Processing

Please wait...

Settings

Settings

Goto Application

1. WO2005064015 - PRIMERS AND A SCREENING METHOD FOR IDENTIFICATION OF ARTEMISININ PRODUCING PLANTS

Publication Number WO/2005/064015
Publication Date 14.07.2005
International Application No. PCT/IN2003/000404
International Filing Date 29.12.2003
Chapter 2 Demand Filed 29.07.2005
IPC
C12Q 1/68 2006.01
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
68involving nucleic acids
CPC
A01H 1/04
AHUMAN NECESSITIES
01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
HNEW PLANTS OR ; NON-TRANSGENIC; PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
1Processes for modifying genotypes ; ; Plants characterised by associated natural traits;
04Processes of selection ; involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
C07H 21/04
CCHEMISTRY; METALLURGY
07ORGANIC CHEMISTRY
HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
21Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
04with deoxyribosyl as saccharide radical
C12Q 1/6895
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms
68involving nucleic acids
6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
6888for detection or identification of organisms
6895for plants, fungi or algae
C12Q 2600/13
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
2600Oligonucleotides characterized by their use
13Plant traits
C12Q 2600/156
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS
2600Oligonucleotides characterized by their use
156Polymorphic or mutational markers
Applicants
  • COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH [IN]/[IN] (AllExceptUS)
  • KHANUJA, Suman, Preet, Singh [IN]/[IN] (UsOnly)
  • PAUL, Shilpi [IN]/[IN] (UsOnly)
  • SHASANY, Ajit, Kumar [IN]/[IN] (UsOnly)
  • DAROKAR, Mahendra, Pandurang [IN]/[IN] (UsOnly)
  • SHUKLA, Ashutosh, Kumar [IN]/[IN] (UsOnly)
  • GUPTA, Madan, Mohan [IN]/[IN] (UsOnly)
  • KUMAR, Anuruddha [IN]/[IN] (UsOnly)
Inventors
  • KHANUJA, Suman, Preet, Singh
  • PAUL, Shilpi
  • SHASANY, Ajit, Kumar
  • DAROKAR, Mahendra, Pandurang
  • SHUKLA, Ashutosh, Kumar
  • GUPTA, Madan, Mohan
  • KUMAR, Anuruddha
Agents
  • BHOLA, Ravi
Priority Data
Publication Language English (EN)
Filing Language English (EN)
Designated States
Title
(EN) PRIMERS AND A SCREENING METHOD FOR IDENTIFICATION OF ARTEMISININ PRODUCING PLANTS
(FR) AMORCE ET PROCEDE D'IDENTIFICATION DE PLANTES RICHES EN ARTEMISININE
Abstract
(EN)
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
(FR)
L'invention porte sur une paire d'amorces, soit: une amorce directe SEQ ID NO. 1 présentant la séquence CCAAGCTTGCTGAACGCATCGG, et une amorce inverse SEQ ID No. 2 présentant la séquence CCAAGCTTGCCACGCAGGATTATC, et sur une méthode de criblage permettant l'identification précoce de plantes Artemisia annua à forte teneur en artémisinine et favorisant de ce fait la génération de populations de plantes à teneur renforcée en artémisinine.
Latest bibliographic data on file with the International Bureau