Processing

Please wait...

Settings

Settings

Goto Application

1. WO2006097636 - NUCLEIC ACID FRAGMENTS AND SPECIFIC DETECTION METHOD BY MOLECULAR IDENTIFICATION OF DIFFERENT BACTERIA SPECIES OF THE GENUS ACINETOBACTER

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ FR ]

REVENDICATIONS

1. Gène rpoB complet d'une bactérie du genre Acinetobacter choisie parmi les 23 espèces suivantes : A. calcoaceticus (espèce génomique 1), espèce génomique 3, A. haemolyticus(espèce. génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleή, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend une séquence choisie parmi les séquences telle que décrite dans les séquences SEQ. ID. n°9 et 11 à 32 respectivement, et les séquences présentant au moins au moins 98% de similitude, ainsi que leurs séquences complémentaires.

2. Gène rpoB complet d'une bactérie du genre Acinetobacter choisie parmi lesdites 23 espèces selon la revendication 1 , caractérisé en ce que sa séquence consiste en une séquence choisie parmi les séquences SEQ. ID. n°9 et 1 1 à 32, les séquences inverses et séquences complémentaires et les séquences présentant au moins 98% de similitude avec les dites séquences.

3. Fragment de gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 23 espèces suivantes : A. calcoaceticus (espèce génomique 1), espèce génomique 3, A. haemolyticusÇespèce. génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°33 et 35 à 56 respectivement, et les séquences SEQ. ID. n°77 et 79 à 100 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

4. Fragment de gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(espèce. génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouυetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parυus, caractérisé en ce que sa séquence consiste en une séquence choisie parmi les séquences SEQ. ID. n°33 à 56 respectivement et les séquences SEQ. ID. n°77 à 100 respectivement, et les séquences présentant au moins 98% de similitude, et leurs séquences complémentaires.

5. Fragment non codant encadrant le gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus

(espèce génomique 1), A. baumannii (espèce génomique 2) , espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouυetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvu caractérisé en ce que sa séquence comprend une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°121 à 144 respectivement, et les séquences SEQ. ID. n° 165 à 188 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

6. Fragment de gène non codant encadrant le gène rpoB d'une bactérie du genre Acinetobacter selon la revendication 5, caractérisé en ce que sa séquence consiste en une séquence choisie parmi les séquences SEQ. ID. n° 121 à 144 respectivement et les séquences SEQ. ID. n° 165 à 188 respectivement, et les séquences présentant au moins 98% de similitude, et leurs séquences complémentaires.

7. Oligonucléotide caractérisé en ce qu'il présente une séquence spécifique d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus (espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouυetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus. caractérisé en ce que sa séquence comprend une séquence de préférence au moins 18, de préférence encore de 1 8 à 35, motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences :

- SEQ. ID. n°33 à 56 respectivement,

- SEQ. ID. n°77 à 100 respectivement,

- SEQ. ID. n° 121 à 144 respectivement,

- SEQ. ID. n° 165 à 188 respectivement, et

-les séquences présentant au moins 98% de similitude et leurs séquences complémentaires.

8. Utilisation in vitro à titre de sonde d'espèce d'un fragment de gène selon l'une des revendications 3 à 6 ou un oligonucléotide selon la revendication 7.

9. Oligonucléotide caractérisé en ce qu'il présente une séquence conservée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. /jaemotyticus(esiρèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 1 1 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvu, comprenant une séquence d'au moins 12, de préférence d'au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°l à 8 suivantes, leurs séquences complémentaires :

- SEQ. ID. n° 1 : 5'-TAYCGYAAAGAYTTGAAAGAAG-S' ,

- SEQ. ID. n° 2 : 5'-CMACACCYTTGTTMCCRTGA-3',

- SEQ. ID. n° 3 : 5'-GTGATAARATGGCBGGTCGT-3l,

- SEQ. ID. n° 4 : δ'-CGBGCRTGCATYTTGTCRT-S',

- SEQ. ID. n° 5 ! 5'-GAAGARCTTAAGAMDAARCTTG-S'

- SEQ. ID. n° 6 : 5'-CGTTTCTTTTCGGTATATGAGT-S',

- SEQ. ID. n° 7 : 5'- GTTCTTTAGGTATCAACATTGAA -3',

-SEQ. ID. n° 8 : 5'- GACGCAAGACCAATACGRAT -3',

dans lesquelles :

-D représente A, G ou T,

- Y représente C ou T,

- B représente C, G ou T,

- R représente A ou G, et

- M représente A ou C.

10. Mélange d'oligonucléotides caractérisé en ce qu'il comprend un mélange équimolaire d'oligonucléotides tels que définis dans la revendication 9, de séquences différentes comprenant au moins 12, de préférence au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences SEQ. ID. n° 1 à 5 et 8 ou les oligonucléotides de séquences complémentaires.

1 1. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 8 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° l , ou des oligonucléotides de séquences complémentaires.

12. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 16 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°2 ou des oligonucléotides de séquences complémentaires.

13. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 6 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°3 ou des oligonucléotides de séquences complémentaires.

14. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 24 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° 4 ou des oligonucléotides de séquences complémentaires.

15. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 24 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID . n° 5 ou des oligonucléotides de séquences complémentaires.

16. Oligonucléotide selon la revendication 9, caractérisé en ce que sa séquence consiste dans la séquence SEQ ID . n°6 ou séquence complémentaire.

17. Oligonucléotide selon la revendication 9, caractérisé en ce que sa séquence consiste dans la séquence SEQ. ID. n°7 ou une séquence complémentaire.

18. Mélange d'oligonucléotides selon la revendication 10, caractérisé en ce qu'il consiste en un mélange équimolaire de 2 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°8 ou des oligonucléotides de séquences complémentaires.

19. Utilisation à titre d'amorce d'amplification et/ou de réaction de séquençage d'un oligonucléotide ou mélange d'oligonucléotides selon l'une des revendications 9 à 18, pour la détection par identification moléculaire d'une bactérie de l'une desdites espèces du genre Acitenobacter.

20. Procédé de détection par identification moléculaire d'une bactérie de l'une des espèces du genre Acitenobacter, caractérisé en ce qu'on utilise :

- le gène rpoB complet de ladite bactérie selon la revendication 1 ou 2, ou

- un fragment de gène selon l'une des revendications 3 à 6, et/ou

- un oligonucléotide selon l'une des revendications 7, 9, 16 ou 17 ou un mélange d'oligonucléotides selon l'une des revendications 10 à 15 ou 18.

21. Procédé selon la revendication 20, caractérisé en ce qu'on cherche à détecter spécifiquement une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. hae/Mo/yticusÇesTpèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. hvoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11 , A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baj/ji, A. bouvetii, A. gerneή, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvns , procédé dans lequel :

1- on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un oligonucléotide selon le revendication 7 ou un fragment de gène selon l'une des revendications 3 à 7, de préférence un fragment de gène consistant respectivement dans l'une desdites séquences choisie parmi :

- SEQ. ID. n°33 à 56 respectivement,

- SEQ. ID. n°77 à 100 respectivement,

- SEQ. ID. n° 121 à 144 respectivement,

- SEQ. ID. n° 165 à 188 respectivement, et

- les séquences présentant au moins 98% de similitude et leurs séquences inverses et séquences complémentaires.

2- on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques de l'échantillon, et on détermine ainsi la présence de ladite espèce de Acinetobacter dans l'échantillon s'il y a formation d'un complexe d'hybridation.

22. Procédé selon la revendication 20, caractérisé en ce qu'il comprend les étapes dans lesquelles :

1 - on met en contact des amorces d'amplification comprenant desdits mélanges d'oligonucléotides selon l'une des revendications 10 à 15 ou 18, avec un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie du genre Acinetobacter, et on réalise une amplification d'acides nucléiques par réaction de polymérisation enzymatique comprenant :

comme amorce 5', au moins un oligonucléotide ou mélange d'oligonucléotides selon l'une des revendications 10, 11 , 13, 15 et 17 comprenant une séquence incluse dans l'une des séquences SEQ. ID. n° 1 , 3, 5, et 7 de préférence consistant dans ladite séquence SEQ. ID. n° l , 3, 5, et 7 complète ou les séquences complémentaires, et comme amorce 3', au moins un oligonucléotide ou mélange d'oligonucléotides selon l'une des revendications 10, 12, 14, 16, et 18 comprenant des séquences incluses dans l'une des séquences SEQ. ID. n° 2,

4 6, et 8 respectivement, de préférence consistant dans ladite séquence SED ID n°2, 4, 6, et 8 complète ou respectivement une séquence complémentaire.

2- et on détermine l'apparition ou l'absence d'un produit d'amplification, et on détermine ainsi la présence ou l'absence de ladite bactérie dans l'échantillon si un produit d'amplification est ou n'est pas apparu respectivement.

23. Procédé selon la revendication 22, caractérisé en ce qu'on cherche à détecter une espèce donnée d'une bactérie bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce gênomique 1 ), A. baumannii (espèce gênomique 2), espèce gênomique 3, A., h aemolyticus (espèce gênomique 4), A. junii (espèce gênomique 5), espèce gênomique 6, A. johnsonii (espèce gênomique 7), A. Imoffii (espèce gênomique 8), espèce gênomique 9, espèce gênomique 10, espèce gênomique 11, A. radioresistens (espèce gênomique 12), espèce gênomique 13, espèce gênomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A.parvus, et, à l'étape 2, on détermine la présence ou l'absence de l'espèce donnée d'une dite bactérie en effectuant les étapes dans lesquelles :

a) on réalise une réaction de séquençage d'un fragment de gène amplifié avec des dites amorces, et

b) on compare la séquence dudit fragment amplifié obtenu avec la séquence d'un fragment de gène de ladite bactérie comprenant respectivement :

- lesdites séquences SEQ. ID. n° 33 à 56, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n°l et 2 respectivement - les dites séquences SEQ. ID. n° 77 à 100, lorsque les dites amotces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 3 et 4 respectivement, et

- les dites séquences SEQ. ID. n° 121 à 144, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences

SEQ. ID. n° 5 et 6 respectivement, et

- les dites séquences SEQ. ID. n° 165 à 188, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement.

24. Procédé selon la revendication 22, caractérisé en ce qu'on cherche à détecter une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce gênomique 1), A. baumannii (espèce génomiqne 2), espèce gênomique 3, A. haemolyticus(espèce gênomique 4), A. junii (espèce gênomique 5), espèce gêno?nique 6, A. johnsonii (espèce gênomique 7), A. Iwoffii (espèce gênomique 8), espèce gênomique 9, espèce gênomique 10, espèce gênomique 1 1, A. radioresistens (espèce gênomique 12), espèce gênomique 13, espèce gênomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A.parvus, et, à l'étape 2, on détermine la présence ou l'absence de l'espèce donnée d'une dite bactérie par en effectuant les étapes dans lesquelles :

a- on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques amplifié d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un fragment de gène rpoB selon l'une des revendications 3 à 6, ou un oligonucléotide selon la revendication 7, de préférence un fragment consistant respectivement dans l'une desdites séquences choisie parmi :

- SEQ. ID. n°33 à 56 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 1 et 2 respectivement - SEQ. ID . n°77 à 100 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 3 et 4 respectivement, et

- SEQ. ID. n°121 à 144 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ.

ID. n° 5 et 6 respectivement, et

-SEQ. ID. n°165 à 188 respectivement, lorsque les dites amorces 5' et 3' sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement, et.

b- on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques amplifié de l'échantillon, et on détermine ainsi la présence ou l'absence de ladite espèce de Acinβtobacter dans l'échantillon s'il y a formation ou non d'un complexe d'hybridation.

25. Procédé selon l'une des revendications 22 à 24, caractérisé en ce que l'on réalise les étapes comprenant :

1 - une première amplification de l'acide nucléique dudit échantillon avec un couple d'amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon les revendications 11 et 12, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n° l et SEQ. ID. n°2, de préférence consistant dans lesdites séquences SEQ. ID. n° l et 2, ou les séquences complémentaires, et

2- une première détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 1 avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°33 à 56 respectivement, et

-si à cette étape 2 on détermine la présence des espèces A. grimontii ou A. J7inii, on réalise en outre: 3a — une seconde réaction d'amplification avec des amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon la revendication 10 ou les revendications 13 et 14, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n° 3 et SEQ. ID. n° 4, de préférence consistant dans lesdites séquences SEQ. ID. n°3 et 4, ou les séquences complémentaires, et

4a- une détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 3a avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID . n°77 à 100 respectivement, ou

- si à cette étape 2 on détermine la présence des espèces A. baylii ou A. gênomique espèce 1 1, on réalise en outre :

3b- une seconde réaction d'amplification avec des amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon les revendications 17 et 18, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n° 7 et SEQ. ID. n°8, de préférence consistant dans lesdites séquences SEQ. ID. n° 7 et 8, ou les séquences complémentaires, et

4b- une détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d'au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l'étape 3b avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°165 à 188 respectivement.

26. Trousse de diagnostic utile dans un procédé selon l'une des revendications 20 à 25, caractérisée en ce qu'elle comprend au moins un dit oligonucléotide selon l'une des revendications 7, 9, 16 ou 17 ou un mélange d'oligonucléotides selon l'une des revendications 10 à 15 ou 18 ou un fragment de gène selon l'une des revendications 3 à 6, ainsi que, de préférence, des réactifs utiles dans les réactions d'hybridations ou réactions d'amplification ou séquençage le cas échéant.