PATENTSCOPE will be unavailable a few hours for maintenance reason on Tuesday 19.11.2019 at 4:00 PM CET
Search International and National Patent Collections
Some content of this application is unavailable at the moment.
If this situation persists, please contact us atFeedback&Contact
1. (WO2010071934) MODULATION OF PLATELET ACTIVATION
Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

MODULATION OF PLATELET ACTIVATION

FILING DATA

This application is associated with and claims priority from Australian Provisional Patent Application No. 2008906560, filed on 22 December, 2008, entitled "Modulation of platelet activation", the entire contents of which, are incorporated herein by reference.

FIELD

The present invention relates to methods for modulating and detecting platelet activation and for detecting infections. In particular, the present invention relates to methods for modulating and detecting platelet activation involving staphylococcal superantigen-like proteins (SSLs), to methods for detecting staphylococcal infections, to agents used for such modulation and detection, and to associated kits.

BACKGROUND

Staphylococcus aureus (S. aureus) is one of the most common and most pathogenic microorganism in humans. It can cause a range of diseases from minor skin and soft tissue infections to osteomyelitis, endocarditis, toxic shock syndrome and life-threatening septicaemia. It is found in the community and in hospitals, and is one of the most common bacteria isolated in blood cultures. The ability of S. aureus to develop multiple drug resistances, initially in hospitals and later in the community, is one of the major challenges in regard to infections in our health care system.

As part of its pathophysiological role in diseases, S. aureus can interact directly with platelets using a variety of surface-associated proteins, such as clumping factor A (CIfA), fibronectin-binding protein A (FnBPA), staphylococcal protein A (SpA), the serine aspartate repeat protein SdrE, serine-rich adhesin for platelets (SraP), and α-toxin. While CIfA binds to fibrinogen, establishing a bridge to the GPIb/Ia platelet receptor complex, FnBPA interacts with GPIIb/IIIa through either fibronectin or fibrinogen. On the other hand, SpA binds to von Willebrand factor (vWF), which functions as a bridge to platelet GPIb. These direct interactions between S. aureus and platelets result in bacteria-platelet aggregates, which are the main characteristic of S. aureus endocarditis. A serious complication of 5. aureus infections is disseminated intravascular coagulation (DIC).

Accordingly, there is a need for better treatment and prevention of diseases associated with S. aureus. In particular, there is a need for a better understanding in the mechanisms involved in S. aureus infection, including, for example, the interaction between S. aureus and platelets. Such understanding would provide the basis for developing better treatment and prevention strategies for a range of diseases including, but not limited to, endocarditis and disseminated intravascular coagulation.

Staphylococcus aureus also secretes potent toxins, such as the Staphylococcal superantigen-like proteins (SSLs) that are structurally homologous to the superantigens

(SAgs), but which do not seem to exhibit the same functions. SSLs are a group of related genes (sharing 36-67% homology) that are clustered on a genomic island, as determined by sequencing of the genomes of several different S. aureus strains. This pathogenicity island is thought to contain between 7 and 1 1 SSL genes, and it is present in all strains of S. aureus examined to date. SSLs are designated SSLl to SSLl 1 in clockwise order from the replication origin of the chromosome based on homology to the full complement of genes found in strain MW2.

Reports on the functional roles of SSL proteins have recently emerged and have defined potential functions for SSL5, SSL7 and SSLI l . SSL7 is thought to bind IgA and complement C5, thereby inhibiting the ability of IgA to bind to its receptor and blocking complement-mediated killing of bacterial cells. Both SSL5 and SSLI l bind P-selectin glycoprotein ligand-1 (PSGL-I ) on granulocytes and cell surface receptors for human IgA

(FcαRI) in a sialic acid-dependent manner, thereby inhibiting P-selectin mediated neutrophil rolling and the subsequent migration of neutrophils to sites of infection.

SSL5 is comprised of a typical two-domain SAg fold, with the N-terminal domain forming a β -barrel structure and the C-terminal domain forming a β-grasp fold in which a central helix is cradled by a five-stranded mixed β-sheet. An N-terminal helix sits between the two domains. Co-crystallization of SSL5 with sialyl Lewis X (sLex), a key determinant of PSGL-I binding to P-selectin, has been shown, thereby demonstrating that sLex binds to a specific site on the surface of the C-terminal domain of SSL5. This involves a key interaction with Thrl 75 at the centre of the Sia binding site, as the point mutation T175P, designed to abolish the hydrogen bonds between the Thrl75 NH and O groups to the Sia carboxyl group, has been found to inhibit the binding of SSL5 to granulocytes without disrupting the SSL5 conformation.

The crystal structure of SSLl 1 in complex with sLex also confirms that sLex is a ligand for SSLI l . Although low sequence homology exists across the SSL gene family, the sLex binding site is totally conserved in both SSL5 and SSLl 1. Furthermore, multiple sequence alignments show that seven of the eight key sLex binding residues in SSL5 and SSLl 1 are identical in SSL2, SSL3, SSL4 and SSL6, suggesting that sLex is also a ligand for these four SSL members. A structural glycomic array performed with SSLI l reveals a binding specificity for glycans containing the trisaccharide sialyllactosamines (sLacNac -Neu5Acα2-3Galβl -4-GlcNAc), such as sLex. This is consistent with the binding of SSL5 and SSLl 1 to PSGL-I , a ligand terminated by sLe'\ It is also consistent with the potential for some SSLs to bind certain platelet receptors such as GPIbα, whose glycan chains bear a sLacNac terminus.

SUMMARY

In accordance with the present invention, SSL5 is shown to strongly activate platelets by binding to glycoproteins (including GPIbα, GPVI), causing platelet aggregation and thrombus formation in vivo. It is also shown that SSL5 binds to trisaccharide sialyllactosamines (sLacNacs) and platelets carrying glycans containing the sLacNac terminus are receptors for SSL5. Moreover, the inventors have developed novel agents for inhibiting platelet activation by inhibiting binding of SSL5 to platelets. Such agents include monoclonal antibodies. Such agents are therefore useful not only in modulating and detecting platelet activation involving staphylococcal superantigen-like proteins (SSLs), but also for diagnosing diseases involving staphylococcal infections and/or platelet activation. These significant findings therefore describe a novel and important pathomechanistic role of SSL proteins in human diseases caused by S. aureus, and accordingly provide for methods for modulating and detecting platelet activation involving staphylococcal superantigen-like proteins (SSLs), as well as agents used for such modulation and detection, and associated kits.

Accordingly, one aspect of the present invention contemplates a method for inhibiting platelet activation in a subject, said method comprising administering to said subject an agent which inhibits binding of a staphylococcal superantigen-like protein (SSL) to a molecule expressed on the surface of a platelet, thereby inhibiting platelet activation.

Another aspect provides an agent for inhibiting platelet activation, wherein said agent inhibits binding of a staphylococcal superantigen-like protein (SSL) to a molecule expressed on the surface of a platelet, thereby inhibiting platelet activation.

The agent may be selected from the group consisting of:

(a) an agent that binds to a staphylococcal superantigen-like protein (SSL), thereby inhibiting binding of the SSL to the molecule expressed on the surface of the platelet;

(b) an agent that binds to a molecule expressed on the surface of a platelet, thereby competing with a SSL in binding to the molecule expressed on the surface of a platelet;

(c) an agent that down-regulates the amount of a SSL available to bind to a molecule expressed on the surface of a platelet; or

(d) an agent that down-regulates the ability of a SSL to bind to a molecule expressed on the surface of a platelet.

The agent may be selected from the group comprising sialyl Lewis X or a mimetic thereof, sLacNac or a mimetic thereof, an anti-SSL antibody, an anti-platelet glycoprotein antibody, a regulator of SSL transcription or translation, or a soluble or solubilised receptor for an SSL, or any precursor, modulator or combination thereof.

The sLacNac mimetic may be selected from the group comprising a monosaccharide sialyllactosamine (sLacNac) mimetic, a disaccharide sialyllactosamine (sLacNac) mimetic, or a trisaccharide sialyllactosamine (sLacNac) mimetic. The sLacNac mimetic may be selected from the group comprising CGP77175A and CGP69669A as well as a compound selected from Formulae 1 through 64.

The sialyl Lewis X mimetic may be selected from the group comprising a monosaccharide sialyl Lewis X (sLX) mimetic, a disaccharide sLX mimetic, a trisaccharide sLX mimetic or a tetrasaccharide sLX mimetic.

The anti-SSL antibody may be the monoclonal antibody designated herein 5E3 (See Example 2).

The SSL may be selected from the group comprising SSL2, SSL3, SSL4, SSL5, SSL6 and SSLl 1. The SSL may be SSL5.

The molecule expressed on the surface of the platelet may be a glycoprotein. The glycoprotein may be selected from the group comprising GPIbα and GPVI.

In a further aspect, there is provided an agent for inhibiting platelet activation, wherein said agent inhibits binding of a staphylococcal superantigen-like protein (SSL) to a platelet glycoprotein, thereby inhibiting platelet activation.

The agent may be selected from the group consisting of:

(a) an agent that binds to a staphylococcal superantigen-like protein (SSL), thereby inhibiting binding of the SSL to a platelet glycoprotein;

(b) an agent that binds to a platelet glycoprotein, thereby competing with a SSL in binding to a platelet glycoprotein;

(c) an agent that down-regulates the amount of a SSL available to bind to a platelet glycoprotein; or (d) an agent that down-regulates the ability of a SSL to bind to a platelet glycoprotein.

The agent may be selected from the group comprising sialyl Lewis X or a mimetic thereof, sLacNac or a mimetic thereof including a compound selected from Formulae 1 through 64, an anti-SSL antibody, an anti-platelet glycoprotein antibody, a regulator of SSL transcription or translation, or any precursor, modulator or combination thereof. Furthermore, a soluble or solubilized form of an SSL receptor or a mimic or homolog thereof may also be employed. In a particular embodiment, the agent is a soluble SSL5 receptor such as GPIbalpha, GPIIb, GPIV or PSGL-I .

The sLacNac mimetic may be selected from the group comprising a monosaccharide sialyllactosamine (sLacNac) mimetic, a disaccharide sialyllactosamine (sLacNac) mimetic, or a trisaccharide sialyllactosamine (sLacNac) mimetic. The sLacNac mimetic may be selected from the group comprising CGP77175A and CGP69669A including a compound selected from Formulae 1 through 64.

The sialyl Lewis X mimetic may be selected from the group comprising a monosaccharide sialyl Lewis X (sLX) mimetic, a disaccharide sLX mimetic, a trisaccharide sLX mimetic or a tetrasaccharide sLX mimetic.

The anti-SSL antibody may be the monoclonal antibody designated 5E3.

The SSL may be selected from the group comprising SSL2, SSL3, SSL4, SSL5, SSL6 and SSLl 1. The SSL may be SSL5.

The platelet glycoprotein may be selected from the group comprising GPIbα and GPVI.

In another aspect, there is provided a polynucleotide encoding the agent which inhibits platelet activation. Still another aspect, there is provided a host cell transformed or transfected with the vector comprising the polynucleotide. In yet another aspect, there is provided an expression product of the host cell comprising the vector.

A further aspect, provides a pharmaceutical composition comprising the agent herein, the polynucleotide encoding same, the vector comprising the polynucleotide, the host cell transformed with the vector, the expression product of the polynucleotide, or a combination thereof, and a pharmaceutically acceptable carrier, excipient or diluent.

In another aspect, there is provided a method for inhibiting platelet activation in a subject, wherein said method comprises administering to the subject an agent as herein described, the polynucleotide encoding same, the vector comprising the polynucleotide, the host cell transformed with the vector, the expression product of the polynucleotide or pharmaceutical composition comprising the agent thereby inhibiting platelet activation.

Still yet another aspect provides a method for inhibiting formation of a thrombis involving platelet activation in a subject, said method comprising administering to said subject an agent which inhibits binding of a staphylococcal superantigen-like protein (SSL) to a platelet glycoprotein, thereby inhibiting platelet activation.

Even yet another aspect contemplates a method for treating or preventing a disease involving platelet activation in a subject, wherein said method comprises administering to the subject the agent wherein the agent is selected from the group consisting of (a) an agent that binds to a staphylococcal superantigen-like protein (SSL), thereby inhibiting binding of the SSL to a platelet glycoprotein;

(b) an agent that binds to a platelet glycoprotein, thereby competing with a SSL in binding to a platelet glycoprotein;

(c) an agent that down-regulates the amount of a SSL available to bind to a platelet glycoprotein; or (d) an agent that down-regulates the ability of a SSL to bind to a platelet glycoprotein thereby inhibiting platelet activation and preventing the disease.

The diseases may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia, septicaemia, sepsis, disseminated intravascular coagulopathy (DIC) and infection by Staphylococcus aureus. The latter can result in abnormal bleeding from the digestive tract, the respiratory tract and surgical wounds and can also result in small clots affecting blood flow to organs.

The venous thrombosis may be selected from the group comprising deep vein thrombosis, portal vein thrombosis, renal vein thrombosis, jugular vein thrombosis, Budd-Chiari syndrome, Paget-Schroetter disease and cerebral venous sinus thrombosis.

The arterial thrombosis may be selected from stroke and myocardial infarction.

The embolisation may be selected from pyemia, a septic embolus and septicaemia.

In another aspect, there is provided a method for

(a) diagnosing platelet activation in a subject; (b) diagnosing formation of a thrombus involving platelet activation in a subject; or

(c) diagnosing a disease involving platelet activation in a subject wherein said method comprises:

(d) administering to the subject; or (e) contacting ex vivo a biological sample of the subject with an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma or lymph.

The disease involving platelet activation may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia, septicaemia, sepsis and a Staphylococcus aureus infection.

The anti-SSL antibody may be the monoclonal antibody designated 5E3.

In a further aspect, there is provided a kit for:

(a) inhibiting platelet activation in a subject;

(b) inhibiting formation of a thrombus involving platelet activation in a subject; or

(c) treating or preventing a disease involving platelet activation in a subject wherein said kit comprises the agent, the polynucleotide, the vector, the host cell, the expression product or the pharmaceutical composition all as herein described, wherein administration to the subject of said agent, polynucleotide, vector, host cell, expression product or pharmaceutical composition inhibits platelet activation.

In another aspect, there is provided a kit for:

(a) diagnosing platelet activation in a subject;

(b) diagnosing formation of a thrombus involving platelet activation in a subject; or

(c) diagnosing a disease involving platelet activation in a subject wherein said kit comprises an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The kit may be used by assaying a biological sample of the subject with the anti-SSL antibody. The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma, lymph, urine, abscess, cerebral, pericardial and pleuritic fluid.

The disease involving platelet activation may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia, septicaemia, sepsis and a Staphylococcus aureus infection.

The anti-SSL antibody may be the monoclonal antibody designated herein 5E3.

Also provided is a method for:

(a) inhibiting platelet activation in a subject;

(b) inhibiting formation of a thrombus involving platelet activation in a subject; or (c) treating or preventing a disease involving platelet activation in a subject wherein said method comprises administering to the subject an agent that inhibits binding of Staphylococcal superantigen-like protein-5 (SSL5) to a platelet glycoprotein.

The agent may be an anti-SSL5 monoclonal antibody.

The disease may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia, sepsis, septicaemia and infection by Staphylococcus aureus.

Further provided is a method for diagnosing a Staphylococcus aureus infection in a subject, wherein said method comprises:

(a) administering to the subject; or

(b) contacting ex vivo a biological sample of the subject with an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma, lymph, urine, abscess, cerebral, pericardial and pleuritic fluid.

The anti-SSL antibody may be the monoclonal antibody designated 5E3.

In yet another aspect, there is provided a kit for diagnosing a Staphylococcus aureus infection in a subject, wherein the kit comprises an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The kit may be used by assaying a biological sample of the subject with the anti-SSL antibody. The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma, lymph, urine, abscess, cerebral, pericardial and pleuritic fluid.

The anti-SSL antibody may be the monoclonal antibody designated herein as 5E3.

An SSL may also be used as diagnostic agent to capture antibodies to an SSL in a subject's body fluid. This is particularly useful for SSL5. Such a diagnostic agent issued inter alia to determine acute and chronic infection or to determine historical exposure to Staphylococcus aureus.

Accordingly, another aspect of the present invention provides for the use of an SSL in the manufacture of a diagnostic agent to detect anti-SSL antibodies in a subject.

Definitions

The term "inhibit", as well as variations such as "inhibits" or "inhibiting", as used herein, especially in relation to platelet activation, includes complete inhibition as well as any portion or degree of partial inhibition, and includes any prevention, reduction, decrease, down-regulation or abrogation.

The terms "polypeptide", "peptide" and "protein" are used interchangeably and refer to a polymer made up of amino acids linked together by peptide bonds.

The term "conservative amino acid substitution" refers to a substitution or replacement of one amino acid for another amino acid with similar properties within a polypeptide chain (primary sequence of a protein). For example, the substitution of the charged amino acid glutamic acid (GIu) for the similarly charged amino acid aspartic acid (Asp) would be a conservative amino acid substitution.

The terms "polynucleotide", "nucleic acid" and "oligonucleotide" are used interchangeably and refer to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, or analogues, derivatives, or combinations thereof. The terms include reference to specified sequences as well as to sequences complementary thereto, unless otherwise indicated. It will be understood that "5' end" as used herein in relation to a nucleic acid molecule corresponds to the N-terminus of the encoded polypeptide and "3' end" corresponds to the C-terminus of the encoded polypeptide.

The term "analogue" when used in relation to a polynucleotide or residue thereof, means a compound having a physical structure that is related to a DNA or RNA molecule or residue, and preferably is capable of forming a hydrogen bond with a DNA or RNA residue or an analogue thereof (i.e., it is able to anneal with a DNA or RNA residue or an analogue thereof to form a base-pair). Such analogues may possess different chemical and biological properties to the ribonucleotide or deoxyribonucleotide residue to which they are structurally related. Methylated, iodinated, brominated or biotinylated residues are examples of analogues.

The term "analogue" as used herein with reference to a polypeptide means a polypeptide which is a derivative of the polypeptide of the invention, which derivative comprises addition, deletion or substitution of one or more amino acids, such that the polypeptide retains substantially the same function.

The term "derivative" when used in relation to a polynucleotide of the present invention includes any functionally-equivalent nucleic acids, including any fusion molecules produced integrally (e.g., by recombinant means) or added post-synthesis (e.g., by chemical means). Such fusions may comprise one or both strands of the double-stranded oligonucleotide of the invention with RNA or DNA added thereto or conjugated to a polypeptide (e.g., puromycin or other polypeptide), a small molecule (e.g., psoralen) or an antibody.

The term "fragment" when used in relation to a polypeptide or polynucleotide molecule refers to a constituent of a polypeptide or polynucleotide. Typically the fragment possesses qualitative biological activity in common with the polypeptide or polynucleotide. The peptide fragment may be between about 5 to about 300 amino acids in length, between about 5 to about 250 amino acids in length, between about 5 to about 200 amino acids in length, between about 5 to about 150 amino acids in length, between about 5 to about 100 amino acids in length, between about 5 to about 50 amino acids in length, or between about 5 to about 25 amino acids in length. Alternatively, the peptide fragment may be between about 5 to about 15 amino acids in length. However, fragments of a polynucleotide do not necessarily need to encode polypeptides which retain biological activity. Rather, a fragment may, for example, be useful as a hybridization probe or PCR oligonucleotide. The fragment may be derived from a polynucleotide of the invention or alternatively may be synthesized by some other means, for example chemical synthesis.

The term "variant" as used herein refers to substantially similar sequences. Generally, polypeptide or polynucleotide sequence variants possess qualitative biological activity in common. Further, these polypeptide or polynucleotide sequence variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity which includes 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 and 100% identity. Also included within the meaning of the term "variant" are homologues of polypeptides or polynucleotides of the invention. A homologue is typically a polypeptide or polynucleotide from a different species but sharing substantially the same biological function or activity as the corresponding polypeptide or polynucleotide disclosed herein.

The term "isolate" as used herein as it pertains to methods of isolating molecules means recovering a molecule from a cell culture medium substantially free of cellular material, although the molecule need not be free of all components of the media. For example a secreted polypeptide may be recovered in the extracellular media, such as the supernatant, and still be "isolated".

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g. in cell biology, chemistry, molecular biology and cell culture). Standard techniques used for molecular and biochemical methods can be found in Sambrook et al, Molecular Cloning: A

Laboratory Manual, 3rd ed. (2001) Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, N. Y. and Ausubel et al, Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc. - and the full version entitled Current Protocols in Molecular Biology).

Reference to "bimosiamose" includes compounds and derivatives disclosed is International Patent Publication No. WO97/01335 (PCT/US96/ 1 1032), the contents of which are incorporated herein by reference in its entirety.

Disseminated intravascular coagulation (DIC), also known as consumptive coagulopathy, is a pathological activation of coagulation (blood clotting) mechanisms that happens in response to a variety of diseases. It leads to the formation of small blood clots inside the blood vessels throughout the body. As the small clots consume all the available coagulation proteins and platelets, normal coagulation is disrupted and abnormal bleeding occurs from the skin (e.g. from sites where blood samples were taken), the digestive tract, the respiratory tract and surgical wounds. The small clots also disrupt normal blood flow to organs (such as the kidneys), which may malfunction as a result.

Sepsis is a medical condition that is characterized by a whole-body inflammatory state (called a systemic inflammatory response syndrome or SIRS) and the presence of a known or suspected infection. The body may develop this inflammatory response to microbes in the blood, urine, lungs, skin, or other tissues.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Throughout this specification, reference to numerical values, unless stated otherwise, is to be taken as meaning "about" that numerical value. The term "about" is used to indicate that a value includes the inherent variation of error for the device and the method being employed to determine the value, or the variation that exists among the study subjects.

The reference to any prior art in this specification is not, and should not be taken as an acknowledgement or any form of suggestion that prior art forms part of the common general knowledge anywhere in the world.

BRIEF DESCRIPTION OF THE FIGURES

The present invention will now be described, by way of example only, with reference to the following figures.

Figure 1: SDS-PAGE and Western blot of target protein SSL5-His: The molecular weight of SSL5-His is 26.9kD, and the purity is more than 95%.

Figure 2: A) Binding of SSL5 to human platelets: Flow cytometry was used to analyse SSL5 binding to platelets. Platelets (8χ 106/ml) were incubated with a concentration range of SSL5-His (0.5-10μg/ml) for 15 minutes at 370C in waterbath. The binding of SSL5-His was detected by Alexa Fluor 488 -conjugated anti-Penta»His mAb. The picture is the representative of at least three independent experiments; B) Analysis of SSL5 and CD 162 interaction: Immunoprecipitation assay (IP) with recombinant His-SSL5 proteins. Purified His-SSL5 proteins incubated with HL60 lysates was co-immunoprecipitataed by an anti-CD 162 mouse mAb and subjected to immunoblotting probed with an HRP conjugated anti-His antibodies (Top panel). The filter was re-probed with anti-CD 162 mAb to show the CD 162 was present in the IP (bottom panel). As negative controls the SSL5 incubated HL60 lysates were immunoprecipitated with anti-IgG2 mouse mAb and Purified His-SSL5 proteins were immunoprecipitataed with anti-CD 162 mouse mAb.

Figure 3: A) Reducing of PE-conjugated SZ2 (blocking monoclonal antibody against human CD42b) binding to human platelets by SSL5 in a dose dependant manner: Human platelets (8>< 106/ml) were incubated with a concentration range of SSL5 (0.3 - 10 μg/ml) for 15 minutes at 370C in water bath. Then the platelets were treated with 1 μg/ml PE-conjugated SZ2, FITC-conjugated anti-CD41 (P2) mAb, FITC-conjugated anti-CD61(SZ21) mAb, 1 μg/ml isotype control FITC or PE-conjugated mouse IgGl . Mean fluorescence after subtraction the isotype control of each was adapted to calculate the relative binding. The picture is the representative of at least three independent experiments; B) Experiment as described in panel A using AT instead of SSL5; C) Inhibition effects of SSL5 on anti-CD42b mAbs binding to human platelets: Human platelets (8χ 106/ml) were incubated with a concentration range of SSL5 (0.3-10 μg/ml) for 15 minutes at 370C. Then the platelets were treated with lOμg/ml anti-CD42b SZ2, AK2, WM23, or BXl . Bound antibodies were detected with FITC-conjugated goat anti-mouse IgG. Data represent relative binding compared with untreated (without SSL5) platelets; D) Filled histogram: secondary anti-His-tag antibody alone, thick line: 10 μg/ml SSL5 T175P mutant, thin line: lOμg/ml SSL5; E) Filled histogram: secondary anti-His-tag antibody alone, thick line: 10 μg/ml SSL5 + neuraminidase, thin line: lOμg/ml SSL5.

Figure 4: SSL5 activates human platelets directly and induces their aggregation in plasma in a dose-dependent manner: Human gel filtered platelets (8χ l06/ml) in modified Tyrode's buffer were incubated with 1 -10 μg/ml SSL5; A) The expression of P-selectin on platelets were detected by PE-conjugated anti-CD62P mAb, using mouse PE-conjugated IgGl as isotype control; B) The expression of PAC-I on platelets were assayed by FITC-conjugated anti-PAC-1 mAb, using mouse FITC-conjugated IgGl as isotype control; C) Representative aggregation trace obtained upon incubation of PBS (lag time 7min), 5 μg/ml SSL5 (lag time 2.5min), lOμg/ml SSL5 (lag time 1.5min), or 20μg/ml SSL5 (lag time lmin) in PRP. Lag time to platelet aggregation by SSL5 was shorten as SSL5 concentration increased. The picture is the representative of three independent experiments.

Figure 5: SSL5 induces the adhesion of platelets on fibrinogen under static conditions: Human gel filtered platelets (2.5χ lO7/ml) were incubated with 1 -10 μg/ml SSL5 at 370C for 30min on fibrinogen coated coverslips (30μg/ml fibrinogen in PBS, overnight at 40C). AT lOμg/ml as negative control, ADP 20μM as positive control; A) The adhered platelets on the coverslips were counted under F-View II digital camera (DIC model, χ60). The data represent are mean values ± SEM of four independent experiments; B) Representative pictures were obtained by DIC (χ60) under F-View II digital camera. ** PO.01 ; *** PO.001.

Figure 6: SSL5 induces thrombi formation in the lung of mice: Mice were injected intravenously with 4mg/kg SSL5 or MB9 (as control). Before injection, a mixture with

20μg/ml infrared-800 conjugated human fibrinogen was made for tracing the thrombi, and monitored for 60 minutes; A, B) Representative section of lungs from a SSL5-injected mouse, show extensive thrombi in the large and middle vessels. B 40 x, C 100χ.

Figure 7: Inhibitory effects of 5E3 monoclonal antibody on SSL5-induced platelet activation. Platelet-rich plasma was incubated with: A) P-Selectin alone; B) SSL5 (lOμg/ml) + P-Selectin; C) SSL5 (lOμg/ml) + P-Selectin + 5E3 (l μg/ml); D) SSL5

(lOμg/ml) + P-Selectin + 5E3 (5μg/ml); E) SSL5 (lOμg/ml) + P-Selectin + 5E3 (lOμg/ml).

Figure 8: Mean number of thrombi per lung lobe counted in the three groups of mice subjected to the mouse pulmonary thrombi formation model, showing the in vivo inhibitory effects of the 5E3 monoclonal antibody on SSL5-induced platelet activation.

Figure 9: Role of GPVI as an SSL5 platelet receptor. A) P-Selectin alone; B) P-Selectin + ADP (20μM); C) GPVI recombinant protein (lOμg/ml) + P-Selectin; D) SSL5 (lOμg/ml) + P-Selectin; E) GPVI recombinant protein (lOμg/ml) + SSL5 (lOμg/ml) + P-Selectin.

Figure 10: Repeat experiment confirming GPVI as an SSL5 platelet receptor. A) Histogram of mean fluorescence of P-Selectin alone, P-Selectin + SSL5 (0.7μM) and P-Selectin + SSL5 (0.7μM) + 5μl of lmg/ml GPVI recombinant protein; B) Histogram of median fluorescence of P-Selectin alone, P-Selectin + SSL5 (0.7μM) and P-Selectin + SSL5 (0.7μM) + 5μl of 1 mg/ml GPVI recombinant protein.

Figure 11 : Inhibition of SSL5-induced platelet activation by glycans. A) SSL5 (0.7μM) activates platelets by 72% of the level activated by the ADP (20μM) positive control; B) Inhibitory effects of sLex on SSL5-induced platelet activation; C) Inhibitory effects of sLacNac on SSL5-induced platelet activation; D) Inhibitory effects of sialic acid glycoside on SSL5-induced platelet activation.

Figure 12: Dose response curves showing the inhibition of SSL5-induced platelet activation by sLex and sLacNac. A) Inhibition of SSL5 (0.7μM) by sLex using mean fluorescence; B) Inhibition of SSL5 (0.7μM) by sLex using median fluorescence; C) Inhibition of SSL5 (0.7μM) by sLacNac using mean fluorescence; A) Inhibition of SSL5 (0.7μM) by sLacNac using median fluorescence.

Figure 13: SSL5 Elisa using the 5E3 Ab: A range of concentrations of recombinant His-SSL5 spiked plasma was captured using 5E3 antibody, detected using HRP-labelled anti-His.Tag antibody and colourmetric TMB-based assay performed. A SSL5 associated increase in absorbance was measured demonstrating 5E3 antibody is capable of capturing SSL5 from plasma and measured in a concentration dependent manner. Data shown as mean ±S.E.M of duplicate samples from three different plasma donors.

Figure 14: Bimosiamose inhibition of SSL5-induced GPIIb/IIIa activation. Flow cytometry was used to assess the activation status of platelet GPIIb/IIIa by increasing concentrations of bimosiamose with or without SSL5. A decrease in GPIIb/IIIa activation was observed with increasing amounts of Bimosiamose. There was no activation of

GPIIb/IIIa at corresponding concentrations of bimosiamose alone. Bar graphs represent the geometric mean ±S.E.M. Bimosiamose and derivatives thereof are disclosed in International Patent Publication No. WO 97/01335 (PCT.US96/1 1032).

DETAILED DESCRIPTION

Before describing the present invention in detail, it is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of components, manufacturing methods, dosage or diagnostic regimes, or the like. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

The singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a staphylococcal superantigen-like protein (SSL)" includes a single SSL protein as well as two or more different SSL proteins; reference to "an antibody" includes a single antibody, as well as two or more antibodies; reference to "the invention" includes a single invention or multiple invention; and so forth.

The inventors have demonstrated that SSL5 strongly activates platelets by binding to glycoproteins (including GPIbα and GPVI), causing platelet aggregation and thrombus formation in vivo. The inventors have also demonstrated that SSL5 binds to sialyl Lewis X and to trisaccharide sialyllactosamines (sLacNacs) in general, that sialyl Lewis X and platelets with glycans containing the sLacNac terminus are receptors for SSL5. Further, the inventors have developed novel agents for inhibiting platelet activation by inhibiting binding of SSL5 to platelets. Such agents include monoclonal antibodies. Such agents are therefore useful not only in modulating and detecting platelet activation involving Staphylococcal superantigen-like proteins (SSLs), but also for diagnosing diseases involving Staphylococcal infections and/or platelet activation. These significant findings therefore describe a novel and important pathomechanistic role of SSL proteins in human diseases caused by S. aureus, and accordingly provide for methods for modulating platelet activation involving Staphylococcal superantigen-like proteins (SSLs), as well as agents used for such modulation and associated kits. The SSLs may also be used to capture antibodies to the SSL. For example, SSL5 can be used to pain a subject's serum or body fluid for SSL5 antibodies, the level of which can indicate acute or chronic infection or historical exposure to Staphylococcus aureus.

In particular, the inventors have shown that SSL5, a toxin secreted by S. aureus, binds to both human and mouse platelets in a dose-dependent manner (Figure 4) and activates these platelets in vitro, as evident by the increased expressions of P-selectin (Figure 4a) and PAC-I (Figure 4b) on human platelets, and P-selectin and JON/A on mouse platelets. Additionally, SSL5 was found to induce the aggregation of platelets in PRP. This indicates that SSL5 can activate platelets independent of S. aureus and may play an important role in S. aureus-m' duced platelet aggregation.

Experiments were undertaken to identify SSLI l receptors on platelets using an array. In this array, SSl 1, a highly homologous protein to SSL5, was tested for binding against 285 glycans using a microarray format provided by the Consortium for Functional Glycomics (San Diego). A binding specificity of SSLI l for glycans containing the trisaccharide sialyllactosamine terminus (sLacNac - Neu5Acα2-3Galβl -4GIcNAc) was identified. SSL5 was also found to bind sLex in a similar fashion to the interaction between SSLI l and sLex, and with a high conservation of the key binding residues, and accordingly, SSL5 is likely to have a binding specificity for glycans terminated by sLacNac. Therefore, platelet glycoproteins with glycans containing the sLacNac terminus are putative receptors for SSL5.

GPIbα was the platelet glycoprotein prioritized for assessment as a putative receptor for SSL5. In addition to bearing glycans terminated by the sLacNac terminus, GPIbα is structurally and functionally similar to PSGL-I , a known SSL5 ligand. Both are elongated, membrane-associated sialomucins containing large clusters of O-linked sugar chains. In this study, the binding of anti-GPIbα mAbs to platelets was confirmed by immunoprecipitation and competitively inhibited by SSL5. The binding of anti-GPIbα mAbs to different sites on GPIbα is consistent with an interaction between SSL5 and the sLacNac glycan terminus rather than a specific site on the platelet surface. This correlates with the inhibited binding of SSL5 to platelets by either the T175P point mutation on SSL5 or the exposure of platelets to neuraminidase to cleave terminal sialic acid residues from glycoproteins, both of which also inhibited the SSL5-sLex interaction. The data from the glycomics array of SSL5 (Table 1) confirmed that the principal ligand for SSL5 is sLacNac, a subcomponent of sLex (position 6, Table 1). The sLacNac glycan terminus was also found to be the principal ligand for SSLI l, and eight of the ten strongest SSLI l binding glycans were found to bind SSL5. PSGL-I was also observed as an SSL5 ligand (position 4, Table 1).

A further platelet glycoprotein (GPVI) as identified as SSL5 receptors through experiments involving a selection of several monoclonal antibodies that recognize a variety of platelet receptors. The binding of GPVI was also found to be competitively inhibited by SSL5. As a collagen receptor, GPVI, which contains an O-linked carbohydrate-rich stalk like region (analogous to the carbohydrate-rich region of GPIbα, is essential for normal platelet-collagen interactions.

The present inventors also found that SSL5 induces thrombi formation in vivo using a mouse model. An hour after injecting 4μg of SSL5/gram of body weight into the tail vein of mice, nearly 60% of SSL5-injected mice formed thrombi in their lungs. However, no thrombus was observed in the lungs of the MB9 control group. This indicates that S aureus may induce vascular thrombosis by secreting SSL5, which may play a greater role in S. aureus infection-induced thrombi formation than the binding of S. aureus to platelets. In addition, the results of this in vivo experiment suggest that platelet activation by S. aureus and the secretion of SSL5 play a key role in necrosis formation in necrotizing pneumonia, a disease, characterized by leukopenia, hemoptysis and extensive necrosis of lung tissue. Another possible complication associated with SSL5-induced thrombi is diabetic foot, as S. aureus is by far the most common and most virulent pathogen in this condition.

The activation of platelets by SSL5 to induce platelet activation and thrombus formation is a novel mechanism implicating S. aureus infection with coagulation and inflammation. Therefore, SSL5 is a potential target in the treatment of S. aureus infections and for reducing their complications. A therapeutic strategy therefore includes the introduction of a sLacNac mimetic drug. The specific binding of such a drug to SSL5 with high affinity has the potential to inhibit the interaction between SSL5 and platelets, thereby preventing platelet activation and the consequent formation of thrombi. Furthermore, it may simultaneously inhibit the binding of SSL5 to PSGL-I and maintain typical neutrophil rolling. Examples of sLacNac mimetics with potential therapeutic benefits are CGP77175A (as disclosed in AIi et al The FASEB Journal 18: 152-154, 2004) and CGP69669A (as disclosed in Norman et al. Blood P/.475-483, 1998) as well as a compound selected from Formulae 1 though 64, which mimic sLex to disrupt E-selectin rolling in vivo, thereby representing good anti-inflammatory drug targets. sLacNac mimetics may also be employed including Bimosiamose.

Agents for inhibiting platelet activation

The present invention provides agents for inhibiting platelet activation, wherein the agent inhibits binding of a Staphylococcal superantigen-like protein (SSL) to a molecule expressed on the surface of a platelet, thereby inhibiting platelet activation.

The agent may bind to a Staphylococcal superantigen-like protein (SSL), thereby inhibiting binding of the SSL to the molecule expressed on the surface of the platelet. The agent may bind to a molecule expressed on the surface of a platelet, thereby competing with a SSL in binding to the molecule expressed on the surface of a platelet. The agent may down-regulate the amount of a SSL available to bind to a molecule expressed on the surface of a platelet. The agent may down-regulate the ability of a SSL to bind to a molecule expressed on the surface of a platelet.

In some embodiments, the agent may be selected from the group comprising sialyl Lewis X or a mimetic thereof, sLacNac or a mimetic thereof, an anti-SSL antibody, an antiplatelet glycoprotein antibody, a regulator of SSL transcription or translation, or any precursor, modulator or combination thereof. The sLacNac mimetic may be selected from the group comprising a monosaccharide sialyllactosamine (sLacNac) mimetic, a disaccharide sialyllactosamine (sLacNac) mimetic, or a trisaccharide sialyllactosamine (sLacNac) mimetic. The sLacNac mimetic may be selected from the group comprising CGP77175A and CGP69669A as well as Bimosiamose and a compound selected from Formulae 1 through 64. The sialyl Lewis X mimetic may be selected from the group comprising a monosaccharide sialyl Lewis X (sLX) mimetic, a disaccharide sLX mimetic, a trisaccharide sLX mimetic or a tetrasaccharide sLX mimetic.

In some embodiments, the agent comprises an anti-SSL antibody such as the monoclonal antibody designated herein 5E3. The 5E3 monoclonal antibody is a 15OkDa IgG antibody that is secreted from a mouse hybridoma cell line that was produced by fusing immune spleen cells from SSL5-immunized mice with myeloma cells. A series of cloning rounds was performed to identify a monoclonal population of antibody producing cells, confirmed by ELISA screening. The antibody was purified using a Sepharose-Protein G column.

Furthermore a soluble form of an SSL receptor or a mimic or homolog thereof may also be employed such as a soluble or solubilised receptor for SSL5. In a particular embodiment, the soluble form of SSL5 receptor is GPIbalpha, GPIIb, GPIV or PSGL- 1.

In some embodiments, the SSL may be selected from the group comprising SSL2, SSL3, SSL4, SSL5, SSL6 and SSLl 1. In preferred embodiments, the SSL may be SSL5.

In some embodiments, the molecule expressed on the surface of the platelet may be a glycoprotein. In preferred embodiments, the glycoprotein may be selected from the group comprising GPIbα and GPVI.

The present invention therefore also provides agents for inhibiting platelet activation, wherein the agent inhibits binding of a Staphylococcal superantigen-like protein (SSL) to a platelet glycoprotein, thereby inhibiting platelet activation.

In some embodiments, the agent may therefore bind to a Staphylococcal superantigen-like protein (SSL), thereby inhibiting binding of the SSL to a platelet glycoprotein. The agent may bind to a platelet glycoprotein, thereby competing with a SSL in binding to a platelet glycoprotein. The agent may down-regulate the amount of a SSL available to bind to a platelet glycoprotein. The agent may down-regulate the ability of a SSL to bind to a platelet glycoprotein.

sLacNacs are a subcomponent of sialyl Lewis X (sLex). Crystal structures of the sialyl Lewis X ligand bound to SSL-5 and SSL-1 1 provide insight into the features of the ligand-receptor interaction that contribute to the binding. Analysis of the protein surface that is covered by the sialyl Lewis X ligand indicates that the sialic acid moiety makes a dominant contribution, with the galactose and N-acetylglucose making approximately equal contributions, and with the fucose moity making the least contribution. The sialic acid makes extensive hydrogen bond interactions. In addition, there are hydrophobic binding interactions between the sialic acid moiety and the floor of the protein binding site. Furthermore, there is a positively charged Argl 86 residue in the floor of the binding site. The galactose and fucose moieties of sialyl Lewis X also make numerous hydrogen bond contacts to the binding site.

Sialyl Lewis X is also involved in attachment and rolling of leukocytes along an endothelial surface as part of leukocyte extravasation in response to tissue injury. This leukocyte attachment is mediated in part by an interaction between carbohydrate epitopes, particularly of P-selectin glycoprotein ligand (PSGL-I) on leukocytes and selectins on endothelial cells. Selectins are a family of calcium dependant cell adhesion molecules, and the carbohydrate epitope that is integral to their binding with PSGL-I is sialyl Lewis X. Accordingly, inhibition of the interaction between carbohydrate epitopes on leukocytes and endothelial cells may be a useful therapeutic target for a variety of diseases. This has led to the development of mimetics of sialyl Lewis X that were designed as mimetics of the PSGL-I carbohydrate epitope. The structure of sialyl Lewis X has therefore been modified in a systematic way to provide a range of mimetics, as reviewed in Kaila and Thomas Medicinal Chemistry Reviews 22:566-601 , 2002, the contents of which is incorporated herein by reference.

Based on the finding by the present inventors that SSL5 strongly activates platelets by binding to glycoproteins (including GPIbα and GPVI), causing platelet aggregation and thrombus formation in vivo, and that SSL5 binds to sialyl Lewis X and to trisaccharide sialyllactosamines (sLacNacs, being a subcomponent of sialyl Lewis X), the inventors have therefore determined that the sialyl Lewis X mimetics described herein may be useful in inhibiting or partially inhibiting binding of a staphylococcal superantigen-like protein (SSL) to a platelet glycoprotein, thereby inhibiting platelet activation.

In some embodiments, the sLacNac mimetics may comprise any one or more of the following compounds of Formulae 1-64.


and


Medicinal


and


of Medicinal 1998 41


Chemistry


2001 11



Chemistry 1995



Chemistry




8 2803-




2 ef a/. US Bioorganic


5 2061-

36 9161-

OH


Formula 28: 1 and 2 Ri = H1 Ph, disclosed in Hanessian, S. ef a/. Bioorganic Medicinal Chemistry Letters 19988 2803-2808.

Letters




Letters 1997



7 425-433



American 1996



-43 -


-46-


AJ. el


G et al.


at 3


Lys4-Lys2-Lys-β-Ala-OH


8

Formula 64: * = point of attachment to Lysine α and ε NH2 groups. Disclosed in Palcic, M. M. et al. Carbohydrate Research 1998 305 433-442.

One agent which inhibits SSL5 activation of platelets is Bimosiamose. This compound and its derivatives are described in WO 97/01335 and the entire contents of which are incorporated by reference.

Precursors and modulators of agents

In some embodiments of the present invention, the agents may be polypeptides or polynucleotides. In such embodiments, such polypeptides and polynucleotides, and the variants, analogues, derivatives and fragments thereof, are also useful for the screening and identification of other compounds, such as precursors and modulators that interact with these molecules. In particular, desirable compounds are those that modulate the activity of these polypeptides and polynucleotides. Such compounds may exert a modulatory effect by activating, stimulating, increasing, inhibiting or preventing expression or activity of the polypeptides and/or polynucleotides. Suitable compounds may exert their effect by virtue of either a direct (for example binding) or indirect interaction.

Compounds which bind, or otherwise interact with the polypeptides and polynucleotides of the invention, and specifically compounds which modulate their activity, may be identified by a variety of suitable methods. Interaction and/or binding may be determined using standard competitive binding assays or two-hybrid assay systems.

For example, the two-hybrid assay is a yeast-based genetic assay system typically used for detecting protein-protein interactions. Briefly, this assay takes advantage of the multi-domain nature of transcriptional activators. For example, the DNA-binding domain of a known transcriptional activator may be fused to a polypeptide, or a variant, analogue or fragment thereof, and the activation domain of the transcriptional activator fused to a candidate protein. Interaction between the candidate protein and the polypeptide, or a variant, analogue or fragment thereof, will bring the DNA-binding and activation domains of the transcriptional activator into close proximity. Interaction can thus be detected by virtue of transcription of a specific reporter gene activated by the transcriptional activator.

Alternatively, affinity chromatography may be used to identify polypeptide binding partners. For example, a polypeptide, or a variant, analogue or fragment thereof, may be immobilised on a support (such as sepharose) and cell lysates passed over the column. Proteins binding to the immobilised polypeptide, or a variant, analogue or fragment thereof, can then be eluted from the column and identified. Initially such proteins may be identified by N-terminal amino acid sequencing for example.

Alternatively, in a modification of the above technique, a fusion protein may be generated by fusing a polypeptide, or a variant, analogue or fragment thereof, to a detectable tag, such as alkaline phosphatase, and using a modified form of immunoprecipitation as described by Flanagan and Leder (1990).

Methods for detecting compounds that modulate activity of a polypeptide of the invention may involve combining the polypeptide, or a variant, analogue or fragment thereof, with a candidate compound and a suitable labelled substrate and monitoring the effect of the compound on the polypeptide, or a variant, analogue or fragment thereof, by changes in the substrate (which may be determined as a function of time). Suitable labelled substrates include those labelled for colourimetric, radiometric, fluorimetric or fluorescent resonance energy transfer (FRET) based methods, for example. Alternatively, compounds that modulate the activity of the polypeptide, or a variant, analogue or fragment thereof, may be identified by comparing the catalytic activity of the polypeptide, or a variant, analogue or fragment thereof, in the presence of a candidate compound with the catalytic activity of the polypeptide, or a variant, analogue or fragment thereof, in the absence of the candidate compound.

The present invention also contemplates compounds which may exert their modulatory effect on a polypeptide, or a variant, analogue or fragment thereof, of the invention by altering expression of the polypeptide, or a variant, analogue or fragment thereof. In this case, such compounds may be identified by comparing the level of expression of the polypeptide, or a variant, analogue or fragment thereof, in the presence of a candidate compound with the level of expression in the absence of the candidate compound.

Polypeptides of the invention, or variants, analogues or fragments thereof, may be used in high-throughput screens to assay candidate compounds for the ability to bind to, or otherwise interact therewith. These candidate compounds can be further screened against functional polypeptides to determine the effect of the compound on polypeptide activity.

It will be appreciated that the above described methods are merely examples of the types of methods which may be employed to identify compounds that are capable of interacting with, or modulating the activity of, a polypeptide, or a variant, analogue or fragment thereof, of the present invention. Other suitable methods will be known to persons skilled in the art and are within the scope of the present invention.

Potential modulators, for screening by the above methods, may be generated by a number of techniques known to those skilled in the art. For example, various forms of combinatorial chemistry may be used to generate putative non-peptide modulators. Additionally, techniques such as nuclear magnetic resonance (NMR) and X ray crystallography, may be used to model the structure of polypeptides of the invention and computer predictions used to generate possible modulators (in particular inhibitors) that will fit the shape of the substrate binding cleft of the polypeptide.

Compounds can accordingly be identified which either activate (as agonists) or inhibit (as antagonists) the expression or activity of a polypeptide, or a variant, analogue or fragment thereof, of the invention. Such compounds may be, for example, antibodies, low molecular weight peptides, nucleic acids or non-proteinaceous organic molecules.

Antagonists or agonists of polypeptides of the invention may include antibodies. Suitable antibodies include, but are not limited to polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanised antibodies, single chain antibodies and Fab fragments.

Antibodies may be prepared from discrete regions or fragments of the polypeptide of interest. An antigenic polypeptide contains at least about 5, and preferably at least about 10, amino acids. Methods for the generation of suitable antibodies will be readily appreciated by those skilled in the art. For example, a suitable monoclonal antibody, typically containing Fab portions, may be prepared using the hybridoma technology described in Antibodies-A Laboratory Manual, (Harlow and Lane, eds.) Cold Spring Harbor Laboratory, N. Y. (1988), the disclosure of which is incorporated herein by reference.

Similarly, there are various procedures known in the art, which may be used for the production of polyclonal antibodies to polypeptides of interest as disclosed herein. For the production of polyclonal antibodies, various host animals, including but not limited to rabbits, mice, rats, sheep, goats, etc, can be immunized by injection with a polypeptide, or a variant, analogue or fragment thereof. Further, the polypeptide, or a variant, analogue or fragment thereof can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Also, various adjuvants may be used to increase the immunological response, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

Screening for the desired antibody can also be accomplished by a variety of techniques known in the art. Assays for immunospecific binding of antibodies may include, but are not limited to, radioimmunoassays, ELISAs (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays, Western blots, precipitation reactions, agglutination assays, complement fixation assays, immunofluorescence assays, protein A assays, and Immunoelectrophoresis assays, and the like (see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1 , John Wiley & Sons, Inc., New York). Antibody binding may be detected by virtue of a detectable label on the primary antibody. Alternatively, the primary antibody may be detected by virtue of its binding with a secondary antibody or reagent which is appropriately labelled. A variety of methods is known in the art for detecting binding in an immunoassay and such methods are within the scope of the present invention.

Furthermore a soluble form of an SSL receptor or a mimic or homolog thereof may also be employed such as a soluble or solubilised SSL5 receptor. In a particular embodiment, the soluble form is GPIbalpha, GPIIb, GPIV and PSGL-I .

Embodiments of the invention may also utilise antisense technology to inhibit the expression of a polynucleotide by blocking translation of the encoded polypeptide. Antisense technology takes advantage of the fact that nucleic acids pair with complementary sequences. Suitable antisense molecules can be manufactured by chemical synthesis or, in the case of antisense RNA, by transcription in vitro or in vivo when linked to a promoter, by methods known to those skilled in the art.

For example, antisense oligonucleotides, typically of 18-30 nucleotides in length, may be generated which are at least substantially complementary across their length to a region of the nucleotide sequence of the polynucleotide of interest. Binding of the antisense oligonucleotide to their complementary cellular nucleotide sequences may interfere with transcription, RNA processing, transport, translation and/or mRNA stability. Suitable antisense oligonucleotides may be prepared by methods well known to those of skill in the art and may be designed to target and bind to regulatory regions of the nucleotide sequence or to coding (exon) or non-coding (intron) sequences. Typically antisense oligonucleotides will be synthesized on automated synthesizers. Suitable antisense oligonucleotides may include modifications designed to improve their delivery into cells, their stability once inside a cell, and/or their binding to the appropriate target. For example, the antisense oligonucleotide may be modified by the addition of one or more phosphorothioate linkages, or the inclusion of one or morpholine rings into the backbone (so-called 'morpholino' oligonucleotides).

An alternative antisense technology, known as RNA interference (RNAi), may be used, according to known methods in the art (for example WO 99/49029 and WO 01/70949, the disclosures of which are incorporated herein by reference), to inhibit the expression of a polynucleotide. RNAi refers to a means of selective post-transcriptional gene silencing by destruction of specific mRNA by small interfering RNA molecules (siRNA). The siRNA is generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated. Double-stranded RNA molecules may be synthesised in which one strand is identical to a specific region of an mRNA transcript and introduced directly. Alternatively corresponding dsDNA can be employed, which, once presented intracellularly is converted into dsRNA. Methods for the synthesis of suitable molecule for use in RNAi and for achieving post-transcriptional gene silencing are known to those of skill in the art.

A further means of inhibiting expression may be achieved by introducing catalytic antisense nucleic acid constructs, such as ribozymes, which are capable of cleaving mRNA transcripts and thereby preventing the production of wildtype protein. Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementarity to the target flanking the ribozyme catalytic site. After binding the ribozyme cleaves the target in a site-specific manner. The design and testing of ribozymes which specifically recognise and cleave sequences of interest can be achieved by techniques well known to those in the art (for example Lieber and Strauss, 1995, Molecular and Cellular Biology, 75:540-551, the disclosure of which is incorporated herein by reference).

Polynucleotides In embodiments where the agents of the present invention are polypeptides, the present invention also provides polynucleotides encoding such polypeptides, or encoding variants, analogues or fragments of such polypeptides. Such polynucleotides may be naturally occurring.

Also included within the scope of the present invention are variants, analogues, derivatives and fragments of the polynucleotides of the present invention. Such variants, analogues, derivatives and fragments thereof may be functionally equivalent to the polynucleotides set forth herein.

The present invention also contemplates the use of polynucleotides disclosed herein and fragments thereof to identify and obtain corresponding partial and complete sequences from other species using methods of recombinant DNA well known to those of skill in the art, including, but not limited to southern hybridization, northern hybridization, polymerase chain reaction (PCR), ligase chain reaction (LCR) and gene mapping techniques. Polynucleotides of the invention and fragments thereof may also be used in the production of antisense molecules using techniques known to those skilled in the art.

Accordingly, the present invention contemplates oligonucleotides and fragments based on the sequences of the polynucleotides disclosed herein for use as primers and probes for the identification of homologous sequences. Oligonucleotides are short stretches of nucleotide residues suitable for use in nucleic acid amplification reactions such as PCR, typically being at least about 10 nucleotides to about 50 nucleotides in length, more typically about 15 to about 30 nucleotides in length. Probes are nucleotide sequences of variable length, for example between about 10 nucleotides and several thousand nucleotides, for use in detection of homologous sequences, typically by hybridization. The level of homology (sequence identity) between sequences will largely be determined by the stringency of hybridization conditions. In particular the nucleotide sequence used as a probe may hybridize to a homologue or other functionally equivalent variant of a polynucleotide disclosed herein under conditions of low stringency, medium stringency or high stringency. Low stringency hybridization conditions may correspond to hybridization performed at 50°C in 2 x SSC. There are numerous conditions and factors, well known to those skilled in the art that may be employed to alter the stringency of hybridization. For instance, the length and nature (DNA, RNA, base composition) of the nucleic acid to be hybridized to a specified nucleic acid; concentration of salts and other components, such as the presence or absence of formamide, dextran sulfate, polyethylene glycol etc; and altering the temperature of the hybridization and/or washing steps. For example, a hybridization filter may be washed twice for 30 minutes in 2 X SSC, 0.5% SDS and at least 55°C (low stringency), at least 6O0C (medium stringency), at least 65°C (medium/ high stringency), at least 700C (high stringency) or at least 75°C (very high stringency).

In some embodiments, the polynucleotides may be operably linked to one or more promoters. In particular embodiments, the polynucleotides may encode sialyl Lewis X or a mimetic thereof, sLacNac or a mimetic thereof including a compound selected from Formulae 1 through 64, an anti-SSL antibody, an anti-platelet glycoprotein antibody, a regulator of SSL transcription or translation, or any precursor or modulator thereof.

Polynucleotides (mRNA or DNA) encoding an SSL such as SSL5 may also be detected and is a useful diagnostic aspect of the present invention.

Vectors, host cells and expression products

The present invention also provides vectors comprising the polynucleotides as set forth herein. The vector may be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion of foreign sequences, its introduction into cells and the expression of the introduced sequences. The vector may be a eukaryotic expression vector and may include expression control and processing sequences such as a promoter, an enhancer, ribosome binding sites, polyadenylation signals and transcription termination sequences.

The present invention further provides host cells comprising the vectors as set forth herein. Typically, a host cell is transformed, transfected or transduced with a vector, for example, by using electroporation followed by subsequent selection of transformed, transfected or transduced cells on selective media. The resulting heterologous nucleic acid sequences in the form of vectors and polynucleotides inserted therein may be maintained extrachromosomally or may be introduced into the host cell genome by homologous recombination. Methods for such cellular transformation, transfection or transduction are well known to those of skill in the art. Guidance may be obtained, for example, from standard texts such as Sambrook et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989 and Ausubel et al, Current Protocols in Molecular Biology, Greene Publ. Assoc, and Wiley-Intersciences, 1992.

The present invention moreover provides expression products of the host cells as set forth herein. In some embodiments, the expression product may be sialyl Lewis X or a mimetic thereof, sLacNac or a mimetic thereof including Bimosiamose, an anti-SSL antibody, an anti-platelet glycoprotein antibody, a regulator of SSL transcription or translation, or any precursor, modulator or combination thereof. In one embodiment, the expression product may be a sLacNac mimetic selected from the group comprising CGP77175A and CGP69669A or a compound selected from Formulae 1 through 64. Furthermore a soluble form of an SSL receptor such as a SSL5 receptor or a mimic or homolog thereof may also be employed. In a particular embodiment, the soluble form is GPIbalpha, GPIIb, GPIV and PSGL-I .

Pharmaceutical compositions

The compositions of the present invention can be used in a variety of applications, such as in inhibiting platelet activation in a subject, inhibiting formation of a thrombus in a subject and treating or preventing a disease in a subject, such as venous thrombosis, arterial thrombosis and embolisation.

Compositions of the present invention may be administered therapeutically. In such applications, compositions may be administered to a subject already suffering from a condition, in an amount sufficient to cure or at least partially arrest the condition and any complications. The quantity of the composition should be sufficient to effectively treat the patient. Compositions may be prepared according to methods which are known to those of ordinary skill in the art and accordingly may include a cosmetically or pharmaceutically acceptable carrier, excipient or diluent. Methods for preparing administrable compositions are apparent to those skilled in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa., incorporated by reference herein.

The composition may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included.

The compositions may also be administered in the form of liposomes. Liposomes may be derived from phospholipids or other lipid substances, and may be formed by mono- or multi-lamellar hydrated liquid crystals dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolisable lipid capable of forming liposomes may be used. The compositions in liposome form may contain stabilisers, preservatives and excipients. Preferred lipids include phospholipids and phosphatidyl cholines (lecithins), both natural and synthetic. Methods for producing liposomes are known in the art, and in this regard specific reference is made to: Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N. Y. (1976), p. 33 et seq., the contents of which are incorporated herein by reference.

Dosages

The therapeutically effective dose level of a medicament for any particular patient will depend upon a variety of factors including the condition being treated and the severity of the condition, the activity of the compound or agent employed, the composition employed, the age, body weight, general health, sex and diet of the patient, the time of administration, the route of administration, the rate of sequestration of the medicament, the duration of the treatment, and any drugs and other medicaments used in combination or coincidental with the treatment, together with other related factors well known in the art. One skilled in the art would therefore be able, by routine experimentation, to determine an effective, nontoxic amount of hyaluronic acid which would be required to treat applicable conditions.

Typically, in therapeutic applications, the treatment would be for the duration of the disease state.

Further, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages of the composition will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the nature of the particular individual being treated. Also, such optimum conditions can be determined by conventional techniques.

It will also be apparent to one of ordinary skill in the art that the optimal course of treatment, such as, the number of doses of the composition given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.

Routes of administration

The compositions of the present invention can be administered by standard routes. In general, the compositions may be administered by the parenteral (e.g., intravenous, intraspinal, subcutaneous or intramuscular), oral or topical route.

Carriers, excipients and diluents

Carriers, excipients and diluents must be "acceptable" in terms of being compatible with the other ingredients of the composition, and not deleterious to the recipient thereof. Such carriers, excipients and diluents may be used for enhancing the integrity and half-life of the compositions of the present invention. These may also be used to enhance or protect the biological activities of the compositions of the present invention.

Examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oils, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methylphenyl polysolpoxane; volatile silicones; mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose; lower alkanols, for example ethanol or iso-propanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1 ,3-butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyrolidone; agar; gum tragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from 10% to 99.9% by weight of the compositions.

The compositions of the invention may be in a form suitable for administration by injection, in the form of a formulation suitable for oral ingestion (such as capsules, tablets, caplets, elixirs, for example), in the form of an ointment, cream or lotion suitable for topical administration, in an aerosol form suitable for administration by inhalation, such as by intranasal inhalation or oral inhalation, in a form suitable for parenteral administration, that is, subcutaneous, intramuscular or intravenous injection.

For administration as an injectable solution or suspension, non-toxic acceptable diluents or carriers can include Ringer's solution, isotonic saline, phosphate buffered saline, ethanol and 1,2 propylene glycol.

Methods for inhibiting platelet activation

The present invention provides methods for inhibiting platelet activation in a subject, wherein the methods comprise administering to the subject the agents, polynucleotides, vectors, host cells, expression products or pharmaceutical compositions as herein described. Such methods inhibit platelet activation by inhibiting binding of a SSL to a platelet glycoprotein.

In a preferred embodiment, the present invention provides methods for inhibiting platelet activation in a subject, wherein the methods comprise administering to the subject an agent that inhibits or partially inhibits binding of Staphylococcal superantigen-like protein-5

(SSL5) to a platelet glycoprotein. In particularly preferred embodiments, the agent is the anti-SSL5 antibody designated 5E3. In other preferred embodiments, the agent binds to a SSL5 receptor on a platelet.

Methods for inhibiting thrombus formation The present provides methods for inhibiting formation of a thrombus involving platelet activation in a subject, wherein the methods comprise administering to the subject the agents, polynucleotides, vectors, host cells, expression products or pharmaceutical compositions as herein described. Such methods inhibit platelet activation by inhibiting binding of a SSL to a platelet glycoprotein, thereby inhibiting platelet activation, thereby inhibiting formation of a thrombus.

The thrombus may be a venous thrombus or an arterial thrombus.

The venous thrombus may be a deep vein thrombosis, portal vein thrombosis, renal vein thrombosis, jugular vein thrombosis, Budd-Chiari syndrome, Paget-Schroetter disease and cerebral venous sinus thrombosis.

The arterial thrombus may be a stroke or a myocardial infarction.

In a preferred embodiment, the present invention provides methods for inhibiting formation of a thrombus involving platelet activation in a subject, wherein the methods comprise administering to the subject an agent that inhibits or partially inhibits binding of Staphylococcal superantigen-like protein-5 (SSL5) to a platelet glycoprotein. In particularly preferred embodiments, the agent is the anti-SSL5 antibody designated 5E3. In other preferred embodiments, the agent binds to a SSL5 receptor on a platelet. In another particular embodiment, the agent is an mimetic such as Bimosiamose or sLex.

Methods for treating or preventing diseases

The present invention provides methods for treating or preventing diseases involving platelet activation in a subject, wherein the methods comprise administering to the subject the agents, polynucleotides, vectors, host cells, expression products or pharmaceutical compositions as herein described. Such methods inhibit platelet activation by inhibiting binding of a SSL to a platelet glycoprotein, thereby inhibiting platelet activation, thereby treating or preventing diseases.

The disease may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia, sepsis, septicaemia and infection by Staphylococcus aureus.

Venous thrombosis describes the formation of a thrombus or blood clot within a vein, examples of which include deep vein thrombosis, portal vein thrombosis, renal vein thrombosis, jugular vein thrombosis, Budd-Chiari syndrome, Paget-Schroetter disease and cerebral venous sinus thrombosis.

Deep vein thrombosis (DVT) describes the formation of a blood clot within a deep vein. It most commonly affects leg veins, such as the femoral vein. Three factors are important in the formation of a blood clot within a deep vein, being the rate of blood flow, the thickness of the blood and the qualities of the vessel wall. Classical signs of DVT include swelling, pain and redness of the affected area.

Portal vein thrombosis is a form of venous thrombosis affecting the hepatic portal vein, which can lead to portal hypertension and reduction of blood supply to the liver. It usually has a pathological cause such as pancreatitis, cirrhosis, diverticulitis or cholangiocarcinoma.

Renal vein thrombosis is the obstruction of the renal vein by a thrombus. This can lead to reduced drainage from the kidney.

Jugular vein thrombosis is a condition that may occur due to infection, intravenous drug use or malignancy. Jugular vein thrombosis can be complicated by systemic sepsis, pulmonary embolism, and papilledema, and is often characterized by a sharp pain at the site of the vein.

Budd-Chiari syndrome refers to blockage of the hepatic vein or the inferior vena cava. This form of thrombosis can present with abdominal pain, ascites and hepatomegaly. Traditional therapy treatments vary between drug therapy and surgical intervention by the use of shunts.

Paget-Schroetter disease refers to obstruction of an upper extremity vein (such as the auxiliary vein or subclavian vein) by a thrombus. The condition usually comes becomes apparent after vigorous exercise and usually presents in younger, otherwise healthy people.

Cerebral venous sinus thrombosis (CVST) is a form of stroke which results from the blockage of the dural venous sinuses by a thrombus. Symptoms may include headache, abnormal vision, any of the symptoms of stroke such as weakness of the face and limbs on one side of the body and seizures.

Arterial thrombosis is the formation of a thrombus within an artery. In most cases, arterial thrombosis follows rupture of atheroma, and is therefore referred to as atherothrombosis. There are at least two diseases that can be classified under this category, being stroke and myocardial infarction.

A stroke may involve a rapid decline of brain function due to a disturbance in the supply of blood to the brain due to ischemia, thrombus, embolus (a lodged particle) or hemorrhage (a bleed). In thrombotic stroke, a thrombus (blood clot) may form around atherosclerotic plaques. Since blockage of the artery is gradual, onset of symptomatic thrombotic strokes is slower. Thrombotic stroke can be divided into two categories, being large vessel disease and small vessel disease. The former affects vessels such as the internal carotids, vertebral and the circle of Willis. The latter can affect smaller vessels such as the branches of the circle of Willis.

Myocardial infarction (MI) is caused by an infarct (death of tissue due to ischemia), often due to the obstruction of the coronary artery by a thrombus. MI can quickly become fatal if emergency medical treatment is not received promptly. If diagnosed within 12 hours of the initial episode, then thrombolytic therapy may be initiated.

An embolisation may involve pyemia, a septic embolus or septicaemia. In such cases, a bacterial infection may be present at the site of thrombosis, leading to the thrombus breaking down, and spreading of particles of infected material throughout the circulatory system, which can lead to metastatic abscesses.

In a preferred embodiment, the present invention provides methods for treating or preventing diseases involving platelet activation in a subject, wherein the methods comprise administering to the subject an agent that inhibits or partially inhibits binding of Staphylococcal superantigen-like protein-5 (SSL5) to a platelet glycoprotein. In particularly preferred embodiments, the agent is the anti-SSL5 antibody designated herein 5E3.

Methods for diagnosis The present invention provides methods for diagnosing platelet activation in a subject, diagnosing formation of a thrombus involving platelet activation in a subject or diagnosing a disease involving platelet activation in a subject, wherein the methods comprise administering to the subject, or contacting ex vivo a biological sample of the subject with, an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The disease involving platelet activation may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia and a Staphylococcus aureus infection.

Methods involving administration of the anti-SSL antibody to the subject may involve the inclusion of a fluorescent, luminescent, magnetic, radioactive or other detectable tag conjugated to the antibody so as to permit diagnostic imaging of the antibody in the subject. Methods for diagnostic imaging are well known to those of skill in the art and include, for example, magnetic resonance imaging (MRI).

In some embodiments, a biological fluid such as blood, serum, plasma or lymph may be taken from the subject and then assayed ex-vivo for binding to SSL5. In such embodiments, where it is sought to determine binding of the antibody to a SSL in the biological fluid, standard methods known to those in the art may be used, such as radioimmunoassays, ELISAs (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays, Western blots, precipitation reactions, agglutination assays, complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, and the like (see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1 , John Wiley & Sons, Inc., New York). Antibody binding may be detected by virtue of a detectable label on the primary antibody. Alternatively, the primary antibody may be detected by virtue of its binding with a secondary antibody or reagent which is appropriately labelled. A variety of methods is known in the art for detecting binding in an immunoassay and such methods are within the scope of the present invention.

Methods for diagnosing not only platelet activation, but also a Staphylococcus aureus infection, are particularly useful in, for example, hospital settings where it is advantageous to rapidly determine whether patients (who may be in a hospital setting for unrelated reasons) have a Staphylococcus aureus infection.

Accordingly, the present invention also provides methods for diagnosing a Staphylococcus aureus infection in a subject, wherein said method comprises administering to the subject or contacting ex vivo a biological sample of the subject with an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

In certain embodiments, the anti-SSL antibody may be the monoclonal antibody designated herein 5E3.

Kits

The present invention provides kits for inhibiting platelet activation in a subject, inhibiting formation of a thrombus involving platelet activation in a subject or treating or preventing diseases involving platelet activation in a subject, wherein the kits comprise the agents, polynucleotides, vectors, host cells, expression products or pharmaceutical compositions as herein described, wherein administration to the subject of the agents, polynucleotides, vectors, host cells, expression products or pharmaceutical compositions inhibit platelet activation.

The present invention also provides kits for diagnosing platelet activation in a subject, diagnosing formation of a thrombus involving platelet activation in a subject or diagnosing diseases involving platelet activation in a subject, wherein the kits comprise an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The diagnostic kits of the present invention may be used by assaying a biological sample of the subject with the anti-SSL antibody. The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma, lymph, urine, abscess, cerebral, pericardial and pleuritic fluid.

The diseases involving platelet activation diagnosed by the kits of the present invention may be selected from the group comprising venous thrombosis, arterial thrombosis, embolisation, gangrene, diabetes, pneumonia and a Staphylococcus aureus infection.

Accordingly, the present invention also provides kits for diagnosing a Staphylococcus aureus infection in a subject, wherein the kits comprise an anti-SSL antibody, wherein binding of the anti-SSL antibody to a SSL is indicative of platelet activation, or a predisposition thereto, and wherein binding of the anti-SSL antibody to a SSL is indicative of a Staphylococcus aureus infection.

The kits diagnosing a Staphylococcus aureus infection may be used by assaying a biological sample of the subject with the anti-SSL antibody. The biological sample of the subject may be a fluid. The fluid may be selected from the group comprising blood, serum, plasma, lymph, urine, abscess, cerebral, pericardial and pleuritic fluid.

The anti-SSL antibody used in the kits of the present invention may be the monoclonal antibody designated herein 5E3.

Kits of the present invention facilitate the employment of the methods of the present invention. Typically, kits for carrying out a method of the invention contain all the necessary reagents to carry out the method. For example, in one embodiment, the kit may comprise an agent, a polynucleotide, a vector, a host cell, an expression product or a pharmaceutical composition as herein disclosed.

Typically, the kits described herein will also comprise one or more containers. In the context of the present invention, a compartmentalised kit includes any kit in which compounds or compositions are contained in separate containers, and may include small glass containers, plastic containers or strips of plastic or paper. Such containers may allow the efficient transfer of compounds or compositions from one compartment to another compartment whilst avoiding cross-contamination of samples, and the addition of agents or solutions of each container from one compartment to another in a quantitative fashion.

Typically, a kit of the present invention will also include instructions for using the kit components to conduct the appropriate methods.

Methods and kits of the present invention are equally applicable to any animal, including humans and other animals, for example including non-human primate, equine, bovine, ovine, caprine, leporine, avian, feline and canine species. Accordingly, for application to different species, a single kit of the invention may be applicable, or alternatively different kits, for example containing compounds or compositions specific for each individual species, may be required.

Methods and kits of the present invention find application in any circumstance in which it is desirable to inhibit platelet activation by a SSL.

Combination Therapies Those skilled in the art will appreciate that the agents, polynucleotides, vectors, host cells, expression products and pharmaceutical compositions disclosed herein may be administered as part of a combination therapy approach, employing one or more of the agents, polynucleotides, vectors, host cells, expression products and pharmaceutical compositions disclosed herein in conjunction with other therapeutic approaches to the methods disclosed herein. For such combination therapies, each component of the combination may be administered at the same time, or sequentially in any order, or at different times, so as to provide the desired therapeutic or cosmetic effect. When administered separately, it may be preferred for the components to be administered by the same route of administration, although it is not necessary for this to be so. Alternatively, the components may be formulated together in a single dosage unit as a combination product. Suitable agents which may be used in combination with the compositions of the present invention will be known to those of ordinary skill in the art.

Timing of Therapies Those skilled in the art will appreciate that the agents, polynucleotides, vectors, host cells, expression products and pharmaceutical compositions disclosed herein may be administered as a single agent or as part of a combination therapy approach to the methods disclosed herein, either at diagnosis or subsequently thereafter, for example, as follow-up treatment or consolidation therapy as a compliment to currently available therapies for such treatments. The agents, polynucleotides, vectors, host cells, expression products and pharmaceutical compositions disclosed herein may also be used as preventative therapies for subjects who are genetically or environmentally predisposed to developing such diseases.

The present invention is further described by the following non-limiting Examples. In the Examples the following methods are employed.

EXAMPLE 1

Materials and methods

1.1 Antibodies Phycoerythrin (PE)-conjugated monoclonal antibodies (mAb) directed against CD62P (clone AK4) and CD 162 (function-blocking, clone KPL-I), fluorescein isothyiocyanate (FITC) -labeled PAC-I (which recognizes an epitope on the glycoprotein Ilβ/IIIα complex of activated human platelets), and rat anti-mouse CD62P- FITC (clone RB40.34) were purchased from BD Biosciences (San Jose, Calif). Mouse anti-human CD41-FITC (clone P2), CD61-FITC (clone SZ21), and CD42b-PE (function-blocking, clone SZ2), mouse IgGl-FITC and IgGl-PE were purchased from Beckman Coulter (Fullerton, Calif). Alexa Fluor 488-conjugated mouse mAb against PentaΗis was purchased from Qiagen (Hilden,Germany). A variety of unlabeled mouse anti-human CD42b mAbs and SZ2 were purchased from BD Biosciences. AK2 (function-blocking) and WM23 (non-blocking) were generous gifts from Professor Berndt (Department of Biochemistry and Molecular Biology, Monash University, Melbourne), while BXl (non-blocking) was a gift from Cellular Pathology of Haemostasis Laboratory (CNRS-Universite Bordeaux 2-CHlJ in Bordeaux). PE-labeled rat anti-mouse CD42b mAb (clone Xia.G5), rat anti-mouse GPVI mAb (clone JAQl, functional blocking), PE-labeled rat anti-mouse GPIIbIIa mAb (clone JON/A, which selectively binds to the high affinity conformation of mouse GPIIβlllα) and PE or FITC- labeled rat IgG polyclonal antibodies were purchased from Emfret Analytics (Eibelstadt, Germany). FITC-conjugated goat anti-rat IgG and FITC-conjugated goat anti-mouse IgG+IgM were purchased from Jackson ImmunoResearch (West Grove, PA).

The 5E3 antibody is an IgG monoclonal antibody with an approximate molecular weight of 15OkDa. It was prepared by Monoclonal Antibodies South Australia (MAbAS) Technologies using a mouse hybridoma cell line. This involved the fusion of immune spleen cells from SSL5-immunized mice to myeloma cells. A series of cloning rounds was performed to identify a monoclonal population of antibody producing cells. Monoclonality of the antibody was confirmed by ELISA screening and its purification was undertaken using a Sepharose-Protein G column. Generation of the 5E3 monoclonal antibody is described in more detail under Example 2.

1.2 Cloning, Expression and Purification of SSL5-His

S. aureus strain NCTC8325 was kindly provided by Dr. Howden (Microbiology Department, Monash University, Australia). The SSL5 gene, without the signal sequence was amplified by PCR using the oligonucleotide primers 5'-GTTCCATGGCTAGTGAACATAAAGCAAAAT ATGAA-3' (SEQ ID NO: 1) and 5'-GTTGCGGCCGCTCTAATGTTGGCTTCTATTTTTTC-3' (SEQ ID NO:2) (with Ncol and Notl recognition sites underlined respectively) using VentR DNA polymerase (Biolabs, New England) and subsequently cloned into pHOG21 expression vector. After verification of the correct sequence, the pHOG21/sSSL5 expression vector was transformed in TGl E. coli as described previously (Hagemeyer, C, et al, Thromb Haemost., 2004, 92:47-53). Expression of His-tagged SSL5 (SSL5-His) was induced with lmmol/L isopropyl-β-D-thiogalactopyranoside (IPTG; Sigma) for 4 hours at 370C. His-tagged SSL5 was isolated under denaturing conditions in denaturing buffer (8M urea,100mmol/L NaH2PO4, 10mmol/L Tris base, pH 8.0), sonicated for 30 seconds (Branson Digital Sonifier; %Duty cycle 40-50; Output 4-5). A Ni-NTA Agarose (Invitrogen, Qiagen product of Germany) column was used for binding of SSL5-His protein, then washed with pH6.3 and pH 5.9 buffer (8M urea, Invitrogen, Carlsbad, CA and 100mmol/L NaH2PO4, 10mmol/L Tris base) separately. Bound protein was eluted using pH 4.5 buffer (8 mol/L urea, 100mmol/L NaH2PO4, 10mmol/L Tris base) according to the manufacturer's instructions (Invitrogen) and collected the fractions. The eluted protein was renatured by dialysis against pH 7.4 buffer (6 mol/L urea, 100mmol/L NaH2PO4, 10mmol/L Tris base), then against the same buffer with 4mol/L urea. Finally, SSL5-His was dialysed thoroughly against phosphate-buffered saline (PBS) and stored in PBS at -800C before use. Purity was examined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

1.3 Construction of Mutant pHOG-SSL5 (Tl 75P)-cMYC-HIS:

The pHOG-SSLS-cMYC-HIS construct was used as DNA template for mutagenesis. Proline mutant (Tl 75P) was constructed with a Quick-Change Site-Directed Mutagenesis Kit (Stratagene), according to the manufacturer's instructions. Primers used were: sense primer 5'- TGAAAGATGGCGGCTATT ATCCGTTTGAACTTAATAAAAAATTACAAAC-3' (SEQ ID NO:3) and antisense primer 5'- GTTTGTAATTTTTTATTAAGTTCAAACGGATAATAGCCGCCATCTTTCA -3 '

(SEQ ID NO:4). The resultant proline mutant sequence was verified to have the intended mutations, but not extraneous mutations, by ABI PRISM™ 3100 Genetic Analyzer.

1.4 Cells

HL-60 cells, kindly provided by Dr. Y. Shen (Department of Immunology, Monash University, Australia), were maintained in RPMI 1640 medium containing 10% FBS supplemented with 2mmol/L L-glutamine plus penicillin and streptomycin.

1.5 Human Blood Collection

Blood was collected by venipuncture with a 21 -gauge butterfly needle from healthy volunteers taking no medications, and anticoagulated with citric acid (Monovette, Sarstedt) using a 1 : 10 dilution. Platelet-rich plasma (PRP) was obtained by centrifugation at 20Og for 10 minutes. Gel filtered platelets were prepared from citrated PRP using a sepharose CL-2B column (Sigma) (Bassler N., et al, Arterioscler Thromb Vase Biol. 2007; 27;e9-15). After elution with modified Tyrode's buffer (150mmol/L NaCl, 2.5mmol/L KCl, 12mmol/L NaHCO3, 2mmol/L MgC12, 2mmol/L CaC12, lmg/ml BSA, lmg/ml dextrose; pH 7.4), platelets were further diluted in modified Tyrode's buffer to 8X106/ml for FACS study or 2.4X107/ml for static adhesion experiments. To prepare washed platelets, the PRP was acidified to pH6.5 using ACD buffer (38mmol/L citric acid anhydrous, 75mmol/L sodium citrate, 136mmol/L D-glucose, pH 5.0) and treated with l μM PGEl . The PRP was centrifuged at l OOOg for 15 minutes and the platelet pellet was washed in pH6.5 buffer composed of 140mmol/L NaCl, 5mmol/L KCl, 12mmol/L Na Citrate, 10mmol/L Glucose, 12.5mmol/L Saccharose, and then centrifuged again at lOOOg for 10 min (Patel Y., et al, Blood. 2003; 707:4828-4835). The platelet pellet was then used for immunoprecipitation.

1.6 Preparation of Washed Mouse Whole Blood Blood samples (50μl) were collected using a heparinized ImI syringe by heart puncture and added to 1.5ml tubes containing 200μl of TBS/Heparin (20U/ml). This was diluted in ImI of Tyrode's buffer and subjected to flow cytometric analysis. Washed blood, was prepared by centrifugation of the diluted blood at 90Og for 5 min, removing the supernatant and resuspending the pellet in 1.25ml Tyrode's buffer.

1.7 Immunoprecipitation HL60 cells were cultured overnight in RPMI 1640 media (containing 10% FBS supplemented with 2mmol/L L-glutamine, penicillin and streptomycin). Human washed platelets were prepared as described above. Washed platelets and HL60 cells were lysed in ice cold PBS lysis buffer containing 50mmol/L Tris-HCl (pH 7.4), 150mmol/LNaCl, 1% Triton X-100, Protease inhibitor cocktail (Roche Cat. # 1 836 153), 10mmol/L NaF, lmmol/L Na3VO4 and 10mmol/L NaP2O7 and sonicated for 10 sec. Sonicated samples were centrifuged at 13,000 rpm for 10 min at 40C. Recombinant purified His-tagged SSL5 proteins (5μg) were added to the clear cell lysates. A mass of 3μg of anti-CD 162 (clone KPL-I) was used to co-immunoprecipitate target proteins from HL60 lysates mixed with His-SSL5. Additionally, 2μg of anti-CD42b (clone WM23) was used to co-immunoprecipitation target proteins from washed platelet lysates that mixed with His-SSL5, as described previously. Briefly, the lysates were pre-cleared by incubation with 30μl of protein G-sepharose beads (Amersham) for 1 hour at 40C. Beads were pelleted and the clear supernatant transferred to a fresh tube containing recombinant His-SSL5 protein (5μg) and either anti-CD 162, anti-CD42b or anti-mouse IgG2. After incubation for 2 hours at 40C, 30μl of protein G-sepharose beads were added to the pre-cleared lysate/recombinant-His-SSL5 protein/antibody mixture and incubated overnight at 40C. The immune complexes were washed with lysis buffer a minimum of 5 times and eluted in 40μl of SDS- sample loading buffer and heated to 95 0C for 10 min.

1.8 Immunoblotting Analysis

The immune complexes were separated on a 12% SDS-PAGE gel and transferred onto a Hybond-C nitrocellulose membrane (Amersham). Immunoblots were probed with anti-CD162 (1 :500) or anti-CD42b (1 : 1000) and anti-His«Tag (1 :3000) (Novagen, Madison, WI). Horseradish peroxidase-conjugated secondary antibodies were used at their recommended dilutions and protein bands were detected with enhanced chemiluminescent substrate (Supersignal West Pico, Pierce Biotechnology).

1.9 MALDI-tof/tof-MS Sequencing and Identification of Target Protein

The SSL5 associated peptides purified using Ni-NTA and isolated by SDS-PAGE were subjected to MALDI-tof/tof-MS sequence analysis. The separated protein bands were excised from the Coomassie-stained gel and briefly washed with NH4HCO3. The gel pieces were incubated with DTT to reduce the disulphide bonds and free cysteines alkylated by vinylpyridine. Alkylated sample were then washed thoroughly and the remaining dye was completely removed. Excess solvent from the gel pieces was removed by drying in a vacuum centrifuge. The gel pieces were re-hydrated with NH4HCO3 containing sequence grade trypsin and incubated at 4°C for 20 minutes. The excess trypsin was then removed and the gel pieces were digested at 37°C overnight. Following digestion, the supernatant was collected into a clean tube for MS analysis. The gel pieces were further extracted with MiIIiQ water followed by 30% acetronitrile in 5% (aq) formic acid. Each extraction was separately analysed by MALDI-tof-MS and selected peptides sequenced by MALDI-tof/tof-MS.

1.10 SSL5 binding to HL60 cells and Platelets

To determine binding of SSL5 to HL60 cells, HL60 cells (5 x 106 cells/ml) were incubated with increasing concentrations of SSL5-His in RPMI/HSA for 30minutes on ice. After two washes, Alexa Fluor 488-conjugated anti-PentaΗis was added and incubated on ice for 20minutes in the dark. CeIlFIX (BD Biosciences) was then added, and fluorescence measured on a flow cytometer (FACSCalibur, Becton Dickinson, Franklin Lanes, NJ). To detect the binding of SSL5 to platelets, platelets (8xlO6/ml) in Tyrode's buffer were incubated with increasing concentrations of SSL5-His for 15 minutes at 37°C in water bath. Alexa Fluor 488-conjugated anti-PentaΗis was then added and incubated in room temperature for 20 minutes in the dark before a final addition of CeIlFIX.

1.11 Competition for Receptors Binding

The interaction between SSL5 and PSGL-I on HL60 cells, was examined by first incubating HL60 cells (5x106 cells/ml) with 1-10 μg/ml SSL5 (or AT as control) for 20 minutes on ice in RPMI/HSA. AT is a construct from E. coli previously described as non-targeted scFv-TAP, which cannot interact with human platelets (Hagemeyer, C, et al, Thromb Haemost., 2004, 92:47-53) . A volume of KPLl-PE (1 μg/ml) was then added and the mixture incubated on ice for a further 20 minutes. After washing, cells were fixed by CeIlFIX. Fluorescence was measured using flow cytometry. To determine the putative receptors for SSL5 on platelets, platelets in Tyrode's buffer were incubated with lOμg/ml SSL5 for 15 minutes at 370C in water bath. Subsequently, FITC- or PE- conjugated mAbs directed against a series of cell surface receptors were added and the mixture incubated for 20 minutes at room temperature. In another experiment, platelets (8 x 106 /ml) were incubated with increasing concentrations of SSL5 for 15 minutes in a water bath at 37°C, followed by an incubation with anti-CD42b-PE mAb (clone SZ2) for 20 minutes at room temperature. They were then fixed and analysed by FACS. To further investigate the competitive binding between SSL5 and different clones of mouse anti-human CD42b to the CD42b platelets receptor, several clones such as SZ2, AK2, WM23 and BXl were used instead of anti-CD42b-PE mAb, while goat anti-mouse IgG-FITC was added as a secondary antibody. For mouse platelets, washed blood dilution in Tyrode's buffer (1 :25) was incubated with rat anti-mouse CD42b-PE and rat anti-mouse GPVI mAb for 20 minutes at room temperature. Rat anti-mouse GPVI mAb was further stained with goat anti-rat IgG-FITC.

1.12 Activation of Platelets by SSL5

Platelets were incubated with SSL5 using the same protocols as above. After incubation, mouse anti-human CD62P-PE and PAC-I-FITC were used for detecting the activation of human platelets, while rat anti-mouse CD62P-FITC and JON/A-PE were used for detecting the activation of mouse platelets. The isotype antibodies were used in each experiment.

1.13 Aggregation of Platelets Induced by SSL5

PRP (3xl08/ml) was prepared as described above and used for aggregation between 30-60 minutes. An aliquot of PRP was further centrifuged at 120Og for 12 minutes to yield platelet-poor-plasma (PPP). This was used as 100% light transmission reference in PRP aggregation assays or for the dilution of PRP. Aggregometry was performed in a Biodata PAP-4 aggregometer. Aggregation was induced by addition of PBS (with calcium) and different concentrations of SSL5 at 370C, with stirring at 900 rpm, and a 12-minute recording.

1.14 Adhesion of Platelets to Fibrinogen under Static Conditions

Glass cover slips (12 mmol/L circular, No 1 ; Fisher Scientific) were incubated with fibrinogen (30μg/ml) at 4°C overnight. After washing with modified Tyrode's buffer, the cover slips were blocked with 1% BSA and washed twice with modified Tyrode's buffer.

The washed platelets (2.4xlO7/ml -preparation described above) were incubated with 1 , 5 and lOμg/ml SSL5, using PBS and lOμg/ml AT as a negative control, and 20μM ADP as a positive control, for 30 minutes at 37°C. The cover slips were then washed twice with modified Tyrode's buffer fixed with 1 X CeIlFIX for 15 minutes and mounted with Vectashield mounting medium (Vector laboratories, Burlingame,CA). The DIC (χ60) was assessed using an F-View II digital camera.

1.15 Effects of Neuraminidase on SSL5 Binding to Platelets

To study the possible effects of neuraminidase on SSL5 binding to platelets, GFP (2χ l O6 cells/ml) in l χGl buffer and neuraminidase (New England Biolabs) were added to a final neuraminidase concentration of 100U/ml. GFP in I xGl buffer was used as the control, after being incubated for 60 minutes at 37°C and washed once with Tyrode's buffer.

Pellets were resuspended in Tyrode's at 8χ 106 cells/ml, then lμg/ml SSL5 was added and incubated for 15 minutes at 37°C. Following this, Alexa Fluor 488-conjugated anti-PentaΗis was added and incubated in room temperature for 20 minutes in the dark.

Finally CeIlFIX was added.

1.16 Effects of SSL5 on Thrombi Formation in the Lung of Mice

Maintenance of the C57BL/6 mice (all male, 25-34g) used in this experiment followed the national guidelines and was approved by the institutional animal care and ethics committees. While under anaesthesia state, mice were injected intravenously with 4μg/g

BW SSL5 (or MB9 as control) via the tail vein. MB9 is a construct previously described as

MA2, which cannot interact with mouse platelets (Schawrz, M., et al, Circ Res., 2006,

99:25-33). Half of the sample was injected as a bolus and the other half by infusion for 20 minutes using a Model 100 series syringe pump (KD scientific, Holliston, MA). Before injection, a mixture of 20μg/ml infrared-800 conjugated human fibrinogen (about

2μg/mice) was administered for tracing the thrombi. After infusion, tail-bleeding time was monitored. Mice were sacrificed at 60 minutes after bolus injection. Blood (ImI) was then extracted by heart puncture and added to 200μl TBS/Heparin (20 U/ml) for platelets function evaluation in vitro by FACS. After bleeding, 10% formalin (5ml) was perfused from the left ventricle. Lungs were subsequently removed, and after immersing in saline for 10 minutes, they were fixed for 2 days with 10% neutral buffered formalin, embedded in Sakura Tissue-Tek OCT compound and stored at -800C until use. Lungs were scanned with Odyssey infrared imaging system on the same day. Sections (8μm slice thickness) were cut by cryostat in intervals of five and stained with H&E and Carstairs. Images were captured with an Olympus BX50 microscope and MicroPublisher 3.3 RTV digital camera (QIMAGlNG, Burnaby, BC, Canada) and processed with Image ProPlus™ software.

1.17 Determination of GIycan Binding Specificity by Glycomics Array

A sample of purified SSL5 was sent to Core H of the Centre for Functional Glycomics (http://www.functionalglycomics.org), located at Wayne Rollins Research Centre, Atlanta, GA. The sample, at a concentration of 200μg/ml, was labelled with the anti-penta-his fluorescent antibody for detection, incubated with an array of 377 glycan structures covalently linked to NHS-activated glass microscope slides and analysed for binding. The glycan structures provided by this array are listed on (http://www.functionalglycomics.org/static/consortium/resources/resourcecoreh8.shtml). Relative binding was expressed at relative fluorescence units (RFU).

1.18 Statistical Analysis

Data are presented as Mean±SEM. The statistical comparisons were made by ANOVA (following a Newman-Keuls test) in GraphPad Software 5.0, and differences were considered to be significant at .PO.05.

EXAMPLE 2 Generation of 5E3 monoclonal antibody

The 5E3 antibody is an IgG monoclonal antibody with an approximate molecular weight of 15OkDa. It was prepared by Monoclonal Antibodies South Australia (MAbAS) Technologies using a mouse hybridoma cell line as set out below.

2.1 Fusion of mouse splenocytes to SP 2/0 myeloma cells

The spleens of two mice, one immune and one non-immunised control, were removed using aseptic techniques. The immune spleen cells were isolated and fused to SP2/0 Myeloma cells (5-9x107) using PEG 1500. The normal spleen cells were also isolated and used as feeder cells in the final stationary culture of fused cells. Immune spleen cells were combined with SP2/0 cells (1 : 1 - 1 :4 ratio). The cells were then spun down and the liquid removed and fusion performed on the well-drained pellet, with ImL Polyethylene Glycol (PEG) 1500 added over 1 minute (0.25ml/15seconds) and mixed for 1 - 2 min, 4mL pre-warmed (37°C) Washing Medium added over 4 minutes (1 ml/minute) and then, whilst mixing, 1OmL pre-warmed (37°C) Washing Medium added slowly (2mL/minute). The fusion mixture was then incubated at 37°C for 5 minutes and the concentration adjusted to 2 X 106 cells/mL. Feeder cells were added to the fused cell suspension to make a concentration of 1 X 106 cells/mL and 48 well plates seeded with 50OuL/ well and 96 well plates with 100uL/well before placing in a 6% CO? incubator overnight. The following day, a further 50OuL Selection Medium was added to each well (Plating Medium with 2% Azaserine and 2% Hypoxanthine) and then incubated was undertaken in a 6% CO2 incubator for a further 2 days. On the fourth day, half the Plating medium was removed from each well of each fusion plate and replaced with fresh Growth Medium. Incubation then took place in a 6% CO2 incubator until fused colonies were ready for ELISA screening.

2.2 Cell Cloning A series of cloning "rounds" were performed to ultimately identify a monoclonal population of antibody producing cells. A population of cells confirmed to produce appropriate antibody by ELISA screening of the initial fusion clones or from a previous cloning plate were chosen. A proportion of this polyclonal population was sampled and plated onto a 96 well tissue culture plate by a standard dilution method. After approximately 7-10 days of incubation, the cell culture supernatant of each individual well containing single cell colonies was screened by ELISA. A suitable colony was chosen to repeat the process until each sample that was screened showed a positive ELISA signal to its antigen. It is at this time that the population was deemed to be monoclonal.

2.3 ELISA screening

Antigen was diluted and bound to a solid 96 well vinyl microtitre plate at concentration of 0.2-2 ug/well in bicarbonate buffer (100uL/well). After 1 hr incubation and washing (3 X with PBS/0.1% Tween 20), primary antibody (the antibody of interest in the form of hybridoma cell culture supernatant, purified antibody or serum) was exposed to the antigen coated plate, followed by further incubation, washing and addition of a HRP-secondary antibody (goat anti-mouse Ig or IgG HRP) followed, after 1 hour, by TMB substrate (10 μg/ml in NaAc/EDTA buffer, 0.01% H2O2). The addition of sulfuric acid quenched the reaction and the plate was read at a wavelength of 450nm/650nm.

2.4 Antibody harvesting

Hybridoma cells were grown in stationary tissue culture flasks and adapted to the BD Cell™ MAb medium supplemented with Glutamax. Established hybridoma cells growing in the exponential growth phase and at > 80% viability were seeded into either a 75 or 150 cm2 tissue culture flask, at a density of 2.0 x 105 cells/ml at a ratio of 1 : 1 with BD Cell™

MAb medium. Cells were left in this media for at least 2 days before the next passage and cellular response was checked by undertaking a cell count and a viability test. This was repeated a number of times until cells were growing well in the final medium. Cells were then introduced into a BD Biosciences Celline™ Device in 15 mis of medium at 2 x 106 cells/ml. The cell suspension was then harvested one week later, and every week after that.

The cells were spun down, counted, assessed and a proper amount re-introduced in the device. The supernatant was collected from the centrifuge tube and filtered through 0.45 um filter before freezing and awaiting purification.

2.5 Antibody purification

IgM antibodies were purified by precipitation in 50% ammonium sulphate overnight in the fridge followed by centrifugation and resuspension of the pellet in PBS. The solution was then passed through a Sephadex G-25 column equilibrated in PBS. The eluted antibody was then assessed for total protein concentration and sterile filtered through a 0.22 μm filter.

IgG antibodies were purified through a Sepharose-Protein G column equilibrated in borate buffer at pH 8. After washing of the unbound protein, the antibody was eluted using glycine buffer at pH 2.7. The eluate was quickly neutralised with Tris and the product buffer-exchanged through Sephadex G25 as above.

EXAMPLE 3 SSL5 binding

3.1 SSL5 Binds to HL60 Cells and Competes with KPL-I

SSL5-His was produced in TGl E. coli and isolated with high purity (Figure 1). The binding of SSL5-His complex to both human and mouse platelets, as determined by Alexa Fluor 488-conjugated anti-Penta»His mAb and flow cytometry, was found to increase in a dose-dependent manner, contrasting the T175P mutant that did not bind (Figure 2a), whereas the binding of KPL-I -PE decreased (data not shown). The immunoprecipitation assay further confirmed the binding of recombinant SSL5-His proteins with CD 162 (Figure 2b).

3.2 Binding of SSL5 to Platelets

The main surface-expressed receptors on platelets, especially the glycoproteins, were treated as potential receptor target for SSL5. Due to this, several monoclonal antibodies that recognize a variety of platelet receptors involved in adhesion or activation were selected for analysis. SSL5 was found to completely block the binding of SZ22-PE to human platelets at lOμg/ml, while the binding of P2-FITC (anti-CD41) and SZ21-FITC (anti-CD61) was unaffected (Figure 3a-b). The anti-CD42b mAb clones, including SZ2, AK2, WM23 and BXl , were all blocked by SSL5 (Figure 3c). The point mutation T175P on SSL5 was found to inhibit the binding of SSL5 to platelets by approximately 1000-fold (Figure 3d). The presence of neuraminidase was also shown to inhibit the binding of SSL5 to platelets by approximately 1000-fold (Figure 3e). Immunoprecipitation also showed that SSL5 bound with GPIbα (CD42b) (data not shown). Furthermore, it was also shown that the binding of both anti-GPIbα mAb and anti-GPVI mAb to mouse platelets was inhibited by about 70% by SSL5 at 15μg/ml final concentration (data not shown).

3.3 Fine Specificity of SSL5 Binding by GIycomics Array

A hit was defined as any glycan whose binding strength to SSL5 exceeded two standard deviations greater than the mean of all values below the background level (10% of the strongest binding glycan). Using this criteria, binding of SSL5 was observed to 37/377 glycans. The strongest 20 hits are presented in Table 1. Notably, the trisaccharide sialyllactosamine (sLacNac - Neu5Acα2-3Galβl -4GIcNAc) terminus (in bold) was present in all these glycans, with itself present in position 8 in table 1. This reveals a specificity of SSL5 for glycans containing the sLacNac terminus.

TABLE 1 SSL5 binding glycans from the glycomics consortium array



3.4 SSL5 Activates Platelets Directly and Induces Thrombi Formation in Mouse Lung

The activation of platelets by SSL5 was evident by the increased expression of CD62P (Figure 4a) and PAC-I on human platelets (Figure 4b) and the increased expression of CD62P and JON/A on mouse platelets (data not shown). SSL5 was also found to induce aggregation of human platelets with lag time, which shortened when SSL5 concentration increased (Figure 4c). After activation by SSL5, the platelets were found to adhere to a fibrinogen-coated coverslip under static conditions in a dose-dependent manner (Figure 5a) and with obvious shape change (Figure 5b). A mouse pulmonary thrombi formation model was used to study the effect of SSL5 in vivo, in which platelet activation was induced by tail vein infusion of 4μg/g SSL5 or MB9 as control. Obvious thrombi formed in the lungs in 57% of SSL5-injection mice (4 of 7 mice), while no thrombi were observed in MB9-injected mice (4 mice), as was examined by both infrared scan and Carstairs or H&E stain (Figure 6).

3.5 The 5E3 Monoclonal Antibody Inhibits the Actions of SSL5 both In Vitro and in vivo

Flow cytometry analysis showed that the 5E3 monoclonal antibody inhibits the platelet-activating properties of SSL5. The incubation of 5E3 with SSL5 for 15 minutes at 37°C, before subjecting the incubated sample to platelets, decreased the level of platelet activation by SSL5 in a dose-dependent manner. Ratios (w/v) of 5E3 to SSL5 of 1 :5, 1 : 1 and 5: 1 achieved inhibition of platelet activation by 12%, 72% and 85% respectively (figure 7). The mouse pulmonary thrombi formation model mentioned above was also used to study the inhibitory effects of 5E3 on SSL5 in vivo. A slight modification of injecting the samples through the jugular vein was carried out, while thrombi formation was quantified by a direct count of thrombi numbers using microscopy. In this in vivo analysis, mice were divided into the following three groups:

Group 1 : Saline control mice - Mice injected with 2μg/g BW of saline (n=9); Group 2: SSL5-injected mice - Mice injected with 2μg/g BW of SSL5 (n=8); and - Group 3: Antibody-treated mice - Mice injected with 8μg/g BW of 5E3 antibody followed by 2μg/g BW SSL5 about two minutes later (n=8).

Significant differences in the number of thrombi developed were seen between the SSL5-injected mice and the saline control group (P < 0.005), as well as between the SSL5-injected mice and antibody treated mice (P < 0.05) (Figure 8). No differences were seen between the saline control group and the antibody treated mice.

3.6 GPVI acts as an SSL5 Receptor on Platelets

The role of GPVI as an SSL5 platelet receptor was assessed by flow cytometry using a GPVI recombinant protein. SSL5 incubated with the GPVI recombinant protein had its binding to platelets inhibited by 53% (Figure 9). This is a partial effect due to the presence of other SSL5 receptors on platelets. The role of GPVI as an SSL5 receptor on platelets was confirmed using a second experiment (Figure 10).

3.7 The Sialyl Lewis X, sLacNac and Sialic Acid Glycoside Glycans Inhibit Platelet Activation by SSL5

Flow cytometry was used to assess the inhibitory effects of sLacNac mimetics on SSL5-induced platelet activation using the sialic acid glycoside, sLacNac and sLex glycans. The results (Figure 1 1) show that SSL5-induced platelet activation was inhibited by 100% using the sLacNac and sLex glycans and by 55% using sialic acid glycoside. Dose response curves of the inhibition of SSL5-induced platelet activation by sLex and sLacNac were also generated (Figure 12).

EXAMPLE 4

Anti-SSL5 antibody based ELISA

The anti-SSL5 antibody, 5E3, was diluted to a concentration of 12.5μg/ml using PBS. This solution was then used to coat wells of a 'maxi-sorb' 96-well plate, 50μl/well, by incubating overnight at 4°C. The wells were then washed twice with PBS before addition of blocking buffer (200μl/well; 5% w/v milk powder/PBS) and 2-hour incubation at room temperature (RT). The wells were then again washed twice and left to air dry (30mins, RT).

Platelet rich plasma was obtained from whole blood, as previously described, which in turn was centrifuged (15000 xg, 5mins) to obtain platelet poor plasma (PPP). Recombinant His-SSL5 protein was diluted into PPP to final concentrations of 0.1 - lOOμg/ml.

lOOμl of SSL5-spiked plasma was then added to 5E3 coated wells and incubated at 370C for 2 hours. Following the incubation, the wells were washed (x3) with PBS before addition of 200μl of a HRP-labelled anti-His*Tag antibody (1 :3000; Roche) and incubated

2 hours at room temperature. After a final PBS washing step, lOOμl TMB substrate (10 μg/ml in NaAc/EDTA buffer, 0.01% v/v H2O2) incubated for ~20mins before addition of

2M H2SO4. Absorbance of each well was then measured at 450nm. Results are shown in Figure 13.

EXAMPLE 5 Bimosiamose inhibition of SSL5-induced platelet activation

SSL5 (lOμg/ml) was incubated with a range of concentrations of Bimosiamose (1 OnM -ImM) for lOmins 37°C before addition of platelets and CD-62b expression and GPIIb/IIIa activation measured as described above. Bimosiamose and its derivatives are contemplated for use in accordance with the present invention. Bimosiamose and its derivatives are disclosed in WO 97/01335 (PCT/US96/1 1032) which is incorporated herein by reference in its entirety. Results are shown in Figure 14.

BIBLIOGRAPHY

AIi et al. The FASEB Journal 18: 152-154, 2004

Allanson, N.M. et al. Tetrahedron: Asymmetry 1994 5 2061-2076

Anderson, M.B. et al. US 5,837,689

Anderson, M.B. et al. WO 97/30984

Anderson, M.B. et al. WO 97/31007

Antibodies-A Laboratory Manual, (Harlow and Lane, eds.) Cold Spring Harbor

Laboratory, N. Y. (1988)

Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1 , John Wiley &

Sons, Inc., New York

Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons,

Inc. - and the full version entitled Current Protocols in Molecular Biology)

Bantelli, R. et al. Tetrahedron Letters 1997 38 4059-4062.

Bassler N., et al, Arterioscler Thromb Vase Biol. 2007; 27:e9-15

Birbeck, A. A. et al. Bioorganic Medicinal Chemistry Letters 1995 5 2637-2642

Borbas, A. et al. Tetrahedron Letters 1999 40 3639-3642

Bradley, B. K. et al. Glycobiology 1993 3 633-639 and Ohmoto, H. Journal of Medicinal

Chemistry 1996 39 1339-1343

Cappi, M. et al. Bioorganic Medicinal Chemistry 1997 5 283-296

Carrel, F. et al. Helvetica Chimica Acta 2004 87 1084-1070

Dasgupta, F. et al. US 5,658,880

De Vleeschauwer et al. Bioorganic Medicinal Chemistry Letters 2001 1 1 1 109-1 1 12

Dekany, G. el al. Journal of Carbohydrate Chemistry 1996 15 383-398

Denton, R. W. et al. European Journal of Organic Chemistry 2007 645-654

Flanagan and Leder (1990)

Hagemeyer, C, et al, Thromb Haemost., 2004, 92:47-53

Hagemeyer, C, et al, Thromb Haemost., 2004, 92:47-53

Hanessian, S. et al. Bioorganic Medicinal Chemistry Letters 1997 7 2729-2734

Hanessian, S. et al. Bioorganic Medicinal Chemistry Letters 1998 8 2803-2808 Hanessian, S. et al. Synlett 1994 868-870

Hiramatsu, Y. et al. Journal of Medicinal Chemistry 1998 41 2302-2307

Hiramatsu, Y. Journal of Medicinal Chemistry 1997 40 362-369

Hiramatsu, Y. Journal of Medicinal Chemistry 2000 43 1476-1483

Hiruma, K. et al. Tetrahedron 1998 54 15781-15792

Huang, H. et al. Journal of Organic Chemistry 1995 60 3100-3106

Imazaki, N. et al. Bioorganic Medicinal Chemistry Letters 1996 6 2043-2048

Imazaki, N. et al. WO 99/29681

Ito, M. et al. JP 1 1269162

Kaila and Thomas Medicinal Chemistry Reviews 22:566-601 , 2002

Kaila N. et al. Bioorganic Medicinal Chemistry Letters 2001 1 1 151-155

Kaila, N. et al. Tetrahedron Letters 1995 36 5503

Kogan, T.P. et al. Journal of Medicinal Chemistry 1995 38 4976-4984

Kogan, T.P. et al. Journal of Medicinal Chemistry 1998 41 1099-1 1 1 1

Kretzschmar, G. et al. DE 19648681

Kretzschmar, K. Tetrahedron 1998 54 3765-3780

Kuribayashi, T. et al. Bioorganic Medicinal Chemistry Letters 1998 8 3307-3310

Lieber and Strauss, 1995, Molecular and Cellular Biology, /5:540-551

Lin, CC. et al Bioorganic Medicinal Chemistry 1999 7 425-433

Liu, A. et al. Tetrahedron Letters 1996 37 3785-3788

Manning D. D. et al. Journal Organic Chemistry 1995 60 6254-6255

Manning, D.D. Tetrahedron Letters 1996 37 1953-1956

Marron, T.G. et al. Tetrahedron Letters 1996 37 9037-9040

Moreno- Vargas, A.J. el al. European Journal of Chemistry 2008 2973

Murphy P. V. et al. Bioorganic Medicinal Chemistry Letters 1998 6 2421-2439

Musser, J. H. Pharmacochemical Library 1993 20 33-40

Norman et al. Blood 91.475-483, 1998

Ohmoto, H. et al. Journal of Medicinal Chemistry 1996 39 1339-1343

Palcic, M.M. et al. Carbohydrate Research 1998 305 433-442

Patel Y., et al, Blood. 2003; 707:4828-4835

Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N. Y.

(1976) Prodger, J. C. et al. Bioorganic Medicinal Chemistry 1996 4 793-801

Ragan, J. A. et al. Bioorganic Medicinal Chemistry Letters 194 4 2563-2566

Rao, N. et al. WO 94/18189

Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa.

Roche, D. et al. Tetrahedron Letters 1998 39 2545-2548

Sambrook et al. Molecular Cloning: A Laboratory Manual, 3rd ed. (2001) Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, N. Y.

Sambrook et al., Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New

York, 1989 and Ausubel el al, Current Protocols in Molecular Biology, Greene Publ.

Assoc, and Wiley-Intersciences, 1992

Sato, S. et al JP 1 1302272

Schmidt, W. et al EP 761661

Shibata, K. Journal Organic Chemistry 2000 65 2393-2398

Singh K. et al Journal Chemical Society Chemical Communcations 1994 775-776

Slee, D.H. et al Journal of Medicinal Chemistry 2001 44 2094-2107

Stahn, R. et al. Glycobiology 1998 8 31 1-319

Sutherlin, D.P. el al Journal of Organic Chemistry 1996 61 8350-8354

Thoma, G el al. Journal of the American Chemical Society 2001 123 101 13-101 14

Thoma, G. Journal Organic Chemistry 1996 61 514-524

Thoma, G. WO 98/06730

Toepfer A. et al. EP 671408

Toepfer A. et al. EP 671409

Toepfer A. et al EP 786467

Toepfer, A. Bioorganic Medicinal Chemistry Letters 1997 7 131 1-1316

Toepfer, A. et al. Bioorganic Medicinal Chemistry Letters 1997 7 1317-1322

Toepfer, A. et al. DE 19537334

Toepfer, A. et al Tetrahedron Letters 1995 36 9161-9164

Tsai, C-Y. et al Bioorganic Medicinal Chemistry Letters 1998 8 2333-2338

Tsai, C-Y. et al Tetrahedron Letters 2000 41 9499-9503

Tsukida, T. et al Journal of Medicinal Chemistry 1998 41 4279-4287

Tsukida, T. et al. WO 97/15585

Uchiyama, T. et al. Bioorganic Medicinal Chemistry 1996 4 1 149-1 165 Uchiyama, T. et al. Journal American Chemical Society 1995 1 17 5395-5396

WO 01/70949

WO 97/01335

WO 97/01335 (PCT/US96/1 1032)

WO 99/49029

Wong C-H. et al. US 5,962,660

Wong C-H. et al. US 6, 1 1 1 ,084

Wong, CC. et al. Journal American Chemical Society 1997 1 19 8152-8158

Yuri, M. JP 1 1246503