Processing

Please wait...

Settings

Settings

Goto Application

1. WO2006097636 - NUCLEIC ACID FRAGMENTS AND SPECIFIC DETECTION METHOD BY MOLECULAR IDENTIFICATION OF DIFFERENT BACTERIA SPECIES OF THE GENUS ACINETOBACTER

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ FR ]

FRAGMENTS D'ACIDES NUCLEIQUES ET METHODE DE DETECTION SPECIFIQUE PAR IDENTIFICATION MOLECULAIRE DE DIFFERENTES ESPECES DE BACTERIES DU GENRE ACINETOBACTER

La présente invention concerne le domaine du diagnostic. Plus précisément, l'invention concerne une méthode pour l'identification moléculaire des bactéries du genre Acinetobacter par les techniques d'amplification et séquençage d'acides nucléiques à l'aide d'amorces oligonucléotidiques.

Les bactéries du genre Acinetobacter sont des bactéries apparaissant sous forme de cocco-bacilles Gram négatif, de croissance aérobie. On reconnaît actuellement presque 60 espèces et 2 sous espèces.

Ces bactéries sont essentiellement, mais pas uniquement, des agents d'infections nosocomiales. Leur spectre va de la simple colonisation à des infections mettant en jeu le pronostic vital, notamment des pneumonies, des infections urinaires, des bactériémies et des méningites (van Dessel et al., 2004) . Leur excellente capacité de survie dans l'environnement extérieur de l'hôpital et leur capacité à développer rapidement des résistances à la majorité des antibiotiques sont des facteurs majeurs de leur émergence comme agent d'infections nosocomiales, notamment dans les unités de soin intensif (Bergogne-Berezin and Towner, 1996; Towner, 1997) .

Bien que la plupart des espèces soient responsables d'infections chez l'homme, certaines espèces n'ont été isolées que dans l'environnement (Nemec et al., 2001 , 2003; Carr et al., 2003) .

Alors que, dans le genre Acinetobacter, 32 espèces ont été proposées

(van Dessel et al., 2004), 24 espèces génomiques (" genomic species » selon la nomenclature en vigueur et abrégées ci-après « geno species » ou « g.sp. ») sont reconnues et seulement 17 espèces ont un nom validé (Nemec et al., 2003; Carr et al. , 2003) . Malheureusement, les membres de ce genre ont une très grande variabilité phénotypique intra-spécifique.et ne sont donc pas différentiables sur un plan phénotypique L'accroissement du nombre d'infections liées à ces agents a stimulé la recherche de méthodes d'analyse pour l'identification et la taxonomie de ces bactéries. Il a aussi été démontré que les méthodes d'identification basées sur les caractères phénotypiques et le séquençage du gène de TARN 16S ribosomique par comparaison à l'hybridation DNA-DNA n'étaient pas valables. Ainsi, la recherche de méthodes d'identification rapide de ces bactéries est toujours d'actualité (Gerner-Smidt et al., 1991 ; Ibrahim et al., 1997; Rainey et al., 1994) . Notamment, les techniques moléculaires basées sur le séquençage du gène de l'ARN 16S ribosomique ne permettent pas de distinguer les espèces les plus proches, notamment en raison d'un manque de polymorphisme de ce gène dans ce genre. (Yamamoto and Harayama, 1998; Ochman and Wilson, 1987; Stackebrandt and Goebel, 1994). De plus, en raison de ce manque de polymorphisme, il y a nécessité de déterminer la séquence complète du gène 16S ARNr si l'on désire pouvoir identifier une espèce. Cela impose de séquencer la totalité du gène qui fait environ 1600 paires de bases. La conséquence pratique est que le séquençage doit s'appuyer sur un minimum de 6 réactions de séquençage en plus de la réaction d'amplification pour avoir un résultat évaluable. Des tentatives de phylogénies ont été faites en utilisant la comparaison des gènes gyrV> (Yamamoto and Harayama, 1996; Yamamoto et al., 1999) et recK (Krawczyk et al., 2002) en alternative au gène de l'ARN 16S ribosomique (Ibrahim et al., 1997). Malheureusement, les séquences de ces gènes n'ont pas été déterminées sur les 10 espèces les plus récentes (Nemec et al., 2001 , 2003; Carr et al., 2003) .

Il existe donc toujours une demande d'un outil d'identification moléculaire des bactéries des espèces du genre Acinetobacter, utilisable en routine au laboratoire de bactériologie, avec notamment un gène suffisamment polymorphique, tel que la détermination d'une séquence courte (moins de 500 paires de bases) avec seulement 1 réaction d'amplification et deux réactions de séquences soit identifiante, c'est-à-dire amplifiable et séquençable par l'utilisation d'un seul jeu d'amorces.

Les inventeurs ont découvert et démontré selon la présente invention, que

- le gène rpoB et les séquences non codantes qui le bornent, à savoir

- les séquences non codantes en 5' entre les séquences des gènes rp/L et rpoB (ci- après dénommées " spacer rplL-rpoB " ou « fragment intergénique rp/L- rpoB »), et

- les séquences non codantes en 3' entre les séquences des gènes rpoC et rpoB (ci-après dénommées " spacer rpoB-rpoC " ou « fragment intergénique rpoB-rpoC ») ,

constituent un marqueur génétique permettant la détection et l'identification spécifique de la bactérie de chaque espèce du genre Acinetobacter et, en particulier, les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. bmimannii (espèce génomique2), espèce génomique 3, A. haemo/yticusÇes-pèce. génomique 4), A. jttnii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7) , A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. bajlji, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus.

Les espèces génomiques 1 à 16 ("genomic species ») correspondent à des souches référencées dans GENEBANK, pour certaines (n°3, 6, 9, 10, 13 et 16) aucun nom ne leur ayant encore été attribuées.

Les inventeurs ont découverts certaines zones hypervariables entre les différentes espèces et donc spécifiques de chaque espèce, encadrées par des séquences conservées entre les différentes espèces, permettant de mettre en œuvre une méthode d'identification moléculaire des différentes espèces de bactéries Acinetobacter par amplification à l'aide d'amorces choisies dans les séquences conservées et hybridation et/ou séquençage des séquences spécifiques ainsi amplifiées.

Plus particulièrement, la présente invention concerne des séquences d'acides nucléiques spécifiques de chaque espèce du genre Λcinetobacter citée ci-dessus dont la séquence nucléotidique est tirée du gène rpόh des dites bactéries.

Selon Lazcano et al. Q. Mo1- Evo1- (1988) 27 :365-376], les ARN polymérases sont divisées en deux groupes selon leur origine, l'un constitué par les ARN polymérases virales ARN- ou ADN-dépendantes, et l'autre constitué par les ARN polymérases ADN-dépendantes d'origine eucaryote ou procaryotes (archaébactéries et eubactéries) . Les ARN polymérases ADN-dépendantes eubactériennes sont caractérisées par une constitution multimérique simple et conservée notée " core enzyme ", représentée par αββ', ou " holoenzyme " représentée par αββ'σ [Yura and Ishihama, Ann. Rev. Genêt. (1979) 13 :59-97] . De nombreux travaux ont mis en évidence le rôle fonctionnel, au sein du complexe enzymatique multimérique, de la sous-unité β de l'ARN polymérase eubactérienne. Les ARN polymérases archaébactérienne et eucaryote présentent, pour leur part, une structure plus complexe pouvant atteindre une dizaine, voire une trentaine de sous-unités [Pùhlet et al. Proc . Natl. Acad. Sci. USA (1989) 86 :4569-4573] .

Les gènes qui codent les différentes sous-unités Ocββ'σ de l'ARN polymérase ADN-dépendante chez les eubactéries, respectivement les gènes rpoA., rpoB, rpoC et rpoD, sont classés en différents groupes comprenant les gènes codant pour des protéines constitutives des sous-unités ribosomiques ou pour des enzymes impliqués dans la réplication et la réparation du génome

[Yura and Yshihma, Ann. Rev. Genêt. (1979) 13 :59-97] . Certains auteurs ont montré que les séquences des gènes rpoB et rpoC pouvaient être utilisées afin de construire des arbres phylogénétiques [Rowland et al. Biochem. Soc.

Trans. (1992) 21 :40S] permettant de séparer les différents embranchements et sous-embranchements parmi les règnes du vivant.

Avant d'exposer plus en détail l'invention, différents termes, utilisés dans la description et les revendications, sont définis ci-après: - par " acide nucléique extrait de bactéries " on entend soit l'acide nucléique total, soit l'ADN génomique, soit les ARN messagers, soit encore l'ADN obtenu à partir de la transcription inverse des ARN messagers ;

- un " fragment nucléotidique " ou un " oligonucléotide " sont deux termes synonymes désignant un enchaînement de motifs nucléotidiques caractérisé par une séquence informationnelle des acides nucléiques naturels (ou éventuellement modifiés) et susceptibles de s'hybrider, comme les acides nucléiques naturels, avec un fragment nucléotidique complémentaire ou sensiblement complémentaire, dans des conditions prédéterminées de stringence stricte. L'enchaînement peut contenir des motifs nucléotidiques de structure différente de celle des acides nucléiques naturels. Un fragment nucléotidique (ou oligonucléotide) peut contenir par exemple jusqu'à 100 motifs nucléotidiques. Il contient généralement au moins 10, de préférence de 18 à 35, motifs nucléotidiques et peut être obtenu à partir d'une molécule d'acide nucléique naturelle et/ou par recombinaison génétique et/ou par synthèse chimique,

- un motif nucléotidique est dérivé d'un monomère qui peut être un nucléotide naturel d'acide nucléique dont les éléments constitutifs sont un sucre, un groupement phosphate et une base azotée choisie parmi l'adénine (A), la guanine (G), Furacile (U), la cytosine (C), la thymine (T) ; ou bien le monomère est un nucléotide modifié dans l'un au moins des trois éléments constitutifs précédents ; à titre d'exemple, la modification peut intervenir soit au niveau des bases, avec des bases modifiées telles que l'inosine, qui peut s'hydrider avec toute base A, T, U, C ou G, la méthyl-5-désoxycytidine, la désoxyuridine, la diméthylamino-5-désoxyuridine ou toute autre base modifiée capable d'hybridation, soit au niveau du sucre, par exemple le remplacement d'au moins un désoxyribose par un polyamide [Nielsen PE et al., Science (1991) 254 : 1497-1500] , soit encore au niveau du groupement phosphate, par exemple par remplacement par des esters choisis notamment parmi les diphosphates, les alkylphosphonates et les phosphorothioates, - par " hybridation ", on entend le processus au cours duquel, dans des conditions appropriées, deux fragments nucléotidiques ayant des séquences suffisamment complémentaires sont susceptibles de s'associer par des liaisons hydrogène stables et spécifiques, pour former un double brin. Les conditions d'hybridation sont déterminées par la " stringence ", c'est à dire la rigueur des conditions opératoires. L'hybridation est d'autant plus spécifique qu'elle est effectuée à plus forte stringence. La stringence est fonction notamment de la composition en bases d'un duplex sonde/cible, ainsi que par le degré de mésappariement entre deux acides nucléiques. La stringence peut également être fonction des paramètres de la réaction d'hybridation, tels que la concentration et le type d'espèces ioniques présentes dans la solution d'hybridation, la nature et la concentration d'agents dénaturants et/ou la température d'hybridation. La stringence des conditions dans lesquelles une réaction d 'hybridation doit être réalisée dépend notamment des sondes utilisées. Toutes ces données sont bien connues et les conditions appropriées peuvent éventuellement être déterminées dans chaque cas par des expériences de routine. En général, selon la longueur des sondes utilisées, la température pour la réaction d'hybridation est comprise entre environ 20 et 65°C, en particulier entre 35 et 650C dans une solution saline à une concentration d'environ 0,8 à 1 M.

- une " sonde " est un fragment nucléotidique possédant une spécificité d'hybridation dans des conditions déterminées pour former un complexe d 'hybridation avec un acide nucléique ayant, dans le cas présent, une séquence nucléotidique comprise soit dans un ARN messager, soit dans un ADN obtenu par transcription inverse dudit ARN messager, produit de transcription ; une sonde peut être utilisée à des fins de diagnostic (notamment sondes de capture ou de détection) ou à des fins de thérapie,

- une sonde peut être immobilisée ou immobilisable sur un support solide par tout moyen approprié, par exemple par covalence, par adsorption, ou par synthèse directe sur un solide. Des exemples de supports comprennent les plaques de microtitration et les puces à ADN, - une " sonde" est en général marquée au moyen d'un agent marqueur choisi par exemple parmi les isotopes radioactifs, les enzymes, en particulier les enzymes susceptibles d'agir sur un substrat chromogéne, fluorigène ou luminescent (notamment une peroxydase ou une phosphatase alcaline), les composés chimiques chromophores, les composés chromogènes, fluorigènes ou luminescents, les analogues des bases nucléotidiques .Ce marquage peut être directe entre l'ADN et le dit marqueur ou indirecte c'est à dire par l'intermédiaire de ligands tels que la biotine ou autre molécule apte à se lier à des agents de marquage,

- une " sonde d'espèce " est une sonde permettant l'identification spécifique de l'espèce d'une bactérie d'un genre donné, en l'espèce ici acinetobacter,

- une " sonde de genre" est une sonde permettant l'identification spécifique du genre de la bactérie quelque soit l'espèce de la bactérie dudit genre dans certaines conditions d'hybridation,

- une " amorce " est une sonde comprenant par exemple 10 à 100 motifs nucléotidiques et possédant une spécificité d'hybridation dans des conditions déterminées pour les réactions d'amplification enzymatique,

- par "amorce de genre", on entend un jeu d'amorces permettant l'amplification spécifique de toute bactérie d'un même genre donné, sans distinction de l'espèce, dans des certaines conditions d'hybridation et d'amplification (les "amorces de genre" sont aussi appelées "amorces consensus " ou "amorces universelles " dans la présente demande)

par "réaction d'amplification" on entend une réaction de polymérisation enzymatique, par exemple dans une technique d'amplification telle que la PCR, initiée par des oligonucléotides amorces et utilisant une ADN polymérase.

- par "réaction de séquençage", on entend une réaction conduisant à la détermination de la séquence d'un fragment d'acide nucléique ou d'un gène complet par un procédé de polymérisation abortive à partir d'amorces oligonucléotidiques et utilisant lesdits didésoxynucléotides (Sanger F, Coulson AR (1975), J.Mol.Biol. 94 : 441) ou par hybridations multiples avec des sondes multiples fixées sur support solide telles qu'utilisées dans les puces ADN par exemple, ou d'autres techniques connues de l'homme de l'Art.

Les inventeurs ont déterminé les séquences complètes des gènes rpoB et des séquences non codantes flanquantes qui le bornent et le séparent des gènes rp/L et rpoC (" fragment intergénique rplL-rpoB " et " fragment intergénique rpoB-rpoC ") de 24 espèces du genre Λcinetobacter: A. calcoaceticus (espèce génomique 1), A. bautnannii (espèce génomique 2), espèce génomique 3, A. bae?%o/yticus(esτpèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus.

Pour arriver à déterminer lesdites séquences complètes de rpoB et ses séquences flanquantes de la totalités des espèces de bactéries Acinetobacter , les inventeurs ont du, après un grand nombre d'essais infructueux, déterminer tout d'abord 51 amorces (Tableau 2), à partir de la seule séquence rpoB et des zones non codantes qui la bornent de bactéries du genre Acinetobacter des séquences correspondantes de bactéries qu'ils ont identifiées comme proches disponibles sur GENBANK, à savoir Acinetobacter sp. ADPl (GeneBank accession number NC_005966), Pseudomonas syringae pv.tomato str.DC3000 (GeneBank accession number NC 004578) et P. putida KT2440 (GeneBank accession number NC 006347) .

La souche Acinetobacter sp.ADPl est une souche qui n'avait pas été caractérisée avant l'invention et qui ne correspond à aucune des souches pathogènes décrites dans la présente demande de brevet et listées ci-après.

La présente invention a donc pour objet un gène complet rpoB d'une bactérie du genre Acinetobacter choisie parmi les 23 espèces suivantes : A.

calcoaceticus (espèce génomique 1), espèce génomique 3, A- haemolyticus(es-pèce. génomique 4), A., junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernhergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend ,et plus particulièrement consiste en une séquence choisie parmi les séquences telle que décrite dans les séquences SEQ. ID. n°9 et 1 1 à 32 respectivement, et les séquences présentant au moins au moins 98% de similitude, ainsi que leurs séquences complémentaires.

La présente invention a également pour objet les fragment d'acide nucléique comprenant, et plus particulièrement consistant dans un fragment non codant encadrant le gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5) , espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend, et plus particulièrement consiste en une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n° 121 à 144 respectivement, et les séquences SEQ. ID. n°165 à 188 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

Les dites séquences présentant des taux de similitude d'au moins 98% avec les dites séquences SEQ. ID. 9 à 32, 121 à 144 et 165 à 188 correspondent aux variations possibles entre les différentes souches d'une même espèce correspondant éventuellement à des sous-espèces. Ainsi, les séquences SEQ. ID. n°145 à 164 et 189 à 208 correspondent à diverses souches d'A. baumannii présentant au moins 98% d'homologie avec, respectivement, les séquences SEQ. ID . n° 122 et 166.

On entend ici par "taux de similitude" ou "pourcentage d'homologie", un pourcentage d'identité de séquences, c'est-à-dire un pourcentage de nucléotides de la séquence qui sont identiques à la même position par rapport à une autre séquence.

Les séquences SEQ. ID. n° 121 à 144 correspondent aux séquences flanquantes en 5' représentant le fragment intergénique rplL-rpo~S> complet qui borne le gène rpoB entre les gènes rp/L et rpoB, d'une longueur comprise entre 301 et 310 pb, pour chaque espèce de la bactérie du genre Λcinetobacter, pour les 24 espèces mentionnées ci-dessus.

Les séquences SEQ. ID. n° 165 à 188 correspondent aux séquences flanquantes en 3' représentant le fragment intergénique rpoB-rpoc complet qui borne le gène rpo~B entre les gènes rpoB et rpoC, d'une longueur comprise entre 86 et 177 pb, pour chaque espèce de la bactérie du genre Λcinetobacter, pour les 24 espèces mentionnées ci-dessus.

Les fragments intergéniques rpoB-rpoC et rp/L-rpoB qui bornent le gène rpoB et la séquence complète du gène tpoB peuvent être utilisées pour identifier la bactérie pas seulement à titre de sonde et/ou par l'étude de sa séquence primaire, mais aussi, par l'étude des structures secondaire et tertiaire de l'ARN messager provenant de la transcription de la séquence complète d'ADN.

Dans ces gènes rpoU et les séquences non codantes qui les bornent (fragment intergénique rp/L-rpo'B et fragment intergénique rpo3-rpoC) d' Λcinetobacter, les inventeurs ont mis en évidence des séquences consensus SEQ. ID. n° l , 2, 3, 4, 5, 6, 7 et 8 (Tableau 3) qui sont des séquences conservées entre toutes les bactéries du genre Acinetobacter, c'est-à-dire pouvant être utilisées comme amorces permettant d'amplifier la même portion du gène rpoB et les zones non codantes qui le bornent (fragment intergénique tpIL-rpoB et fragment intergénique rpo~B-rpoC) de toutes lesdites bactéries Acinetobacter:, à savoir :

SEQ. ID. n°l , et 2 pour une première zone du gène rpoB,

- SEQ. ID. n°3, et 4 pour une seconde zone du gène rpoB,

- SEQ. ID. n°5, et 6 pour le fragment intergénique rp/L-rpoB, et

- SEQ. ID. n°7, et 8 pour le fragment intergénique rpoB-rpoC

-SEQ. ID. n° 1 à 4 et 6-7 sont à l'intérieur du gène rpoB, avec :

SEQ. ID. n° 8 et 6 sont à proximité des extrémités 5' des gènes rpoB, et respectivement rpoC.

- SEQ. ID. n° 7 et 5 sont à proximité des extrémités 3' des gènes rp/L et respectivement rpoB.

La présente invention fournit donc des oligonucléotides qui présentent des séquences conservées d'une bactérie Acitenobacter choisie parmi les dites 24 espèces comprenant une séquence d'au moins 12, de préférence d'au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°l à 8 suivantes, leurs séquences complémentaires, de préférence consistant dans les dites séquences:

- SEQ. ID. n° 1 : 5'-TA YCGYAAA GAYTTGAAAGAAG-3',

- SEQ. ID. n° 2 : 5'-CMACACCYTTGTTMCCRTGA-3',.

- SEQ. ID. n° 3 : δ'-GTGATAARATGGCBGGTCGT-S',

- SEQ. ID. n° 4 : 5'-CGBGCRTGCATYTTGTCRT-3',

- SEQ. ID. n° 5 : 5 '-GAAGARCTTAAGAMDAARCTTG-S'

- SEQ. ID. n° 6 : 5'-CGTTTCTTTTCGGTATATGAGT-S', - SEQ. ID. n° 7 : 5'- GTTCTTTAGGTATCAACATTGAA -3',

- SEQ. ID. n° 8 : 5'- GACGCAAGACCAATACGRAT -3',

dans lesquelles :

-D représente A, G ou T,

- Y représente C ou T,

- B représente C, G ou T,

- R représente A ou G, et

- M représente A ou C.

A la position correspondant à un nucléotide D, Y, B, M ou R dans les séquences SEQ. ID. n° l 2, 3, 4, 5 et 8 on trouve dans les séquences cibles complémentaires des nucléotides variables en fonction de l'espèce de la bactérie considérée, mais tous les autres nucléotides sont conservés dans toutes les espèces des bactéries du genre A.cinetobacter.

Les séquences SEQ. ID . n° 1 , 3, 5 et 7 sont utilisées à titre d'amorces sur le brin direct et les séquences SEQ. ID. n°2, 4, 6 et 8 sont utilisées à titre d'amorce sur le brin indirect. Les séquences SEQ. ID. n°2, 4, 6 et 8 correspondent donc à des séquences complémentaires de celles du brin direct.

Pour être utilisés à titre d'amorces consensuelles, ces oligonucléotides de séquences SEQ. ID. n° l , 2, 3, 4, 5 et 8 sont donc mis en œuvre, en fait, sous forme de mélanges équimolaires d'oligonucléotides de séquences différentes, lesdits oligonucléotides de séquences différentes répondant pour chaque séquence SEQ. ID. n° l à 8 aux diverses définitions possibles des séquences respectivement n° l , 2, 3, 4, 5 et 8.

Ces mélanges équimolaires d'oligonucléotides sont obtenus en mettant en oeuvre, lors de la synthèse oligonucléotidique, des mélanges équimolaires des différents nucléotides concernés respectivement : - A, G et T pour D,

- C et T pour Y,

- C, G et T pour B,

- A et G pour R,

- A et C pour M.

Les mélanges d'oligonucléotides, répondant aux nucléotides de définition des séquences SEQ. ID. n° l 2, 3, 4, 5 et 8, peuvent donc s'hybrider avec les différentes séquences complémentaires cibles incluses dans les gènes tpoB et aux extrémités des gènes rp/L et rpoC encadrant les zones non codantes qui les bornent (fragment intergénique rplL-rpόft et fragment intergénique rpo~B-rpoC) de toutes les espèces de bactéries du genre Acinetobacter et, plus particulièrement, les 24 espèces citées ci-dessus.

La capacité de ces amorces à amplifier des fragments de gènes rpoB et des zones non codantes qui les bornent (fragment intergénique rp/L-tpo'B et fragment intergénique rpoB-rpoC), de toutes les espèces à'Acinetobacter permet de considérer que ces amorces seront efficaces pour l'identification d'espèces à'Acinetobacter additionnelles qui seraient décrites dans le futur.

La présente invention a donc également pour objet un mélange d'oligonucléotides caractérisé en ce qu'il comprend un mélange équimolaire d'oligonucléotides de séquences différentes comprenant au moins 12, de préférence au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences SEQ. ID. n° 1 à 5 et 8 ou les oligonucléotides de séquences complémentaires.

Plus particulièrement, la présente invention a pour objet les mélanges d'oligonucléotides suivants :

un mélange équimolaire de 8 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° l , ou des oligonucléotides de séquences complémentaires.

- un mélange équimolaire de 16 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°2 ou des oligonucléotides de séquences complémentaires.

un mélange équimolaire de 6 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°3 ou des oligonucléotides de séquences complémentaires.

- un mélange équimolaire de 24 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° 4 ou des oligonucléotides de séquences complémentaires.

- un mélange équimolaire de 24 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° 5 ou des oligonucléotides de séquences complémentaires.

- oligonucléotide de séquence consistant dans la séquence SEQ. ID. n°6 ou séquence complémentaire.

- oligonucléotide de séquence consistant dans la séquence SEQ. ID. n°7 ou séquence complémentaire.

un mélange équimolaire de 2 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°8 ou des oligonucléotides de séquences complémentaires.

Les oligonucléotides ou mélanges d'oligonucléotides comprenant une séquence incluse dans l'une des séquences SEQ. ID. n° 1 à 8 selon l'invention, peuvent être utilisés à titre d'amorces de genre des bactéries du genre acinetobacter.

Comme mentionné précédemment, en outre, les séquences consensus SEQ. ID. n°l, 2, 3, 4, 5 et 8, ainsi définies, encadrent des séquences hyper variables dont la séquence est spécifique pour chaque espèce des bactéries du genre Acinetobacter.

Les inventeuts ont ainsi pu mettre en évidence des séquences spécifiques d'espèces pour chacune des 24 espèces de bactéries citées ci-dessus, correspondant aux séquences :

- SEQ. ID. n°33 à 56, encadrées par les séquences consensus SEQ. ID. n°l et 2 (ci-après "zone 1 de rpoB");

- SEQ. ID. n°77 à 100, encadrées par les séquences consensus SEQ. ID. n°3 et 4 (ci-après "zone 2 de rpoB");

- SEQ. ID. n°121 à 144, encadrées par les séquences consensus SEQ. ID. n°5 et 6 (ci-après "fragment intergénique rpo/L-rpoB"); et

- SEQ. ID. n°165 à 188, encadrées par les séquences consensus SEQ.

ID. n°7 et 8 (ci-après "fragment intergénique rpoB-rpoC");

Les oligonucléotides de séquences encadrées par les SEQ. ID. n°l 2, 3, 4, 5, 6, 7 et 8, peuvent donc être utilisés à titre de sonde d'espèce des bactéries du genre Acinetobacter.

Lesdites séquences hyper variables spécifiques SEQ. ID. n°33 à 56 encadrées par les séquences SEQ. ID. n°l et 2, représentent un fragment du gène rpoB d'une longueur de 350 pb avec moins de 96% de similitude entre les différentes espèces (tableau 7) à l'exception des couples A. boy Hi/ ge.no. species 11 et A. grimontii/ 'A. junii, de sorte qu'elles constituent une courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus, à l'exception des couples A. baylii/ geno. species 11 et A . grim o n HiI A . Ju n ii, .

Lesdites séquences hyper variables spécifiques SEQ. ID. n°77 à 100 encadrées par les séquences SEQ. ID. n°3 et 4, représentent un fragment du gène rpo3 d'une longueur de 450 pb avec moins de 96% de similitude entre les différentes espèces (tableau 8) à l'exception des couples A. baylii/ ge.no. species 1 1 et A. grimontii/ 'A. jnnii, de sorte qu'elles constituent une deuxième courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus, à l'exception des couples A. bayliil geno. species 11 et A. grimontii/ 'A. juni .

Lesdites séquences hyper variables spécifiques SEQ. ID. n° 121 à 164 encadrées par les séquences SEQ. ID. n°5 et 6, représentent le fragment intergénique rplL-rpo~S> qui borne le gène rpo¥> d'une longueur comprise entre

301 et 310 pb avec moins de 97% de similitude entre les différentes espèces

(voir tableau 5 ci-après) à l'exception des couples A. bayliil geno. species 1 1 ,

A. grimontii I A. junii, et A. Iwoffi/ geno. species 9, de sorte qu'elles constituent une troisième courte séquence spécifique cible pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les

24 espèces mentionnées ci-dessus, à l'exception des couples A. baylii/ geno. species 1 1 , A. grimontii / 'A. junii, et A. I tu offi/ ge.no. species 9.

Enfin, lesdites séquences hyper variables spécifiques SEQ. ID. n° 165 à 188 encadrées par les séquences SEQ. ID. n°7 et 8, représentent le fragment intergénique rpoϋ-rpoC qui borne le gène rpoB d'une longueur comprise entre 86 et 177 pb avec moins de 97% de similitude entre les différentes espèces (voir tableau 6 ci-après) à l'exception des couples A. grimontii/ A. junii et des espèces du groupe Acb (A. baumannii, A ; calcoaceticus et genospecies 3, de sorte qu'elles constituent une quatrième courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus , à l'exception des couples A. grimontii I A. junii et des espèces du groupe Acb (A. baumannii, A ; calcoaceticus et genospecies 3.

Un autre objet de la présente invention est donc un fragment de gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces: A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. baemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. nrsingii, A. baylyi, A. bouυetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence consiste en une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n° 33 à 56 respectivement, et les séquences SEQ. ID. n°77 à 100 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

La présente invention a également pour objet un fragment de gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 23 espèces: A. calcoaceticns (espèce génomique 1), espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n° 33 et 35 à 56 respectivement, et les séquences SEQ. ID. n°77 et 79 à 100 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

Les dites séquences présentant des taux de similitude d'au moins 98% avec les dites séquences SEQ. ID. n°33 à 56 et 77 à 100 correspondent aux variations possibles entre les différentes souches d'une même espèce correspondant éventuellement et plus particulièrement à des sous-espèces. Ainsi les séquences SEQ. ID. n°57 à 76 et 101 à 120 correspondent à diverses souches de A. baumannii présentant au moins 98% d'homologie avec, respectivement, SEQ. ID. n° 34 et 78.

La présente invention a donc également pour objet l'utilisation à titre de sonde d'espèce d'un fragment de gène rpoB, rp/1 ou rpoC selon l'invention ou d'un oligonucléotide de séquences spécifiques d'une dite espèce de bactérie Acinetobacter selon l'invention.

Plus précisément, la présente invention fournit un procédé de détection par identification moléculaire d'une bactérie de l'une des espèces du genre Λ.cinetobacter caractérisé en ce qu'on utilise :

- le gène rpoB complet de ladite bactérie selon l'invention, comprenant une dite séquence SEQ. ID . n°9 à 32, ou de préférence consistant en une dite séquence SEQ. ID. n°9 à 32, ou les séquences complémentaires, ou séquences présentant au moins 98% de similitude,

- un fragment de gène rpoB d'une dite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°33 à 56 ou 77 à 100, ou consistant en une dite séquence SEQ. ID. n°33 à 56 ou 77 à 100 les séquences complémentaires, ou séquences présentant au moins 98% de similitude,

- un fragment de gène rpoR d'une dite bactérie selon l'invention, comprenant une dite séquence SEQ. ID . n°77 à 100, ou, de préférence, consistant en une dite séquence SEQ. ID. n°77 à 100, ou séquences complémentaires, ou séquences présentant au moins 98% de similitude,

- un fragment de gène comprenant un fragment intergénique rp/L-rpo~B ou rβoïï-rpoC complet de ladite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°121 à 144 ou 165 à 188, ou de préférence consistant en une dite séquence SEQ. ID. n° 121 à 144 ou 165 à 188, les séquences complémentaires ou séquences présentant au moins 98% de similitude.

- un oligonucléotide présentant une séquence spécifique d'une bactérie Acitenobacter choisie parmi les 24 espèces ci-dessus de préférence d'au moins 18 , de préférence encore de 18 à 35, motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences :

- SEQ. ID. n°33 à 56 respectivement,

- SEQ. ID. n°77 à 100 respectivement, - SEQ. ID. n°121 à 144 respectivement,

- SEQ. ID. n°165 à 188 respectivement, et

- les séquences présentant au moins 98% de similitude et leurs séquences complémentaires; ou

- un oligonucléotide ou mélange équimolaire d'oligonucléotides selon l'invention, comprenant une séquence d'au moins 12, de préférence 18 nucléotides consécutifs inclus dans l'une des séquences SEQ. ID. n° l 2, 3, 4, 5, 6, 7 et 8 ou les séquences complémentaires, ou de préférence consistant dans l'une desdites séquences SEQ. ID. n° l 2, 3, 4, 5, 6, 7 et 8.

Dans un premier mode de réalisation d'un procédé de détection d'une bactérie selon l'invention, on cherche à détecter spécifiquement une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. banmannii (espèce génomique 2), espèce génomique 3, A.
génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouυetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus , procédé dans lequel :

1 - on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un oligonucléotide ou un fragment de gène selon l'invention, de préférence un fragment de gène consistant respectivement dans l'une desdites séquences choisie parmi :

- SEQ. ID . n°33 à 56 respectivement,

- SEQ. ID. n°77 à 100 respectivement,

- SEQ. ID. n°121 à 144 respectivement, - SEQ. ID . n°165 à 188 respectivement, et

- les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

2- on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques de l'échantillon, et on détermine ainsi la présence de ladite espèce de Jicinetobacter dans l'échantillon s'il y a formation d'un complexe d'hybridation.

Dans un deuxième mode de réalisation d'un procédé de détection d'une bactérie du genre Acinetobacter d'une espèce spécifique, on réalise les étapes dans lesquelles :

1 - on met en contact des amorces d'amplification comprenant desdits mélanges d'oligonucléotides selon l'invention, avec un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie du genre Λcinetobacter, et on réalise une amplification d'acides nucléiques par réaction de polymérisation enzymatique comprenant :

comme amorce 5', au moins un oligonucléotide ou mélange d'oligonucléotides selon l'invention comprenant une séquence incluse dans l'une des séquences SEQ. ID. n° 1 , 3, 5 et 7 de préférence consistant dans ladite séquence SEQ. ID. n° l , 3, 5 et 7 complète ou les séquences complémentaires, et

comme amorce 3', au moins un oligonucléotide ou mélange d'oligonucléotides selon l'invention comprenant des séquences incluses dans l'une des séquences SEQ. ID. n° 2, 4 6, et 8 respectivement, de préférence consistant dans ladite séquence SEQ. ID. n°2, 4, 6, et 8 complète ou respectivement une séquence complémentaire.

2- et on détermine l'apparition ou l'absence d'un produit d'amplification, et on détermine ainsi la présence ou l'absence de ladite bactérie dans l'échantillon si un produit d'amplification est ou n'est pas apparu respectivement.

Plus particulièrement, on cherche à détecter une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus

(espèce génomique 1), A. baumannii (espèce géno?nique 2), espèce génomique 3, A. haemolyticus (espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoit, A. tjernbergiae, A. towneri, A. parvus., et, à l'étape 2 ci-dessus, on détermine la présence ou l'absence de l'espèce donnée d'une dite bactérie en effectuant les étapes dans lesquelles :

a) on réalise une réaction de séquençage d'un fragment de gène amplifié avec des dites amorces, et

b) on compare la séquence dudit fragment amplifié obtenu avec la séquence d'un fragment de gène de ladite bactérie comprenant respectivement :

- lesdites séquences SEQ. ID. n° 33 à 56, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 1 et 2 respectivement

- les dites séquences SEQ. ID. n° 77 à 100, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences

SEQ. ID. n° 3 et 4 respectivement, et

- les dites séquences SEQ. ID. n° 121 à 144, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 5 et 6 respectivement, et

- les dites séquences SEQ. ID. n° 165 à 188, lorsque les dites amorces

5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement.

Dans une autre variante dudit deuxième mode de réalisation d'un procédé de détection d'une bactérie du genre Acinetobacter d'une espèce spécifique, dans lequel, on cherche à détecter une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce gênomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A.. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleή, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, à l'étape 2 ci-dessus on détermine la présence ou l'absence de l'espèce donnée d'une dite bactérie par en effectuant les étapes dans lesquelles :

a- on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques amplifié d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un fragment de gène rpoB ou un oligonucléotide spécifique selon l'invention, de préférence un fragment consistant respectivement dans l'une desdites séquences choisie parmi :

- SEQ. ID. n°33 à 56 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 1 et 2 respectivement

- SEQ. ID. n°77 à 100 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ.

ID. n° 3 et 4 respectivement, et

- SEQ. ID. n°121 à 144 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 5 et 6 respectivement, et

- SEQ. ID. n°165 à 188 respectivement, lorsque les dites amorces 5' et

3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement, et.

b- on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques amplifié de l'échantillon, et on détermine ainsi la présence ou l'absence de ladite espèce de A.cinetobacter dans l'échantillon s'il y a formation ou non d'un complexe d'hybridation.

Dans un mode préféré de réalisation d'un procédé selon l'invention, on réalise les étapes comprenant :

1 - une première amplification de l'acide nucléique dudit échantillon avec un couple d'amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon l'invention, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n° l et SEQ. ID. n°2, de préférence consistant dans lesdites séquences SEQ. ID. n° l et 2, ou les séquences complémentaires, et

2- une première détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 1 avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°33 à 56 et 34 à 76 respectivement, et

-si à cette étape 2 on détermine la présence des espèces A., grimontii ou A., junii, on réalise en outre:

3a — une seconde réaction d'amplification avec des amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon l'invention, comprenant des séquences incluses respectivement dans les séquences SEQ.

ID. n°3 et SEQ. ID. n°4, de préférence consistant dans lesdites séquences

SEQ. ID . n°3 et 4, ou les séquences complémentaires, et

4a- une détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 3a avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID . n°77 à 100 respectivement, ou - si à la première étape 2 on détermine la présence des espèces A. baylii ou A. espèce gênomique 1 1, on réalise en outre :

3b- une seconde réaction d'amplification avec des amorces 5' et 3' choisis parmi desdits mélanges d'oligonucléotides selon l'invention comprenant des séquences incluses respectivement dans les séquences SEQ.

ID. n°7 et SEQ. ID. n°8, de préférence consistant dans lesdites séquences

SEQ. ID . n° 7 et 8, ou les séquences complémentaires, et

4b- une détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 3b avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n° 165 à 188 respectivement.

Les séquences SEQ. ID. n° l à 208 peuvent être préparées par génie génétique et/ou par synthèse automatique ou synthèse chimique en utilisant les techniques bien connues de l'homme du métier.

Les sondes selon l'invention peuvent être utilisées, à des fins de diagnostic, comme mentionné précédemment, par la détermination de la formation ou de l'absence de formation d'un complexe d'hybridation entre la sonde et un acide nucléique cible dans un échantillon, selon toutes les techniques d'hybridation connues et notamment les techniques de dépôt ponctuel sur filtre, dites " DOT-BLOT " [Maniatis et al. (1982) Molecular Cloning, CoId Spring Harbor] , les techniques de transfert d'ADN dites " SOUTHERN BLOT " [Southern E.M., J. Mol. Biol. (1975) 98 :503] , les techniques de transfert d'ARN dites " NORTHERN BLOT ", ou les techniques dites " sandwich ", en particulier avec une sonde de capture et/ou une sonde de détection, lesdites sondes étant capables de s'hybrider avec deux régions différentes de l'acide nucléique cible, et l'une au moins desdites sondes (généralement la sonde de détection) étant capable de s'hybrider avec une région de la cible qui est spécifique de l'espèce, étant entendu que la sonde de capture et al sonde de détection doivent avoir des séquences nucléotidiques au moins partiellement différentes.

L'acide nucléique à détecter (cible) peut être de l'ADN ou de l'ARN (le premier obtenu après amplification par PCR) . Dans le cas de la détection d'une cible de type acide nucléique double brin, il convient de procéder à la dénaturation de ce dernier avant la mise en oeuvre du procédé de détection.

L'acide nucléique cible peut être obtenu par extraction selon les méthodes connues des acides nucléiques d'un échantillon à examiner. La dénaturation d'un acide nucléique double brin peut être effectuée par les méthodes connues de dénaturation chimique, physique ou enzymatique, et en particulier par chauffage à une température appropriée, supérieure à 80°C.

Pour mettre en œuvre les techniques d'hybridation précitées, et en particulier les techniques " sandwich " , une sonde de l'invention, appelée sonde de capture est immobilisée sur un support solide, et une autre sonde de l'invention, appelée sonde de détection, est marquée avec un agent marqueur. Les exemples de support et d'agent marqueur sont tels que définis précédemment.

De manière avantageuse, une sonde d'espèce est immobilisée sur un support solide, et une autre sonde d'espèce est marquée par un agent marqueur.

Une autre application d'un dit mélange d'oligonucléotides de l'invention est son utilisation comme amorce nucléotidique comprenant un oligonucléotide monocaténaire choisi parmi les oligonucléotides ayant une séquence d'au moins 12 motifs nucléotidiques incluses dans l'une des séquences SEQ. ID. n° l à 8, qui est utilisable dans la synthèse d'un acide nucléique en présence d'une polymérase par un procédé connu en soi, notamment dans des méthodes d'amplification utilisant une telle synthèse en présence d'une polymérase (PCR, RT-PCR, etc.) . En particulier, une amorce de l'invention peut être utilisée pour la transcription inverse spécifique d'une séquence d'ARN messager de bactérie d'une espèce du genre Acinetobacter pour obtenir une séquence d'ADN complémentaire correspondante. Une telle transcription inverse peut constituer le premier stade de la technique RT-PCR, le stade suivant étant l'amplification par PCR de l'ADN complémentaire obtenu.

Selon un cas particulier, ladite amorce comprenant un oligonucléotide de l'invention comprend en outre la séquence sens ou anti-sens d'un promoteur reconnu par une ARN polymérase (promoteurs T7, T3, SP6 par exemple [Studier FW, BA Moffatt (1986) J. Mol. Biol. 189 : 113] : de telles amorces sont utilisables dans des procédés d'amplification d'acide nucléique faisant intervenir une étape de transcription, tels que, par exemple, les techniques NASBA ou 3SR [Van Gemen B. et al. Abstract MA 1091 , 7th

International Conférence on AIDS (1991) Florence, Italy] .

Un autre objet de l'invention est une amorce nucléotidique comprenant un mélange d'oligonucléotides monocaténaires choisis parmi les oligonucléotides ayant des séquences comprenant l'une des séquences SEQ. ID. n° l à 8 ou de préférence, consistant dans l'une des séquences SEQ. ID . n° l à 8 qui est utilisable pour le séquençage total ou partiel du gène rpoB ou du fragment intergénique rplL-rpoB ou du fragment intergénique rpoB-rpoC d'une quelconque espèce du genre Λ.cinetobacter.

Le séquençage du gène rpoB partiel ou complet ou du fragment intergénique rp/L-rpoB ou du fragment intergénique rpoB-rpoC chez toute bactérie du genre Acinetobacter permet l'identification de toute bactérie

Acinetobacter par analyse bioinformatique de cette séquence et la reconnaissance de nouvelles espèces de bactéries Acinetobacter inconnues.

De préférence, dans une utilisation comme amorce ou pour le séquençage des gènes rpoB, ou du fragment intergénique rplh-rpoB ou du fragment intergénique rpoB-rpoC on utilise des dits mélanges d'oligonucléotides de séquence SEQ. ID . n° l et 2.

La présente invention a également pour objet une trousse de diagnostic utile dans un procédé selon l'invention comprenant au moins un dit fragment de gène tpoB ou du fragment intergénique rp/L-rpoB ou du fragment intergénique rβoB-rpoC selon l'invention, comprenant ou consistant dans l'une des séquences SEQ. ID. n°9 à 188 ou un oligonucléotide ou dit mélange d'oligonucléotides équimolaires selon l'invention, comprenant des séquences incluses dans les séquences SEQ. ID. n° l à 8, et les oligonucléotides et fragments de gènes rpoB ou du fragment intergénique rβ/L-rpo~B ou du fragment intergénique rpo3-rpoC de séquences complémentaires, tels que définis ci-dessus, ainsi que, de préférence, des réactifs utiles dans les réactions d'hybridations ou réactions d'amplification ou séquençage le cas échéant.

Comme mentionné dans les définitions, un oligonucléotide ou fragment d'acide nucléique selon l'invention peut être sous forme d'un acide désoxyribonucléique (ADN) ou d'un acide ribonucléique (ARN) pour lesquels dans ce cas T est remplacé par U.

Enfin, un dernier objet de l'invention est une sonde de thérapie génique pour traiter les infections provoquées par une souche appartenant à une espèce du genre Acinetobacter, ladite sonde comprenant un oligonucléotide tel que défini précédemment. Cette sonde de thérapie génique, capable de s'hybrider sur l'ARN messager et/ou sur l'ADN génomique desdites bactéries, peut bloquer les phénomènes de traduction et/ou transcription et/ou de réplication.

Le principe des méthodes de thérapie génique est connu et repose notamment sur l'utilisation d'une sonde correspondant à un brin anti-sens : la formation d'un hybride entre la sonde et le brin sens est capable de perturber au moins l'une des étapes du décryptage de l'information génétique. Les sondes de thérapie génique sont donc utilisables comme médicaments antibactériens, permettant de lutter contre les infections causées par les bactéries des espèces du genre Acinetobacter.

D'autres caractéristiques et avantages de la présente invention apparaîtront et l'invention sera mieux comprise à l'aide de l'exposé ci-après qui concernent les expériences effectuées et résultats obtenus dans le but de réaliser l'invention et qui sont donnés à titre purement illustratif.

Le tableau 1 , ci-après, reprend la liste des espèces àΑcinetobacter pour lesquelles des séquences rpofà et le fragment intergénique rplL-rpoB et le fragment intergénique rpoB-rpoC ont été déterminées, les souches mentionnées proviennent de la Collection de l'Institut Pasteur (CIP), les séquences SEQ. ID. n° 1 à 208 sont décrites dans le listage de séquences annexé à la description.

Dans le tableau 2, sont listées les différentes amorces utilisées pour l'amplification et le séquençage des gènes rpoB.

Dans le tableau 2, lorsque l'on présente des séquences comprenant des nucléotides W, H, Y, V, R, B, M, K, S ou D, ceux-ci ont les significations connues de l'homme de l'art et, de manière également conventionnelle, ces amorces sont en fait utilisées sous forme de mélange équimolaire d'oligonucléotides de séquences différentes à l'emplacement des dits nucléotides comme expliqué ci-dessus.

Le tableau 3 présente des comparaisons de similitudes des séquences des gènes 16S ARNr et ?pol& entre les deux sous-espèces C. affermentans et entre les 11 couples d'espèces considérées comme proches pour lesquelles les similitudes entre séquences de gènes 16S ARNr sont supérieures ou égales à 98,5%, avec comparaison statistique des moyennes de similitude obtenues.

La figure 1 est une représentation graphiques du taux de variabilité

(range site variability : RSV (axe des Y)) des séquences des gènes rpoB et séquences flanquantes des différentes espèces du genre Acinetobacter étudiées par fenêtres de 50 nucléotides (axe des X) . Les régions hyper variables, bordées par les régions conservées, utilisée pour l'identification d'espèce à l'aide des amorces consensus sont encadrées.

La figure 2 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du

"neighbour-joining" . L'arbre a été construit par l'alignement des séquences du gène rpoB. Les valeurs d'échantillonnage de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres, sont indiquées à chaque nœud, seules les valeurs supérieures ou égales à 75% sont indiquées

La figure 3 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du "neighbour-joining". L'arbre a été construit par l'alignement des séquences hypervariable (zone 1 et zone 2) du gène rpoB. Les valeurs de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres sont indiquées à chaque nœud.

La figure 4 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du

"neighbour-joining". Les 4 arbres ont été construits par l'alignement des séquences des gène rpo~S>, 16SRNA, rpoB, gyrB, recA Les valeurs d'échantillonnage de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres, sont indiquées à chaque nœud, seules les valeurs supérieures ou égales à 75% sont indiquées

1 - Matériels et méthodes.

1.1- Souches bactériennes.

Les souches bactériennes utilisées sont listées dans le tableau 1. Toutes les souches ont été cultivées sur géloses Columbia 5% de sang de mouton et ont été incubée 48 h à 37 °C en condition d'aérobie.

1.2- amplification et séquençage du gène rpoB et des fragment intergéniques rp/L-rpoT$ et rpoB-rpoC.

La séquence du gène rpoΕ> et des fragments intergéniques qui le bordent des espèces les plus proches, ont été alignées afin de produire une séquence consensus. Les séquences choisies étaient celles à'Acinetobacter sp. ADPl (GeneBank accession number NC_005966), Psendomonas syringae pv.tomato str.DC3000 (GeneBank accession number NC 004578) and P. pntida KT2440 (GeneBank accession number NC 006347). La séquence consensus a permis de détermine* les amorces utilisées ensuite pour les PCR, la technique de marche sur le génome ("génome walking") et pour le séquençage. Certaines amorces ont été déterminées ultérieurement à l'analyse des résultats obtenus. Les amorces sont présentées au tableau 2 ci-après.

L'ADN bactérien a été extrait de suspensions des souches par QIAamp blood kit (Qiagen, Hilden, Germany) selon les recommandations du fabricant. Tous les mélanges réactionnels de PCR comportaient 2.5 X 10"2 U de polymerase Taq par μl, IX tampon Taq, 1.8 mM MgCl2 (Gibco BRL, Life Technologies, Cergy Pontoise, France), 200 μM de dATP, dCTP, dTTP et dGTP (B oehringer Manheim GmbH, Hilden, Germany), et 0.2 μM de chaque amorce (Eurogentec, Seraing, Belgium) . Les mélanges réactionnels de PCR ont été soumis à 35 cycles de dénaturation à 94°C pendant 30 s, une hybridation des amorces pendant 30 s, et une extension à 72°C pendant 2 min. Chaque programme d'amplification débutait par une étape de dénaturation à 950C pendant 2 min. et terminait par une étape d'élongation à 720C pendant 10 min. La détermination de la séquence des extrémités des gènes a été réalisée par l'utilisation du Universal GenomeWalker Kit (Clontech Laboratories, PaIo Alto, CA) . Brièvement, l'ADN génomique était digéré par Eco RV, Dra I, Pvti II, S tu I et Sca I. Les fragments d'ADN été liés avec le GenomeWalker adaptor, La PCR été réalisée en incorporant l'amorce "adaptor primer" fournie par le fabricant et les amorces spécifiques. Pour l'amplification, 1.5 U d'enzyme ELONGASE (Boehringer Manheim) été utilisée avec 10 pmol de chaque amorce, 20 mM de chaque dNTP, 10 mM Tris-HCl, 50 mM KCl, 1.6 mM MgCl2 et 5 μl d'ADN digéré pour un volume final de 50 μl. Les amplicons ont été purifiés à l'aide du " QlAquick spin PCR purification kit" (Qiagen). Les réactions de séquence ont été réalisées à l'aide des réactifs du séquenceur ABI Prism 3100 ADN séquencer (dRhod.Terminator RR Mix, Perkin Elmer Applied Biosystems) .

Ces conditions d'extraction de l'ADN et amplification PCR et séquençage ont été décrites dans Khamis et al 2003.

1.3- Détermination des séquences partielles discriminantes dans le gène rpoB.

Afin de détecter les portions de séquence avec une haute variabilité entourées de régions conservées, on a utilisé le programme SVARAP (for Séquence VARiability Analysis Program, Hypertext link "Téléchargement" at the URL: http: / /ifr48.free.fr/recherche/jeu cadre /jeu rickettsie.html). Une fois cette analyse faite, les zones les plus polymorphiques du gène rpolè ont été déterminées et des amorces universelles, choisies dans les zones bordantes conservées, ont été désignées après différents essais infructueux. Les conditions de PCR qui incorporaient les amorces universelles étaient les mêmes que précédemment mentionnées. Ces amorces ont été utilisées pour l'amplification et le séquençage des 4 zones hyper variables pour toutes les souches étudiées.

Ces amorces sont présentées au tableau 3 ci-après et figure 1.

1.4- Analyse des séquences rpoB et des fragments intergéniques qui le bordent.

Les fragments de séquences des gènes rpόh et des fragment intergéniques qui le bordent obtenus dans cette étude, ont été analysées à l'aide de "Séquence Analysis Software" (Applied Biosystems), et les séquences partielles ont été combinées en une seule séquence consensus à l'aide du "Séquence Assembler Software" (Applied Biosystems). Toutes les références de dépôt des souches à la Collection de l'Institut Pasteur (« CIP ») (France, Paris) sont listées dans le tableau 1. Les alignements multiples et les pourcentages de similitude entres les gènes des différentes espèces ont été réalisés par CLUSTAL W sur le serveur EMBL-EBI (http: / /www.ebi.ac.uk/clustalw/) (Thompson et al.1994). Des arbres phylogéniques ont été réalisés à partir des séquences par la méthode du "neighbor-joining" (Felsenstein et al.1989). Les "bootstraps" ont été réalisées pour évaluer la solidité des nœuds en utilisant SEQBOOT dans le logiciel PHYLIP.

2- Résultats

a. Séquences complètes des gènes rpoB des différentes espèces ά'Acinetobacter

Les amorces désignées ont permis d'amplifier les régions tests de toutes les souches du travail; la taille du gène complet est de 4089 pb pour toutes les espèces. Les pourcentages de similitude entre les souches varient de

83 à 94 %, excepté 2 paires d'espèces (tableau 4) . En effet, 2 paires d'espèces, A. junii/A. grimontii et A. baylji/ espèce génomique 1 1 ont des similitudes de 99%. Les autres espèces ont moins de 95% de similitude entre elles.

b. Identification des différentes espèces άΑcinetobacter basées sur les séquences partielles du gène rpoB.

Le programme SVARAP a permis l'identification de 2 zones variables bordées par des zones conservées qui ont permis de générer des amorces universelles:

-zone 1 : entre les positions 2900 et 3250, et

-zone 2 : entre les positions 3250 et 3700 bp (Figure 1) .

Ces zones sont amplifiées à l'aide des amorces suscitées chez toutes les espèces d'Acinetobacter et toutes les souches d'A. baumannii. La taille de la zone 1 est de 350 pb et la zone 2 est de 450 pb. Le pourcentage de similitude entre les différentes espèces de la zone 1 varie de 78,6 à 95,4% pour toutes les espèces excepté 2 paires. En effet, comme pour la séquence complète, A. baylyi/ espèce génomique 1 1 et A. junii/A. grimontii ont les valeurs de similitude plus élevées, respectivement 98 et 99,1 %, alors que les autres espèces ont moins de 96%. Le pourcentage de similitude la zone 2 est entre 75,8 et 95,3% pour toutes les espèces excepté, là encore, les espèces A. junii/A. grimontii et A. baylyi/ espèce génomique 1 1 qui ont de plus hautes similitude, respectivement 98,8 et 99,6%, alors que les autres espèces ont moins de 96% entre elles.

La similitude intta-spécifique des différentes souches d'A. baumannii pour la zone 1 varie de 98,3 à 100% à l'exception de la souche CIP 103655. En effet, cette souche ne possède qu'entre 94,9 et 95,7% avec les autres souches. De la même façon, la zone 2 varie de 98,7 à 100% pour toutes les souches de A.Baumanii à l'exception de la souche CIP 103655. Cette souche a des similitudes comprises entre 93,6 et 94,4% avec les autres souches de l'espèce. Les espèces les plus proches d'A. baumannii sont espèce génomique 3 pour la zone 1 et A. calcoaceticus pour la zone 2 avec des similitudes respectives de 95,1 % et 93,6%. Ce sont des valeurs nettement inférieures à la variabilité intraspécifique à l'exception de la souche CIP 103655 pour la quelle la souche d'A. baumannii la plus éloignée possède 94,9% et 93,6% de similitude, respectivement dans les zones 1 et 2.

Au total, la variabilité de séquence est de 0,4 à 24,2% pour les séquences partielles contre 0,8 à 16,9% pour les séquences complètes de rpoB. Les 2 séquences partielles permettent donc une identification non ambiguë des 24 espèces.

c. Analyse des zones flanquantes du gène rpoB (fragment intergénique rp/L-rpoB et fragment intergénique rβoB-rpoC) .

La taille des 2 fragments intergéniques est variable en fonction des espèces. La taille du fragment intergénique entre rplL et rpoB varie de 301 à

310 pb (Tableau 1). Entre les espèces, le taux de similitude de ce fragment intergénique rp/L-rpoB varie de 80,8 à 96,9%, excepté que le fragment intergénique est identique entre A. junnii et A. grimontii., et les couples d'espèces comme A. bajlji-espèce génomique 1 1 et A. Iivoffii-espèce génomique 9 ont des taux de similitude comprises entre 98,4 et 99,7%.

La taille du fragment intergénique entre rpoB et rpoC varie de 86 à 177 pb (Table 1) avec des taux similitude entre les espèces comprises entre 70,2 et 96,5%, excepté pour A. junnii/ A. gritnontii qui ont une similitude élevée de 99,5%, et au sein du complexe Acb {A. calcoaceticns, A. baumannii and espèce génomique 3) dont les taux de similitude sont compris entre 98,5 et 99,0% pour le fragment intergénique tpoB-rpoC. En revanche, par rapport au fragment intergénique rp/L-rpo'B, A. bay/yi-e.sipèce génomique 11 et A. Iwoffii-espèce génomique 9 n'ont que 83,8 et 87,9% respectivement de taux de similitude pour le fragment intergénique tpoB-rpoC.

Au sein de l'espèce A. baumannii, la taille du fragment intergénique rplL-rpόh est de 305 pb pour toutes les souches à l'exception de la souche CIP 103655 pour laquelle la taille est de 304 pb. Le fragment intergénique rpoB-rpoC a une taille de 86 pb pour toutes les souches . Toujours dans cette espèce, le pourcentage de similitude dans le fragment intergénique rpoIL-rpoB varie de 99 à 100% pour toutes les souches à l'exception de la souche CIP 103655. Cette souche possède entre 96,1 et 96,4% de similitude avec les autres souches. L'autre fragment intergénique rpoU-rpoC est 100% similaire pour toutes les souches à l'exception de la souche CIP 103655 qui est 97,7 à 98,8% similaire aux autres souches. L'espèce la plus proche d'A. baumannii est espèce génomique 3 pour le fragment intergénique rplL-rpoTi et A. calcoaceticus pour le fragment intergénique rpoB-rpoC avec des similitudes respectives de 95,9% et 98,5%. Ce sont des valeurs nettement supérieures à la similitude intra-spécifique à l'exception de la souche CIP 103655 pour laquelles les espèces d'A. baumannii sont des similarités de 96,1 % et 97,7% respectivement pour les fragment intergéniques rpIL-rpoB et rpoϋ-rpoC.

En fait, comme il ressort des positions des amorces des séquences

SEQ. ID. n°5, 6, 7 et 8, les fragments correspondant aux amplifiats obtenus à l'aide de ces amorces ont des séquences qui dépassent celles des fragments intergéniques proprement dits aux extrémités 5' et 3', mais les séquences SEQ. ID. n°121 à 144 et 165 à 188 données dans le listage de séquences annexé à la présente description, correspondent aux fragments intergéniques complets et ne débordent pas dans les gènes rp/L, rpoB et rpoC respectivement.

d. Analyse phylogénique des espèces d'Acinetobacter.

L'arbre phylogénique construit a\rec les séquences complètes du gène rpo~B construit par la technique du neighbour-joining est supporté par de très hautes valeurs de bootstrap (Figure 2). Le nombre de valeurs de bootstrap >_ 75% est de 17/22 en utilisant le gène rpoB complet alors qu'il est de seulement 7/22 par l'utilisation du gène 16S rRNA (p< 0.01) . Toutes les espèces sont bien séparées en différents groupes. L'arbre basé sur le gène rpoB partiel (zone 1 et zone 2 concaténées) montre un groupement homogène des souches d' A. baumannii. La souche CIP 103655 apparaît dans le même groupe mais est clairement séparée des autres isolats à'A. baumannii. Ce regroupement est supporté par une valeur de bootstrap de 85%.

2.4- Discussion.

A l'exception du gène 16S rRNA, il n'existe actuellement aucune séquence de gène de ménage réalisée sur toutes les espèces àJAcinetobacter. Les séquences des gènes gyrB et recA ne sont pas disponibles pour les 10 espèces les plus récemment décrites. En effet, Yamamoto et al (1996, 1999) et Krawczyk et al (2002) ont séquence les gènes gyrB et recA de 14 espèces et ont comparé cette technique à l'hybridation DNA-DNA (Bouvet and Jeanjean, 1989; Bouvet and Grimont, 1986; Tjernberg and Ursing, 1989) . Par construction d'un arbre basé sur le gène rpoB qui incorpore 14 espèces, aucune congruence n'est observée entre les différentes espèces. Toutefois, l'arbre basé sur le gène rpoB a de façon significative plus de valeurs de bootstrap >. 75% (11 / 12) que celui basé sur le gène 16S rRNA (4/ 12), gyrB (5/ 12) et recA (6/ 12) (p < 0,01 , p = 0,01 et p = 0,02 respectivement) (Figure 4) . Cela démontre la robustesse de l'arbre basé sur le gène rpoB. A. Iwoffi et Acinetobacter espèce génomique 9 sont 100% identiques sur le gène gyrB, mais sont séparés sur la séquence de gyrO et recA (Yamamoto et al., 1999; Krawczyk et al (2002) . Les espèces mal délimitées par le gène rpoB sont les couples A. grimontii/ A., junii et A. bajlii/ espèce génomique 9. Malheureusement il est impossible de les comparer en gyrB et recA, les séquences de A. grimontii et A. baylii n'étant pas disponibles.

Pour l'identification moléculaire en routine des Acinetobacter, chacune des séquences partielles du gène rpoB et des 2 fragments intergéniques qui le bordent, peut être utilisée en raison de son pouvoir discriminant et de sa longueur. L'inconvénient de l'utilisation d'une seule de ces séquences est l'absence de bonne discrimination entre les paires A. grimontiil A. junii et A. baylii/ espèce génomique 9 (Table 4 à 11). Cependant, cet inconvénient peut être réduit en combinant la séquence d'au moins 2 de ces séquences hypervariables. En raison de sa taille nous pensons qu'il est préférable de débuter par la séquence de la zone 1 car elle permet d'identifier parfaitement

20 espèces sur 24. Si les séquences obtenues sont celles de A. grimontiil A. junii, il vaut mieux par la suite réaliser la séquence de la zone 2 qui différencie mieux ces 2 espèces. Si la séquence obtenue est plus proche de A. baylii/ espèce génomique 9, il sera préférable de déterminer la séquence du fragment intergénique rpoϋ-rpoC qui discrimine mieux ces 2 espèces.

La variabilité intra-spécifique des courts fragments observée au sein de l'espèce A. baumannii montre qu'à l'exception de la souche CIP 103655, tous les isolats ont des similitudes nettement inférieures à celles que l'on peut observer entre A. baumannii et les espèces qui en sont le plus proches. Toutefois, les similitudes faibles observées entre la souche d'A. baumannii CIP 103655 et les autres isolats de l'espèce montrent que l'identification de certains isolats de cette espèce peut rester ambiguë. L'espèce A. baumannii est l'espèce la plus fréquente en affection chez l'homme .Les résultats montrent que la souche CIP 103655 est une souche différentes des 24 espèces répertoriées et n'est vraisemblablement pas une souche d'espèce A. bau?nannii.

En conclusion, les résultats obtenus par l'utilisation des séquences partielles du gène rpo~B et les fragments intergéniques rplL-tpoB et rpoB-rpoC montrent que ces outils sont efficaces pour l'identification moléculaire de routine des souches ftAcinetobacter. Cependant, en raison de la forte similitude entre certaines espèces, des travaux complémentaires étudiant les similitudes intra-spécifiques dans plusieurs espèces seront nécessaires. De même, le statut de certaines souches comme la souche à'A. banmannii CIP 103655 et de certaines espèces comme A. grimontii et A. baylii, devra être étudié par hybridation ADN- ADN et séquences d'autres gènes de ménage (recA and gyt'B).

Tableau 1. Souches d'Acinetobacter étudiées.
-4


oc

Tableau 2. Amorces utilisées pour amplifier le gène rpoB et ses zones flanquantes


Tableau 3 : Amorces utilisées pouf amplifier et séquence* la zone 1 et la zone 2 du gène rpoB ainsi que les fragments intergéniques qui la bordent des espèces à'Jlcinetobacter de la présente étude.


* il s'agit de la position du premier nucléotide de la séquence amorce par rapport au gène rpoB

Tableau 4 : Comparaison du taux de similitude (%) du gène rpoB (4089 pb) entre les différentes espèces à?A.cinetobacter

— 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 .

[ 1] A. calcoacetkus
[ 2] A. genospecies 3 93.9
[ 3] A. baumamύi 92.0 93.8
[ 4] A. genospecies 16 88.6 88.7 89.4
[ 5] A.parvus 87.9 88.3 89.0 93.9
[ 6] A. genospecies 13 89.4 89.5 90.0 94.4 93.7
[ T] A. tjernbergiae 89.4 89.0 89.4 91.9 91.6 93.3
[ Z] A. gήmonti 87.7 87.9 88.6 91.8 91.7 92.1 90.1
[ 9] Ajtmii 87.5 87.8 88.6 91.6 91.8 92.0 90.0 99.2
[10] A. haemojltkus 88.0 88.3 89.1 92.5 91.8 92.1 90.4 91.7 91.9
[11] A. genospecies 6 87.8 87.8 87.5 90.1 89.5 90.4 89.8 90.1 90.1 90.6 ^

[\2] A. boιιvetiï 84.8 85.2 85.6 85.8 85.4 86.1 85.4 84.3 84.4 85.3 84.8 1^

[13] A.Jσ/mso/m 86.6 86.8 87.2 87.8 87.7 88.4 87.6 86.8 86.7 87.3 86.6 88.6
[14] A. genospecies 9 85.5 86.3 86.2 86.5 86.1 86.2 85.2 85.1 85.0 85.9 85.1 87.6 88.4
[\5] A. /woβ 85.7 86.4 85.9 86.8 85.9 86.9 85.7 85.2 85.0 86.1 85.4 86.9 88.4 93.3
[16] A. sώi/ιd/eri 86.0 86.7 86.9 87.2 86.8 87.4 86.4 85.9 85.7 86.3 85.7 88.4 88.7 90.7 90.5
[iη A. towneή 85.1 85.2 85.7 86.2 86.0 86.5 85.5 86.4 86.5 86.5 86.0 86.0 88.0 87.3 86.7 87.0
[n] A tmιdoii 86.4 87.0 86.7 87.5 87.4 88.0 87.2 87.3 87.4 87.9 87.1 86.4 87.9 86.4 86.8 87.4 87.1
[\9] A bqyβl 86.5 86.6 87.2 87.4 86.7 87.6 86.6 86.6 86.7 87.2 86.3 86.2 87.0 86.9 86.9 86.7 86.0 86.7
[2O] A genospecies 11 86.6 86.9 87.3 87.6 87.0 87.9 86.9 86.8 86.9 87.4 86.5 86.3 87.3 87.1 87.2 86.9 86.1 86.8 99.2
[21] A. genospecies 10 86.6 86.9 87.3 87.4 87.7 88.2 87.6 87.2 87.2 87.5 86.9 86.4 87.4 86.6 86.7 87.4 85.5 87.4 92.3 92.5
[22] A. gemeri 86.5 86.7 87.6 86.9 86.9 87.7 87.4 87.3 87.3 87.5 86.9 86.8 87.7 86.3 86.4 86.7 87.0 87.6 88.7 88.9 89.0
[23] A. itrsmgii 85.7 86.0 85.6 85.4 85.7 85.9 86.3 85.3 85.3 86.2 86.5 84.3 85.5 85.1 84.9 85.2 85.3 86.5 85.3 85.5 85.3 86.1
[24] A. radioresistense 84.2 84.5 84.9 84.6 84.4 84.4 84.1 84.4 84.2 84.4 84.2 83.1 83.2 84.6 84.3 84.9 84.6 83.9 84.1 84.0 83.7 84.3 85.2

Tableau 5 : Comparaison des taux de similitude (%) des séquences (301 -310 pb) fragments intergénique rplL-rpoh des différentes espèces d' Acinetobacter .

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

[ 1] A. cakoacetkus
[ Z] espèce génomique 3 92.8
[ 3] A. baumanniï 90.6 95.9
[ 4] espèce génomique 13 84.0 86.8 86.5
[ 5] espèce génomique 16 86.5 87.4 86.8 93.4
[ 6] A.parvtιs 83.0 86.2 86.5 96.9 93.4
[ 7] A. tjernbergiae 85.5 87.1 86.5 95.0 93.7 94.0
[ 8] A.jtmn 87.7 88.4 88.4 91.5 93.4 91.2 93.1
[ 9] A. grimontii 87.7 88.4 88.4 91.5 93.4 91.2 93.1 100.0
[10] A. haemotfticus 85.8 87.1 86.5 93.4 93.7 92.1 93.1 93.4 93.4
[11] espèce génomique 6 87.1 87.4 86.2 91.2 93.1 90.6 92.1 93.1 93.1 91.2 4- [12] espèce génomique 9 87.7 86.8 86.8 84.0 85.8 83.0 85.2 86.5 86.5 85.5 85.8
[13] A. hvoβi 86.8 86.5 86.5 83.0 84.6 82.7 85.2 85.5 85.5 84.6 85.5 98.4
[14] A. schindleri 87.4 87.7 88.1 83.6 85.5 83.6 85.8 87.4 87.4 85.5 85.8 96.2 95.9
[15] A. bouvetii 87.7 86.5 86.5 84.6 85.2 84.3 86.2 86.5 86.5 86.2 85.5 91.8 91.2 91.5
[16] A jobmomi 84.3 84.6 84.9 81.1 82.4 80.8 82.7 82.1 82.1 82.4 82.1 88.1 87.7 87.4 86.5
[17] A towmri 84.9 85.8 87.1 87.1 85.5 86.5 87.4 84.6 84.6 85.8 84.9 89.0 88.4 89.3 91.2 87.4
[18] A. tandoii 86.2 85.8 85.8 84.0 84.3 83.6 85.2 84.9 84.9 84.3 84.3 89.0 88.4 89.3 93.1 84.9 90.3
[19] A. bqyfyi 82.7 82.4 83.0 81.4 83.6 82.4 82.7 83.6 83.6 81.8 82.7 86.2 85.2 85.8 85.5 89.3 87.1 84.9
[20] espèce génomique
11 83.0 82.7 83.3 81.8 84.0 82.7 83.0 84.0 84.0 82.1 82.7 86.5 85.5 86.2 85.8 89.6 87.4 85.2 99.7
[21] espèce génomique
10 84.9 84.6 84.9 84.3 85.5 84.9 85.5 86.2 86.2 83.6 84.9 88.1 87.1 87.7 90.3 86.8 89.3 89.6 92.5 92.8
[ZZ] A. genuή 86.8 85.5 85.8 83.0 84.6 83.6 84.9 85.2 85.2 83.6 84.0 88.4 88.4 87.7 88.7 85.5 88.4 88.1 91.5 91.8 92.8
[23] A. radioresistense 86.2 87.1 88.4 86.8 87.4 86.2 86.8 87.7 87.7 86.8 85.2 86.8 86.2 85.8 86.2 84.9 86.5 84.9 83.0 83.3 86.5 86.5
[24] A. nrsiiifii 85.8 84.9 85.5 85.2 86.5 84.9 86.8 85.5 85.5 84.9 85.2 85.5 85.5 84.9 87.7 85.5 85.8 86.2 85.2 85.5 86.8 87.7 90.3

Tableau 6 : Taux de similitude (%) des séquences (301 -310 pb) fragment intergénique rpoB-îipoC ( 86-177 pb) des différentes espèces à'Λcinetobacter .

10 11 12 13 14 15 16 17 18 19 20 21 22 23
[ 1] espèce génomique 6
[ 2] A.bmmojl tiaιs 92.4
[ 3] _4.>»« 90.4 89.4
[ 4] A.gπmo>ιtii 90.9 89.9 99.5
[ 5} A. calcoaceticns 90.4 89.9 91.4 91.4
[ 6] espèce génomique 3 90.9 89.9 91.9 91.9 99.0
[ l\ A. baιιmaιmii 90.4 89.9 91.4 91.4 98.5 98.5
[ 8] espèce génomique 13 76.3 75.3 78.8 79.3 92.9 93.4 92.9
[ 9] espèce génomique 16 75.3 75.3 77.8 78.3 91.9 92.4 91.9 96.5
[W] A.panms 79.3 79.3 79.8 80.3 91.4 91.4 91.4 86.4 85.9
[11] .4. tβmbitgim 80.3 80.8 81.3 81.8 93.4 93.4 93.4 86.4 86.9 91.4 ^

[\2} A. taιιdoii 74.2 77.8 75.8 76.3 90.4 91.4 90.4 79.8 80.3 77.3 79.8 *"

[13] A. /owιieri 74.2 77.3 78.8 79.3 88.4 89.4 88.9 76.8 76.8 76.3 78.8 85.4
[\A] A. bayl)'i 82.8 81.8 80.3 80.8 88.4 87.9 87.9 84.8 86.4 87.4 87.4 85.9 82.8
[15] espèce génomique
11 78.3 79.8 77.3 77.8 88.9 89.9 89.4 77.3 77.8 79.3 81.3 84.3 84.3 83.8
[16] espèce génomique
10 75.3 77.3 77.3 76.8 88.4 88.4 88.9 79.3 79.8 81.8 84.8 72.7 75.3 82.8 80.8
[M] A. germri 78.3 78.8 80.3 80.8 89.4 90.4 89.4 74.7 75.3 74.2 75.3 76.8 71.7 82.3 70.7 74.7
[\S\ A bonvetii 70.7 73.7 74.7 75.3 89.9 90.9 89.9 89.4 91.4 84.3 85.4 81.8 79.8 83.3 75.3 76.3 74.2
[19] A. sώiiidkπ 70.2 73.7 72.7 73.2 90.9 91.9 90.9 88.9 90.4 84.3 85.9 80.8 78.3 84.3 75.3 77.8 71.7 92.9
[20] A. jobnsomi 75.3 77.8 74.2 73.7 89.4 89.4 89.4 73.2 73.7 75.8 76.8 76.3 74.2 81.8 72.2 75.8 77.3 76.3 77.8
[21] espèce génomique 9 76.8 79.8 80.8 81.3 90.4 91.4 90.4 80.3 82.3 79.3 81.3 81.8 82.8 82.3 78.8 77.3 76.3 84.8 84.8 80.8
[22] A. Iwoffά 74.7 77.3 78.8 79.3 90.4 91.4 90.4 82.3 83.8 81.3 82.8 83.8 82.3 85.9 78.3 76.8 74.2 83.8 81.8 73.2 87.9
[2Z] A. radhresisteme 86.4 86.4 85.4 85.4 94.9 94.9 94.9 88.4 87.9 91.9 93.4 87.9 86.4 90.9 85.9 89.9 84.3 86.9 85.4 86.4 86.9 87.4
[24] A. itrsb≠ 77.3 75.3 79.8 79.3 90.9 91.4 91.9 81.3 82.8 85.4 88.4 77.8 77.8 85.4 79.3 81.3 72.2 77.8 77.8 76.8 77.8 78.3 88.4

Tableau 7 : Comparaison des taux de similitude (%) des séquences (350 pb) des séquences partielles de la zone 1 de rpoB des différentes espèces d' Acinβtobacter .

10 11 12 13 14 15 16 17 18 19 20 21 23
[ 1] ^4. baumanmi
[ 2] espèce génomique 3 95.1
[ 3] ^4. calcoaceticus 88.3 90.6
[ 4] A ,|/7>/Λ>//// 87.1 86.6 88.0
[ 5] Λ.jrιmi 86.9 86.3 87.1 99.1
[ 6] espèce génomique 16 86.0 84.3 84.6 90.3 89.4
[ 7\ A.parvιιs 87.1 85.7 84.0 91.4 90.6 95.4
[ 8] espèce génomique 13 87.4 86.9 85.7 90.6 89.7 93.4 93.1
[ 9] A.jo/msoιm 85.1 84.3 84.6 90.0 89.4 89.4 91.1 91.7
[\0} A. tJeπιbergiae 87.1 86.3 85.4 90.6 89.7 92.3 92.9 93.1 93.1
[11] espèce génomique 6 83.7 82.9 82.9 87.4 87.1 89.4 88.3 87.1 87.7 87.7 4*.

[\2} A. haemojl tiaιs 87.7 85.4 85.1 87.7 87.4 92.0 89.7 91.1 89.1 90.0 90.3 ^

[\3] A. sώim//eri 84.6 84.0 82.9 89.1 88.6 87.7 88.0 88.3 86.0 87.1 85.4 86.3
[U] A. bqyl)'i 85.1 84.0 82.6 85.1 84.9 86.0 85.4 84.6 86.0 85.1 85.7 85.7 84.9
[15] espèce génomique 11 85.1 84.3 82.9 85.1 84.9 85.7 85.1 84.9 85.7 85.4 85.7 85.7 85.7 98.0
[\6\ A. bouvetii 84.6 84.6 81.1 85.4 85.7 84.9 85.4 85.4 86.0 84.9 83.7 84.9 86.3 90.0 89.4
[17] espèce génomique 10 82.9 82.6 80.6 84.6 83.7 84.9 84.9 85.1 84.3 84.9 82.6 84.9 85.1 88.6 88.0 85.1
[18] A. gmwri 84.9 85.7 82.3 89.1 88.9 85.4 86.9 85.7 87.4 86.9 85.4 85.1 85.7 87.1 87.1 89.1 86.0
[19] espèce génomique 9 85.4 84.3 82.3 83.7 84.0 86.0 85.1 85.7 86.0 84.9 84.6 86.0 86.9 86.0 86.9 86.3 85.1 86.6
[20] AJwoβi 83.7 85.1 83.1 83.4 83.7 85.7 84.6 87.1 85.1 84.6 84.0 85.7 86.0 85.4 86.6 85.4 84.3 86.3 93.7
[21] A. towmri 81.7 80.9 81.4 85.1 85.4 84.9 84.0 83.7 87.1 83.4 83.4 84.0 82.0 83.7 83.1 83.4 80.9 86.3 86.3 84.0
[22] A. ursingi 82.6 82.0 82.0 84.9 84.6 82.9 84.0 83.7 83.7 85.1 84.6 82.9 83.4 82.0 82.6 84.0 81.7 85.4 80.6 81.7 82.0
\τS\ A. tandou 83.4 82.6 82.0 88.6 88.3 89.4 90.0 86.9 88.0 88.3 86.9 88.0 85.7 83.4 83.7 85.4 82.3 87.4 85.1 85.7 84.9 83.7
[24] A. radioresistense 79.7 78.9 78.6 82.0 81.1 82.0 82.0 80.0 79.4 81.7 80.6 79.4 82.0 78.6 79.4 80.3 79.7 83.1 80.0 80.0 78.6 80.0 83.4

Tableau 8 : Comparaison des taux de similitude (%) des séquences (450 pb) des séquences partielles de la zone 2 de rpoϋ des différentes espèces d' A.cinetobacter .

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

[ 1] A. cakoactticus
[ 2] espèce génomique 3 94.2
[ 3] A. baumanmi 93.6 91.8
[ 4] espèce génomique 13 89.3 90.0 88.4
[ 5] Λ. tjenώergiae 90.0 90.7 89.1 93.8
[ 6] espèce génomique 16 88.2 88.7 89.1 93.3 93.1
[ 7] Λ. parviis 88.4 88.7 89.6 93.6 93.1 94.9
[ 8] A. bqyjl i 84.7 84.9 84.4 86.9 85.6 86.2 86.2
[ 9] espèce génomique 11 84.2 84.9 84.4 86.4 85.6 86.2 86.2 99.6
[10] espèce génomique 10 84.0 84.2 84.9 84.4 83.8 87.3 86.9 94.9 95.3
[It] A. boiwetii 86.2 85.8 85.1 83.8 86.0 85.6 84.9 87.3 87.3 88.0
[12] A. sώinàkri 82.9 85.1 84.2 83.6 83.3 85.3 84.7 87.1 87.1 87.3 90.9
[13] A.jobnsonii 84.7 85.3 85.8 85.8 86.0 86.7 86.2 87.1 87.1 86.4 89.8 88.7
[14] espèce génomique 9 83.6 85.1 83.8 83.6 83.8 85.1 86.0 86.0 86.0 85.8 86.4 88.0 86.0
[\S\ A. lιvoffύ 83.6 85.6 83.3 84.4 84.0 85.8 84.2 86.4 86.4 85.8 86.4 88.0 86.7 95.1
[\6\ Agermri 81.8 80.0 82.0 81.6 80.9 82.4 81.6 87.3 87.3 86.7 84.0 83.3 83.6 82.2 82.4
[17] A tandoii 82.2 82.7 83.1 83.3 83.3 83.1 83.1 82.9 82.9 82.2 83.1 81.8 82.4 80.9 80.7 83.1
[18] A. towneri 83.6 83.6 83.6 83.1 82.4 82.9 83.3 83.3 83.3 83.8 84.0 84.9 83.8 85.1 85.1 85.3 88.7
[19] A baemojl ticus 83.3 83.1 84.4 81.3 82.4 82.7 82.0 84.7 84.7 83.8 81.8 81.8 82.4 83.8 82.2 85.1 84.7 86.7
[20] espèce génomique 6 82.0 82.0 82.0 82.0 82.0 83.8 82.2 81.8 81.8 81.8 81.3 80.7 81.8 81.3 81.8 84.7 83.8 84.7 87.3
[21] A. uningiï 81.8 81.3 80.7 81.6 82.2 79.6 79.8 80.0 79.6 78.2 79.1 81.1 79.8 78.9 79.3 81.1 83.1 84.0 81.6 85.8
[22] A. grimonή 80.9 81.6 81.6 82.2 82.2 83.6 83.1 80.2 80.2 81.6 78.2 80.7 80.9 82.7 83.3 80.9 83.1 84.7 84.9 85.8 81.6
[23] Ajunii 80.4 80.9 81.6 81.6 81.1 82.4 82.9 80.4 80.4 81.3 78.4 79.6 80.7 80.9 81.8 81.3 83.6 84.2 85.6 86.0 80.9 98.0

[24] A. radioresistense 75.8 76.0 77.1 77.1 76.9 78.0 77.8 78.7 78.2 78.7 77.1 78.2 76.0 80.7 79.6 80.4 79.1 80.2 80.4 81.8 81.6 83.6 82.4

Tableau 9 : Comparaison des taux de similitude (%) des séquences (350 pb) des séquences partielles de la zone 1 de rpoB des différentes souches A. baumannii

Strains 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

[ 1] 64.1
[ 2] 70.9 100.0
[ 3] 70.33 100.0 100.0
[ 4] 105742 100.0 100.0 100.0
[ 5] 53.79 100.0 100.0 100.0 100.0
[ 6] 70.8 99.4 99.4 99.4 99.4 99.4
[ 7] 54.97 99.4 99.4 99.4 99.4 99.4 100.0
[ 8] 70.32 98.3 98.3 98.3 98.3 98.3 98.9 98.9
[ 9] 70.34 98.3 98.3 98.3 98.3 98.3 98.9 98.9 100.0
[10] 68.38 98.3 98.3 98.3 98.3 98.3 98.9 98.9 99.4 99.4
[11] 70.24 98.6 98.6 98.6 98.6 98.6 99.1 99.1 99.7 99.7 99.7
[12] 53.77 99.1 99.1 99.1 99.1 99.1 99.7 99.7 99.1 99.1 99.1 99.4
[13] 54.147 99.1 99.1 99.1 99.1 99.1 99.7 99.7 99.1 99.1 99.1 99.4 100.0
[14] 70.10 99.1 99.1 99.1 99.1 99.1 99.7 99.7 98.6 98.6 98.6 98.9 99.4 99.4
[15] 1072.1 98.9 98.9 98.9 98.9 98.9 99.4 99.4 98.3 98.3 98.3 98.6 99.1 99.1 99.7
[16] 70.21 99.1 99.1 99.1 99.1 99.1 99.7 99.7 " 98.6 98.6 98.6 98.9 99.4 99.4 100.0 99.7
[iη 70.28 98.9 98.9 98.9 98.9 98.9 99.4 99.4 98.3 98.3 98.3 98.6 99.1 99.1 99.7 99.4 99.7
[18] 70.35 98.9 98.9 98.9 98.9 98.9 99.4 99.4 98.3 98.3 98.3 98.6 99.1 99.1 99.7 99.4 99.7 100.0
[19] 70.22 99.1 99.1 99.1 99.1 99.1 99.7 99.7 98.6 98.6 98.6 98.9 99.4 99.4 99.4 99.1 99.4 99.7 99.7
[20] 103572 98.9 98.9 98.9 98.9 98.9 99.4 99.4 98.3 98.3 98.3 98.6 99.1 99.1 99.1 98.9 99.1 99.4 99.4 99.7
[21] 103655 95.4 95.4 95.4 95.4 95.4 95.4 95.4 94.9 94.9 94.9 95.1 95.1 95.1 95.1 94.9 95.1 95.4 95.4 95.7 95.4

Tableau 10 : Comparaison des taux de similitude (%) des séquences (450 pb) des séquences partielles de la zone

2 de rpoU de différentes souches d' A. baumannii

souches 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

[ 1] 70.10
[ 2] 70.21 100.0
[ 3] 1072.1 99.8 99.8
[4] 103572 99.8 99.8 100.0
[ 5] 53.77 99.1 99.1 99.3 99.3
[ 6] 70.22 99.1 99.1 99.3 99.3 99.6
[ 7] 70.32 99.3 99.3 99.6 99.6 99.3 99.3
[ 8] 70.34 99.3 99.3 99.6 99.6 99.3 99.3 100.0
[ 9] 68.38 99.3 99.3 99.6 99.6 99.3 99.3 100.0 100.0
[10] 54.147 99.3 99.3 99.6 99.6 99.3 99.3 100.0 100.0 100.0
[11] 53.79 99.1 99.1 99.3 99.3 99.1 99.6 99.8 99.8 99.8 99.8
[12] 70.9 98.9 98.9 99.1 99.1 98.9 99.3 99.6 99.6 99.6 99.6 99.8
[13] 64.1 99.1 99.1 99.3 99.3 99.1 99.6 99.8 99.8 99.8 99.8 100.0 99.8
[14] 70.33 99.1 99.1 99.3 99.3 99.1 99.6 99.8 99.8 99.8 99.8 100.0 99.8 100.0
[15] 105742 99.1 99.1 99.3 99.3 99.1 99.6 99.8 99.8 99.8 99.8 100.0 99.8 100.0 100.0
[16] 54.97 99.1 99.1 99.3 99.3 99.1 99.1 99.8 99.8 99.8 99.8 99.6 99.3 99.6 99.6 99.6
[17] 70.8 99.1 99.1 99.3 99.3 98.7 98.7 99.3 99.3 99.3 99.3 99.1 98.9 99.1 99.1 99.1 99.6
[18] 70.24 99.6 99.6 99.8 99.8 99.1 99.1 99.8 99.8 99.8 99.8 99.6 99.3 99.6 99.6 99.6 99.6 99.6
[19] 70.35 99.6 99.6 99.8 99.8 99.6 99.6 99.8 99.8 99.8 99.8 99.6 99.3 99.6 99.6 99.6 99.6 99.1 99.6
[20] 70.28 99.6 99.6 99.8 99.8 99.1 99.1 99.3 99.3 99.3 99.3 99.1 98.9 99.1 99.1 99.1 99.1 99.1 99.6 99.6
[211 103655 94.0 94.0 94.2 94.2 94.2 94.2 93.8 93.8 93.8 93.8 93.8 93.6 93.8 93.8 93.8 93.6 93.6 94.0 94.0 94.4

Tableau 11 : Comparaison des taux de similitude (%) des séquences du fragment mtergénique rp/L.-rpoB de différentes souches de A. baumannu
Souches 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
[ 1] 708
[ 2] 7033 997
[ 3] 6838 1000 997
[4] 105742 1000 997 1000
[5] 641 1000 997 1000 1000
[ 6] 103572 1000 997 1000 1000 1000
[7] 54147 1000 997 1000 1000 1000 1000
[ 8] 7035 1000 997 1000 1000 1000 1000 1000
[ 9] 7032 1000 997 1000 1000 1000 1000 1000 1000
[10] 7028 1000 997 1000 1000 1000 1000 1000 1000 1000
[11] 7024 1000 997 1000 1000 1000 1000 1000 1000 1000 1000
[12] 7022 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000
£*

[13] 7021 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 VO

[14] 7010 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[15] 5497 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[16] 5379 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[iη 5377 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[18] 709 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[19] 7034 1000 997 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000
[20] 10721 993 990 993 993 993 993 993 993 993 993 993 993 993 993 993 993 993 993 993
[21] 103655 967 964 967 967 967 967 967 967 967 967 967 967 967 967 967 967 967 967 967 964

Tableau 12. Comparaison des taux de similitude (%) des séquences (301 -310 pb) fragment intergénique rpoB-rpoC de différentes souches d' A., baumannii
Souches 10 11 12 13 14 15 16 17 18 19 2C m 54.97
[ 2] 103655 98.8
[ 3] 70.10 100.0 98.8
[ 4] 70.24 100.0 98.8 100.0
[ 5] 70.33 100.0 98.8 100.0 100.0
[ 6] 70.34 100.0 98.8 100.0 100.0 100.0
[ V] 70.35 100.0 98.8 100.0 100.0 100.0 100.0
[ 8] 1072.1 100.0 98.8 100.0 100.0 100.0 100.0 100.0
[ 9] 103572 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0
[10] 105742 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[11] 70.32 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[12] 70.28 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
O
[13] 70.22 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[14] 70.21 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[15] 70.9 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[16] 70.8 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[iη 68.38 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[18] 64.1 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[19] 54.147 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[20] 53.79 100.0 98.8 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0
[21] 53.77 98.8 97.7 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98

Références bibliographiques

1. Bouvet PJ, Jeanjean S. Delineation of new proteolytic espèce génomique in the genus Acinetobacter. Res Microbiol. 1989 May-Jun;140(4-5):291-9.

2. Bouvet, PJ. M., and Grimont, P. A. D. Taxonomy of the genus

Acinetobacter with the récognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter Iwoffii. Int. J. Sjst. Bacteriol., 1986, 36, 228-240.

3. Carr EL, Kampfer P, Patel BK, Gurtler V, Seviour RJ. Seven novel species of Acinetobacter isolated from activated sludge. Int J Syst Evol Microbiol. 2003 Jul;53(Pt 4):953-63.

4. Felseinstein 1989 1989. PHYLIPphylogeny inference package

(version 3.2). Cladistics 5: 164-166.

5. Gerner-Smidt P, Tjernberg I, Ursing J. Reliability of phenotypic tests for identification of Acinetobacter species. J Clin Microbiol. 1991 Feb;29(2):277-82.

6. Gerner-Smidt P. Ribotyping of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex. J Clin Microbiol. 1992 Oct;30(10):2680-5.

7. Ibrahim A, Gerner-Smidt P, Liesack W. Phylogenetic relationship of the twenty-one DNA groups of the genus Acinetobacter as revealed by 16S ribosomal DNA séquence analysis. Int J Syst Bacteriol. 1997

8. Khamis A, Colson P, Raoult D, Scola BL. Usefulness of rpoB gène sequencing for identification of Afipia and Bosea species, including a strategy for choosing discriminative partial séquences. Appl Environ Microbiol. 2003 Nov;69(l l):6740-9.

9. Krawczyk B, Lewandowski K, Kur J. Comparative studies of the Acinetobacter genus and the species identification method based on the recA séquences. Mol CeIl Probes. 2002 Feb;16(l) : l -l l .

10. Nemec A, De Baere T, Tjernberg I, Vaneechoutte M, van der Reijden TJ, Dijkshoorn L. Acinetobacter ursingii sp. nov. and Acinetobacter schindleri sp. nov., isolated from human clinical spécimens. Int J Syst Evol Microbiol. 2001 Sep;51 (Pt 5): 1891 -9

1 1. Nemec A, Dijkshoorn L, Cleenwerck I, De Baere T, Janssens D, Van Der Reij den TJ, Jezek P, Vaneechoutte M. Acinetobacter parvus sp. nov., a small-colony-forming species isolated from human clinical spécimens. Int J Syst Evol Microbiol. 2003 Sep;53 (Pt 5): 1563-7.

12. Ochman and Wilson AC. R Evolution in bacteria: évidence for a universal substitution rate in cellular génomes. J Mol Evol. 1987;26:74-86.

13. Stackebrandt, E., and B. M. Goebel. 1994. Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA séquence analysis in the présent species définition in bacteriology. Int. J. Syst. Bacteriol. 44:846-849.

14. Rainey, F. A., E. Lang, and E. Stackebrandt. 1994. The phylogenetic structure of the genus Acinetobacter. FEMS Microbiol. Lett. 124:349-353.

15. Tjernberg I, Ursing J. Clinical strains of Acinetobacter classified by DNA-DNA hybridization. APMIS. 1989 Jul;97(7) :595-605.

16. Towner KJ. Clinical importance and antibiotic résistance of Acinetobacter spp. Proceedings of a symposium held on 4-5 November 1996 at Eilat, Israël. J Med Microbiol. 1997 Sep;46(9):721 -46.

17. Van Dessel H, Dijkshoorn L, Van Der Reijden T, Bakker N, Paauw A, Van Den Broek P, Verhoef J, Brisse S. Identification of a new geographically widespread multiresistant Λcinetobacter baumannii clone from European hospitals. Res Microbiol. 2004 Mat; 155 (2) : 105-12.

18. Thompson, J. D., D . G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple séquence alignment through séquence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.22:4673-4680

19. Yamamoto, S., and S. Harayama. 1996. Phylogenetic analysis of Acinetobacter strains based on the nucleotide séquences of gyrB gènes and on the amino acid séquences of their products. Int. J. Syst. Bacteriol. 46:506-51 1.

20. Yamamoto, S., and S. Harayama. 1998. Phylogenetic relationships of Pseudomonas putida strains deduced from the nucleotide séquences of gyrQ, rpoO and 16S rRNA gènes. Int. J. Syst. Bacteriol. 48: 813-819.

21. Yamamoto, S., P. J. Bouvet, and S. Harayama. 1999.

Phylogenetic structures of the genus Acinetobacter based on gyrB séquences: comparison with the grouping by DNA-DNA hybridization. Int. J. Syst. Bacteriol. 49: 87-95.