and combinations thereof. Exemplary formulations can include polymers and a polynucleotide complexed with a metal cation as described in, e.g., U.S. Pat. Nos. 6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety. In some embodiments, cationic nanoparticles can contain a combination of divalent and monovalent cations. The delivery of polynucleotides in cationic nanoparticles or in one or more depot comprising cationic nanoparticles can improve polynucleotide bioavailability by acting as a long-acting depot and/or reducing the rate of degradation by nucleases. g Amino Acid Lipids

[0593] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) that is formulation with an amino acid lipid. Amino acid lipids are lipophilic compounds comprising an amino acid residue and one or more lipophilic tails. Non-limiting examples of amino acid lipids and methods of making amino acid lipids are described in U.S. Pat. No. 8,501,824. The amino acid lipid formulations can deliver a polynucleotide in releasable form that comprises an amino acid lipid that binds and releases the polynucleotides. As a non-limiting example, the release of the polynucleotides described herein can be provided by an acid-labile linker as described in, e.g., U.S. Pat. Nos. 7,098,032, 6,897,196, 6,426,086, 7,138,382, 5,563,250, and 5,505,931, each of which is herein incorporated by reference in its entirety.

h. Interpolyelectrolyte Complexes

[0594] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) in an interpoly electrolyte complex. Interpolyelectrolyte complexes are formed when charge-dynamic polymers are complexed with one or more anionic molecules. Non- limiting examples of charge-dynamic polymers and interpolyelectrolyte complexes and methods of making interpoly electrolyte complexes are described in U.S. Pat. No. 8,524,368, herein incorporated by reference in its entirety.

i. Crystalline Polymeric Systems

[0595] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) in crystalline polymeric systems. Crystalline polymeric systems are polymers with crystalline moieties and/or terminal units comprising crystalline moieties. Exemplary polymers are described in U.S. Pat. No. 8,524,259 (herein incorporated by reference in its entirety).

j. Polymers, Biodegradable Nanoparticles, and Core-Shell

Nanoparticles

[0596] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) and a natural and/or synthetic polymer. The polymers include, but not limited to, polyethenes, polyethylene glycol (PEG), poly(l-lysine)(PLL), PEG grafted to PLL, cationic lipopolymer, biodegradable cationic lipopolymer, polyethyleneimine (PEI), cross-linked branched poly(alkylene imines), a polyamine derivative, a modified poloxamer, elastic biodegradable polymer, biodegradable copolymer, biodegradable polyester copolymer, biodegradable polyester copolymer, multiblock copolymers, poly [a-(4-aminobutyl)-L-gly colic acid) (PAGA), biodegradable cross-linked cationic multi-block copolymers, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), poly cyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), amine-containing polymers, dextran polymers, dextran polymer derivatives or combinations thereof.

[0597] Exemplary polymers include, DYNAMIC POLYCONJUGATE® (Arrowhead

Research Corp., Pasadena, CA) formulations from MIRUS® Bio (Madison, WI) and Roche Madison (Madison, WI), PHASERXTM polymer formulations such as, without limitation, SMARTT POLYMER TECHNOLOGY™ (PHASERX®, Seattle, WA), DMRI/DOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, CA), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, CA), dendrimers and poly(lactic-co-gly colic acid) (PLGA) polymers. RONDELTM (RNAi/Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, CA) and pH responsive co-block polymers such as

PHASERX® (Seattle, WA).

[0598] The polymer formulations allow a sustained or delayed release of the

polynucleotide (e.g., following intramuscular or subcutaneous injection). The altered release profile for the polynucleotide can result in, for example, translation of an encoded protein over an extended period of time. The polymer formulation can also be used to increase the stability of the polynucleotide. Sustained release formulations can include, but are not limited to, PLGA microspheres, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, FL), HYLENEX® (Halozyme Therapeutics, San Diego CA), surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, GA), TISSELL® (Baxter International, Inc.

Deerfield, IL), PEG-based sealants, and COSEAL® (Baxter International, Inc.

Deerfield, IL).

[0599] As a non-limiting example modified mRNA can be formulated in PLGA

microspheres by preparing the PLGA microspheres with tunable release rates (e.g., days and weeks) and encapsulating the modified mRNA in the PLGA microspheres while maintaining the integrity of the modified mRNA during the encapsulation process. EVAc are non-biodegradable, biocompatible polymers that are used extensively in pre-clinical sustained release implant applications (e.g., extended release products Ocusert a pilocarpine ophthalmic insert for glaucoma or progestasert a sustained release progesterone intrauterine device; transdermal delivery systems Testoderm, Duragesic and Selegiline; catheters). Poloxamer F-407 NF is a hydrophilic, non-ionic surfactant triblock copolymer of poly oxy ethylene- poly oxypropylene-polyoxy ethylene having a low viscosity at temperatures less than 5°C and forms a solid gel at temperatures greater than 15°C.

[0600] As a non-limiting example, the polynucleotides described herein can be

formulated with the polymeric compound of PEG grafted with PLL as described in U.S. Pat. No. 6,177,274. As another non-limiting example, the polynucleotides described herein can be formulated with a block copolymer such as a PLGA-PEG block copolymer (see e.g., U.S. Pub. No. US20120004293 and U.S. Pat. Nos.

8,236,330 and 8,246,968), or a PLGA-PEG-PLGA block copolymer (see e.g., U.S. Pat. No. 6,004,573). Each of the references is herein incorporated by reference in its entirety.

[0601] In some embodiments, the polynucleotides described herein can be formulated with at least one amine-containing polymer such as, but not limited to polylysine, polyethylene imine, poly(amidoamine) dendrimers, poly(amine-co-esters) or combinations thereof. Exemplary polyamine polymers and their use as delivery agents are described in, e.g., U.S. Pat. Nos. 8,460,696, 8,236,280, each of which is herein incorporated by reference in its entirety.

[0602] In some embodiments, the polynucleotides described herein can be formulated in a biodegradable cationic lipopolymer, a biodegradable polymer, or a biodegradable copolymer, a biodegradable polyester copolymer, a biodegradable polyester polymer, a linear biodegradable copolymer, PAGA, a biodegradable cross-linked cationic multi-block copolymer or combinations thereof as described in, e.g., U.S. Pat. Nos.

6,696,038, 6,517,869, 6,267,987, 6,217,912, 6,652,886, 8,057,821, and 8,444,992; U.S. Pub. Nos. US20030073619, US20040142474, US20100004315, US2012009145 and US20130195920; and Inti Pub. Nos. W02006063249 and WO2013086322, each of which is herein incorporated by reference in its entirety.

[0603] In some embodiments, the polynucleotides described herein can be formulated in or with at least one cyclodextrin polymer as described in U.S. Pub. No.

US20130184453. In some embodiments, the polynucleotides described herein can be formulated in or with at least one crosslinked cation-binding polymers as described in Inti. Pub. Nos. W02013106072, W02013106073 and WO2013106086. In some embodiments, the polynucleotides described herein can be formulated in or with at least PEGylated albumin polymer as described in U.S. Pub. No. US20130231287. Each of the references is herein incorporated by reference in its entirety.

[0604] In some embodiments, the polynucleotides disclosed herein can be formulated as a nanoparticle using a combination of polymers, lipids, and/or other biodegradable agents, such as, but not limited to, calcium phosphate. Components can be combined in a core-shell, hybrid, and/or layer-by-layer architecture, to allow for fine-tuning of the nanoparticle for delivery (Wang et al, Nat Mater. 2006 5:791-796; Fuller et al, Biomaterials. 2008 29: 1526-1532; DeKoker et al, Adv Drug Deliv Rev. 2011 63:748- 761; Endres et al, Biomaterials. 2011 32:7721-7731; Su et al, Mol Pharm. 2011 Jun 6;8(3):774-87; herein incorporated by reference in their entireties). As a non-limiting example, the nanoparticle can comprise a plurality of polymers such as, but not limited to hydrophilic-hydrophobic polymers (e.g., PEG-PLGA), hydrophobic polymers (e.g., PEG) and/or hydrophilic polymers (Inti. Pub. No. WO20120225129, herein incorporated by reference in its entirety).

[0605] The use of core-shell nanoparticles has additionally focused on a high- throughput approach to synthesize cationic cross-linked nanogel cores and various shells (Siegwart et al, Proc Natl Acad Sci U S A. 2011 108: 12996-13001; herein incorporated by reference in its entirety). The complexation, delivery, and

internalization of the polymeric nanoparticles can be precisely controlled by altering the chemical composition in both the core and shell components of the nanoparticle. For example, the core-shell nanoparticles can efficiently deliver siRNA to mouse hepatocytes after they covalently attach cholesterol to the nanoparticle.

[0606] In some embodiments, a hollow lipid core comprising a middle PLGA layer and an outer neutral lipid layer containing PEG can be used to delivery of the polynucleotides as described herein. In some embodiments, the lipid nanoparticles can comprise a core of the polynucleotides disclosed herein and a polymer shell, which is used to protect the polynucleotides in the core. The polymer shell can be any of the polymers described herein and are known in the art. The polymer shell can be used to protect the polynucleotides in the core.

[0607] Core-shell nanoparticles for use with the polynucleotides described herein are described in U.S. Pat. No. 8,313,777 or Inti. Pub. No. WO2013124867, each of which is herein incorporated by reference in their entirety.

k. Peptides and Proteins

[0608] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) that is formulated with peptides and/or proteins to increase transfection of cells by the polynucleotide, and/or to alter the biodistribution of the polynucleotide (e.g., by targeting specific tissues or cell types), and/or increase the translation of encoded protein (e.g., Inti. Pub. Nos. WO2012110636 and WO2013123298. In some embodiments, the peptides can be those described in U.S. Pub. Nos. US20130129726, US20130137644 and US20130164219. Each of the references is herein incorporated by reference in its entirety.

1 Conjugates

[0609] In some embodiments, the compositions or formulations of the present

disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a wound healing polypeptide) that is covalently linked to a carrier or targeting group, or including two encoding regions that together produce a fusion protein (e.g., bearing a targeting group and therapeutic protein or peptide) as a conjugate. The conjugate can be a peptide that selectively directs the nanoparticle to neurons in a tissue or organism, or assists in crossing the blood-brain barrier.

[0610] The conjugates include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); an carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an oligonucleotide (e.g., an aptamer). Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N- isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine,

pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a poly amine, or an alpha helical peptide.

[0611] In some embodiments, the conjugate can function as a carrier for the

polynucleotide disclosed herein. The conjugate can comprise a cationic polymer such as, but not limited to, polyamine, polylysine, polyalkylenimine, and polyethylenimine that can be grafted to with poly(ethylene glycol). Exemplary conjugates and their preparations are described in U.S. Pat. No. 6,586,524 and U.S. Pub. No.

US20130211249, each of which herein is incorporated by reference in its entirety.

[0612] The conjugates can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer.

[0613] Targeting groups can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as an endothelial cell or bone cell. Targeting groups can also include hormones and hormone receptors. They can also include non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent frucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, or an activator of p38 MAP kinase.

[0614] The targeting group can be any ligand that is capable of targeting a specific receptor. Examples include, without limitation, folate, GalNAc, galactose, mannose, mannose-6P, apatamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII,

somatostatin, LDL, and HDL ligands. In particular embodiments, the targeting group is an aptamer. The aptamer can be unmodified or have any combination of modifications disclosed herein. As a non-limiting example, the targeting group can be a glutathione receptor (GR)-binding conjugate for targeted delivery across the blood- central nervous system barrier as described in, e.g., U.S. Pub. No. US2013021661012 (herein incorporated by reference in its entirety).

[0615] In some embodiments, the conjugate can be a synergistic biomolecule- polymer conjugate, which comprises a long-acting continuous-release system to provide a greater therapeutic efficacy. The synergistic biomolecule-polymer conjugate can be those described in U.S. Pub. No. US20130195799. In some embodiments, the conjugate can be an aptamer conjugate as described in Inti. Pat. Pub. No.

W02012040524. In some embodiments, the conjugate can be an amine containing polymer conjugate as described in U.S. Pat. No. 8,507,653. Each of the references is herein incorporated by reference in its entirety. In some embodiments, the polynucleotides can be conjugated to SMARTT POLYMER TECHNOLOGY® (PHASERX®, Inc. Seattle, WA).

[0616] In some embodiments, the polynucleotides described herein are covalently conjugated to a cell penetrating polypeptide, which can also include a signal sequence or a targeting sequence. The conjugates can be designed to have increased stability, and/or increased cell transfection; and/or altered the biodistribution (e.g., targeted to specific tissues or cell types).

[0617] In some embodiments, the polynucleotides described herein can be conjugated to an agent to enhance delivery. In some embodiments, the agent can be a monomer or polymer such as a targeting monomer or a polymer having targeting blocks as described in Inti. Pub. No. WO2011062965. In some embodiments, the agent can be a transport agent covalently coupled to a polynucleotide as described in, e.g., U.S. Pat. Nos. 6,835.393 and 7,374,778. In some embodiments, the agent can be a membrane barrier transport enhancing agent such as those described in U.S. Pat. Nos. 7,737,108 and 8,003,129. Each of the references is herein incorporated by reference in its entirety.

22. Methods of Use

[0618] The polynucleotides, pharmaceutical compositions and formulations described herein are used in the preparation, manufacture and therapeutic use of a medicament to: (i) promote and/or improve wound healing, (ii) prevent and/or reduce scar formation at a wound, (iii) reduce the visibility of a scar in a subject in need thereof; and/or (iv) treat diseases that result in wounds or chronic skin pathology owing to lack of or reduced levels of a wound healing polypeptide, e.g., as in the case of epidermolysis bullosa.

[0619] In some embodiments, the polynucleotides, pharmaceutical compositions and formulations of the invention are used in methods for increasing the levels of wound healing polypeptides in a subject in need thereof. In some embodiments, the polynucleotides, pharmaceutical compositions and formulations of the invention are used in methods for increasing the levels of wound healing polypeptides in a subject in need thereof.

[0620] For instance, one aspect of the invention provides a method of promoting

and/or improving wound healing in a subject comprising the intradermal (e.g., using microneedles) or topical administration of a composition or formulation comprising a polynucleotide encoding a wound healing polypeptide to that subject (e.g., an mRNA encoding a wound healing polypeptide).

[0621] As used herein, the term“topical administration” refers to application of a composition or formulation of the invention to the skin, e.g., to intact or broken skin. If the skin is broken, the term“topical” covers contacting a composition or formulation with the surface of the wound, rather than a particular layer of the skin.

In a preferred embodiment, the skin is broken, either from the wound itself or by

abrading the skin gently prior to application of the composition or formulation. In one embodiment, the wound is the result of an accident, e.g., an abrasion, a puncture, a laceration, or an ulcer. In one embodiment, the wound is the result of a surgical procedure.

[0622] As used herein, the term“intradermal” refers to application of the compounds of formulations of the invention into the dermis, i.e., between the epidermis and the hypodermis. The compounds or formulations of the invention may be injected intradermally using known methods, e.g using microneedles.

[0623] In another embodiment, the wound is a chronic wound, e.g., a wound that has not healed three months after the wound is received. In one embodiment, the wound is an acute wound.

[0624] Another aspect of the invention provides a method of preventing and/or

reducing scar formation at a wound in a subject comprising the intradermal (e.g., using microneedles) or topical administration of a composition or formulation comprising a polynucleotide encoding a wound healing polypeptide to that subject (e.g., an mRNA encoding a wound healing polypeptide).

[0625] Another aspect of the invention provides a method of reducing the visibility of a scar in a subject comprising the intradermal (e.g., using microneedles) or topical administration of a composition or formulation comprising a polynucleotide encoding a wound healing polypeptide to that subject (e.g., an mRNA encoding a wound healing polypeptide).

[0626] Yet another aspect of the invention provides a method of treatment of

epidermolysis bullosa in a subject in need thereof comprising the intradermal (e.g., using microneedles) or topical administration of a composition or formulation comprising a polynucleotide encoding a wound healing polypeptide to that subject (e.g., an mRNA encoding a wound healing polypeptide), wherein the wound healing polypeptide is a collagen. In certain embodiments, the epidermolysis bullosa is epidermolysis bullosa simplex. In some embodiments, the epidermolysis bullosa is junctional epidermolysis bullosa. In some embodiments, the epidermolysis bullosa is dystrophic epidermolysis bullosa.

[0627] The level of wound healing polypeptides in wounds (e.g., acute or chronic wounds) may be decreased. Thus, increasing the level of wound healing polypeptides in a wound is a potential treatment for: (i) promoting and/or improving wound healing, (ii) preventing and/or reducing scar formation at a wound, (iii) reducing the visibility of a scar, and/or (iv) treatment of epidermolysis bullosa. Thus, in certain aspects of the invention, the polynucleotides, e.g., mRNA, disclosed herein comprise one or more sequences encoding a wound healing polypeptide that is suitable for use in (i) promoting and/or improving wound healing, (ii) preventing and/or reducing scar formation at a wound, (iii) reducing the visibility of a scar, and/or (iv) treatment of epidermolysis bullosa. In some embodiments, the present disclosure treats a lack of wound healing polypeptide or wound healing polypeptide activity, or decreased or abnormal wound healing polypeptide activity in a subject by providing a

polynucleotide, e.g., mRNA, that encodes a wound healing polypeptide to the subject. In some embodiments, the polynucleotide is sequence-optimized. In some embodiments, the polynucleotide (e.g., an mRNA) comprises a nucleic acid sequence (e.g., an ORF) encoding a wound healing polypeptide, wherein the nucleic acid is sequence-optimized, e.g., by modifying its G/C, uridine, or thymidine content, and/or the polynucleotide comprises at least one chemically modified nucleoside. In some embodiments, the polynucleotide comprises a miRNA binding site, e.g., a miRNA binding site that binds miRNA- 142 and/or a miRNA binding site that binds miRNA- 126.

[0628] In some embodiments, the intradermal (e.g., using microneedles) or topical administration of the polynucleotide, pharmaceutical composition or formulation of the invention results in expression of wound healing polypeptide in cells of the subject. In some embodiments, intradermally (e.g., using microneedles) or topically administering the polynucleotide, pharmaceutical composition or formulation of the invention results in an increase of expression and/or activity of the wound healing polypeptide in the subject. For example, in some embodiments, the polynucleotides of the present invention are used in methods of intradermally (e.g., using microneedles) or topically administering a composition or formulation comprising an mRNA encoding a wound healing polypeptide to a subject, wherein the method results in an increase of expression and/or activity of the wound healing polypeptide in at least some cells of a subject.

[0629] In some embodiments, the intradermal (e.g., using microneedles) or topical administration of a composition or formulation comprising an mRNA encoding a wound healing polypeptide to a subject results in an increase of expression and/or activity of the wound healing polypeptide in cells subject to a level at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% or more of the expression and/or activity level expected in a normal subject, e.g. , a human not suffering from a wound.

[0630] In some embodiments, the intradermal (e.g., using microneedles) or topical administration of the polynucleotide, pharmaceutical composition or formulation of the invention results in expression of the wound healing protein in at least some of the cells of a subject that persists for a period of time sufficient to allow significant wound healing to occur.

[0631] In some embodiments, the expression of the encoded polypeptide is increased.

In some embodiments, the polynucleotide increases expression and/or activity levels of the wound healing polypeptide in cells when introduced into those cells, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% with respect to the wound healing polypeptide expression and/or activity level in the cells before the polypeptide is introduced in the cells.

[0632] Other aspects of the present disclosure relate to transplantation of cells

containing polynucleotides to a mammalian subject, e.g., a subject having a wound or other condition that would benefit from increased expression of wound healing polypeptides. Administration of cells to mammalian subjects is known to those of ordinary skill in the art, and includes, but is not limited to, local implantation (e.g., intradermal (e.g., using microneedles), topical or subcutaneous administration), organ delivery or systemic injection (e.g., intravenous injection or inhalation), and the formulation of cells in pharmaceutically acceptable carriers.

[0633] The present disclosure also provides methods to increase activity of a wound healing polypeptide in a subject in need thereof, e.g., a subject with a wound, comprising intradermally (e.g., using microneedles) or topically administering to the subject a therapeutically effective amount of a composition or formulation comprising mRNA encoding a wound healing polypeptide disclosed herein, e.g., a human wound healing polypeptide described in Table 1, a mutant thereof, or a fusion protein comprising a human wound healing polypeptide described in Table 1.

[0634] In some aspects, the wound healing polypeptide activity measured after

intradermal (e.g., using microneedles) or topical administration to a subject in need thereof, e.g., a subject with a wound, is at least the normal wound healing polypeptide activity level observed in healthy human subjects. In some aspects, the wound healing polypeptide activity measured after intradermal (e.g., using microneedles) or topical administration is at higher than the wound healing polypeptide activity level observed in wounded patients. In some aspects, the increase in wound healing polypeptide activity in a subject in need thereof, e.g., a subject with a wound, after intradermally (e.g., using microneedles) or topically administering to the subject a therapeutically effective amount of a composition or formulation comprising mRNA encoding a wound healing polypeptide disclosed herein is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or greater than 100 percent of the normal wound healing polypeptide activity level observed in healthy human subjects. In some aspects, the increase in wound healing polypeptide activity above the wound healing polypeptide activity level observed in wounded patients after intradermally (e.g., using microneedles) or topically administering to the subject a composition or formulation comprising an mRNA encoding a wound healing polypeptide disclosed herein (e.g., after a single dose intradermal (e.g., using microneedles) or topical administration) is maintained for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 12 days, 14 days, 21 days, or 28 days.

[0635] In some embodiments, the polynucleotides (e.g., mRNA), pharmaceutical compositions and formulations used in the methods of the invention comprise a uracil-modified sequence encoding a wound healing polypeptide disclosed herein and a miRNA binding site disclosed herein, e.g., a miRNA binding site that binds to miR- 142 and/or a miRNA binding site that binds to miR-126. In some embodiments, the uracil-modified sequence encoding a wound healing polypeptide comprises at least one chemically modified nucleobase, e.g., Nl-methylpseudouracil or 5- methoxyuracil. In some embodiments, at least 95% of a type of nucleobase (e.g., uracil) in a uracil-modified sequence encoding a wound healing polypeptide of the invention are modified nucleobases. In some embodiments, at least 95% of uracil in a uracil-modified sequence encoding a wound healing polypeptide is 1-N- methylpseudouridine or 5 -methoxy uridine. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) disclosed herein is formulated with a delivery agent comprising, e.g., a compound having the Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having the Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233-342, e.g., Compound VI; or a compound having the Formula

(VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about

47.5: 10.5:39.0:3.0 or about 50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio in the range of about 30 to about 60 mol% Compound II or VI (or related suitable amino lipid) (e.g., 30-40, 40-45, 45-50, 50-55 or 55-60 mol%

Compound II or VI (or related suitable amino lipid)), about 5 to about 20 mol% phospholipid (or related suitable phospholipid or“helper lipid”) (e.g., 5-10, 10-15, or 15-20 mol% phospholipid (or related suitable phospholipid or“helper lipid”)), about 20 to about 50 mol% cholesterol (or related sterol or“non-cationic” lipid) (e.g., about 20-30, 30-35, 35-40, 40-45, or 45-50 mol% cholesterol (or related sterol or“non- cationic” lipid)) and about 0.05 to about 10 mol% PEG lipid (or other suitable PEG lipid) (e.g., 0.05-1, 1-2, 2-3, 3-4, 4-5, 5-7, or 7-10 mol% PEG lipid (or other suitable PEG lipid)). An exemplary delivery agent can comprise mole ratios of, for example, 47.5: 10.5:39.0:3.0 or 50: 10:38.5: 1.5. In certain instances, an exemplary delivery agent can comprise mole ratios of, for example, 47.5: 10.5:39.0:3; 47.5: 10:39.5:3;

47.5: 11:39.5:2; 47.5: 10.5:39.5:2.5; 47.5: 11:39:2.5; 48.5: 10:38.5:3; 48.5: 10.5:39:2; 48.5: 10.5:38.5:2.5; 48.5: 10.5:39.5: 1.5; 48.5: 10.5:38.0:3; 47: 10.5:39.5:3;

47: 10:40.5:2.5; 47: 11 :40:2; 47: 10.5:39.5:3; 48: 10.5:38.5:3; 48: 10:39.5:2.5;

48: 11 :39:2; or 48: 10.5:38.5:3. In some embodiments, the delivery agent comprises Compound II or VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound II or VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0 or about 50: 10:38.5: 1.5.

[0636] The skilled artisan will appreciate that the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of expression of an encoded protein in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human). Likewise, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of activity of an encoded protein (e.g., enzyme) in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human). Furthermore, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of an appropriate biomarker in sample(s) taken from a subject. Levels of protein and/or biomarkers can be determined post-administration with a single dose of an mRNA therapeutic of the invention or can be determined and/or monitored at several time points following intradermal (e.g., using microneedles) or topical administration with a single dose or can be determined and/or monitored throughout a course of treatment, e.g., a multi-dose treatment.

Wound Healing Protein Expression Levels

[0637] Certain aspects of the invention feature measurement, determination and/or monitoring of the expression level or levels of a wound healing protein in a subject, for example, in an animal (e.g., rodents, primates, and the like) or in a human subject. Animals include normal, healthy or wild type animals, as well as animal models for use in understanding wound healing and treatments thereof. Exemplary animal models include rodent models, for example, diabetic and venous hypertension mouse models, and a porcine pressure ulcer model.

[0638] Wound healing protein expression levels can be measured or determined by any art-recognized method for determining protein levels in biological samples, e.g., from blood samples or a needle biopsy. The term "level" or "level of a protein" as used herein, preferably means the weight, mass or concentration of the protein within a sample or a subject. It will be understood by the skilled artisan that in certain embodiments the sample may be subjected, e.g., to any of the following: purification, precipitation, separation, e.g. centrifugation and/or HPLC, and subsequently subjected to determining the level of the protein, e.g., using mass and/or spectrometric analysis. In exemplary embodiments, enzyme-linked immunosorbent assay (ELISA) can be used to determine protein expression levels. In other exemplary embodiments, protein purification, separation and LC-MS can be used as a means for determining the level of a protein according to the invention. In some embodiments, an mRNA therapy of the invention (e.g., a single intradermal (e.g., using microneedles) or topical dose) results in increased wound healing protein expression levels in the tissue (e.g., liver) of the subject (e.g., 2-fold, 3 -fold, 4-fold, 5 -fold, 6-fold, 7-fold, 8-fold, 9-fold, 10- fold, 20-fold, 30-fold, 40-fold, 50-fold increase and/or increased to at least 50%, at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, or at least 100% of normal levels) for at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 122 hours after intradermal (e.g., using microneedles) or topical administration of a single dose of the mRNA therapy. Wound Healing Protein Activity

[0639] In wounds (e.g., nonhealing wounds), the activity (e.g., signaling activity) of a wound healing polypeptide (see, e.g., Table 1) is reduced compared to a normal physiological activity level (e.g., in a healing wound). Further aspects of the invention feature measurement, determination and/or monitoring of the activity level(s) (e.g., signaling activity level(s)) of a wound healing polypeptide in a subject, for example, in an animal (e.g., rodent, primate, and the like) or in a human subject. Activity levels can be measured or determined by any art-recognized method for determining signaling activity levels in biological samples (e.g., analysis of downstream signaling protein levels, analysis of phosphorylation status, use of reporter assays). The term "activity level" or "signaling activity level" as used herein, preferably means the activity of the polypeptide per volume, mass or weight of sample or total protein within a sample. In exemplary embodiments, the "activity level" or "signaling activity level" is described in terms of units per milliliter of fluid (e.g., bodily fluid, e.g., serum, plasma, urine and the like) or is described in terms of units per weight of tissue or per weight of protein (e.g., total protein) within a sample.

[0640] In certain embodiments, an mRNA therapy of the invention features a

pharmaceutical composition comprising a dose of mRNA effective to result in at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 50-fold, or at least 100-fold, from 1.5-fold to 100-fold, from 1.5 to 10-fold, from 10-fold to 50-fold increase in wound healing polypeptide activity in a tissue (e.g., the site of the wound or a site adjacent to the wound) from 6 to 12 hours, from 12 to 24 hours, from 24 to 48 hours, or from 48 to 72 hours post intradermal (e.g., using microneedles) or topical administration (e.g., at 48 or at 72 hours post intradermal (e.g., using microneedles) or topical administration) (e.g., as compared to the activity level of the wound healing polypeptide prior to intradermal (e.g., using microneedles) or topical administration of the pharmaceutical composition).

[0641] In exemplary embodiments, an mRNA therapy of the invention features a pharmaceutical composition comprising a single intradermal (e.g., using

microneedles) or topical dose of mRNA that results in the above-described levels of activity. In another embodiment, an mRNA therapy of the invention features a pharmaceutical composition which can be administered in multiple single unit intradermal (e.g., using microneedles) or topical doses of mRNA that maintain the above-described levels of activity.

Wound Healing Biomarkers

[0642] In some embodiments, the intradermal (e.g., using microneedles) or topical administration of an effective amount of a polynucleotide, pharmaceutical composition or formulation of the invention normalizes the levels of a biomarker of wound healing impairment (see, e.g., Lindley et al, 2016, Plast Reconstr Surg, 138(3): 18S-28S for a summary of biomarkers of wound healing impairment).

Nonlimiting examples of biomarkers of impaired wound healing include: (i) increased levels of beta-catenin, c-myc, ADAM12, miRNA-16, miRNA-20a, miRNA-21, miRNA-106a, miRNA-130a, miRNA-203, MMP1, MMP2, MMp3, MMP7, MMP8, MMP9, MMP10, MMP11, MMP13, IL1, IL6, and/or procalcitonin, (ii) decreased levels of BMPR, LRIG1, GAT A3, IDR2,4, K15, cathelicidin, TGF-b I, II, and III ligands, phospho-smad2, TIMP1, CD34+/CD45 -diminished circulating cells, HIF1-2, miRNA-200b, and/or miRNA-191, and (iii) increased cytoplasmic staining of EGFR. In some embodiments, the intradermal (e.g., using microneedles) or topical administration of the polynucleotide, pharmaceutical composition or formulation of the invention results in normalization of the level of one or more biomarkers of wound healing impairment within a short period of time after intradermal (e.g., using microneedles) or topical administration of the polynucleotide, pharmaceutical composition or formulation of the invention. Methods of determining the level of biomarkers are known in the art may be used in determining the level the biomarkers described herein.

[0643] In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in wound tissue (e.g., debrided wound tissue or wound fluid). Methods of obtaining wound tissue (e.g., debrided wound tissue or wound fluid) and for measuring the level of biomarkers in wound tissue (e.g., debrided wound tissue or wound fluid) are known in the art. In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in blood. In some

embodiments, the level of one of more biomarkers of wound healing impairment is measured in a component of blood, for example in plasma or serum. Methods of obtaining blood and components of blood and for measuring the level of biomarkers in blood or a component of blood are known in the art. In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in a dried blood spot. In embodiments where levels of wound healing impairment are determined in dried blood spots, the method of determination can be mass spectrometry methods known in the art. In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in urine. Methods of obtaining urine and for measuring the level of biomarkers in urine are known in the art. In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in bile. Methods of obtaining bile and for measuring the level of biomarkers in bile are known in the art. In some embodiments, the level of one or more biomarkers of wound healing impairment is measured in liver tissue. Methods of obtaining liver tissue, e.g. biopsy, and for measuring the level of biomarkers in liver tissue are known in the art.

[0644] Further aspects of the invention feature determining the level (or levels) of a biomarker determined in a sample as compared to a level (e.g., a reference level) of the same or another biomarker in another sample, e.g., from the same patient, from another patient, from a control and/or from the same or different time points, and/or a physiologic level, and/or an elevated level, and/or a supraphysiologic level, and/or a level of a control. The skilled artisan will be familiar with physiologic levels of biomarkers, for example, levels in normal or wild type animals, normal or healthy subjects, and the like, in particular, the level or levels characteristic of subjects who are healthy and/or normal functioning. As used herein, the phrase“elevated level” means amounts greater than normally found in a normal or wild type preclinical animal or in a normal or healthy subject, e.g. a human subject. As used herein, the term“supraphysiologic” means amounts greater than normally found in a normal or wild type preclinical animal or in a normal or healthy subject, e.g. a human subject, optionally producing a significantly enhanced physiologic response. As used herein, the term "comparing" or "compared to" preferably means the mathematical comparison of the two or more values, e.g., of the levels of the biomarker(s). It will thus be readily apparent to the skilled artisan whether one of the values is higher, lower or identical to another value or group of values if at least two of such values are compared with each other. Comparing or comparison to can be in the context, for

example, of comparing to a control value, e.g., as compared to a reference blood, serum, plasma, and/or tissue (e.g., wound tissue) level of a biomarker of impaired wound healing, in said subject prior to intradermal (e.g., using microneedles) or topical administration (e.g., in a person suffering from a wound (e.g., a nonhealing wound)) or in a normal or healthy subject. Comparing or comparison to can also be in the context, for example, of comparing to a control value, e.g., as compared to a reference blood, serum, plasma and/or tissue (e.g., wound tissue) level of a biomarker of impaired wound healing in said subject prior to intradermal (e.g., using

microneedles) or topical administration (e.g., in a person suffering from a wound (e.g., a nonhealing wound)) or in a normal or healthy subject.

[0645] As used herein, a“control” is preferably a sample from a subject wherein the wound healing status of said subject is known. In one embodiment, a control is a sample of a healthy patient. In another embodiment, the control is a sample from at least one subject having a known wound healing status, for example, a severe, mild, or healthy wound healing status, e.g. a control patient. In another embodiment, the control is a sample from a subject not being treated for wound healing. In a still further embodiment, the control is a sample from a single subject or a pool of samples from different subjects and/or samples taken from the subject(s) at different time points.

[0646] The term "level" or "level of a biomarker" as used herein, preferably means the mass, weight or concentration of a biomarker of the invention within a sample or a subject. It will be understood by the skilled artisan that in certain embodiments the sample may be subjected to, e.g., one or more of the following: substance purification, precipitation, separation, e.g. centrifugation and/or HPLC and subsequently subjected to determining the level of the biomarker, e.g. using mass spectrometric analysis. In certain embodiments, LC-MS can be used as a means for determining the level of a biomarker according to the invention.

[0647] The term "determining the level" of a biomarker as used herein can mean

methods which include quantifying an amount of at least one substance in a sample from a subject, for example, in a bodily fluid from the subject (e.g., serum, plasma, urine, lymph, wound fluid etc.) or in a tissue of the subject (e.g., wound, etc.).

[0648] The term "reference level" as used herein can refer to levels (e.g., of a

biomarker) in a subject prior to intradermal (e.g., using microneedles) or topical administration of an mRNA therapy of the invention (e.g., in a person suffering from a wound) or in a normal or healthy subject.

[0649] As used herein, the term“normal subject” or“healthy subject” refers to a subject not suffering from symptoms associated with a wound or wound healing impairment. In certain embodiments of the present invention, a sample from a healthy subject is used as a control sample, or the known or standardized value for the level of biomarker from samples of healthy or normal subjects is used as a control.

[0650] With respect to biomarkers of wound healing impairment that are elevated, increased, or higher compared to a baseline or reference level, in some embodiments, comparing the level of the biomarker in a sample from a subject in need of treatment for wound healing (e.g., wound healing impairment) or in a subject being treated for wound healing (e.g., wound healing impairment) to a control level of the biomarker comprises comparing the level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) to a baseline or reference level, wherein if a level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) is elevated, increased or higher compared to the baseline or reference level, this is indicative that the subject is suffering from wound healing impairment and/or is in need of treatment; and/or wherein if a level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) is decreased or lower compared to the baseline level this is indicative that the subject is not suffering from, is successfully being treated for wound healing, or is not in need of treatment for wound healing. The stronger the reduction (e.g., at least 2-fold, at least 3-fold, at least 4-fold, at least 5- fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 10-fold, at least 20-fold, at least-30 fold, at least 40-fold, at least 50-fold reduction and/or at least 10%, at least 20%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% reduction) of the level of a biomarker, within a certain time period, e.g., within 6 hours, within 12 hours, within 24 hours, within 36 hours, within 48 hours, within 60 hours, or within 72 hours, and/or for a certain duration of time, e.g., 48 hours, 72 hours, 96 hours, 120 hours, 144 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, etc., the more successful is a therapy, such as for example an mRNA therapy of the invention (e.g., a single dose or a multiple regimen).

[0651] A reduction of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least 100% or more of the level of biomarker, in particular, in bodily fluid (e.g., plasma, serum, urine, e.g., urinary sediment, wound fluid) or in tissue(s) in a subject (e.g., wound tissue), within 1, 2, 3, 4, 5, 6 or more days following intradermal (e.g., using microneedles) or topical administration is indicative of a dose suitable for successful treatment of wound healing, wherein reduction as used herein, preferably means that the level of biomarker determined at the end of a specified time period (e.g., post-administration, for example, of a single intradermal (e.g., using microneedles) or topical dose) is compared to the level of the same biomarker determined at the beginning of said time period (e.g., pre-administration of said dose). Exemplary time periods include 12, 24, 48, 72, 96, 120 or 144 hours post

administration, in particular 24, 48, 72 or 96 hours post-administration.

[0652] A sustained reduction in substrate levels (e.g., biomarkers) is particularly indicative of mRNA therapeutic dosing and/or intradermal (e.g., using microneedles) or topical administration regimens successful for treatment of wound healing. Such sustained reduction can be referred to herein as“duration” of effect. In exemplary embodiments, a reduction of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% or more of the level of biomarker, in particular, in a bodily fluid (e.g., plasma, serum, urine, e.g., urinary sediment, wound fluid) or in tissue(s) in a subject (e.g., wound tissue), within 1, 2, 3, 4, 5, 6, 7, 8 or more days following intradermal (e.g., using microneedles) or topical administration is indicative of a successful therapeutic approach. In exemplary embodiments, sustained reduction in substrate (e.g., biomarker) levels in one or more samples (e.g., fluids and/or tissues) is preferred. For example, mRNA therapies resulting in sustained reduction in a biomarker, optionally in combination with sustained reduction of said biomarker in at least one tissue, preferably two, three, four, five or more tissues, is indicative of successful treatment.

[0653] With respect to biomarkers of wound healing impairment that are diminished, decreased, or lower compared to a baseline or reference level, in some embodiments, comparing the level of the biomarker in a sample from a subject in need of treatment for wound healing (e.g., wound healing impairment) or in a subject being treated for wound healing (e.g., wound healing impairment) to a control level of the biomarker comprises comparing the level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) to a baseline or reference level, wherein if a level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) is diminished, decreased, or lower compared to the baseline or reference level, this is indicative that the subject is suffering from wound healing impairment and/or is in need of treatment; and/or wherein if a level of the biomarker in the sample from the subject (in need of treatment or being treated for wound healing) is increased or higher compared to the baseline level this is indicative that the subject is not suffering from, is successfully being treated for wound healing, or is not in need of treatment for wound healing. The stronger the increase (e.g., at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 10-fold, at least 20-fold, at least- 30 fold, at least 40-fold, at least 50-fold increase and/or at least 10%, at least 20%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% increase) of the level of a biomarker, within a certain time period, e.g., within 6 hours, within 12 hours, within 24 hours, within 36 hours, within 48 hours, within 60 hours, or within 72 hours, and/or for a certain duration of time, e.g., 48 hours, 72 hours, 96 hours, 120 hours, 144 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, etc., the more successful is a therapy, such as for example an mRNA therapy of the invention (e.g., a single dose or a multiple regimen).

[0654] An increase of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least 100% or more of the level of biomarker, in particular, in bodily fluid (e.g., plasma, serum, urine, e.g., urinary sediment, wound fluid) or in tissue(s) in a subject (e.g., wound tissue), within 1, 2, 3, 4, 5, 6 or more days following intradermal (e.g., using microneedles) or topical administration is indicative of a dose suitable for successful treatment of wound healing, wherein increase as used herein, preferably means that the level of biomarker determined at the end of a specified time period (e.g., post-administration, for example, of a single intradermal (e.g., using microneedles) or topical dose) is compared to the level of the same biomarker

determined at the beginning of said time period (e.g., pre-administration of said dose). Exemplary time periods include 12, 24, 48, 72, 96, 120 or 144 hours post

administration, in particular 24, 48, 72 or 96 hours post-administration.

[0655] A sustained increase in substrate levels (e.g., biomarkers) is particularly

indicative of mRNA therapeutic dosing and/or intradermal (e.g., using microneedles) or topical administration regimens successful for treatment of wound healing. Such sustained increase can be referred to herein as "duration" of effect. In exemplary embodiments, an increase of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% or more of the level of biomarker, in particular, in a bodily fluid (e.g., plasma, serum, urine, e.g., urinary sediment, wound fluid) or in tissue(s) in a subject (e.g., wound tissue), within 1, 2, 3, 4, 5, 6, 7, 8 or more days following intradermal (e.g., using microneedles) or topical administration is indicative of a successful therapeutic approach. In exemplary embodiments, sustained increase in substrate (e.g., biomarker) levels in one or more samples (e.g., fluids and/or tissues) is preferred. For example, mRNA therapies resulting in sustained increase in a biomarker, optionally in combination with sustained increase of said biomarker in at least one tissue, preferably two, three, four, five or more tissues, is indicative of successful treatment.

[0656] In some embodiments, a single dose of an mRNA therapy of the invention is about 0.01 mg/kg to about 10 mg/kg of polynucleotide per subject body weight (mpk). In some embodiments, a single dose of an mRNA therapy of the invention is about 1 to 10 mpk, about 2 to 9 mpk, about 3 to 8 mpk, about 4 to 7 mpk, or about 5 to 6 mpk. In some embodiments, a single dose of an mRNA therapy of the invention is about 0.2 to about 0.8 mpk, about 0.3 to about 0.7 mpk, about 0.4 to about 0.8 mpk, or about 0.5 mpk. In another embodiment, a single dose of an mRNA therapy of the invention is less than 1.5 mpk, less than 1.25 mpk, less than 1 mpk, or less than 0.75 mpk.

Scar Formation and Visibility

[0657] Certain aspects of the invention feature measurement, determination and/or monitoring of the visibility of a scar in a subject, for example, in an animal (e.g., rodents, primates, and the like) or in a human subject. Animals include normal, healthy or wild type animals, as well as animal models for use in understanding scar reduction and scar prevention treatments thereof.

[0658] The formation or visibility of a scar can be measured or determined by any art- recognized method for determining the reduction or visibility of a scar (see, e.g.,

Idriss & Maibach, 2009, Skin Research and Technology, 15: 1-5). For example, the size, height, color, pliability, texture, surface area, and/or presence of hair at the site of a scar can be measured or determined and compared to the size, height, color, pliability, texture, surface area, and/or presence of hair at the site of a scar, respectively, prior to treatment. In some embodiments, an mRNA therapy of the invention (e.g., a single intradermal (e.g., using microneedles) or topical dose results in a decrease in the size, height, or surface area of a scar on the subject (e.g., a 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold decrease and/or decreased to at least 50%, at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, or 100% of the size, height, or surface area, respectively, prior to mRNA therapy) at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 122 hours after intradermal (e.g., using microneedles) or topical administration of a single dose of the mRNA therapy. In some embodiments, an mRNA therapy of the invention (e.g., a single intradermal (e.g., using microneedles) or topical dose results in an increase in the pliability of or presence of hair on a scar on the subject (e.g., a 2-fold, 3-fold, 4- fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold increase and/or increased to at least 50%, at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, or 100% of the pliability of or presence of hair on, respectively, a scar prior to mRNA therapy) at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 122 hours after intradermal (e.g., using microneedles) or topical administration of a single dose of the mRNA therapy.

23. Compositions and Formulations for Use

[0659] Certain aspects of the invention are directed to compositions or formulations comprising any of the polynucleotides disclosed above. In certain embodiments, the

compositions or formulations are for intradermal (e.g., using microneedles) or topical administration to a subject.

[0660] In some embodiments, the composition or formulation comprises:

(i) a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a sequence- optimized nucleotide sequence (e.g., an ORF) encoding a wound healing polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereol), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g.,

Nl-methylpseudouracil or 5 -methoxy uracil (e.g., wherein at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are Nl-methylpseudouracils or 5 -methoxy uracils), and wherein the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 (e.g., a miR-142-3p or miR-142-5p binding site) and/or a miRNA binding site that binds to miR-126 (e.g., a miR-126-3p or miR-126-5p binding site); and

(ii) a delivery agent comprising, e.g., a compound having the Formula (I), e.g., any of Compounds 1-232, e.g., Compound II; a compound having the Formula (III), (IV), (V), or (VI), e.g., any of Compounds 233-342, e.g., Compound VI; or a compound having the Formula (VIII), e.g., any of Compounds 419-428, e.g., Compound I, or any combination thereof. In some embodiments, the delivery agent is a lipid nanoparticle comprising Compound II, Compound VI, a salt or a stereoisomer thereof, or any combination thereof. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound II, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 50: 10:38.5: 1.5. In some embodiments, the delivery agent comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG-DMG, e.g., with a mole ratio of about 47.5: 10.5:39.0:3.0.

[0661] In some embodiments, the uracil or thymine content of the ORF relative to the theoretical minimum uracil or thymine content of a nucleotide sequence encoding the wound healing polypeptide (%14TM OG %TTM), is between about 100% and about 150%.

[0662] In some embodiments, the polynucleotides, compositions, or formulations above are used to promote and/or increase wound healing.

[0663] In some embodiments, the polynucleotides, compositions, or formulations above are used to prevent and/or reduce scar formation at a wound.

[0664] In some embodiments, the polynucleotides, compositions, or formulations above are used to reduce the visibility of a scar in a subject in need thereof.

[0665] In some embodiments, the polynucleotides, compositions, or formulations above are used to treat epidermolysis bullosa.

24. Forms of Administration

[0666] The polynucleotides, pharmaceutical compositions and formulations of the invention described above can be administered intradermally (e.g., using microneedles) or topically. In some embodiments, a formulation for a intradermal (e.g., using microneedles) or topical administration can include at least one inactive ingredient.

[0667] The polynucleotides of the present invention (e.g., a polynucleotide

comprising a nucleotide sequence encoding a wound healing polypeptide or a functional fragment or variant thereol) can be formulated, using the methods described herein. The formulations can contain polynucleotides that can be modified and/or unmodified. The formulations can further include, but are not limited to, cell penetration agents, a pharmaceutically acceptable carrier, a delivery agent, a bioerodible or biocompatible polymer, a solvent, and a sustained-release delivery depot. The formulated polynucleotides can be delivered to the cell using routes of administration known in the art and described herein (e.g., intradermal (e.g., using microneedles) or topical administration).

[0668] A pharmaceutical composition for intradermal (e.g., using microneedles) or topical administration can comprise at least one inactive ingredient. Any or none of the inactive ingredients used can have been approved by the US Food and Drug Administration (FDA).

25. Kits and Devices

CL Kits

[0669] The invention provides a variety of kits for conveniently and/or effectively using the claimed nucleotides of the present invention. Typically, kits will comprise sufficient amounts and/or numbers of components to allow a user to perform multiple treatments of a subject(s) and/or to perform multiple experiments.

[0670] In one aspect, the present invention provides kits comprising the molecules

(polynucleotides) of the invention.

[0671] Said kits can be for protein production, comprising a first polynucleotides comprising a translatable region. The kit can further comprise packaging and instructions and/or a delivery agent to form a formulation composition. The delivery agent can comprise a saline, a buffered solution, a lipidoid or any delivery agent disclosed herein.

[0672] In some embodiments, the buffer solution can include sodium chloride,

calcium chloride, phosphate and/or EDTA. In another embodiment, the buffer solution can include, but is not limited to, saline, saline with 2mM calcium, 5% sucrose, 5% sucrose with 2mM calcium, 5% Mannitol, 5% Mannitol with 2mM calcium, Ringer's lactate, sodium chloride, sodium chloride with 2mM calcium and mannose (See, e.g., U.S. Pub. No. 20120258046; herein incorporated by reference in its entirety). In a further embodiment, the buffer solutions can be precipitated or it can be lyophilized. The amount of each component can be varied to enable consistent, reproducible higher concentration saline or simple buffer formulations. The components can also be varied in order to increase the stability of modified RNA in the buffer solution over a period of time and/or under a variety of conditions. In one aspect, the present invention provides kits for protein production, comprising: a polynucleotide comprising a translatable region, provided in an amount effective to produce a desired amount of a protein encoded by the translatable region when introduced into a target cell; a second polynucleotide comprising an inhibitory nucleic acid, provided in an amount effective to substantially inhibit the innate immune response of the cell; and packaging and instructions.

[0673] In one aspect, the present invention provides kits for protein production, comprising a polynucleotide comprising a translatable region, wherein the

polynucleotide exhibits reduced degradation by a cellular nuclease, and packaging and instructions.

[0674] In one aspect, the present invention provides kits for protein production, comprising a polynucleotide comprising a translatable region, wherein the polynucleotide exhibits reduced degradation by a cellular nuclease, and a mammalian cell suitable for translation of the translatable region of the first nucleic acid.

b. Devices

[0675] The present invention provides for devices that can incorporate

polynucleotides that encode polypeptides of interest. These devices contain in a stable formulation the reagents to synthesize a polynucleotide in a formulation available to be immediately delivered to a subject in need thereof, such as a human patient

[0676] Devices for intradermal (e.g., using microneedles) or topical administration can be employed to deliver the polynucleotides of the present invention according to single, multi- or split-dosing regimens taught herein. Such devices are taught in, for example, International Application Publ. No. WO2013151666, the contents of which are incorporated herein by reference in their entirety.

26. Definitions

[0677] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application.

[0678] The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0679] In this specification and the appended claims, the singular forms "a", "an" and

"the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple."

[0680] Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term

"and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0681] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford

Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford

University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0682] Wherever aspects are described herein with the language "comprising,"

otherwise analogous aspects described in terms of "consisting of and/or "consisting essentially of are also provided.

[0683] Units, prefixes, and symbols are denoted in their Systeme International de

Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the invention. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the invention. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.

[0684] Nucleotides are referred to by their commonly accepted single-letter codes.

Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.

[0685] Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB

Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation.

[0686] About: The term "about" as used in connection with a numerical value

throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art, such interval of accuracy is ± 10 %.

[0687] Where ranges are given, endpoints are included. Furthermore, unless

otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0688] Administered in combination: As used herein, the term "administered in

combination" or "combined administration" means that two or more agents are administered to a subject at the same time or within an interval such that there can be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved.

[0689] Amino acid substitution: The term "amino acid substitution" refers to

replacing an amino acid residue present in a parent or reference sequence (e.g., a wild type wound healing polypeptide sequence) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence (e.g., a wild type wound healing polypeptide sequence), for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a

"substitution at position X" refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the schema AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In other aspects, substitution patterns can be described according to the schema An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position X, and Y and Z are alternative substituting amino acid residue.

[0690] In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) are conducted at the nucleic acid level, /. e. substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.

[0691] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone.

[0692] Approximately: As used herein, the term "approximately," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0693] Associated with: As used herein with respect to a disease, the term "associated with" means that the symptom, measurement, characteristic, or status in question is linked to the diagnosis, development, presence, or progression of that disease. As association can, but need not, be causatively linked to the disease. For example, symptoms, sequelae, or any effects causing a decrease in the quality of life of a

wounded patient are considered associated with wound healing (e.g., impaired wound healing) and in some embodiments of the present invention can be treated, ameliorated, or prevented by intradermally (e.g., using microneedles) or topically administering the polynucleotides of the present invention to a subject in need thereof.

[0694] When used with respect to two or more moieties, the terms "associated with,"

"conjugated," "linked," "attached," and "tethered," when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An "association" need not be strictly through direct covalent chemical bonding. It can also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the "associated" entities remain physically associated.

[0695] Bifunctional: As used herein, the term "bifunctional" refers to any substance, molecule or moiety that is capable of or maintains at least two functions. The functions can affect the same outcome or a different outcome. The structure that produces the function can be the same or different. For example, bifunctional modified RNAs of the present invention can encode a wound healing peptide (a first function) while those nucleosides that comprise the encoding RNA are, in and of themselves, capable of extending the half-life of the RNA (second function). In this example, delivery of the bifunctional modified RNA to a subject suffering from a protein deficiency would produce not only a peptide or protein molecule that can ameliorate or treat a disease or conditions, but would also maintain a population modified RNA present in the subject for a prolonged period of time. In other aspects, a bifunctional modified mRNA can be a chimeric or quimeric molecule comprising, for example, an RNA encoding a wound healing peptide (a first function) and a second protein either fused to first protein or co-expressed with the first protein.

[0696] Biocompatible: As used herein, the term "biocompatible" means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.

[0697] Biodegradable: As used herein, the term "biodegradable" means capable of being broken down into innocuous products by the action of living things.

[0698] Biologically active. As used herein, the phrase "biologically active" refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present invention can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant.

[0699] Chimera. As used herein, "chimera" is an entity having two or more

incongruous or heterogeneous parts or regions. For example, a chimeric molecule can comprise a first part comprising a wound healing polypeptide, and a second part (e.g., genetically fused to the first part) comprising a second therapeutic protein (e.g., a protein with a distinct enzymatic activity, an antigen binding moiety, or a moiety capable of extending the plasma half life of the wound healing polypeptide, for example, an Fc region of an antibody).

[0700] Sequence Optimization : The term "sequence optimization" refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity.

[0701] In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by the codon optimized nucleotide sequence with respect to the polypeptide encoded by the reference nucleotide sequence.

[0702] Codon substitution : The terms "codon substitution" or "codon replacement" in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a "substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon.

[0703] As used herein, the terms "coding region" and "region encoding" and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a

polynucleotide that upon expression yields a polypeptide or protein.

[0704] Compound: As used herein, the term“compound,” is meant to include all stereoisomers and isotopes of the structure depicted. As used herein, the term “stereoisomer” means any geometric isomer (e.g., cis- and trans- isomer), enantiomer, or diastereomer of a compound. The present disclosure encompasses any and all stereoisomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well-known.“Isotopes” refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium. Further, a compound, salt, or complex of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods.

[0705] Contacting : As used herein, the term“contacting” means establishing a

physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal (e.g., using microneedles), and subcutaneous) and can involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition.

[0706] Conservative amino acid substitution: A "conservative amino acid

substitution" is one in which the amino acid residue in a protein sequence is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, or histidine), acidic side chains (e.g., aspartic acid or glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, or cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta-branched side chains ( e.g ., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, or histidine). Thus, if an amino acid in a polypeptide is replaced with another amino acid from the same side chain family, the amino acid substitution is considered to be conservative. In another aspect, a string of amino acids can be conservatively replaced with a structurally similar string that differs in order and/or composition of side chain family members.

[0707] Non-conservative amino acid substitution : Non-conservative amino acid

substitutions include those in which (i) a residue having an electropositive side chain (e.g., Arg, His or Lys) is substituted for, or by, an electronegative residue (e.g., Glu or Asp), (ii) a hydrophilic residue (e.g., Ser or Thr) is substituted for, or by, a hydrophobic residue (e.g., Ala, Leu, lie, Phe or Val), (iii) a cysteine or proline is substituted for, or by, any other residue, or (iv) a residue having a bulky hydrophobic or aromatic side chain (e.g., Val, His, lie or Trp) is substituted for, or by, one having a smaller side chain (e.g., Ala or Ser) or no side chain (e.g., Gly).

[0708] Other amino acid substitutions can be readily identified by workers of

ordinary skill. For example, for the amino acid alanine, a substitution can be taken from any one of D-alanine, glycine, beta-alanine, L-cysteine and D-cysteine. For lysine, a replacement can be any one of D-lysine, arginine, D-arginine, homo arginine, methionine, D-methionine, ornithine, or D- ornithine. Generally, substitutions in functionally important regions that can be expected to induce changes in the properties of isolated polypeptides are those in which (i) a polar residue, e.g., serine or threonine, is substituted for (or by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, or alanine; (ii) a cysteine residue is substituted for (or by) any other residue; (iii) a residue having an electropositive side chain, e.g., lysine, arginine or histidine, is substituted for (or by) a residue having an electronegative side chain, e.g., glutamic acid or aspartic acid; or (iv) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having such a side chain, e.g., glycine. The likelihood that one of the foregoing non-conservative substitutions can alter functional properties of the protein is also correlated to the position of the substitution with respect to functionally important regions of the protein: some non conservative substitutions can accordingly have little or no effect on biological properties.

[0709] Conserved As used herein, the term "conserved" refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.

[0710] In some embodiments, two or more sequences are said to be "completely conserved" if they are 100% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of an polynucleotide or polypeptide or can apply to a portion, region or feature thereof.

[0711] Controlled Release: As used herein, the term "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.

[0712] Cyclic or Cyclized: As used herein, the term "cyclic" refers to the presence of a continuous loop. Cyclic molecules need not be circular, only joined to form an unbroken chain of subunits. Cyclic molecules such as the engineered RNA or mRNA of the present invention can be single units or multimers or comprise one or more components of a complex or higher order structure.

[0713] Cytotoxic. As used herein, "cytotoxic" refers to killing or causing injurious, toxic, or deadly effect on a cell (e.g., a mammalian cell (e.g, a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

[0714] Delivering : As used herein, the term“delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve intradermally (e.g., using microneedles) or topically administering a nanoparticle composition including the polynucleotide to the subject. Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition.

[0715] Delivery Agent: As used herein, "delivery agent" refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells.

[0716] Destabilized: As used herein, the term "destable," "destabilize," or

"destabilizing region" means a region or molecule that is less stable than a starting, wild-type or native form of the same region or molecule.

[0717] Diastereomer: As used herein, the term "diastereomer," means stereoisomers that are not mirror images of one another and are non-superimposable on one another.

[0718] Digest: As used herein, the term "digest" means to break apart into smaller pieces or components. When referring to polypeptides or proteins, digestion results in the production of peptides.

[0719] Distal: As used herein, the term "distal" means situated away from the center or away from a point or region of interest.

[0720] Domain: As used herein, when referring to polypeptides, the term "domain" refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).

[0721] Dosing regimen: As used herein, a "dosing regimen" or a "dosing regimen" is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care.

[0722] Effective Amount: As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of intradermally (e.g., using microneedles) or topically administering an agent that treats a protein deficiency (e.g., a wound healing polypeptide deficiency), an effective amount of an agent is, for example, an amount of mRNA expressing sufficient wound healing polypeptide to ameliorate, reduce, eliminate, or prevent the symptoms associated with the wound healing

polypeptide deficiency, as compared to the severity of the symptom observed without administration of the agent. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose."

[0723] Enantiomer: As used herein, the term "enantiomer" means each individual optically active form of a compound of the invention, having an optical purity or enantiomeric excess (as determined by methods standard in the art) of at least 80% (i.e.. at least 90% of one enantiomer and at most 10% of the other enantiomer), at least 90%, or at least 98%.

[0724] Encapsulate: As used herein, the term "encapsulate" means to enclose,

surround or encase.

[0725] Encapsulation Efficiency. As used herein,“encapsulation efficiency” refers to the amount of a polynucleotide that becomes part of a nanoparticle composition, relative to the initial total amount of polynucleotide used in the preparation of a nanoparticle composition. For example, if 97 mg of polynucleotide are encapsulated in a nanoparticle composition out of a total 100 mg of polynucleotide initially provided to the composition, the encapsulation efficiency can be given as 97%. As used herein,“encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.

[0726] Encoded protein cleavage signal : As used herein, "encoded protein cleavage signal" refers to the nucleotide sequence that encodes a protein cleavage signal.

[0727] Engineered: As used herein, embodiments of the invention are "engineered" when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule.

[0728] Enhanced Delivery. As used herein, the term“enhanced delivery” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to the level of delivery of a polynucleotide by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. It will be understood that the enhanced delivery of a nanoparticle to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a rat model).

[0729] Exosome: As used herein, "exosome" is a vesicle secreted by mammalian cells or a complex involved in RNA degradation.

[0730] Expression : As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an mRNA template from a DNA sequence (e.g., by transcription); (2) processing of an mRNA transcript (e.g, by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

[0731] Ex Vivo : As used herein, the term“ex vivo” refers to events that occur outside of an organism (e.g, animal, plant, or microbe or cell or tissue thereol). Ex vivo events can take place in an environment minimally altered from a natural (e.g, in vivo) environment.

[0732] Feature: As used herein, a "feature" refers to a characteristic, a property, or a distinctive element. When referring to polypeptides, "features" are defined as distinct amino acid sequence-based components of a molecule. Features of the polypeptides encoded by the polynucleotides of the present invention include surface

manifestations, local conformational shape, folds, loops, half-loops, domains, half domains, sites, termini or any combination thereof.

[0733] Formulation : As used herein, a "formulation" includes at least a

polynucleotide and one or more of a carrier, an excipient, and a delivery agent.

[0734] Fragment: A "fragment," as used herein, refers to a portion. For example, fragments of proteins can comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. In some embodiments, a fragment is a subsequences of a full length protein (e.g., a wound healing polypeptide) wherein N- terminal, and/or C-terminal, and/or internal subsequences have been deleted. In some preferred aspects of the present invention, the fragments of a protein of the present invention are functional fragments.

[0735] Functional. As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized. Thus, a functional fragment of a polynucleotide of the present invention is a polynucleotide capable of expressing a functional fragment of a wound healing polypeptide. As used herein, a functional fragment of a wound healing polypeptide refers to a fragment of the wild type wound healing polypeptide (i.e., a fragment of any of its naturally occurring isoforms), or a mutant or variant thereof, wherein the fragment retains a least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the biological activity of the corresponding full length protein.

[0736] Helper Lipid : As used herein, the term“helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). Typically the helper lipid is a phospholipid. A function of the helper lipid is to“complement” the amino lipid and increase the fusogenicity of the bilayer and/or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP.

[0737] Homology. As used herein, the term "homology" refers to the overall

relatedness between polymeric molecules, e.g. between nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Generally, the term "homology" implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present invention, the term homology encompasses both to identity and similarity.

[0738] In some embodiments, polymeric molecules are considered to be

"homologous" to one another if at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0739] Identity. As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules

(e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent.

[0740] Suitable software programs are available from various sources, and for

alignment of both protein and nucleotide sequences. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa.

[0741] Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.

[0742] Different regions within a single polynucleotide or polypeptide target

sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.

[0743] In certain aspects, the percentage identity "%ID" of a first amino acid

sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y/Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0744] One skilled in the art will appreciate that the generation of a sequence

alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually.

[0745] Immune response: The term“immune response” refers to the action of, for example, lymphocytes, antigen presenting cells, phagocytic cells, granulocytes, and soluble macromolecules produced by the above cells or the liver (including antibodies, cytokines, and complement) that results in selective damage to, destruction of, or elimination from the human body of invading pathogens, cells or tissues infected with pathogens, cancerous cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. In some cases, the administration of a nanoparticle comprising a lipid component and an encapsulated therapeutic agent can trigger an immune response, which can be caused by (i) the encapsulated therapeutic agent (e.g., an mRNA), (ii) the expression product of such encapsulated therapeutic agent (e.g., a polypeptide encoded by the mRNA), (iii) the lipid component of the nanoparticle, or (iv) a combination thereof.

[0746] Inflammatory response : “Inflammatory response” refers to immune responses involving specific and non-specific defense systems. A specific defense system reaction is a specific immune system reaction to an antigen. Examples of specific defense system reactions include antibody responses. A non-specific defense system reaction is an inflammatory response mediated by leukocytes generally incapable of immunological memory, e.g., macrophages, eosinophils and neutrophils. In some aspects, an immune response includes the secretion of inflammatory cytokines, resulting in elevated inflammatory cytokine levels.

[0747] Inflammatory cytokines : The term“inflammatory cytokine” refers to cytokines that are elevated in an inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1; also known as GROa, interferon-g (IFNy), tumor necrosis factor a (TNFa), interferon g-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF). The term inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin- 12 (IL-12), interleukin- 13 (11-13), interferon a (IFN-a), etc.

[0748] In vitro : As used herein, the term“in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0749] In vivo: As used herein, the term in vivo” refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

[0750] Insertional and deletional variants: "Insertional variants" when referring to polypeptides are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. "Immediately adjacent" to an amino acid means connected to either the alpha-carboxy or alpha- amino functional group of the amino acid. "Deletional variants" when referring to polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.

[0751] Intact: As used herein, in the context of a polypeptide, the term "intact" means retaining an amino acid corresponding to the wild type protein, e.g., not mutating or substituting the wild type amino acid. Conversely, in the context of a nucleic acid, the term "intact" means retaining a nucleobase corresponding to the wild type nucleic acid, e.g., not mutating or substituting the wild type nucleobase.

[0752] Ionizable amino lipid : The term“ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3) and (13Z,165Z)-N,N-dimethyl-3-nonydocosa-13-16-dien-l -amine (L608).

[0753] Isolated : As used herein, the term“isolated” refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances ( e.g., polynucleotides or polypeptides) can have varying levels of purity in reference to the substances from which they have been isolated. Isolated substances and/or entities can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated substances are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is“pure” if it is substantially free of other components.

[0754] Substantially isolated : By "substantially isolated" is meant that the compound is substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the compound of the present disclosure. Substantial separation can include compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compound of the present disclosure, or salt thereof.

[0755] A polynucleotide, vector, polypeptide, cell, or any composition disclosed herein which is "isolated" is a polynucleotide, vector, polypeptide, cell, or composition which is in a form not found in nature. Isolated polynucleotides, vectors, polypeptides, or compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature. In some aspects, a polynucleotide, vector, polypeptide, or composition which is isolated is substantially pure.

[0756] Isomer: As used herein, the term "isomer" means any tautomer, stereoisomer, enantiomer, or diastereomer of any compound of the invention. It is recognized that the compounds of the invention can have one or more chiral centers and/or double bonds and, therefore, exist as stereoisomers, such as double-bond isomers (i.e., geometric E/Z isomers) or diastereomers ( e.g ., enantiomers (i.e.. (+) or (-)) or cis/trans isomers). According to the invention, the chemical structures depicted herein, and therefore the compounds of the invention, encompass all of the corresponding stereoisomers, that is, both the stereomerically pure form (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and

stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereoisomeric mixtures of compounds of the invention can typically be resolved into their component enantiomers or stereoisomers by well-known methods, such as chiral-phase gas chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Enantiomers and stereoisomers can also be obtained from stereomerically or enantiomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0757] Linker. As used herein, a "linker" refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene,

heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units,

e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof., Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.

[0758] Methods of Administration: As used herein,“methods of administration” can include intradermal (e.g., using microneedles), topical, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.

[0759] Modified: As used herein "modified" refers to a changed state or structure of a molecule of the invention. Molecules can be modified in many ways including chemically, structurally, and functionally. In some embodiments, the mRNA molecules of the present invention are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and C. Noncanonical nucleotides such as the cap structures are not considered "modified" although they differ from the chemical structure of the A, C, G, U ribonucleotides.

[0760] Mucus: As used herein, "mucus" refers to the natural substance that is viscous and comprises mucin glycoproteins.

[0761] Nanoparticle Composition: As used herein, a“nanoparticle composition” is a composition comprising one or more lipids. Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer.

Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less.

[0762] Naturally occurring: As used herein, "naturally occurring" means existing in nature without artificial aid.

[0763] Non-human vertebrate: As used herein, a "non-human vertebrate" includes all vertebrates except Homo sapiens, including wild and domesticated species. Examples

of non-human vertebrates include, but are not limited to, mammals, such as alpaca, banteng, bison, camel, cat, catle, deer, dog, donkey, gayal, goat, guinea pig, horse, llama, mule, pig, rabbit, reindeer, sheep water buffalo, and yak.

[0764] Nucleic acid sequence: The terms "nucleic acid sequence," "nucleotide

sequence," or "polynucleotide sequence" are used interchangeably and refer to a contiguous nucleic acid sequence. The sequence can be either single stranded or double stranded DNA or RNA, e.g., an mRNA.

[0765] The term "nucleic acid," in its broadest sense, includes any compound and/or substance that comprises a polymer of nucleotides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a b- D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'- amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'- amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.

[0766] The phrase "nucleotide sequence encoding" refers to the nucleic acid (e.g., an mRNA or DNA molecule) coding sequence which encodes a polypeptide. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence can further include sequences that encode signal peptides.

[0767] Off-target: As used herein, "off target" refers to any unintended effect on any one or more target, gene, or cellular transcript.

[0768] Open reading frame: As used herein, "open reading frame" or "ORE" refers to a sequence which does not contain a stop codon in a given reading frame.

[0769] Operably linked: As used herein, the phrase "operably linked" refers to a

functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.

[0770] Optionally substituted: Herein a phrase of the form "optionally substituted X"

(e.g., optionally substituted alkyl) is intended to be equivalent to "X, wherein X is optionally substituted" (e.g., "alkyl, wherein said alkyl is optionally substituted"). It is not intended to mean that the feature "X" (e.g., alkyl) per se is optional.

[0771] Part : As used herein, a "part" or "region" of a polynucleotide is defined as any portion of the polynucleotide that is less than the entire length of the polynucleotide.

[0772] Patient: As used herein, "patient" refers to a subject who can seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition. In some embodiments, the treatment is needed, required, or received to prevent or decrease the risk of developing acute disease, i.e., it is a prophylactic treatment.

[0773] Pharmaceutically acceptable : The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0774] Pharmaceutically acceptable excipients: The phrase "pharmaceutically

acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non inflammatory in a patient. Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxy toluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol,

starch (com), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0775] Pharmaceutically acceptable salts : The present disclosure also includes

pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate,

benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2- hydroxy -ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium,

tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. Lists of suitable salts are found in Remington's Pharmaceutical Sciences , 17th ed., Mack Publishing Company,

Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al, Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

[0776] Pharmaceutically acceptable solvate : The term "pharmaceutically acceptable solvate," as used herein, means a compound of the invention wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), /V-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N.N'-di methyl formami de (DMF), N.N'- dimethylacetamide (DMAC), l,3-dimethyl-2-imidazolidinone (DMEU), 1,3- dimethyl-3,4,5,6-tetrahydro-2-(lH)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a "hydrate."

[0777] Pharmacokinetic: As used herein, "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.

[0778] Physicochemical: As used herein, "physicochemical" means of or relating to a physical and/or chemical property.

[0779] Polynucleotide: The term "polynucleotide" as used herein refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide. More particularly, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-gly coside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide ( e.g ., peptide nucleic acids "PNAs") and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. In particular aspects, the polynucleotide comprises an mRNA. In other aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5- methoxyuridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A (adenosine), G

(guanosine), C (cytidine), and T (thymidine) in the case of a synthetic DNA, or A, C, G, and U (uridine) in the case of a synthetic RNA.

[0780] The skilled artisan will appreciate that the T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present invention. A skilled artisan would also understand that equivalent codon-maps can be generated by replaced one or more bases with non natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a YYO codon (RNA map in which U has been replaced with pseudouridine).

[0781] Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2, respectively, of adenosine and between the C2-oxy, N3 and C4-NH2, of cytidine and the C2-NH2, N'— H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino-6-oxy-9- -D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9- -D-ribofuranosyl-purine). Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (l- -D-ribofuranosyl-2-oxy-4- amino-pyrimidine) to form isocytosine (l- -D-ribofuranosyl-2-amino-4-oxy- pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine (U.S. Pat. No. 5,681,702 to Collins et al). Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine can be prepared by the method described by Switzer et al. (1993)

Biochemistry 32: 10489-10496 and references cited therein; 2'-deoxy-5-methyl- isocytidine can be prepared by the method of Tor et al, 1993, J. Am. Chem. Soc. 115:4461-4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al, 1993, supra, and Mantsch et al., 1993, Biochem. 14:5593-5601, or by the method described in U.S. Pat. No.

5,780,610 to Collins et al. Other nonnatural base pairs can be synthesized by the method described in Piccirilli et al, 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (l-methylpyrazolo-[4,3]pyrimidine-5,7- (4H,6H)-dione. Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc.

114:3675-3683 and Switzer et al, supra.

[0782] Polypeptide: The terms "polypeptide," "peptide," and "protein" are used

interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art.

[0783] The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs,

paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multi chain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some embodiments, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0784] Polypeptide variant : As used herein, the term "polypeptide variant" refers to molecules that differ in their amino acid sequence from a native or reference sequence. The amino acid sequence variants can possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 99% identity to a native or reference sequence. In some embodiments, they will be at least about 80%, or at least about 90% identical to a native or reference sequence.

[0785] Polypeptide per unit drug (PUD): As used herein, a PUD or product per unit drug, is defined as a subdivided portion of total daily dose, usually 1 mg, pg, kg, etc., of a product (such as a polypeptide) as measured in body fluid or tissue, usually defined in concentration such as pmol/mL, mmol/mL, etc. divided by the measure in the body fluid.

[0786] Preventing: As used herein, the term "preventing" refers to partially or

completely delaying onset of an infection, disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying progression from an infection, a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and/or condition.

[0787] Proliferate: As used herein, the term "proliferate" means to grow, expand or increase or cause to grow, expand or increase rapidly. "Proliferative" means having the ability to proliferate. "Anti-proliferative" means having properties counter to or inapposite to proliferative properties.

[0788] Prophylactic : As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the spread of disease.

[0789] Prophylaxis: As used herein, a "prophylaxis" refers to a measure taken to maintain health and prevent the spread of disease. An "immune prophylaxis" refers to a measure to produce active or passive immunity to prevent the spread of disease.

[0790] Protein cleavage site : As used herein, "protein cleavage site" refers to a site where controlled cleavage of the amino acid chain can be accomplished by chemical, enzymatic or photochemical means.

[0791] Protein cleavage signal: As used herein "protein cleavage signal" refers to at least one amino acid that flags or marks a polypeptide for cleavage.

[0792] Protein of interest: As used herein, the terms "proteins of interest" or "desired proteins" include those provided herein and fragments, mutants, variants, and alterations thereof.

[0793] Proximal: As used herein, the term "proximal" means situated nearer to the center or to a point or region of interest.

[0794] Pseudouridine: As used herein, pseudouridine (y) refers to the C-gly coside isomer of the nucleoside uridine. A "pseudouridine analog" is any modification, variant, isoform or derivative of pseudouridine. For example, pseudouridine analogs include but are not limited to 1-carboxy methyl-pseudouridine, 1-propynyl- pseudouridine, 1 -taurinomethyl-pseudouridine, 1 -taurinomethyl-4-thio-pseudouridine,

1-methylpseudouridine (m ) (also known as N1 -methyl-pseudouridine), l-methyl-4- thio-pseudouridine (m'sV). 4-thio-l -methyl-pseudouridine, 3 -methyl-pseudouridine (mV), 2-thio-l -methyl-pseudouridine, 1 -methyl- 1-deaza-pseudouridine, 2-thio-l- methyl-1 -deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine,

2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy- 2-thio-pseudouridine, l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 y), and 2'-0-methyl-pseudouridine (\|/m).

[0795] Purified: As used herein, "purify," "purified," "purification" means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection.

[0796] Reference Nucleic Acid Sequence : The term "reference nucleic acid sequence" or“reference nucleic acid” or“reference nucleotide sequence” or“reference

sequence” refers to a starting nucleic acid sequence (e.g., a RNA, e.g., an mRNA sequence) that can be sequence optimized. In some embodiments, the reference nucleic acid sequence is a wild type nucleic acid sequence, a fragment or a variant thereof. In some embodiments, the reference nucleic acid sequence is a previously sequence optimized nucleic acid sequence.

[0797] Salts: In some aspects, the pharmaceutical composition for delivery disclosed herein and comprises salts of some of their lipid constituents. The term“salt” includes any anionic and cationic complex. Non-limiting examples of anions include inorganic and organic anions, e.g., fluoride, chloride, bromide, iodide, oxalate (e.g., hemioxalate), phosphate, phosphonate, hydrogen phosphate, dihydrogen phosphate, oxide, carbonate, bicarbonate, nitrate, nitrite, nitride, bisulfite, sulfide, sulfite, bisulfate, sulfate, thiosulfate, hydrogen sulfate, borate, formate, acetate, benzoate, citrate, tartrate, lactate, acrylate, polyacrylate, fumarate, maleate, itaconate, glycolate, gluconate, malate, mandelate, tiglate, ascorbate, salicylate, polymethacrylate, perchlorate, chlorate, chlorite, hypochlorite, bromate, hypobromite, iodate, an alkylsulfonate, an arylsulfonate, arsenate, arsenite, chromate, dichromate, cyanide, cyanate, thiocyanate, hydroxide, peroxide, permanganate, and mixtures thereof.

[0798] Sample : As used herein, the term "sample" or "biological sample" refers to a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). A sample further can include a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. A sample further refers to a medium, such as a nutrient broth or gel, which can contain cellular components, such as proteins or nucleic acid molecule.

[0799] Signal Sequence: As used herein, the phrases "signal sequence," "signal

peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus,

references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide.

[0800] Signal transduction pathway. A "signal transduction pathway" refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell. As used herein, the phrase "cell surface receptor" includes, for example, molecules and complexes of molecules capable of receiving a signal and the transmission of such a signal across the plasma membrane of a cell.

[0801] Similarity. As used herein, the term "similarity" refers to the overall

relatedness between polymeric molecules, e.g. between polynucleotide molecules ( e.g . DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.

[0802] Single unit dose : As used herein, a "single unit dose" is a dose of any

therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.

[0803] Split dose : As used herein, a "split dose" is the division of single unit dose or total daily dose into two or more doses.

[0804] Specific delivery. As used herein, the term“specific delivery,”“specifically deliver,” or“specifically delivering” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to an off-target tissue (e.g., mammalian spleen). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. For example, for renovascular targeting, a polynucleotide is specifically provided to a mammalian kidney as compared to the liver and spleen if 1.5, 2-fold, 3-fold, 5-fold, 10-fold, 15 fold, or 20 fold more

polynucleotide per 1 g of tissue is delivered to a kidney compared to that delivered to the liver or spleen following systemic administration of the polynucleotide. It will be understood that the ability of a nanoparticle to specifically deliver to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a rat model).

[0805] Stable: As used herein "stable" refers to a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and in some cases capable of formulation into an efficacious therapeutic agent.

[0806] Stabilized: As used herein, the term "stabilize," "stabilized," "stabilized

region" means to make or become stable.

[0807] Stereoisomer: As used herein, the term "stereoisomer" refers to all possible different isomeric as well as conformational forms that a compound can possess (e.g., a compound of any formula described herein), in particular all possible

stereochemically and conformationally isomeric forms, all diastereomers, enantiomers and/or conformers of the basic molecular structure. Some compounds of the present invention can exist in different tautomeric forms, all of the latter being included within the scope of the present invention.

[0808] Subject: By "subject" or "individual" or "animal" or "patient" or "mammal," is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include, but are not limited to, humans, domestic animals, farm animals, zoo animals, sport animals, pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; bears, food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and so on. In certain embodiments, the mammal is a human subject. In other embodiments, a subject is a human patient. In a particular embodiment, a subject is a human patient in need of treatment.

[0809] Substantially. As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical characteristics rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term

"substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical characteristics.

[0810] Substantially equal·. As used herein as it relates to time differences between doses, the term means plus/minus 2%.

[0811] Substantially simultaneous : As used herein and as it relates to plurality of doses, the term means within 2 seconds.

[0812] Suffering from: An individual who is "suffering from" a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.

[0813] Susceptible to: An individual who is "susceptible to" a disease, disorder,

and/or condition has not been diagnosed with and/or cannot exhibit symptoms of the disease, disorder, and/or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition (for example, wound healing (e.g., impaired wound healing)) can be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and/or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition; (4) habits and/or lifestyles associated with development of the disease, disorder, and/or condition; (5) a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microbe associated with development of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

[0814] Sustained release: As used herein, the term "sustained release" refers to a pharmaceutical composition or compound release profile that conforms to a release rate over a specific period of time.

[0815] Synthetic : The term "synthetic" means produced, prepared, and/or

manufactured by the hand of man. Synthesis of polynucleotides or other molecules of the present invention can be chemical or enzymatic.

[0816] Targeted Cells: As used herein, "targeted cells" refers to any one or more cells of interest. The cells can be found in vitro, in vivo, in situ or in the tissue or organ of an organism. The organism can be an animal, for example a mammal, a human, a subject or a patient.

[0817] Target tissue·. As used herein“target tissue” refers to any one or more tissue types of interest in which the delivery of a polynucleotide would result in a desired biological and/or pharmacological effect. Examples of target tissues of interest include specific tissues, organs, and systems or groups thereof. In particular applications, a target tissue can be a liver, a kidney, a lung, a spleen, or a vascular endothelium in vessels (e.g., intra-coronary or intra-femoral). An“off-target tissue” refers to any one or more tissue types in which the expression of the encoded protein does not result in a desired biological and/or pharmacological effect.

[0818] The presence of a therapeutic agent in an off-target issue can be the result of:

(i) leakage of a polynucleotide from the administration site to peripheral tissue or distant off-target tissue via diffusion or through the bloodstream (e.g., a

polynucleotide intended to express a polypeptide in a certain tissue would reach the off-target tissue and the polypeptide would be expressed in the off-target tissue); or

(ii) leakage of an polypeptide after administration of a polynucleotide encoding such polypeptide to peripheral tissue or distant off-target tissue via diffusion or through the bloodstream (e.g., a polynucleotide would expressed a polypeptide in the target tissue, and the polypeptide would diffuse to peripheral tissue).

[0819] Targeting sequence : As used herein, the phrase "targeting sequence" refers to a sequence that can direct the transport or localization of a protein or polypeptide.

[0820] Terminus : As used herein the terms "termini" or "terminus," when referring to polypeptides, refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but can include additional amino acids in the terminal regions. The polypeptide based molecules of the invention can be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NEE)) and a C -terminus (terminated by an amino acid with a free carboxyl group (COOH)). Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini. Alternatively, the termini of the polypeptides can be modified such that they begin or end, as the case can be, with a non-polypeptide based moiety such as an organic conjugate.

[0821] Therapeutic Agent: The term "therapeutic agent" refers to an agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect. For example, in some embodiments, an mRNA encoding a wound healing polypeptide can be a therapeutic agent.

[0822] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.

[0823] Therapeutically effective outcome: As used herein, the term "therapeutically effective outcome" means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.

[0824] Total daily dose: As used herein, a "total daily dose" is an amount given or prescribed in 24 hr. period. The total daily dose can be administered as a single unit dose or a split dose.

[0825] Transcription factor: As used herein, the term "transcription factor" refers to a DNA-binding protein that regulates transcription of DNA into RNA, for example, by activation or repression of transcription. Some transcription factors effect regulation of transcription alone, while others act in concert with other proteins. Some transcription factor can both activate and repress transcription under certain conditions. In general, transcription factors bind a specific target sequence or sequences highly similar to a specific consensus sequence in a regulatory region of a target gene. Transcription factors can regulate transcription of a target gene alone or in a complex with other molecules.

[0826] Transcription: As used herein, the term "transcription" refers to methods to produce mRNA (e.g., an mRNA sequence or template) from DNA (e.g., a DNA template or sequence)

[0827] Transfection: As used herein, "transfection" refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide

modulates a cellular function (e.g., siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.

[0828] Treating, treatment, therapy. As used herein, the term "treating" or

"treatment" or "therapy" refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a disease or condition, e.g., wound healing (e.g., impaired wound healing). For example,

"treating" wound healing can refer to diminishing symptoms associate with the condition, prolong the lifespan (increase the survival rate) of patients, reducing the severity of the condition, preventing or delaying the onset of the condition, etc.

Treatment can be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

[0829] Unmodified : As used herein, "unmodified" refers to any substance, compound or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the

"unmodified" starting molecule for a subsequent modification.

[0830] Uracil. Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via a b-Ni-glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine."

[0831] Uridine Content : The terms "uridine content" or "uracil content" are

interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence).

[0832] Uridine-Modified Sequence: The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and/or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable.

[0833] A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon can be replaced with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied.

[0834] Uridine Enriched: As used herein, the terms "uridine enriched" and

grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).

[0835] Uridine Rarefied: As used herein, the terms "uridine rarefied" and

grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).

[0836] Variant : The term variant as used in present disclosure refers to both natural variants (e.g., polymorphisms, isoforms, etc.), and artificial variants in which at least one amino acid residue in a native or starting sequence (e.g., a wild type sequence) has been removed and a different amino acid inserted in its place at the same position. These variants can be described as "substitutional variants." The substitutions can be single, where only one amino acid in the molecule has been substituted, or they can be multiple, where two or more amino acids have been substituted in the same molecule. If amino acids are inserted or deleted, the resulting variant would be an "insertional variant" or a "deletional variant" respectively.

[0837] Initiation Codon : As used herein, the term“initiation codon”, used

interchangeably with the term“start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as“alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAiMet) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as“alternate initiation codons”.

[0838] The initiation codon plays a critical role in translation initiation. The initiation codon is the first codon of an open reading frame that is translated by the ribosome. Typically, the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides. The initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal

subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; elFs). The current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively“43 S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5' cap) to the initiation codon by scanning nucleotides in a 5' to 3' direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241). Scanning by the PIC ends upon complementary base-pairing between nucleotides comprising the anticodon of the initiator Met-tRNAiMet transfer RNA and nucleotides comprising the initiation codon of the mRNA. Productive base-pairing between the AUG codon and the Met-tRNAiMet anticodon elicits a series of structural and biochemical events that culminate in the joining of the large 60S ribosomal subunit to the PIC to form an active ribosome that is competent for translation elongation.

[0839] Kozak Sequence: The term“Kozak sequence” (also referred to as“Kozak consensus sequence”) refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5' UTR. The Kozak consensus sequence was originally defined as the sequence GCCRCC (SEQ ID NO:41), where R = a purine, following an analysis of the effects of single mutations surrounding the initiation codon (AUG) on translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof.

(Examples of translational enhancer compositions and methods of use thereof, see U.S. Pat. No. 5,807,707 to Andrews et al, incorporated herein by reference in its entirety; U.S. Pat. No. 5,723,332 to Chemajovsky, incorporated herein by reference in its entirety; U.S. Pat. No. 5,891,665 to Wilson, incorporated herein by reference in its entirety.)

[0840] Modified : As used herein“modified” or“modification” refers to a changed state or a change in composition or structure of a polynucleotide (e.g., mRNA).

Polynucleotides may be modified in various ways including chemically, structurally, and/or functionally. For example, polynucleotides may be structurally modified by the incorporation of one or more RNA elements, wherein the RNA element comprises a sequence and/or an RNA secondary structure(s) that provides one or more functions (e.g., translational regulatory activity). Accordingly, polynucleotides of the disclosure may be comprised of one or more modifications (e.g., may include one or more chemical, structural, or functional modifications, including any combination thereof).

[0841] Nucleobase: As used herein, the term“nucleobase” (alternatively“nucleotide base” or“nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and/or synthetic nucleobases, as known in the art and/or described herein, can be

incorporated into nucleic acids.

[0842] Nucleoside/Nucleotide. As used herein, the term“nucleoside” refers to a

compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an intemucleoside linking group (e.g., a phosphate group). As used herein, the term“nucleotide” refers to a nucleoside covalently bonded to an intemucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.

[0843] Nucleic acid: As used herein, the term“nucleic acid” is used in its broadest sense and encompasses any compound and/or substance that includes a polymer of nucleotides, or derivatives or analogs thereof. These polymers are often referred to as “polynucleotides” Accordingly, as used herein the terms“nucleic acid” and “polynucleotide” are equivalent and are used interchangeably. Exemplary nucleic acids or polynucleotides of the disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), DNA-RNA hybrids, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, mRNAs, modified mRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a b-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA

having a 2'-amino functionalization, and 2'-amino-a-LNA having a 2'-amino functionalization) or hybrids thereof.

[0844] Nucleic Acid Structure : As used herein, the term“nucleic acid structure” (used interchangeably with“polynucleotide structure”) refers to the arrangement or organization of atoms, chemical constituents, elements, motifs, and/or sequence of linked nucleotides, or derivatives or analogs thereof, that comprise a nucleic acid (e.g., an mRNA). The term also refers to the two-dimensional or three-dimensional state of a nucleic acid. Accordingly, the term“RNA structure” refers to the arrangement or organization of atoms, chemical constituents, elements, motifs, and/or sequence of linked nucleotides, or derivatives or analogs thereof, comprising an RNA molecule (e.g., an mRNA) and/or refers to a two-dimensional and/or three dimensional state of an RNA molecule. Nucleic acid structure can be further demarcated into four organizational categories referred to herein as“molecular structure”,“primary structure”,“secondary structure”, and“tertiary structure” based on increasing organizational complexity.

[0845] Open Reading Frame : As used herein, the term“open reading frame”,

abbreviated as“ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome.

[0846] Pre-Initiation Complex (PIC): As used herein, the term“pre-initiation

complex” (alternatively“43 S pre-initiation complex”; abbreviated as“PIC”) refers to a ribonucleoprotein complex comprising a 40S ribosomal subunit, eukaryotic initiation factors (elFl, elFlA, eIF3, eIF5), and the eIF2-GTP-Met-tRNAiMet ternary complex, that is intrinsically capable of attachment to the 5' cap of an mRNA molecule and, after attachment, of performing ribosome scanning of the 5' UTR.

[0847] RNA element : As used herein, the term“RNA element” refers to a portion, fragment, or segment of an RNA molecule that provides a biological function and/or has biological activity (e.g., translational regulatory activity). Modification of a polynucleotide by the incorporation of one or more RNA elements, such as those described herein, provides one or more desirable functional properties to the modified polynucleotide. RNA elements, as described herein, can be naturally-occurring, non- naturally occurring, synthetic, engineered, or any combination thereof. For example, naturally-occurring RNA elements that provide a regulatory activity include elements found throughout the transcriptomes of viruses, prokaryotic and eukaryotic organisms (e.g., humans). RNA elements in particular eukaryotic mRNAs and translated viral RNAs have been shown to be involved in mediating many functions in cells.

Exemplary natural RNA elements include, but are not limited to, translation initiation elements (e.g., internal ribosome entry site (IRES), see Kieft et al, (2001) RNA 7(2): 194-206), translation enhancer elements (e.g., the APP mRNA translation enhancer element, see Rogers et al, (1999) J Biol Chem 274(10):6421-6431), mRNA stability elements (e.g., AU-rich elements (AREs), see Gameau et al, (2007) Nat Rev Mol Cell Biol 8(2): 113-126), translational repression element (see e.g., Blumer et al, (2002) Mech Dev 110(l-2):97-l 12), protein-binding RNA elements (e.g., iron- responsive element, see Selezneva et al, (2013) J Mol Biol 425(18):3301-3310), cytoplasmic polyadenylation elements (Villalba et al, (2011) Curr Opin Genet Dev 21(4):452-457), and catalytic RNA elements (e.g., ribozymes, see Scott et al, (2009) Biochim Biophys Acta 1789(9-10):634-641).

[0848] Residence time : As used herein, the term“residence time” refers to the time of occupancy of a pre-initiation complex (PIC) or a ribosome at a discrete position or location along an mRNA molecule.

[0849] Translational Regulatory Activity: As used herein, the term“translational regulatory activity” (used interchangeably with“translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and/or ribosome. In some aspects, the desired translation regulatory activity promotes and/or enhances the translational fidelity of mRNA translation. In some aspects, the desired translational regulatory activity reduces and/or inhibits leaky scanning.

27. Equivalents and Scope

[0850] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

[0851] In the claims, articles such as "a," "an," and "the" can mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0852] It is also noted that the term "comprising" is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term "comprising" is used herein, the term "consisting of is thus also encompassed and disclosed.

[0853] Where ranges are given, endpoints are included. Furthermore, it is to be

understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0854] In addition, it is to be understood that any particular embodiment of the

present invention that falls within the prior art can be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they can be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any nucleic acid or protein encoded thereby; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

[0855] All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.

[0856] Section and table headings are not intended to be limiting.

EXAMPLES

EXAMPLE 1

Chimeric Polynucleotide Synthesis

A. Triphosphate route

[0857] Two regions or parts of a chimeric polynucleotide can be joined or ligated using triphosphate chemistry. According to this method, a first region or part of 100 nucleotides or less can be chemically synthesized with a 5' monophosphate and terminal 3'desOH or blocked OH. If the region is longer than 80 nucleotides, it can be synthesized as two strands for ligation.

[0858] If the first region or part is synthesized as a non-positionally modified region or part using in vitro transcription (IVT), conversion the 5 'monophosphate with subsequent capping of the 3' terminus can follow. Monophosphate protecting groups can be selected from any of those known in the art.

[0859] The second region or part of the chimeric polynucleotide can be synthesized using either chemical synthesis or IVT methods. IVT methods can include an RNA polymerase that can utilize a primer with a modified cap. Alternatively, a cap of up to 80 nucleotides can be chemically synthesized and coupled to the IVT region or part.

[0860] It is noted that for ligation methods, ligation with DNA T4 ligase, followed by treatment with DNAse should readily avoid concatenation.

[0861] The entire chimeric polynucleotide need not be manufactured with a

phosphate-sugar backbone. If one of the regions or parts encodes a polypeptide, then such region or part can comprise a phosphate-sugar backbone.

[0862] Ligation can then be performed using any known click chemistry, orthoclick chemistry, solulink, or other bioconjugate chemistries known to those in the art.

B. Synthetic route

[0863] The chimeric polynucleotide can be made using a series of starting segments.

Such segments include:

(a) Capped and protected 5' segment comprising a normal 3ΌH (SEG. 1)

(b) 5' triphosphate segment which can include the coding region of a polypeptide and comprising a normal 3ΌH (SEG. 2)

(c) 5' monophosphate segment for the 3' end of the chimeric polynucleotide ( e.g the tail) comprising cordycepin or no 3ΌH (SEG. 3)

[0864] After synthesis (chemical or IVT), segment 3 (SEG. 3) can be treated with cordycepin and then with pyrophosphatase to create the 5 'monophosphate.

[0865] Segment 2 (SEG. 2) can then be ligated to SEG. 3 using RNA ligase. The ligated polynucleotide can then be purified and treated with pyrophosphatase to cleave the diphosphate. The treated SEG.2-SEG. 3 construct is then purified and SEG. 1 is ligated to the 5' terminus. A further purification step of the chimeric

polynucleotide can be performed.

[0866] Where the chimeric polynucleotide encodes a polypeptide, the ligated or

joined segments can be represented as: 5' UTR (SEG. 1), open reading frame or ORF (SEG. 2) and 3' UTR+PolyA (SEG. 3).

[0867] The yields of each step can be as much as 90-95%.

EXAMPLE 2

PCR for cDNA Production

[0868] PCR procedures for the preparation of cDNA can be performed using 2x

KAPA HIFI™ HotStart Ready Mix by Kapa Biosystems (Woburn, MA). This system includes 2x KAPA ReadyMixl2.5 pi; Forward Primer (10 mM) 0.75 mΐ; Reverse Primer (10 mM) 0.75 mΐ; Template cDNA -100 ng; and dFEO diluted to 25.0 mΐ. The PCR reaction conditions can be: at 95° C for 5 min. and 25 cycles of 98° C for 20 sec, then 58° C for 15 sec, then 72° C for 45 sec, then 72° C for 5 min. then 4° C to termination.

[0869] The reverse primer of the instant invention can incorporate a poly-T o (SEQ ID NO:271) for a poly-A o (SEQ ID NO:273) in the mRNA. Other reverse primers with longer or shorter poly(T) tracts can be used to adjust the length of the poly(A) tail in the polynucleotide mRNA.

[0870] The reaction can be cleaned up using Invitrogen's PURELINK™ PCR Micro Kit (Carlsbad, CA) per manufacturer's instructions (up to 5 pg). Larger reactions will require a cleanup using a product with a larger capacity. Following the cleanup, the cDNA can be quantified using the NANODROP™ and analyzed by agarose gel electrophoresis to confirm the cDNA is the expected size. The cDNA can then be submitted for sequencing analysis before proceeding to the in vitro transcription reaction.

EXAMPLE 3

In vitro Transcription (IVT)

[0871] The in vitro transcription reactions can generate polynucleotides containing uniformly modified polynucleotides. Such uniformly modified polynucleotides can comprise a region or part of the polynucleotides of the invention. The input nucleotide triphosphate (NTP) mix can be made using natural and un-natural NTPs.

[0872] A typical in vitro transcription reaction can include the following:

1 Template cDNA— 1.0 pg

2 lOx transcription buffer (400 mM Tris-HCl pH 8.0, 190 mM MgCh, 50 mM DTT, 10 mM Spermidine)— 2.0 pi

3 Custom NTPs (25mM each)— 7.2 mΐ

4 RNase Inhibitor— 20 U

5 T7 RNA polymerase— 3000 U

6 cUrkO— Up to 20.0 mΐ. and

7 Incubation at 37° C for 3 hr-5 hrs.

[0873] The crude IVT mix can be stored at 4° C overnight for cleanup the next day. 1

U of RNase-free DNase can then be used to digest the original template. After 15 minutes of incubation at 37° C, the mRNA can be purified using Ambion's

MEGACLEAR™ Kit (Austin, TX) following the manufacturer's instructions. This kit can purify up to 500 pg of RNA. Following the cleanup, the RNA can be quantified using the NanoDrop and analyzed by agarose gel electrophoresis to confirm the RNA is the proper size and that no degradation of the RNA has occurred.

EXAMPLE 4

Enzymatic Capping

[0874] Capping of a polynucleotide can be performed with a mixture includes: IVT

RNA 60 pg-180pg and dH20 up to 72 pi. The mixture can be incubated at 65° C for 5 minutes to denature RNA, and then can be transferred immediately to ice.

[0875] The protocol can then involve the mixing of lOx Capping Buffer (0.5 M Tris- HCl (pH 8.0), 60 mM KC1, 12.5 mM MgCh) (10.0 pi); 20 mM GTP (5.0 pi); 20 mM S-Adenosyl Methionine (2.5 pi); RNase Inhibitor (100 U); 2'-0-Methyltransferase (400U); Vaccinia capping enzyme (Guanylyl transferase) (40 U); dH20 (Up to 28 pi); and incubation at 37° C for 30 minutes for 60 mg RNA or up to 2 hours for 180 pg of RNA.

[0876] The polynucleotide can then be purified using Ambion's MEGACLEAR™ Kit

(Austin, TX) following the manufacturer's instructions. Following the cleanup, the RNA can be quantified using the NANODROP™ (ThermoFisher, Waltham, MA) and analyzed by agarose gel electrophoresis to confirm the RNA is the proper size and that no degradation of the RNA has occurred. The RNA product can also be sequenced by running a reverse-transcription-PCR to generate the cDNA for sequencing.

EXAMPLE 5

PolyA Tailing Reaction

[0877] Without a poly-T in the cDNA, a poly-A tailing reaction must be performed before cleaning the final product. This can be done by mixing Capped IVT RNA (100 pi); RNase Inhibitor (20 U); lOx Tailing Buffer (0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCh) (12.0 pi); 20 mM ATP (6.0 pi); Poly-A Polymerase (20 U); chBO up to 123.5 mΐ and incubating at 37° C for 30 min. If the poly-A tail is already in the transcript, then the tailing reaction can be skipped and proceed directly to cleanup with Ambion's MEGACLEAR™ kit (Austin, TX) (up to 500 pg). Poly-A Polymerase is, in some cases, a recombinant enzyme expressed in yeast.

[0878] It should be understood that the processivity or integrity of the polyA tailing reaction does not always result in an exact size polyA tail. Hence polyA tails of approximately between 40-200 nucleotides, e.g., about 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 150- 165, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164 or 165 are within the scope of the invention.

EXAMPLE 6

Natural 5' Caps and 5' Cap Analogues

[0879] 5'-capping of polynucleotides can be completed concomitantly during the in vv/ra-transcription reaction using the following chemical RNA cap analogs to generate the 5'-guanosine cap structure according to manufacturer protocols: 3'-0-Me- m7G(5')ppp(5') G [the ARCA cap];G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A;

m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5'-capping of modified RNA can be completed post-transcriptionally using a Vaccinia Virus Capping Enzyme to generate the "Cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). Cap 1 structure can be generated using both Vaccinia Virus Capping Enzyme and a 2'-0 methyl-transferase to generate: m7G(5')ppp(5')G-2'-0-methyl.

Cap 2 structure can be generated from the Cap 1 structure followed by the 2'-0- methylation of the 5'-antepenultimate nucleotide using a 2'-0 methyl-transferase. Cap 3 structure can be generated from the Cap 2 structure followed by the 2'-0- methylation of the 5'-preantepenultimate nucleotide using a 2'-0 methyl-transferase. Enzymes can be derived from a recombinant source.

[0880] When transfected into mammalian cells, the modified mRNAs can have a stability of between 12-18 hours or more than 18 hours, e.g., 24, 36, 48, 60, 72 or greater than 72 hours.

EXAMPLE 7

Capping Assays

A. Protein Expression Assay

[0881] Polynucleotides encoding a polypeptide, containing any of the caps taught herein, can be transfected into cells at equal concentrations. After 6, 12, 24 and 36 hours post-transfection, the amount of protein secreted into the culture medium can be assayed by ELISA. Synthetic polynucleotides that secrete higher levels of protein into the medium would correspond to a synthetic polynucleotide with a higher translationally-competent Cap structure.

B. Purity Analysis Synthesis

[0882] Polynucleotides encoding a polypeptide, containing any of the caps taught herein, can be compared for purity using denaturing Agarose-Urea gel electrophoresis or HPLC analysis. Polynucleotides with a single, consolidated band by

electrophoresis correspond to the higher purity product compared to polynucleotides with multiple bands or streaking bands. Synthetic polynucleotides with a single HPLC peak would also correspond to a higher purity product. The capping reaction with a higher efficiency would provide a more pure polynucleotide population.

C. Cytokine Analysis

[0883] Polynucleotides encoding a polypeptide, containing any of the caps taught herein, can be transfected into cells at multiple concentrations. After 6, 12, 24 and 36 hours post-transfection the amount of pro-inflammatory cytokines such as TNF-alpha and IFN-beta secreted into the culture medium can be assayed by ELISA.

Polynucleotides resulting in the secretion of higher levels of pro-inflammatory cytokines into the medium would correspond to polynucleotides containing an immune-activating cap structure.

D. Capping Reaction Efficiency

[0884] Polynucleotides encoding a polypeptide, containing any of the caps taught herein, can be analyzed for capping reaction efficiency by LC-MS after nuclease treatment. Nuclease treatment of capped polynucleotides would yield a mixture of free nucleotides and the capped 5 '-5-triphosphate cap structure detectable by LC-MS. The amount of capped product on the LC-MS spectra can be expressed as a percent of total polynucleotide from the reaction and would correspond to capping reaction efficiency. The cap structure with higher capping reaction efficiency would have a higher amount of capped product by LC-MS.

EXAMPLE 8

Agarose Gel Electrophoresis of Modified RNA or RT PCR Products

[0885] Individual polynucleotides (200-400 ng in a 20 pi volume) or reverse

transcribed PCR products (200-400 ng) can be loaded into a well on a non-denaturing 1.2% Agarose E-Gel (Invitrogen, Carlsbad, CA) and run for 12-15 minutes according to the manufacturer protocol.

EXAMPLE 9

Nanodrop Modified RNA Quantification and UV Spectral Data

[0886] Modified polynucleotides in TE buffer (1 mΐ) can be used for Nanodrop UV absorbance readings to quantitate the yield of each polynucleotide from a chemical synthesis or in vitro transcription reaction.

EXAMPLE 10

Method of Screening for Protein Expression

A. Electrospray Ionization

[0887] A biological sample that can contain proteins encoded by a polynucleotide administered to the subject can be prepared and analyzed according to the

manufacturer protocol for electrospray ionization (ESI) using 1, 2, 3 or 4 mass analyzers. A biologic sample can also be analyzed using a tandem ESI mass spectrometry system.

[0888] Patterns of protein fragments, or whole proteins, can be compared to known controls for a given protein and identity can be determined by comparison.

B. Matrix-Assisted Laser Desorption/Ionization

[0889] A biological sample that can contain proteins encoded by one or more

polynucleotides administered to the subject can be prepared and analyzed according to the manufacturer protocol for matrix-assisted laser desorption/ionization (MALDI).

[0890] Patterns of protein fragments, or whole proteins, can be compared to known controls for a given protein and identity can be determined by comparison.

C. Liquid Chromatography-Mass spectrometry-Mass spectrometry

[0891] A biological sample, which can contain proteins encoded by one or more polynucleotides, can be treated with a trypsin enzyme to digest the proteins contained within. The resulting peptides can be analyzed by liquid chromatography -mass spectrometry -mass spectrometry (LC/MS/MS). The peptides can be fragmented in the mass spectrometer to yield diagnostic patterns that can be matched to protein sequence databases via computer algorithms. The digested sample can be diluted to achieve 1 ng or less starting material for a given protein. Biological samples containing a simple buffer background ( e.g water or volatile salts) are amenable to direct in-solution digest; more complex backgrounds (e.g., detergent, non-volatile salts, glycerol) require an additional clean-up step to facilitate the sample analysis.

[0892] Patterns of protein fragments, or whole proteins, can be compared to known controls for a given protein and identity can be determined by comparison.

EXAMPLE 11

Production of Nanoparticle Compositions

A. Production of nanoparticle compositions

[0893] Nanoparticles can be made with mixing processes such as microfluidics and

T-junction mixing of two fluid streams, one of which contains the polynucleotide and the other has the lipid components.

[0894] Lipid compositions are prepared by combining an ionizable amino lipid

disclosed herein, e.g., a lipid according to Formula (I) such as Compound II or a lipid according to Formula (III) such as Compound VI, a phospholipid (such as DOPE or DSPC, obtainable from Avanti Polar Lipids, Alabaster, AL), a PEG lipid (such as 1,2 dimyristoyl sn glycerol methoxypoly ethylene glycol, also known as PEG-DMG, obtainable from Avanti Polar Lipids, Alabaster, AL), and a structural lipid (such as cholesterol, obtainable from Sigma Aldrich, Taufkirchen, Germany, or a

corticosteroid (such as prednisolone, dexamethasone, prednisone, and

hydrocortisone), or a combination thereof) at concentrations of about 50 mM in ethanol. Solutions should be refrigerated for storage at, for example, -20° C. Lipids are combined to yield desired molar ratios and diluted with water and ethanol to a final lipid concentration of between about 5.5 mM and about 25 mM.

[0895] Nanoparticle compositions including a polynucleotide and a lipid composition are prepared by combining the lipid solution with a solution including the a polynucleotide at lipid composition to polynucleotide wt:wt ratios between about 5: 1 and about 50: 1. The lipid solution is rapidly injected using aNanoAssemblr microfluidic based system at flow rates between about 10 ml/min and about 18 ml/min into the polynucleotide solution to produce a suspension with a water to ethanol ratio between about 1: 1 and about 4: 1.

[0896] For nanoparticle compositions including an RNA, solutions of the RNA at concentrations of 0.1 mg/ml in deionized water are diluted in 50 mM sodium citrate buffer at a pH between 3 and 4 to form a stock solution.

[0897] Nanoparticle compositions can be processed by dialysis to remove ethanol and achieve buffer exchange. Formulations are dialyzed twice against phosphate buffered saline (PBS), pH 7.4, at volumes 200 times that of the primary product using Slide-A- Lyzer cassettes (Thermo Fisher Scientific Inc., Rockford, IL) with a molecular weight cutoff of 10 kD. The first dialysis is carried out at room temperature for 3 hours. The formulations are then dialyzed overnight at 4° C. The resulting nanoparticle suspension is filtered through 0.2 pm sterile filters (Sarstedt, Niimbrecht, Germany) into glass vials and sealed with crimp closures. Nanoparticle composition solutions of 0.01 mg/ml to 0.10 mg/ml are generally obtained.

[0898] The method described above induces nano-precipitation and particle

formation. Alternative processes including, but not limited to, T-junction and direct injection, can be used to achieve the same nano-precipitation.

B. Characterization of nanoparticle compositions

[0899] A Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire,

UK) can be used to determine the particle size, the polydispersity index (PDI) and the zeta potential of the nanoparticle compositions in 1 xPBS in determining particle size and 15 mM PBS in determining zeta potential.

[0900] Ultraviolet-visible spectroscopy can be used to determine the concentration of a polynucleotide (e.g., RNA) in nanoparticle compositions. 100 pL of the diluted formulation in 1 xPBS is added to 900 pL of a 4: 1 (v/v) mixture of methanol and chloroform. After mixing, the absorbance spectrum of the solution is recorded, for example, between 230 nm and 330 nm on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Brea, CA). The concentration of polynucleotide in the nanoparticle composition can be calculated based on the extinction coefficient of the polynucleotide used in the composition and on the difference between the absorbance at a wavelength of, for example, 260 nm and the baseline value at a wavelength of, for example, 330 nm.

[0901] For nanoparticle compositions including an RNA, a QUANT-IT™

RIBOGREEN® RNA assay (Invitrogen Corporation Carlsbad, CA) can be used to evaluate the encapsulation of an RNA by the nanoparticle composition. The samples are diluted to a concentration of approximately 5 pg/mL in a TE buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). 50 pL of the diluted samples are transferred to a polystyrene 96 well plate and either 50 pL of TE buffer or 50 pL of a 2% Triton X- 100 solution is added to the wells. The plate is incubated at a temperature of 37° C for 15 minutes. The RIBOGREEN® reagent is diluted 1 : 100 in TE buffer, and 100 pL of this solution is added to each well. The fluorescence intensity can be measured using a fluorescence plate reader (Wallac Victor 1420 Multilablel Counter; Perkin Elmer, Waltham, MA) at an excitation wavelength of, for example, about 480 nm and an emission wavelength of, for example, about 520 nm. The fluorescence values of the reagent blank are subtracted from that of each of the samples and the percentage of free RNA is determined by dividing the fluorescence intensity of the intact sample (without addition of Triton X-100) by the fluorescence value of the disrupted sample (caused by the addition of Triton X-100).

[0902] Exemplary formulations of the nanoparticle compositions are presented in the

Table 6 below. The term "Compound" refers to an ionizable lipid such as MC3, Compound II, or Compound VI. "Phospholipid" can be DSPC or DOPE. "PEG-lipid" can be PEG-DMG or Compound I.

Table 6. Exemplary Formulations of Nanoparticles



Example 12

Preparation of Nanoparticle and Citrate Saline Compositions

[0903] Stock solution of lipids in ethanol were prepared from Compound II,

distearoyl phosphatidylcholine (DSPC, Avanti Polar Lipids), cholesterol (Sigma), and l,2-dimyristoyl-rac-glycero-3-methoxypoly ethylene glycol-2000 (DMG-PEG2000 from NOF Corporation). The lipids were mixed in ethanol 99.5% to a total lipid concentration of 12.5 mM. The composition was Compound II, DSPC, Cholesterol, DMG-PEG2000 at the ratio of 50: 10:38.5: 1.5 % mol. The VEGF-A modified RNA (e g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, or SEQ ID NO: 6) was thawed and diluted to 6.25 mM in sodium acetate buffer and HyClone water at a

concentration corresponding to a total lipid:mRNA weight ratio of 11 : 1 (charge ratio nitrogen: phosphate (N:P) of 3) in the final formulation. The final formulation after dilution was as follows:

Table 7. Compound II-LNP 1: 11 (N:P=3), mRNA concentration 0.06 mg/mL


Table 8. Sequences





[0904] The Compound II-LNP compositions were prepared by rapidly mixing ethanol solution containing the lipids and aqueous solution of a modified VEGF-A RNA on a microfluidic device, followed by dialysis in phosphate buffered saline (PBS). Briefly, the modified VEGF-A RNA solution and the lipid solution were injected into a microfluidic mixing device (NanoAssemblr™ (Precision Nanosystems)) at a volumetric ratio of aqueous to ethanol 3: 1 and flow rates of 12-14 mL/min using two syringes, which were controlled by syringe pumps. Ethanol was removed by dialyzing Compound II-LNP compositions against PBS buffer overnight using membranes with 10 KD cutoff. Compound II-LNP compositions were characterized by particle size (63 nm), polydispersity index (0.10) and encapsulation (96%). Compound II-LNP compositions were diluted to a final concentration of 0.06 mg/mL with PBS and filtered sterile. Compound II-LNP compositions were stored refrigerated. The size and polydispersity of Compound II-LNPs was determined by dynamic light scattering using a Zetasizer Nano ZS (Malvern Instruments Ltd) and the encapsulation and concentration of mRNA in the Compound II-LNP formulations were determined using the RiboGreen assay.

[0905] DLin-MC3-DMA Lipid Nanoparticles (MC3-LNPs): Stock solution of lipids in ethanol were prepared from DLin-MC3-DMA (synthesized as described in Jayaraman, M., et al, Angew Chem Int Ed Engl, 2012, 51(34), p. 8529-33), distearoyl phosphatidylcholine (DSPC, Avanti Polar Lipids), cholesterol (Sigma), and 1,2- dimyristoyl-rac-glycero-3-methoxypoly ethylene glycol-2000 (DMG-PEG2000 from NOF Corporation). The lipids were mixed in ethanol 99.5% to a total lipid concentration of 12.5 mM. The composition was DLin-MC3-DMA, DSPC,

Cholesterol, DMG-PEG2000 at the ratio of 50: 10:38.5: 1.5 % mol. The VEGF-A modified RNA (e g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, or SEQ ID NO: 6) was thawed and diluted to 6.25 mM in sodium acetate buffer (pH 5) and HyClone water at a concentration corresponding to a total lipid:mRNA weight ratio of 10.25: 1 (charge ratio nitrogen:phosphate (N:P) of 3) in the final formulation. The final formulations after dilution were as follows:

Table 9

LNP 1: 10.25 (N:P=3), mRNA concentration 0.075 mg/mL


[0906] The structure of DLin-MC3-DMA is:


[0907] Lipid nanoparticle (LNP) compositions: The LNP compositions were prepared by rapidly mixing ethanol solution containing the lipids and aqueous solution of VEGF-A modified RNA on a microfluidic device, followed by dialysis in phosphate buffered saline (PBS). Briefly, the VEGF-A modified RNA solution and the lipid solution were injected into a microfluidic mixing device (NanoAssemblr™ (Precision Nanosystems)) at a volumetric ratio of aqueous to ethanol 3: 1 and flow rates of 12-14 mL/min using two syringes, which were controlled by syringe pumps. Following microfluidic mixing, the MC3-LNPs were dialyzed overnight against phosphate buffered saline (pH 7.4) using Slide-A-Lyzer™ G2 dialysis cassettes with a molecular weight cut-off of 10k (Thermo Scientific).

[0908] LNP compositions were characterized by particle size (77 to 85 nm), VEGF-A modified RNA concentration (0.076 to 0.1 mg/mL), polydispersity index (0.04 to 0.08) and encapsulation (96 to 98%). LNP compositions were diluted to a final concentration of 0.075 mg/mL with PBS and filtered sterile. LNP compositions were stored refrigerated. The size and polydispersity of MC3- LNPs was determined by dynamic light scattering using a Zetasizer Nano ZS (Malvern Instruments Ltd) and the encapsulation and concentration of mRNA in the MC3-LNP formulations were determined using the RiboGreen assay.

[0909] Citrate saline compositions: Citrate saline compositions were prepared by diluting a thawed modified VEGF-A RNA solution with Hy Clone water and a concentrated buffer solution to a final composition of 10 mM sodium citrate and 130 mM sodium chloride at pH 6.5.

Example 13

Assessment of Wound Healing Following Intradermal Injection of Modified RNA

Encoding A Wound Healing Polypeptide in Mouse

[0910] A MC3 lipid nanoparticle composition comprising a modified VEGF-A RNA and DLin-MC3-DMA was prepared as in Example 13 with VEGF-A modified RNA having the sequence of SEQ ID NO: 5.

[0911] A second MC3 lipid nanoparticle composition comprising a non-translatable

(NT) modified VEGF-A RNA and DLin-MC3-DMA was prepared as in Example 13 with VEGF-A modified RNA having the sequence of SEQ ID NO: 7.

[0912] Male db/db mice were used. These mice are an established model of Type II diabetes and have impaired wound healing as compared to wild-type mice.

[0913] FIG. 1 provides a timeline of the surgical procedure, treatment, and

observation time points of the study. Glucose and body weight were measured the week before the start of study and at termination. The mice were randomized according to fasting (4 hours) glucose levels, which were measured the week before surgery. The mice were anesthetized with isoflurane before undergoing surgery. The surgical procedure was started by removing the hair on the back of the mice by using clippers and hair removal cream. One wound on the back of each mouse was made by creating a mark with a 10 mm biopsy punch and then cutting it out. The wound was covered by a tegaderm transparent dressing to protect the wound. A self-adhering elastic bandage was placed around the mouse covering the wound area, and an injection of analgesic (Tamgesic at 0.08 mg/ml) was administered at a dosage of 0.05- 0.1 mg/kg according to the weight of the mouse.

[0914] The mice were separated into three treatment groups: (a) citrate/saline solution

(10 mM sodium citrate and 130 mM sodium chloride at pH 6.5) (n=7), (b) mRNA VEGF NT 3 pg MC3 (non-translatable VEGF-A modified RNA formulated with MC3 LNP) (n=7), and (c) mRNA VEGF 3 pg MC3 (modified VEGF-A RNA

formulated with MC3 LNP) (n=7). The treatment solutions were injected

intradermally as 4 injections (10 mΐ each) around the wound (40 mΐ total), as a single dose at day 3 (FIG. 1).

[0915] The wounds were examined every 3rd or 4th day until all wounds were healed, for up to 17 days. The tegaderm was removed and replaced after examination.

Pictures of the wounds were taken with a Canon camera at a fixed distance from the wound. The wound area was determined by tracing the wound margin using the image analyzing software Image J, and then calculated as a percent area of the baseline area. Statistical evaluation was done with an unpaired, two-sided t-test, and p-values<0.05 were considered significant.

[0916] As shown in the results in Table 10 and FIG. 2, intradermal injection of a lipid nanoparticle composition comprising 3 pg of modified VEGF-A RNA formulated with MC3 significantly improved wound healing when compared to a lipid nanoparticle composition comprising 3 pg of non-translatable VEGF-A formulated with MC3, or citrate saline, as demonstrated by the decrease in the percent of open wound area.

[0917] Table 10 - % of open wound original area from baseline (Day 3)


Example 14

Assessment of Wound Healing Following Topical Application of Modified RNA

Encoding a Wound Healing Polypeptide in Mouse

[0918] A MC3 lipid nanoparticle composition comprising a modified VEGF-A RNA and DLin-MC3-DMA was prepared as in Example 13 with VEGF-A modified RNA having the sequence of SEQ ID NO: 5.

[0919] Male db/db mice were used. These mice are an established model of Type II diabetes and have impaired wound healing as compared to wild-type mice.

[0920] FIG. 3 provides a timeline of the surgical procedure, treatment, and

observation time points of the study. Glucose and body weight were measured the

week before the start of study and at termination. The mice were randomized according to fasting (4 hours) glucose levels, which were measured the week before surgery. The mice were anesthetized with isoflurane before undergoing surgery. The surgical procedure was started by removing the hair on the back of the mice by using clippers and hair removal cream. One wound on the back of each mouse was made by creating a mark with a 10 mm biopsy punch and then cutting it out. The wound was covered by a tegaderm transparent dressing to protect the wound. A self-adhering elastic bandage was placed around the mouse covering the wound area, and an injection of analgesic (Tamgesic at 0.08 mg/ml) was administered at a dosage of 0.05- 0.1 mg/kg according to the weight of the mouse.

[0921] The mice were separated into two treatment groups: (a) citrate/saline solution

(10 mM sodium citrate and 130 mM sodium chloride at pH 6.5) (n=5), and (b) mRNA VEGF 3 pg MC3 (n=5). The treatment solutions were administered via topical application through a needle inserted through the tegaderm at day 0 and day 3 (FIG. 3).

[0922] The wounds were examined every 3rd or 4th day until all wounds were healed, for up to 17 days. The tegaderm was removed and replaced after examination.

Pictures of the wounds were taken with a Canon camera at a fixed distance from the wound. The wound area was determined by tracing the wound margin using the image analyzing software Image J, and then calculated as a percent area of the baseline area. Statistical evaluation was done with an unpaired, two-sided t-test, and p-values<0.05 were considered significant.

[0923] As shown in the results in Table 11 and FIG. 4, topical application of a lipid nanoparticle composition comprising 3 pg of modified VEGF- A RNA formulated with MC3 significantly improved wound healing when compared to applied saline citrate, as demonstrated by the decrease in the percent of open wound area.

[0924] Table 11 - % of open wound original area from baseline (Day 0)


Example 15

Quantification of Human Wound Healing Polypeptide in Pig Skin

[0925] Citrate saline compositions and nanoparticle compositions comprising a

VEGF-A modified RNA and either Compound II or DLain-MC3-DMA (MC3) were prepared as in Example 13. The citrate saline composition, Compound II nanoparticle composition, and MC3 nanoparticle composition were all prepared with VEGF-A modified RNA having the sequence of SEQ ID NO: 5.

[0926] Wound preparation: The stratum comeum of the skin of Gottingen mini pigs was removed with a scalpel blade, and the rest of the epidermis was removed by using a Cotech mini grinder.

[0927] Topical administration of a nanonarticle composition comprising a modified

VEGF-A RNA and MC3: 40 pi containing 3 pg of mRNA in the MC3 nanoparticle formulation was applied on three areas where the epidermis was removed from the skin of the pigs. The tissue was removed 5-6 hours after application, snap frozen in liquid nitrogen, and stored at -80 °C until the time the analysis was performed. The procedure was repeated on four pigs.

[0928] Intradermal injection of a nanoparticle composition comprising a modified

VEGF-A RNA and MC3: 40 pi containing 3 pg of mRNA in the MC3 nanoparticle formulation was administered by intradermal injection (using an insulin syringe) into three sites where the epidermis was removed from the skin of the pigs. The tissue was removed 5-6 hours after application, snap frozen in liquid nitrogen, and stored at -80 °C until the time the analysis was performed. The procedure was repeated on four pigs.

[0929] Topical administration of a nanoparticle composition comprising a VEGF-A

RNA and Compound II: 50 pi containing 3 pg of mRNA in the Compound II nanoparticle formulation was applied on three areas where the epidermis was removed from the skin of the pigs. The tissue was removed 5 hours after application, snap frozen in liquid nitrogen, and stored at -80 °C until the time the analysis was performed. The procedure was repeated on five pigs.

[0930] Topical administration of citrate/s aline (control): 50 mΐ containing 100 pg mRNA in the citrate/saline formulation was applied on three areas where the epidermis was removed from the skin of the pigs. The tissue was removed 5 hours

after application, snap frozen in liquid nitrogen, and stored at -80 °C until the time analysis was performed. The procedure was repeated on three pigs.

[0931] Each tissue sample was analyzed for expression of human VEGF-A protein using ELISA, and the results summarized in Table 12 (FIG. 5A-B ).

Table 12


[0932] FIG. 5A shows the production of human VEGF-A protein (hVEGF-A) in pig tissue 5-6 hours after topical application and single injection treatments with the modified VEGF-A RNA formulated in an MC3 LNP, and the production of hVEGF- A protein in pig tissue 5 hours after topical application treatment with the modified VEGF-A RNA formulated with a Compound II LNP. Treatment with the citrate saline composition did not result in the production of hVEGF-A protein. FIG. 5B depicts a wound on pig skin, with the drawn circles indicating the sites of topical treatment with modified VEGF-A RNA formulated in MC3.

[0933] It is to be appreciated that the Detailed Description section, and not the

Summary and Abstract sections, is intended to be used to interpret the claims. The Summary and Abstract sections can set forth one or more but not all exemplary embodiments of the present invention as contemplated by the inventor(s), and thus, are not intended to limit the present invention and the appended claims in any way.

[0934] The present invention has been described above with the aid of functional building blocks illustrating the implementation of specified functions and

relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternate boundaries can be defined so long as the specified functions and relationships thereof are appropriately performed.

[0935] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[0936] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0937] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.