Processing

Please wait...

Settings

Settings

Goto Application

1. WO2007140004 - PRIMERS FOR USE IN DETECTING METALLO-BETA-LACTAMASES

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ EN ]

WHAT IS CLAIMED IS:

1. A primer selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO:1);
51 - CAACCAGTTTTGCCTTACC - 31 (SEQ ID NO:2); and fiill-length complements thereof.

2. A primer selected from the group consisting of:
51 - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 3' (SEQ ID NO:4); and full-length complements thereof.

3. A primer selected from the group consisting of:
5' - CGAGAAGCTTGAAGAAGGT - 3' (SEQ ID NO:5);
5' - GCTGTCGCTATGGAAATGTG - 3' (SEQ ID NO:6); and full-length complements thereof.

4. A primer selected from the group consisting of:
5' - GGTGTAGTCACAAAACACGG - 3' (SEQ ID NO:7);
5' - CAGGTAACCAAACCACTACG - 31 (SEQ ID NO:8); and full-length complements thereof.

5. A primer selected from the group consisting of:
5' - GGTGTTTGGTCGCATATCGC - 31 (SEQ ID NO:9);
5' - CCATTCAGCCAGATCGGCATC - 31 (SEQ ID NO: 10); and full- length complements thereof.

6. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the.method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of an IMP- I , IMP-4, 1MP-5, 1MP-6, IMP-7, IMP-10, or IMP- 18 beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase nucleic acid.

7. The method of claim 6 wherein the primers are selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO:1);
51 - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2); and full- length complements thereof.

8. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers having sequences 5' - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO: 1 ), or a full-length complement thereof, and 51 - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

9. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of an IMP-1 1 or IMP-21 beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the anti sense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase nucleic acid.

10. The method of claim 9 wherein the primers are selected from the group consisting of:
51 - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4); and full-length complements thereof.

1 1. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising: providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers having sequences - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3), or a full-length complement thereof, and 5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

12. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of an IMP-2, IMP-8, IMP-13, or IMP-19 beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;

separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase nucleic acid.

13. The method of claim 12 wherein the primers are selected from the group consisting of:
51 - CGAGAAGCTTGAAGAAGGT - 3' (SEQ ID NO:5);
51 - GCTGTCGCTATGGAAATGTG - 3' (SEQ ID NO:6); and full-length complements thereof.

14. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers having sequences 51 - CACCACGAGAATAACC - 3' (SEQ ID NO:5), or a full-length complement thereof, and 5' - GCCTTGAACTCGACCG - 3' (SEQ ID NO:6), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

15. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;

contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of the IMP-18 beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase nucleic acid.

16. The method of claim 15 wherein the primers are selected from the group consisting of:
5' - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO:1 );
5" - CAACCAGTTTTGCCTTACC - 31 (SEQ ID NO:2);
5' - GGTGTAGTCACAAAACACGG - 3' (SEQ ID NO:7);
5f - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8); and full-length complements thereof.

17. The method of claim 16 wherein the primers are selected from the group consisting of:
5' - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO: 1);
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2); and full-length complements thereof.

18. The method of claim 1 wherein the primers are selected from the group consisting of:
5' - GGTGTAGTCACAAAACACGG - 3' (SEQ ID NO:7);

5' - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8); and foil-length complements thereof.

19. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers selected from the group consisting 5' - GGAAT AGAGTGGCTTAATTC - 3' (SEQ ID NO:1), or a full-length complement thereof;
51 -CAACCAGTTTTGCCTTACC - 31 (SEQ ID NO:2), or a full-length complement thereof; 51 - GGTGTAGTCACAAAACACGG - 31 (SEQ ID NO:7), or a full-length complement thereof; and 5' -CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

20. The method of claim 19 wherein the primers are selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO: 1);
5' - CAACCAGTTTTGCCTTACC - 31 (SEQ ID NO:2); and full-length complements thereof.

21. The method of claim 19 wherein the primers are selected from the group consisting of:
5' 5" - GGTGTAGTCACAAAACACGG - 3' (SEQ ID NO:7);
51 - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8); and full-length complements thereof.

22. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of the 1MP-9 beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase nucleic acid.

23. The method of claim 22 wherein the primers are selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO: 1);
5' - CAACCAGTTTTGCCTTACC - 31 (SEQ ID NO:2);
5' - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3);
5" - GTAAGCTTCAAGAGCGACG - 3' (SEQ ID NO:4); and full-length complements thereof.

24. The method of claim 23 wherein the primers are selected from the group consisting of:
5' - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO:1 );
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2); and full-length complements thereof.

25. The method of claim 23 wherein the primers are selected from the group consisting of:
51 - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 3 " (SEQ ID NO:4); and full-length complements thereof.

26. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers selected from the group consisting of 5' - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO:1 ), or a full-length complement thereof;
51 -CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2), or a full-length complement thereof; 51 - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3), or a full-length complement thereof; 5' - GTAAGCTTCAAGAGCGACG - 3' (SEQ ID NO:4), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and analyzing the separated amplified products for a size characteristic of the beta-lactamase.

27. The method of claim 26 wherein the primers are selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO:1);
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2); and full-length complements thereof.

28. The method of claim 26 wherein the primers are selected from the group consisting of:
5' - CCTCACATTTCCATAGCGAC - 3* (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4); and full-length complements thereof.

29. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of the VIM-family of beta-lactamase enzymes, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the. primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

30. The method of claim 17 wherein the primers are selected from the group consisting of:
5' - GGTGTTTGGTCGCATATCGC - 3' (SEQ ID NO:9);
5' - CCATTCAGCCAGATCGGCATC - 3' (SEQ ID NO: 10); and full-length complements thereof.

31. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers having sequences 5' - GGTGTTTGGTCGCATATCGC - 31 (SEQ ID NO:9), or a full-length complement thereof, and 51 - CCATTCAGCCAGATCGGCATC -3' (SEQ ID NO: 10), or a full-length complement thereof, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 31 terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase.

32. A method for identifying a beta-lactamase nucleic acid in a clinical sample, the method comprising:
providing a clinical sample;
contacting the clinical sample with a pair of oligonucleotide primers specific for nucleic acid characteristic of a beta-lactamase enzyme, wherein one primer of the pair is complementary to at least a portion of the beta-lactamase nucleic acid in the sense strand and the other primer of each pair is
complementary to at least a portion of the beta-lactamase nucleic acid in the antisense strand;
annealing the primers to the beta-lactamase nucleic acid;
simultaneously extending the annealed primers from a 3' terminus of each primer to synthesize an extension product that is complementary to the nucleic acid strands annealed to each primer wherein each extension product after separation from the beta-lactamase nucleic acid serves as a template for the synthesis of an extension product for the other primer of each pair;
separating the amplified products; and
analyzing the separated amplified products for a size characteristic of the beta-lactamase;
wherein the primers are selected from the group consisting of:
5' - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO:1);
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2);
5' - CCTCACATTTCCATAGCGAC - 31 (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 3' (SEQ ID NO:4);
5',- CGAGAAGCTTGAAGAAGGT - 3' (SEQ ID NO:5);
5' - GCTGTCGCTATGGAAATGTG - 3' (SEQ ID NO:6);
5' - GGTGTAGTCACAAAACACGG - 31 (SEQ ID NO:7);
5' - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8);
5' - GGTGTTTGGTCGCATATCGC - 31 (SEQ ID NO:9);
5" - CCATTCAGCCAGATCGGCATC - 3' (SEQ ID NO: 10); and full-length complements thereof.

33. A diagnostic kit for detecting an IMP family beta-lactamase nucleic acid, wherein the kit comprises:
(a) at least one primer pair capable of hybridizing to a beta-lactamase nucleic acid;
(b) at least one positive control and at least one negative control; and
(c) a protocol for identification of the beta-lactamase nucleic acid, wherein the primers are selected from the group consisting of: 5' - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO:1);
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2);
51 - CCTCACATTTCCATAGCGAC - 31 (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4);
5' - CGAGAAGCTTGAAGAAGGT - 3' (SEQ ID NO:5);
5( - GCTGTCGCTATGGAAATGTG - 31 (SEQ ID NO:6);
5' - GGTGTAGTCACAAAACACGG - 31 (SEQ ID NO:7);
5' - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8); and full-length complements thereof.

34. The diagnostic kit of claim 33 wherein the primers are selected from the group consisting of:
5' - GGAATAGAGTGGCTTAATTC - 3' (SEQ ID NO:1);
51 - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2); and full-length complements thereof.

35. The diagnostic kit of claim 33 wherein the primers are selected from the group consisting of:
5' - CCTCACATTTCCATAGCGAC - 3' (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4); and full-length complements thereof.

36. The diagnostic kit of claim 33 wherein the primers are selected from the group consisting of:
5" - CGAGAAGCTTGAAGAAGGT - 3' (SEQ ID NO:5);
51 - GCTGTCGCTATGGAAATGTG - 3' (SEQ ID NO:6); and full-length complements thereof.

37. The diagnostic kit of claim 33 wherein the primers are selected from the group consisting of:
51 - GGTGTAGTCACAAAACACGG - 31 (SEQ ID NO:7);
5' - CAGGTAACCAAACCACTACG - 3' (SEQ ID NO:8); and full-length complements thereof.

38. A diagnostic kit for detecting a VIM family beta-lactamase, wherein the kit comprises:
(a) at least one primer pair capable of hybridizing to a beta-lactamase nucleic acid;
(b) at least one positive control and at least one negative control; and
(c) a protocol for identification of the beta-lactamase nucleic acid, wherein at least one of the primers of the primer pair is selected from the group consisting of:
51 - GGTGTTTGGTCGCATATCGC - 3' (SEQ ID NO:9);
51 - CCATTCAGCCAGATCGGCATC - 3' (SEQ ID NO: 10); and full-length complements thereof.

39. A diagnostic kit for detecting a metallo-beta-lactamase nucleic acid, wherein the kit comprises:
(a) at least one primer pair capable of hybridizing to a beta-lactamase nucleic acid;
(b) at least one positive control and at least one negative control; and
(c) a protocol for identification of the beta-lactamase nucleic acid, wherein the primers are selected from the group consisting of:
51 - GGAATAGAGTGGCTTAATTC - 31 (SEQ ID NO:1 );
5' - CAACCAGTTTTGCCTTACC - 3' (SEQ ID NO:2);
5' - CCTCACATTTCCATAGCGAC - 31 (SEQ ID NO:3);
5' - GTAAGCTTCAAGAGCGACG - 31 (SEQ ID NO:4);
51 - CGAGAAGCTTGAAGAAGGT - 3f (SEQ ID NO:5);
51 - GCTGTCGCTATGGAAATGTG - 3' (SEQ ID NO:6);
5' - GGTGTAGTCACAAAACACGG - 3' (SEQ ID NO: 7);
5' - CAGGTAACCAAACCACTACG - 31 (SEQ ID NO:8);
5' - GGTGTTTGGTCGCATATCGC - 3' (SEQ ID NO:9);
5' - CCATTCAGCCAGATCGGCATC - 3' (SEQ ID NO: 10); and full-length complements thereof.