Processing

Please wait...

Settings

Settings

Goto Application

1. WO2020111519 - PHARMACEUTICAL COMPOSITION COMPRISING, AS ACTIVE INGREDIENT, USP25 PROTEIN OR POLYNUCLEOTIDE FOR ENCRYPTING SAME

Document

명세서

발명의 명칭

기술분야

1  

배경기술

2   3   4  

발명의 상세한 설명

기술적 과제

5   6   7   8   9   10  

과제 해결 수단

11   12   13   14   15   16   17   18   19   20   21   22   23   24   25   26   27   28   29   30   31   32   33   34   35   36   37   38   39   40   41   42   43   44   45   46   47   48   49   50   51   52   53   54   55   56   57   58   59   60   61   62   63   64   65   66  

발명의 효과

67  

도면의 간단한 설명

68   69   70   71   72   73   74  

발명의 실시를 위한 최선의 형태

75  

발명의 실시를 위한 형태

76   77   78   79   80   81   82   83   84   85   86   87   88   89   90   91   92   93   94   95   96   97   98   99   100   101   102   103   104   105   106   107   108   109   110   111   112   113   114   115   116   117   118   119   120   121   122   123   124   125   126   127   128   129   130  

산업상 이용가능성

131   132   133   134   135   136   137   138   139   140   141   142   143   144   145   146   147   148   149   150   151   152   153   154   155   156   157   158   159   160   161   162   163   164   165   166   167   168   169   170   171   172   173   174   175   176   177   178   179   180   181   182   183   184   185   186   187   188   189   190   191   192   193   194   195   196   197   198   199   200   201   202   203   204   205   206   207   208   209   210   211   212   213   214   215   216   217   218   219   220   221   222   223   224   225   226   227   228   229   230   231   232   233   234   235   236   237   238   239   240   241   242   243   244   245   246   247   248   249   250   251   252   253   254   255   256   257   258   259   260   261   262   263   264   265   266   267   268   269   270   271   272   273   274   275   276   277   278   279   280  

청구범위

1   2   3   4   5   6   7   8   9   10   11   12   13   14   15   16  

도면

1a   1b   2   3   4   5   6   7  

명세서

발명의 명칭 : USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물

기술분야

[1]
본 발명은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 약학 조성물에 관한 것이다.

배경기술

[2]
탄력성을 갖는 조직인 연골은 두 개의 뼈를 서로 연결하며, 관절 부위에 운동성을 부여하고 충격을 완화하는 역할을 한다. 특히, 관절 연골은 결합조직으로서, 프로테오글리칸(Proteoglycan)과 타입 콜라겐의 매트릭스에 임베딩되어 있는 연골 세포가 포함된다. 연골 조직이 손상됨으로써, 뼈와 뼈의 직접적인 마찰, 관절의 뻣뻣함, 관절 연골 운동의 점진적 저하 및 연골 부위의 빈발성 통증이 유발된다. 아직 불명확하지만, 골관절염의 초기 병인은 일반적으로 관절 연골 매트릭스 내의 동화 및 이화 대사 기전의 변화나 불균형에 의하여 연골 파괴가 초래되는 것으로 알려져 있다.
[3]
일반적으로 척추동물의 관절을 이루는 연골 조직에는 혈관, 신경 및 임파조직이 부재하여, 상기 연골 조직이 한번 손상되게 되면 정상적으로 생체 내에서 재생될 수 없다. 이렇게 관절의 연골 조직이 손상될 경우 심한 통증으로 인해 일상 활동에 제한을 받게 되며, 연골 조직의 손상이 만성화되는 경우 치명적인 퇴행성 관절염을 유발하게 되어 정상적인 생활이나 직업적인 활동을 거의 할 수 없게 된다. 이에, 손상된 연골 조직을 재생하기 위한 다양한 의학적 방법이 시도되고 있으나, 아직 관절 연골인 초자연골(Hyaline cartilage)을 자연과 같은 상태로 회복하기에는 부족한 실정이다. 임상적으로 연골을 재생시키는 수술 방법으로는 ① 줄기세포의 연골 세포로의 분화를 유도하는 방법, ② 골 연골 이식술(Osteochondral transplantation)로 자가 혹은 동종의 연골조직을 연골 결손 부위에 이식하는 방법, ③ 미세 골절술(Microfracture)로 손상된 연골을 잘 긁어내어 제거하고 연골 하골이 노출되면 여기에 일정한 간격으로 구멍을 뚫고 이를 통해서 흘러나온 골수 세포가 연골 조직으로 재생되는 것을 도모하는 방법, ④ 연골세포 이식술(Chondrocyte transplantation)로 연골 결손부위에 연골세포를 이식함으로써 연골 재생을 유도하는 방법 등이 있다.
[4]
그러나 상기 미세 골절술은 실제 관절에 필요한 초자연골이 아니라 섬유연골(Fibro-cartilage)이 주로 생성되기 때문에, 기능적인 측면에서 볼 때는 만족할 만한 효과를 거두지 못한다는 단점이 존재하고, 상기 골 연골 이식술은 이식된 부위와 기존의 조직 사이에 틈이 남는 다는 단점이 있으며, 상기 연골세포 이식술의 경우 다수 회에 걸친 수술로 인한 환자의 고통과 경제적 부담이 크다는 단점이 존재한다. 이와 같은 문제점에 따라 연골과 같은 조직을 매우 효과적으로 재생할 수 있는 기술의 개발이 여전히 필요한 실정이다.

발명의 상세한 설명

기술적 과제

[5]
본 발명의 일 목적은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 포함하는 약학 조성물을 제공하는 것이다.
[6]
본 발명의 다른 목적은 상기 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는 약학 조성물을 제공하는 것이다.
[7]
본 발명의 또 다른 목적은 상기 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는 약학 조성물을 제공하는 것이다.
[8]
본 발명의 또 다른 목적은 USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공하는 것이다.
[9]
본 발명의 또 다른 목적은 USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공하는 것이다.
[10]
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.

과제 해결 수단

[11]
본 발명자들은 탈 유비퀴틴화 효소 중에서 특히, USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질이 Sox9(SRY-Box 9) 단백질을 탈 유비퀴틴화 시킴으로써, Sox9 단백질이 분해되지 않고 골수 유래 중간엽 줄기세포를 연골 세포로 분화되도록 유도함을 발견하여 본 발명을 완성하게 되었다.
[12]
[13]
본 발명의 일 구현 예에서는 조직 재생용 약학 조성물을 제공한다.
[14]
본 발명의 상기 조직 재생용 약학 조성물은 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질; 이를 암호화하는 폴리뉴클레오티드; 상기 폴리뉴클레오티드를 포함하는 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
[15]
본 발명의 상기 USP25 단백질은 유비퀴틴 부분을 가수분해할 수 있는 기능을 갖는 가수분해 효소로서, 기질에 결합된 유비퀴틴 분자를 가수분해하여 유비퀴틴 분자를 재사용하거나, 기질의 프로테아솜(Proteasome)에 의한 분해를 방지하는 기능을 갖는다. 이와 같은 기능으로 인하여, 본 발명의 상기 USP25 단백질은 골수 유래 중간엽 줄기세포가 연골 세포로 분화되는데 중요한 역할을 하는 전사 인자 단백질을 탈 유비퀴틴화, 즉 유비퀴틴 부분을 가수분해함으로써, 상기 전사 인자의 프로테아솜에 의한 분해를 억제할 수 있다.
[16]
본 발명의 상기 전사 인자 단백질은 연골 세포의 분화와 골격 형성에 역할을 하는 전사 인자라면 모두 포함될 수 있고, 예를 들면, Sox5(SRY-Box 5) 단백질, Sox6(SRY-Box 6) 단백질 또는 Sox9(SRY-Box 9) 단백질 등일 수 있고, 바람직하게는 Sox9(SRY-Box 9) 단백질일 수 있으나, 이에 제한되는 것은 아니다.
[17]
본 발명의 상기 조직은 골 조직 또는 연골 조직일 수 있으나, 이에 제한되는 것은 아니다.
[18]
본 발명의 상기 연골 조직(Cartilage tissue)은 인간을 포함하는 동물의 체내 다양한 부분에서 발견되는 유연한 결합조직으로, 뼈, 흉곽, 귀, 코, 기관지 및 추간판 사이의 접합부를 포함하는 개념이다. 뼈와 달리, 단단하고 경직되어 있지 않으나, 근육과 비교하였을 때에는 덜 유연하고 비교적 뻣뻣하다는 특징을 갖고 있다. 상기 연골 조직은 콜라겐 섬유(Collagen fiber), 프로테오글리칸(Proteoglycan)이 풍부한 기반물질(Ground substance) 및 탄력소 섬유(Elastin fiber)로 구성된 다량의 세포외기질(Extracellular matrix)을 생산하는 연골세포 (Chondroblast)라 불리는 특화된 세포로 구성된다. 상기 연골 조직 내에 포획되어 있는 연골 세포에는 관절 연골의 압박 또는 탄성 연골의 굽힘에 의해 생성되는 펌핑 작용에 의한 확산을 통해 영양분이 제공된다. 이와 같은 이유에 의해 상기 연골 조직은 다른 결합조직과는 달리 혈관을 포함하지 않기 때문에 성장 및 회복이 매우 느릴 수 있다.
[19]
본 발명의 상기 연골 조직은 상기 세 가지 주요 요소의 상대적인 함유량에 따라 분류될 수 있는 탄성 연골(Elastic cartilage), 유리질 연골(Hyaline cartilage) 및 섬유 연골(Fibrocartilage)로 구성된 군으로부터 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
[20]
본 발명의 상기 연골 조직이 위치하는 부위는 유리질 연골(Hyaline cartilage; 예를 들어, 관절, 코, 후두 또는 흉골에 위치하는 유리질 연골), 탄성 연골(Elastic cartilage; 예를 들어 귀에 위치하는 탄성 연골) 및 섬유 연골(Fibrocartilage; 예를 들어, 추간판)일 수 있으나, 이에 제한되는 것은 아니다.
[21]
본 발명의 상기 골 조직(Osseous tissue)는 뼈를 형성하는 조직을 의미한다. 상기 뼈는 표면이 치밀골질로 이루어지고, 중심부나 장골의 양 끝은 그물 같이 연합된 해면골질로 이루어져 있다. 골 조직은 결합조직이 분화된 연골로부터 변화되나, 그 중 일부는 결합조직으로부터 바로 생성될 수 있다. 골 조직의 말단은 이웃된 뼈와 접합하는 부분인 관절면이 있으며, 그 표면은 초자 연골인 관전 연골로 뒤덮여 있다. 골 세포는 골충판 사이에 배열되어 있으며, 불규칙한 별모양으로 가는 원형질 돌기와 인접한 다른 골세포와 연결되어 있다. 뼈의 표면에는 질긴 결합조직성 골막이 존재하며, 뼈의 주변에 분포되어 있는 혈관과 신경에 의해 영양을 공급받을 뿐만 아니라, 보호받을 수 있다. 상기 골막이 결손되면 뼈의 생존, 신생 및 재생이 곤란해질 수 있다.
[22]
본 발명의 상기 골 조직은 체내의 모든 골 부위에 존재할 수 있는 조직일 수 있으며, 예를 들면, 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
[23]
본 발명의 상기 재생은 일반적으로 생물체에는 몸의 일부 또는 그 기 능을 상실하였을 때, 그 부분의 조직이나 기관을 다시 원래의 상태로 복구시키거나 그 기능을 회복하려는 작을 일컫는다. 본 발명의 목적상 상기 재생은 USP25 단백질이 Sox9 단백질을 탈 유비퀴틴화 시켜, 골수 유래 중간엽 줄기세포가 연골 조직 또는 골 조직으로 분화될 수 있도록 유도함으로써, 원래의 상태로 복구될 수 있는 것을 의미할 수 있으나, 이에 제한되는 것은 아니다.
[24]
본 발명의 상기 조성물을 중간엽 줄기세포와 함께 재생이 필요한 손상된 조직, 특히 골 조직 또는 연골 조직에 주입하는 경우, 중간엽 줄기세포가 골 조직 또는 연골 조직으로 매우 효과적으로 분화됨으로써 골 또는 연골을 효과적으로 재생할 수 있다.
[25]
[26]
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 유효성분으로 포함할 수 있다.
[27]
본 발명의 상기 USP25 단백질은 탈 유비퀴틴화 기능이 유지되는 경우라면 펩타이드 형태인 경우도 포함될 수 있고, 바람직하게는 서열번호 3으로 표시되는 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
[28]
상기 아미노산 서열에 다른 아미노산, 펩타이드 등이 융합된 형태의 경우에도 USP25 단백질의 탈 유비퀴틴화 기능을 나타내는 한 모두 포함될 수 있다.
[29]
본 발명의 상기 단백질은 공지의 단백질 합성법 또는 형질전환된 숙주세포를 배양함으로써 제조될 수 있다. 상기 단백질을 형질전환된 숙주세포를 이용하는 경우, 본 발명의 상기 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 제조합 벡터를 숙주 세포에 형질도입하여 형질전환체를 제조한 뒤, 당업계에 공지된 임의의 방법을 적절하게 사용하여 상기 형질전환체를 배양할 수 있다. 이렇게 배양된 상기 형질전환체로부터 단백질은 당업계에서 공지된 원심분리, 크로마토그래피, 전기 영동 등의 방법에 의해 분리 및 정제될 수 있다.
[30]
본 발명의 상기 재조합 벡터는 세포 내에 도입되어 단백질을 발현시키기 위한 수단으로서, 플라스미드 벡터, 코즈미드 벡터, 박테리오파지 벡터 등 공지의 재조합 발현 벡터를 사용할 수 있으며, 벡터는 DNA 재조합 기술을 이용한 임의의 공지된 방법에 따라 당업자가에 의해 용이하게 제조될 수 있다.
[31]
본 발명의 상기 아미노산 서열은 하나 이상의 아미노산이 치환, 결실, 삽입 또는 이들 조합에 의해 용이하게 변형될 수 있다. 따라서, 서열번호 3과 높은 상동성을 갖는 단백질, 예를 들면 상동성이 80% 이상, 85% 이상, 90% 이상 또는 95% 이상인 경우의 단백질도 본 발명의 상기 USP25 단백질에 모두 포함될 수 있다.
[32]
본 발명의 상기 상동성이란, 야생형(Wild type) 단백질의 아미노산 서열과의 유사한 정도를 나타내기 위한 것으로서, 본 발명의 아미노산 서열과 상기와 같은 퍼센트 이상의 동일한 서열을 가지는 서열을 포함한다. 이러한 상동성은 두 서열을 육안으로 비교하여 결정할 수도 있으나, 비교대상이 되는 서열을 나란히 배열하여 상동성 정도를 분석해 주는 생물정보 알고리즘(Bioinformatic algorithm)을 사용하여 결정할 수 있다. 상기 두 개의 아미노산 서열 사이의 상동성은 백분율로 표시될 수 있다. 유용한 자동화된 알고리즘은 Wisconsin Genetics Software Package(Genetics Computer Group, Madison, W, USA)의 GAP, BESTFIT, FASTA와 TFASTA 컴퓨터 소프트웨어 모듈에서 이용가능하다. 상기 모듈에서 자동화된 배열 알고리즘은 Needleman & Wunsch와 Pearson & Lipman과 Smith & Waterman 서열 배열 알고리즘을 포함한다. 다른 유용한 배열에 대한 알고리즘과 상동성 결정은 FASTP, BLAST, BLAST2, PSIBLAST와 CLUSTAL W를 포함하는 소프트웨어에서 자동화될 수 있다.
[33]
[34]
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함할 수 있다.
[35]
본 발명의 상기 폴리뉴클레오티드는 뉴클레오티드(Nucleotide) 단위체가 공유결합에 의하여 길게 사슬모양으로 이루어진 뉴클레오티드의 중합체를 지칭하는 것으로, 일정 길이 이상의 DNA 또는 RNA 가닥을 지칭한다. 상기 폴리뉴클레오티드는 USP25 단백질을 암호화하는 폴리뉴클레오티드일 수 있으며, 바람직하게는 서열번호 4로 표시되는 염기서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
[36]
본 발명의 상기 폴리뉴클레오티드는 상기 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여 코딩영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있다. 구체적으로, 상기 폴리뉴클레오티드는 본 발명의 상기 단백질과 동등한 활성을 갖는 단백질을 암호화하는 한, 적어도 하나의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함될 수 있다.
[37]
[38]
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 발현 벡터를 유효성분으로 포함할 수 있다.
[39]
본 발명의 상기 발현 벡터는 목적하는 숙주세포에서 본 발명의 상기 USP25 단백질 또는 펩타이드가 발현되도록 할 수 있는 재조합 벡터로서, 유전자 삽입물이 발현되도록 작동하게 연결된 필수적인 조절 요소를 포함하는 유전자 제작물을 의미한다. 상기 발현 벡터는 개시 코돈, 종결 코돈, 프로모터, 오퍼레이터 등의 발현을 조절하는 요소들을 포함하는데, 상기 개시 코돈 및 종결 코돈은 일반적으로 폴리펩타이드를 암호화하는 뉴클레오티드 서열의 일부로 간주되며, 유전자 제작물이 투여되었을 때 개체에서 반드시 작용을 나타내야 하며 암호화되는 서열과 함께 번역이 일어나는 서열인 인 프레임(In frame)에 위치하여야 한다. 본 발명의 상기 발현 벡터의 프로모터는 구성적 또는 유도성일 수 있다.
[40]
본 발명의 상기 발현 벡터는 프로모터와 본 발명의 폴리뉴클레오티드가 작동 가능하게 연결되어 있을 수 있다. 상기 '작동가능하게 연결(Operably linked)'이란, 일반적 기능을 수행하도록 핵산 발현 조절 서열과 목적하는 단백질 또는 이를 암호화하는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(Functional linkage)되어 있는 상태를 의미다. 예를 들어 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동가능하게 연결되어 코딩 서열의 발현에 영향을 미칠 수 있다. 발현 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용할 수 있다.
[41]
본 발명의 상기 발현 벡터의 백본(Backbone)으로 사용할 수 있는 벡터는 본 발명의 상기 USP25 단백질을 생산할 수 있는 한 특별히 제한되지는 않으나, 예를 들면, 플라스미드 DNA, 파아지 DNA, 상업적으로 개발된 플라스미드(pGEM ® T 벡터, pET22b, pUC18, pBAD, pIDTSAMRT-AMP 등), 대장균 유래 플라스미드(pYG601BR322, pGEX-4T-1, pET, pBR325, pUC118, pUC119 등), 바실러스 서브틸리스 유래 플라스미드(pUB110, pTP5 등), 효모-유래 플라스미드(YEp13, YEp24, YCp50 등), 파아지 DNA(Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP 등), 동물 바이러스 벡터(레트로바이러스(Retrovirus), 아데노바이러스(Adenovirus), 아데노부속바이러스(Adeno-associated virus), 백시니아 바이러스(Vaccinia virus), 곤충 바이러스 벡터, 큘로바이러스(Baculovirus) 등 일 수 있으나, 이에 제한되는 것은 아니다.
[42]
[43]
본 발명의 일 구체예에서 상기 약학 조성물은 USP25 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
[44]
본 발명의 상기 형질전환은 DNA를 숙주 세포로 도입하여 DNA가 염색체 외의 인자로서 또는 염색체와 통합하여 완성됨으로써 복제 가능하게 되는 것을 지칭하는 것일 수 있다.
[45]
본 발명의 상기 숙주 세포는 본 발명의 상기 발현 벡터에 포함된 폴리뉴클레오티드에 의해 단백질을 생산할 수 있는 것이라면 모두 포함될 수 있고, 예를 들면, BL21 또는 DH5α 등의 대장균( E. coli), 스트렙토마이세스, 살모넬라 티피뮤리움 등의 박테리아 세포, 사카로마이세스 세레비지애, 스키조사카로마이세스 폼베 등의 효모 세포, 피치아 파스토리스 등의 균류 세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포, CHO 세포, COS 세포, NSO 세포, 293 세포, 보우 멜라노마 세포, 줄기 세포 등의 동물 세포, 또는 식물 세포를 이용할 수 있으며, 바람직하게는 중간엽 줄기 세포일 수 있고, 더욱 바람직하게는 골수 유래 중간엽 줄기 세포일 수 있으나, 이에 제한되는 것은 아니다.
[46]
[47]
본 발명의 또 다른 구현 예에서는 골 또는 연골 질환의 예방 또는 치료용 약학 조성물을 제공한다.
[48]
본 발명의 상기 약학 조성물은 USP25 단백질; 이를 암호화하는 폴리뉴클레오티드; 상기 폴리뉴클레오티드를 포함하는 발현 벡터; 또는 상기 발현 벡터에 의해 형질전환된 형질전환체를 유효성분으로 포함할 수 있다.
[49]
본 발명의 상기 골 또는 연골 질환의 예방 또는 치료용 약학 조성물에서, USP25 단백질, 조직 재생, 폴리뉴클레오티드, 발현 벡터, 형질전환체 등에 관한 내용은 본 명세서의 상기 조직 재생용 약학 조성물에 기재된 바와 중복되어 과도한 기재를 피하기 위하여, 이하에서는 그 기재를 생략한다.
[50]
본 발명의 상기 골 또는 연골 질환은 골 또는 연골의 손상으로 인해 발생될 수 있는 질환으로, 예를 들면, 관절염; 골다공증; 골연골증; 골연골염; 불완전 골형성증; 골수염; 골증식체; 연골형성부전증; 연골염; 연골종; 연골육종; 추간판 탈출증; 클리펠-파일 증후군; 변형성 골염; 낭성 섬유뼈염; 및 사고, 골절, 상처, 관절 손상, 자가면역질환, 당뇨병 또는 암으로 인한 골 또는 연골 질환으로 이루어진 군에서 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
[51]
본 발명의 상기 예방은 본 발명의 상기 약학 조성물을 이용하여 골 또는 연골손상으로 인해 발생될 수 있는 골 또는 연골 질환을 차단하거나, 이에 의해 발생될 수 있는 증상을 억제 또는 지연시키는 모든 행위라면 제한없이 포함될 수 있다.
[52]
본 발명의 상기 치료는 본 발명의 상기 약학 조성물을 이용하여 골 또는 연골손상으로 인해 발생될 수 있는 골 또는 연골 질환의 증상을 호전시키거나, 이롭게 되도록 유도하는 행위라면 제한없이 모두 포함될 수 있다.
[53]
본 발명의 상기 구현 예의 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
[54]
본 발명의 상기 약학 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사 용액의 형태로 제형화되어 사용될 수 있다. 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등이 사용될 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등이 혼합되어 사용될 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등이 사용될 수 있다. 본 발명의 약학 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(Elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.
[55]
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항 응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
[56]
본 발명의 상기 약학 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
[57]
본 발명의 상기 비경구는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다.
[58]
본 발명의 상기 약학 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.
[59]
[60]
본 발명의 또 다른 구현 예에서는 USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공한다.
[61]
본 발명의 상기 "개체"란, 골 또는 연골질환의 예방 또는 치료가 필요한 개체로서, 영장류 예를 들면 인간뿐만 아니라, 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
[62]
본 발명의 상기 "투여"란, 임의의 적절한 방법으로 개체에게 본 발명의 유효성분을 도입하는 과정을 의미하는 것으로서, 본 발명의 상기 치료 방법에서 투여 방법은 경구 또는 비경구 등의 다양한 경로를 통해 투여될 수 있다.
[63]
본 발명의 상기 치료 방법에서, 상기 USP25 단백질, 폴리뉴클레오티드, 골 또는 연골 질환, 예방, 치료 등과 관련된 내용은 앞서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
[64]
[65]
본 발명의 또 다른 구현 예에서는 USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는 골 또는 연골 질환의 예방 또는 치료 방법을 제공한다.
[66]
본 발명의 상기 치료 방법에서, 상기 USP25 단백질, 폴리뉴클레오티드, 골 또는 연골 질환, 예방, 치료, 개체, 투여 등과 관련된 내용은 앞서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위하여 생략한다.

발명의 효과

[67]
본 발명의 USP25 단백질이 유효성분으로 포함된 조성물을 사용하는 경우, 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기 세포가 골 조직 세포, 특히 연골 세포로 분화될 수 있도록 매우 효과적으로 유도할 수 있다. 또한, 이렇게 연골 세포로 분화될 수 있도록 유도함으로써 연골 조직이 손상되어 발생될 수 있는 다양한 질환의 예방 또는 치료에 매우 유용하게 적용될 수 있다.

도면의 간단한 설명

[68]
도 1a 및 1b는 본 발명의 일 실시예에 따른 알시안 블루 염색(Alcian blue saining)을 이용한 연골 분화능 억제 효과를 확인한 결과를 나타낸 것이다.
[69]
도 2는 본 발명의 일 실시예에 따른 사프라닌 오 염색(Safranin O staining) 및 알시안 블루 염색을 이용한 연골 분화능 억제 효과를 확인한 결과를 나타낸 것이다.
[70]
도 3은 본 발명의 일 실시예에 따른 면역조직화학(Immunohistochemistry; IHC)을 이용한 연골 분화능 억제 효과 확인한 결과를 나타낸 것이다.
[71]
도 4는 본 발명의 일 실시예에 따른 사프라닌 오 염색 및 알시안 블루 염색을 이용한 연골 분화 효과를 확인한 결과를 나타낸 것이다.
[72]
도 5는 본 발명의 일 실시예에 따른 면역조직화학을 이용한 연골 분화 효과 확인한 결과를 나타낸 것이다.
[73]
도 6은 본 발명의 일 실시예에 따른 사프라닌 오 염색 및 알시안 블루 염색을 이용한 탈 유비퀴틴화 효소간의 연골 분화 효과를 비교한 결과를 나타낸 것이다.
[74]
도 7은 본 발명의 일 실시예에 따른 Sox9(SRY-Box 9) 단백질의 유비퀴틴화 정도를 면역침전법을 이용하여 확인한 결과를 나타낸 것이다.

발명의 실시를 위한 최선의 형태

[75]
본 발명의 일 구현 예에서는 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 조직 재생용; 및 골 또는 연골 질환의 예방 또는 치료용 약학 조성물을 제공한다.

발명의 실시를 위한 형태

[76]
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
[77]
[78]
실시예
[79]
[80]
[ 준비예 1] 인간 골수 유래 중간엽 줄기 세포(hBMSCs)의 배양
[81]
아래의 실험은 모두 IRB(Institutional Review Board)의 승인(승인 번호: IRB no. 4-2017-0232) 하에 진행되었다. 6명의 성인 기증자의 후장골릉(posterior iliac crest)에서 골수 천자액(BM aspirates)을 수득하였다. 상기 골수 천자액으로부터 플라스틱 세포배양 플라스크에 흡착되는 능력을 기준으로 인간 골수 유래 중간엽 줄기세포(hBMSCs)를 선별하였다. 배양 배지(10% FBS(Gibco, Grand Island, NY, USA) 및 1% 항생제-항진균제 용액(Gibco)이 포함된 DMEM-LG(low-glucose Dulbecco's modified Eagle's medium; Gibco))에서 상기 선별된 hBMSCs를 배양하였다. 여기서, 통상의 방법에 따른 유세포 분석에 의해 CD90 및 CD105가 양성이면서, CD34 및 CD45가 음성인 것을 통해 hBMSCs의 특성이 확인된 세포만을 아래의 실험에서 사용하였다.
[82]
[83]
[ 실시예 1] USP25 ( Ubiquitin carboxyl-terminal hydrolase 25) 녹다운에 의한 연골 분화능 억제 효과 확인
[84]
[1-1] USP25가 녹다운된 hBMSCs 제작
[85]
렌티바이러스 벡터(pLKO.1-Puro Lentiviral Vector; Yonsei Genome Center, 한국)의 TRC2 위치에 USP25의 염기 서열의 일부에 상보적인 서열번호 1 및 2의 염기 서열을 삽입하여, pLKO.1-puro-shUSP25-1(TRCN0000004366, Yonsei Genome Center, 한국) 및 pLKO.1-puro-shUSP25-2 (TRCN0000004367, Yonsei Genome Center, 한국)를 제작하였다. 여기서, 대조군의 경우, 상기 서열번호 1 및 2 대신에, 비-타겟 shRNA 염기 서열이 삽입된 대조군 벡터(shScramble, SHC016, pLKO.1-puro (Yonsei Genome Center)를 사용하였다.
[86]
바이러스 패키징 믹스(Sigma-Aldrich, 미국) 및 리포펙타민 LTX PLUS (Invitrogen, 미국)을 이용하여 상기 렌티바이러스 벡터를 Lenti-X-293FT(Clontech, 미국) 세포에 제조사에서 제공된 프로토콜에 따라 형질전환한 뒤, 상기 형질전환된 세포를 배양하고 상기 세포의 배양액으로부터 바이러스를 수득하였다. 그런 다음, 상기 제조예의 hBMSCs에 상기 수득된 바이러스를 24시간 동안 배양하였다. 이후, 상기 바이러스가 포함된 배양 배지를 제거하고, 10 ㎍/㎖의 퓨로마이신(puromycine) 항생제가 포함된 새로운 배양 배지에서 24시간 이상 배양하는 과정을 통해, 항생제에 저항성이 있는 세포만을 선택함으로써 shUSP25-1에 의해 녹다운된 hBMSCs(이하, 'hBMSCs_shUSP25-1'이라 함.), shUSP25-2에 의해 녹다운된 hBMSCs(이하, 'hBMSCs_shUSP25-2'이라 함.)와, 대조군 hBMSCs를 제작하였다.
[87]
[88]
[표1]
이름 번호 염기서열
shUSP25-1 서열번호 1 5′- GCACTTCTCCTGTTGACGATA -3′
shUSP25-2 서열번호 2 5′- GCTGTAGAAGATATGAGAAAT -3′

[89]
[90]
[1-2] 알시안 블루 염색을 이용한 연골 분화능 억제 효과 확인
[91]
마이크로메스(Micromass) 배양을 위하여, 상기 [1-1]에서 제작한 1 × 10 5 (10㎕)개의 hBMSCs_shUSP25-1, hBMSCs_shUSP25-2 및 대조군 세포 펠렛을 24-웰 플레이트에 조심스럽게 배치하고, 37℃에서 2시간 동안 부착될 수 있도록 하였다. 그런 다음, 연골 분화 배지(1× 인슐린-트랜스페린-셀레늄-A [Gibco], 1% 항생제-항진균제 용액, 50 ㎍/mL 아스코르브산 및 10 ng/mL 형질전환성장인자-β3 [TGF-β3; R&D Systems]이 포함된 DMEM-HG (High-glucose Dulbecco's modified Eagle's medium; Gibco)에서 21일 동안 배양하고, 상기 세포의 마이크로메스 펠렛을 24시간 동안 10% 포말린에 고정시켰다. 고정 후, 상기 포말린-고정 표본을 파라핀에 임베디드(embedded)시켰다. 상기 파라핀-임베디드 절편을 탈파라핀화(deparaffinized) 한 뒤, 재수화(rehydrated)하고 PBS를 이용하여 두 번 세척하였다. 그런 다음, 상기 절편을 4 ㎛의 두께로 슬라이스하고, 글리코사미노글리칸을 검출하기 위하여 사프라닌 오(Safranin O)/패스트 그린으로 염색을 실시하였다. 상기 염색한 샘플을 VS120 가상 현미경 (올림푸스, 일본)을 사용하여 염색 정도를 확인하고, 그 결과를 도 1에 나타내었다.
[92]
도 1에서 보는 바와 같이, 연골 특이적 기질 중 산성 점액다당류(Acid mucosubstance and acid mucin)가 파란색으로 염색되는 알시안블루의 염색 정도를 분석하였을 때, 대조군(shMock)의 염색 정도는 비교적 촘촘하게 되어 있는 반면, hBMSCs_shUSP25-1(shUSP25-1) 및 hBMSCs_shUSP25-2(shUSP25-2)에서는 파란색으로 염색된 부분이 엉성해진 것을 확인하였다. 또한, 대조군의 경우 광학 밀도가 1.0에 해당하는 반면, hBMSCs_shUSP25-1(shUSP25-1) 및 hBMSCs_shUSP25-2(shUSP25-2)의 연골 세포로의 광학 밀도는 각각 약 0.1 및 0.3으로, 대조군에 비하여 현저하게 감소된 것을 확인되었다.
[93]
상기 결과를 통해, 본 발명에 따른 USP25는 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 유도할 수 있음을 알 수 있다.
[94]
[95]
[1-3] 사프라닌 오 및 알시안 블루 염색을 이용한 연골 분화능 억제 효과 확인
[96]
상기 [1-1]의 세포를 연골로 분화시킬 때, 마이크로매스 배양법을 이용하였다. 트립신화된 hBMSC를 10% FBS가 함유된 DMEM-LG에서 1×10 8 cells/mL 농도로 재부유시키고, 이 중 10 μL 만을 24-웰 플레이트(1×10 6 cells/웰)의 각각의 웰에 찍어(dotting)주었다. 37℃에서 상기 세포들이 두 시간 동안 흡착될 수 있도록 한 뒤, 연골 분화 배지에서 21일 동안 배양하였다.
[97]
그런 다음, 알시안블루 염색과, 사프라닌-오 염색을 이용하여 연골 세포로의 분화 여부를 분석하여, 그 결과를 도 2에 나타내었다. 여기서, 상기 알시안 블루는 상기 마이크로매스를 포름알데히드에 고정시키고, 파라핀화 한 뒤 크실렌을 이용하여 탈 파라핀화하고 에탄올로 재수화하는 과정을 제외하고는 상기 [1-2]와 동일하게 수행하였다.
[98]
도 2에서 보는 바와 같이, 대조군에 비하여, hBMSCs_shUSP25-1, hBMSCs_shUSP25-2에서 붉은색으로 염색되는 연골 특이적 기질 중에서 프로테오글리칸(Proteoglycan)이 현저하게 감소되었고, 파란색으로 염색되는 점액다당류가 현저하게 감소되는 것을 확인하였다.
[99]
상기 결과를 통해 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로 분화를 유도하고, 기질을 형성하는 역할을 하는 것을 알 수 있다.
[100]
[101]
[1-4] 면역조직화학( Immunohistochemistry ; IHC)을 이용한 연골 분화능 억제 효과 확인
[102]
상기 [1-3]에서와 같이 마이크로매스 배양법을 이용하여 배양된 hBMSCs_shUSP25-1 및 hBMSCs_shUSP25-2에서 2형 콜라겐 및 아그리칸(Aggrecan) 단백질이 존재하는 수준을 면역조직화학염색을 통해 확인하여, 그 결과를 도 3에 나타내었다.
[103]
도 3에서 보는 바와 같이, 대조군에서 기질 단백질에 해당하는 2형 콜라겐과, 아그리칸 단백질이 존재하는 수준과 비교하여, hBMSCs_shUSP25-1 및 hBMSCs_shUSP25-2에서 현저하게 감소된 것을 확인하였다.
[104]
상기 결과를 통해, 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로의 분화가 되도록 유도할 수 있을 뿐만 아니라, 연골 특이적인 기질 단백질의 발현이 증가될 수 있도록 하는 것을 알 수 있다.
[105]
[106]
[실시예 2] USP25 과발현에 의한 연골 분화능 효과 확인
[107]
[2-1] USP25의 과발현 세포 제작
[108]
USP25 단백질을 암호화하는 서열번호 3의 염기 서열을 포함하고 있는 렌티바이러스 벡터(human CMV pLenti-GIII-CMV-GFP-2A-Puro-Lentiviral Vector; cat. No. LV353539, Abm, 미국)를 구입하였다. 여기서, 대조군의 경우, USP25 단백질을 암호화하는 염기 서열이 삽입되지 않은 벡터 (human CMV pLenti-CMV-GFP-2A-Puro- blank Lentiviral Vector; cat. No. LV590, Abm, 미국)를 구입하여 사용하였다. 그런 다음, 상기 벡터를 상기 [1-1]과 동일한 방법으로 hBMSCs에 형질전환하여 USP25 단백질이 과발현된 hBMSCs 및, 대조군 세포를 제작하였다.
[109]
[110]
[2-2] 사프라닌 오 및 알시안 블루 염색을 이용한 연골 분화능 효과 확인
[111]
상기 [2-1]의 USP25 단백질이 과발현된 hBMSCs 및 대조군 세포를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-3]에서와 동일한 방법으로 사프라닌 오 및 알시안 블루 염색을 수행하여, 그 결과를 도 4에 나타내었다.
[112]
도 4에서 보는 바와 같이, 대조군 세포에 비하여, USP25가 과발현된 hBMSCs에서 사프라닌 오 및 알시안 블루가 염색된 범위가 현저하게 증가됨을 통해 연골 특이적인 기질인 프로테오글리칸과 산성 점액다당류가 증가된 것을 확인하였다.
[113]
상기 결과를 통해, 본 발명에 따른 USP25 단백질은 골수 유래 중간엽 줄기세포가 연골로 분화되는 것을 매우 효과적으로 유도할 수 있음을 알 수 있다.
[114]
[115]
[2-3] 면역조직화학을 이용한 연골 분화능 효과 확인
[116]
상기 [2-1]의 USP25 단백질이 과발현된 hBMSCs 및 대조군 세포를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-4]에서와 동일한 방법으로 2형 콜라겐 및 아그리칸(Aggrecan) 단백질이 존재하는 수준을 면역조직화학염색을 통해 확인하여, 그 결과를 도 5에 나타내었다.
[117]
도 5에서 보는 바와 같이, 대조군에서 기질 단백질에 해당하는 2형 콜라겐과, 아그리칸 단백질이 존재하는 수준과 비교하여, USP25 단백질이 과발현된 hBMSCs에서 현저하게 증가된 것을 확인하였다.
[118]
상기 결과를 통해, 본 발명에 따른 USP25 단백질이 골수 유래 중간엽 줄기세포가 연골 세포로의 분화가 되도록 유도할 수 있을 뿐만 아니라, 연골 특이적인 기질 단백질의 발현이 증가될 수 있도록 하는 것을 알 수 있다.
[119]
[120]
[실시예 3] USP25 단백질과 다른 탈 유비퀴틴화 효소의 연골 분화능 비교
[121]
연골 분화능이 탈 유비퀴틴화 기능을 갖는 효소 중에서 특히 USP25 단백질에 특이적인 것인지 확인하였다.
[122]
USP25 단백질을 제외의 다른 탈 유비퀴틴화 효소(USP 1, 2, 4, 5, 7, 8, 9X, 10, 14, 15, 16, 19, 20, 22, 24, 28, 47 및 48)의 기능을 억제하는 DUB 억제제인 10μL의 PR-619(cat no. A13190, AdooQ)를 hBMSCs에 처리하고, 6시간 동안 배양하였다. 그런 다음, 상기 PR-619가 처리된 hBMSCs와 상기 [1-1]에서 제작된 shUSP25-1에 의해 녹다운된 hBMSCs를 마이크로매스 배양법을 이용하여 21일 동안 배양하고, 상기 [1-3]에서와 동일한 방법으로 사프라닌 오 및 알시안 블루 염색을 수행하여, 그 결과를 도 6에 나타내었다. 여기서, 대조군(Cont)에는 shRNA가 삽입된 벡터가 형질전환되지 않고, PR-619가 처리되지 않도록 하였다.
[123]
도 6에서 보는 바와 같이, USP25 단백질이 아닌 다른 효소의 기능을 억제하는 PR-619가 처리된 경우에는 hBMSCs에서 사프라닌 오 및 알시안 블루가 염색된 범위가 감소되지 않은 반면, USP25 단백질이 억제된 경우에는 사프라닌 오 및 알시안 블루가 염색된 범위가 현저하게 감소된 것을 확인하였다.
[124]
상기 결과를 통해, 본 발명에 따른 USP25 단백질은 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 하는 현저한 효과가 존재함을 알 수 있다.
[125]
[126]
[실시예 4] USP25에 의한 연골 분화와 관련된 단백질의 탈 유비퀴틴화 확인
[127]
상기 [2-1]의 USP25가 과발현된 hBMSCs와, 대조군 세포를 21일 동안 배양하였다. 여기서, 세포를 수득하기 6시간 이전에 단백질 분해 억제제인 MG132를 처리하였다. 그런 다음, 상기 세포들을 수득하여 용해 완충액(Lysis buffer)에 넣어 세포를 완전히 용해시켰다. 그런 다음, 상기 세포 용해물에 존재하는 단백질을 정량화 한 뒤, 1 mg의 단백질 시료에 MYC에 특이적인 항체를 첨가하고 4℃에서 12시간 반응시켰다. 이후, 단백질 비드를 첨가한 후, 4℃에서 4시간 동안 추가로 반응시킨 뒤, 상기 반응물을 침전시키고, 추출 완충액으로 3회 세척한 후, SDS 완충액을 첨가하여 반응을 중단시켰다. 이렇게 얻은 샘플을 SDS-PAGE에 전기영동 시키고, 겔에 포함된 단백질을 PVDF 막에 옮긴 뒤에 Sox9(SRY-Box 9) 단백질에 특이적인 항체를 이용하여 웨스턴 블롯 분석을 수행하여, 그 결과를 도 7에 나타내었다.
[128]
도 7에서 보는 바와 같이, 대조군(GFP-USP25 - 컬럼)에서 Sox9 단백질에 유비퀴틴화가 일어나 있는 반면, USP25 단백질이 과발현 되어 있는 경우(GFP-USP25 + 컬럼)에는 Sox9 단백질의 유비퀴틴화 정도가 현저하게 감소되어 있었다.
[129]
상기 결과를 통해, 본 발명에 따른 USP25는 연골의 분화에 있어서 매우 중요한 기능을 하는 전사 인자인 Sox9 단백질을 세포 내에서 유비퀴틴화에 의해 분해되지 않도록 억제함으로써, 골수 유래 중간엽 줄기세포가 연골로 분화될 수 있도록 매우 효과적으로 유도하는 것을 알 수 있다.
[130]
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

산업상 이용가능성

[131]
본 발명은 조직 재생용 약학 조성물에 관한 것으로, 구체적으로 USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 조직 재생용 약학 조성물에 관한 것으로, 상기 조성물을 사용하는 경우, 다른 탈 유비퀴틴화 효소에 비하여 골수 유래 중간엽 줄기 세포가 골 조직 세포, 특히 연골 세포로 분화될 수 있도록 매우 효과적으로 유도할 수 있다. 또한, 이렇게 연골 세포로 분화될 수 있도록 유도함으로써 연골 조직이 손상되어 발생될 수 있는 다양한 질환의 예방 또는 치료에 매우 유용하게 적용될 수 있다.
[132]
<110> Industry-Academic Cooperation Foundation, Yonsei University
[133]
<120> A Pharmaceutical composition comprising the USP25 protein or a
[134]
polynucleotide encoding the same as an active ingredient
[135]
<130> POPB194264PCT
[136]
<150> KR 10-2018-0152187
[137]
<151> 2018-11-30
[138]
<160> 4
[139]
<170> KoPatentIn 3.0
[140]
[141]
<210> 1
[142]
<211> 21
[143]
<212> DNA
[144]
<213> Artificial Sequence
[145]
<220>
[146]
<223> USP25 target shRNA artificial sequence
[147]
<400> 1
[148]
gcacttctcc tgttgacgat a 21
[149]
[150]
<210> 2
[151]
<211> 21
[152]
<212> DNA
[153]
<213> Artificial Sequence
[154]
<220>
[155]
<223> USP25 target shRNA artificial sequence
[156]
<400> 2
[157]
gctgtagaag atatgagaaa t 21
[158]
[159]
<210> 3
[160]
<211> 450
[161]
<212> PRT
[162]
<213> Homo sapiens
[163]
<400> 3
[164]
Met Thr Val Glu Gln Asn Val Leu Gln Gln Ser Ala Ala Gln Lys His
[165]
1 5 10 15
[166]
Gln Gln Thr Phe Leu Asn Gln Leu Arg Glu Ile Thr Gly Ile Asn Asp
[167]
20 25 30
[168]
Thr Gln Ile Leu Gln Gln Ala Leu Lys Asp Ser Asn Gly Asn Leu Glu
[169]
35 40 45
[170]
Leu Ala Val Ala Phe Leu Thr Ala Lys Asn Ala Lys Thr Pro Gln Gln
[171]
50 55 60
[172]
Glu Glu Thr Thr Tyr Tyr Gln Thr Ala Leu Pro Gly Asn Asp Arg Tyr
[173]
65 70 75 80
[174]
Ile Ser Val Gly Ser Gln Ala Asp Thr Asn Val Ile Asp Leu Thr Gly
[175]
85 90 95
[176]
Asp Asp Lys Asp Asp Leu Gln Arg Ala Ile Ala Leu Ser Leu Ala Glu
[177]
100 105 110
[178]
Ser Asn Arg Ala Phe Arg Glu Thr Gly Ile Thr Asp Glu Glu Gln Ala
[179]
115 120 125
[180]
Ile Ser Arg Val Leu Glu Ala Ser Ile Ala Glu Asn Lys Ala Cys Leu
[181]
130 135 140
[182]
Lys Arg Thr Pro Thr Glu Val Trp Arg Asp Ser Arg Asn Pro Tyr Asp
[183]
145 150 155 160
[184]
Arg Lys Arg Gln Asp Lys Ala Pro Val Gly Leu Lys Asn Val Gly Asn
[185]
165 170 175
[186]
Thr Cys Trp Phe Ser Ala Val Ile Gln Ser Leu Phe Asn Leu Leu Glu
[187]
180 185 190
[188]
Phe Arg Arg Leu Val Leu Asn Tyr Lys Pro Pro Ser Asn Ala Gln Asp
[189]
195 200 205
[190]
Leu Pro Arg Asn Gln Lys Glu His Arg Asn Leu Pro Phe Met Arg Glu
[191]
210 215 220
[192]
Leu Arg Tyr Leu Phe Ala Leu Leu Val Gly Thr Lys Arg Lys Tyr Val
[193]
225 230 235 240
[194]
Asp Pro Ser Arg Ala Val Glu Ile Leu Lys Asp Ala Phe Lys Ser Asn
[195]
245 250 255
[196]
Asp Ser Gln Gln Glu Trp His Gln Asp Tyr Arg Lys Phe Arg Glu Thr
[197]
260 265 270
[198]
Thr Met Tyr Leu Ile Ile Gly Leu Glu Asn Phe Gln Arg Glu Ser Tyr
[199]
275 280 285
[200]
Ile Asp Ser Leu Leu Phe Leu Ile Cys Ala Tyr Gln Asn Asn Lys Glu
[201]
290 295 300
[202]
Leu Leu Ser Lys Gly Leu Tyr Arg Gly His Asp Glu Glu Leu Ile Ser
[203]
305 310 315 320
[204]
His Tyr Arg Arg Glu Cys Leu Leu Lys Leu Asn Glu Gln Ala Ala Glu
[205]
325 330 335
[206]
Leu Phe Glu Ser Gly Glu Asp Arg Glu Val Asn Asn Gly Leu Ile Ile
[207]
340 345 350
[208]
Met Asn Glu Phe Ile Val Pro Phe Leu Pro Leu Leu Leu Val Asp Glu
[209]
355 360 365
[210]
Met Glu Glu Lys Asp Ile Leu Ala Val Glu Asp Met Arg Asn Arg Trp
[211]
370 375 380
[212]
Cys Ser Tyr Leu Gly Gln Glu Met Glu Pro His Leu Gln Glu Lys Leu
[213]
385 390 395 400
[214]
Thr Asp Phe Leu Pro Lys Leu Leu Asp Cys Ser Met Glu Ile Lys Ser
[215]
405 410 415
[216]
Phe His Glu Pro Pro Lys Leu Pro Ser Tyr Ser Thr His Glu Leu Cys
[217]
420 425 430
[218]
Glu Arg Phe Ala Arg Ile Met Leu Ser Leu Ser Arg Thr Pro Ala Asp
[219]
435 440 445
[220]
Gly Arg
[221]
450
[222]
[223]
<210> 4
[224]
<211> 3168
[225]
<212> DNA
[226]
<213> Homo sapiens
[227]
<400> 4
[228]
atgaccgtgg agcagaacgt gctgcagcag agcgcggcgc agaagcacca gcagacgttt 60
[229]
ttgaatcaac tgagagaaat tacggggatt aatgacaccc agatactaca gcaagccttg 120
[230]
aaggatagta atggaaactt ggaattagca gtggctttcc ttactgcgaa gaatgctaag 180
[231]
acccctcagc aggaggagac aacttactac caaacagcac ttcctggcaa tgatagatac 240
[232]
atcagtgtgg gaagccaagc agatacaaat gtgattgatc tcactggaga tgataaagat 300
[233]
gatcttcaga gagcaattgc cttgagtttg gccgaatcaa acagggcatt cagggagact 360
[234]
ggaataactg atgaggaaca agccattagc agagttcttg aagccagcat agcagagaat 420
[235]
aaagcatgtt tgaagaggac acctacagaa gtttggaggg attctcgaaa cccttatgat 480
[236]
agaaaaagac aggacaaagc tcccgttggg ctaaagaatg ttggcaatac ttgttggttt 540
[237]
agtgctgtta ttcagtcatt atttaatctt ttggaattta gaagattagt tctgaattac 600
[238]
aagcctccat caaatgctca agatttaccc cgaaaccaaa aggaacatcg gaatttgcct 660
[239]
tttatgcgtg agctgaggta tctatttgca cttcttgttg gtaccaaaag gaagtatgtt 720
[240]
gatccatcaa gagcagttga aattcttaag gatgctttca aatcaaatga ctcacagcag 780
[241]
caagatgtga gtgagtttac acacaaatta ttagattggt tagaagatgc cttccaaatg 840
[242]
aaagctgaag aggagacgga tgaagagaag ccaaagaacc ccatggtaga gttgttctat 900
[243]
ggcagattcc tggctgtggg agtacttgaa ggtaaaaaat ttgaaaacac tgaaatgttt 960
[244]
ggtcagtacc cacttcaggt caatgggttc aaagatctgc atgagtgcct agaagctgca 1020
[245]
atgattgaag gagaaattga gtctttacat tcagagaatt caggaaaatc aggccaagag 1080
[246]
cattggttta ctgaattacc acctgtgtta acatttgaat tgtcaagatt tgaatttaat 1140
[247]
caggcattgg gaagaccaga aaaaattcac aacaaattag aatttcccca agttttatat 1200
[248]
ttggacagat acatgcacag aaacagagaa ataacaagaa ttaagaggga agagatcaag 1260
[249]
agactgaaag attacctcac ggtattacaa caaaggctag aaagatattt aagctatggt 1320
[250]
tccggtccca aacgattccc cttggtagat gttcttcagt atgcattgga atttgcctca 1380
[251]
agtaaacctg tttgcacttc tcctgttgac gatattgacg ctagttcccc acctagtggt 1440
[252]
tccataccat cacagacatt accaagcaca acagaacaac agggagccct atcttcagaa 1500
[253]
ctgccaagca catcaccttc atcagttgct gccatttcat cgagatcagt aatacacaaa 1560
[254]
ccatttactc agtcccggat acctccagat ttgcccatgc atccggcacc aaggcacata 1620
[255]
acggaggaag aactttctgt gctggaaagt tgtttacatc gctggaggac agaaatagaa 1680
[256]
aatgacacca gagatttgca ggaaagcata tccagaatcc atcgaacaat tgaattaatg 1740
[257]
tactctgaca aatctatgat acaagttcct tatcgattac atgccgtttt agttcacgaa 1800
[258]
ggccaagcta atgctgggca ctactgggca tatatttttg atcatcgtga aagcagatgg 1860
[259]
atgaagtaca atgatattgc tgtgacaaaa tcatcatggg aagagctagt gagggactct 1920
[260]
tttggtggtt atagaaatgc cagtgcatac tgtttaatgt acataaatga taaggcacag 1980
[261]
ttcctaatac aagaggagtt taataaagaa actgggcagc cccttgttgg tatagaaaca 2040
[262]
ttaccaccgg atttgagaga ttttgttgag gaagacaacc aacgatttga aaaagaacta 2100
[263]
gaagaatggg atgcacaact tgcccagaaa gctttgcagg aaaagctttt agcgtctcag 2160
[264]
aaattgagag agtcagagac ttctgtgaca acagcacaag cagcaggaga cccagaatat 2220
[265]
ctagagcagc catcaagaag tgatttctca aagcacttga aagaagaaac tattcaaata 2280
[266]
attaccaagg catcacatga gcatgaagat aaaagtcctg aaacagtttt gcagtcggca 2340
[267]
attaagttgg aatatgcaag gttggttaag ttggcccaag aagacacccc accagaaacc 2400
[268]
gattatcgtt tacatcatgt agtggtctac tttatccaga accaggcacc aaagaaaatt 2460
[269]
attgagaaaa cattactaga acaatttgga gatagaaatt tgagttttga tgaaaggtgt 2520
[270]
cacaacataa tgaaagttgc tcaagccaaa ctggaaatga taaaacctga agaagtaaac 2580
[271]
ttggaggaat atgaggagtg gcatcaggat tataggaaat tcagggaaac aactatgtat 2640
[272]
ctcataattg ggctagaaaa ttttcaaaga gaaagttata tagattcctt gctgttcctc 2700
[273]
atctgtgctt atcagaataa caaagaactc ttgtctaaag gcttatacag aggacatgat 2760
[274]
gaagaattga tatcacatta tagaagagaa tgtttgctaa aattaaatga gcaagccgca 2820
[275]
gaactcttcg aatctggaga ggatcgagaa gtaaacaatg gtttgattat catgaatgag 2880
[276]
tttattgtcc catttttgcc attattactg gtggatgaaa tggaagaaaa ggatatacta 2940
[277]
gctgtagaag atatgagaaa tcgatggtgt tcctaccttg gtcaagaaat ggaaccacac 3000
[278]
ctccaagaaa agctgacaga ttttttgcca aaactgcttg attgttctat ggagattaaa 3060
[279]
agtttccatg agccaccgaa gttaccttca tattccacgc atgaactctg tgagcgattt 3120
[280]
gcccgaatca tgttgtccct cagtcgaact cctgctgatg gaagataa 3168

청구범위

[청구항 1]
USP25(Ubiquitin carboxyl-terminal hydrolase 25) 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
[청구항 2]
제 1항에 있어서, 상기 USP25 단백질은 Sox5(SRY-Box 5), Sox6(SRY-Box 6) 및 Sox9(SRY-Box 9)으로 구성된 군으로부터 선택되는 적어도 하나의 단백질을 탈 유비퀴틴화 시키는 것인, 조직 재생용 약학 조성물.
[청구항 3]
제 1항에 있어서, 상기 조직은 골 조직 또는 연골 조직인 것인, 조직 재생용 약학 조성물.
[청구항 4]
제 3항에 있어서, 상기 연골 조직은 유리질 연골(Hyaline cartilage), 탄성 연골(Elastic cartilage) 및 섬유 연골(Fibrocartilage)로 구성된 군으로부터 선택되는 적어도 하나인 것인, 조직 재생용 약학 조성물.
[청구항 5]
제 3항에 있어서, 상기 골 조직은 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것인, 조직 재생용 약학 조성물.
[청구항 6]
USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
[청구항 7]
USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는, 조직 재생용 약학 조성물.
[청구항 8]
USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 9]
제 8항에 있어서, 상기 USP25 단백질은 Sox5, Sox6 및 Sox9으로 구성된 군으로부터 선택되는 적어도 하나의 단백질을 탈 유비퀴틴화 시키는 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 10]
제 8항에 있어서, 상기 연골은 유리질 연골, 탄성 연골 및 섬유 연골로 구성된 군으로부터 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 11]
제 8항에 있어서, 상기 골은 늑골, 두개골, 장골, 상완골, 척추뼈, 골반뼈 및 어깨뼈로 구성된 군으로부터 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 12]
제 8항에 있어서, 상기 골 또는 연골 질환은 관절염; 골다공증; 골연골증; 골연골염; 불완전 골형성증; 골수염; 골증식체; 연골형성부전증; 연골염; 연골종; 연골육종; 추간판 탈출증; 클리펠-파일 증후군; 변형성 골염; 낭성 섬유뼈염; 및 사고, 골절, 상처, 관절 손상, 자가면역질환, 당뇨병 또는 암으로 인한 골 또는 연골 질환으로 이루어진 군에서 선택되는 적어도 하나인 것인, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 13]
USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 14]
USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터가 형질전환된 형질전환체를 유효성분으로 포함하는, 골 또는 연골 질환의 예방 또는 치료용 약학 조성물.
[청구항 15]
USP25 단백질 또는 이를 암호화하는 폴리뉴클레오티드를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 골 또는 연골 질환의 예방 또는 치료 방법.
[청구항 16]
USP25 단백질을 암호화하는 폴리뉴클레오티드가 포함된 발현 벡터; 또는 상기 발현 벡터가 형질전환된 형질전환체를 약학적으로 유효량으로 개체에 투여하는 단계를 포함하는, 골 또는 연골 질환의 예방 또는 치료 방법.

도면

[도1a]

[도1b]

[도2]

[도3]

[도4]

[도5]

[도6]

[도7]