Some content of this application is unavailable at the moment.
If this situation persist, please contact us atFeedback&Contact
1. (WO1999037795) PROMOTER AND REGULATOR SEQUENCES $i(Ha ds10 G1): A GENE LEA OF SUNFLOWER EXPRESSED EXCLUSIVELY IN SEEDS FROM THE MATURATION PHASE
Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

TÍTULO
PROMOTOR Y SECUENCIAS REGULADORAS DE HA DS10 G1: UN GEN LEA DE GIRASOL EXPRESADO EXCLUSIVAMENTE EN SEMILLAS DESDE LA FASE DE MADURACIÓN.

SECTOR DE LA TÉCNICA
Agricultura. Esta invención se relaciona con la obtención de secuencias de ADN reguladoras ("promotores") y la construcción, usando dichas secuencias, de nuevos genes quiméricos capaces de expresarse de forma específica en semillas de plantas transgénicas. El gen Ha ds10 G1 tiene la peculiaridad de expresarse exclusivamente en semillas de girasol desde la fase de maduración hasta la de desecación; sin responder a hormonas como el ácido abscísico (ABA), o al estrés hídrico en tejidos vegetativos. Además, el gen Ha ds10 G1 se expresa de forma homogénea en embriones inmaduros, y preferentemente en el parénquima en empalizada de los cotiledones de embriones maduros. Estos patrones de expresión, junto con los elevados niveles de actividad del gen, sugieren que sus secuencias reguladoras sean especialmente adecuadas para la manipulación genética de sustancias de reserva en semillas

ESTADO DE LA TÉCNICA
Para conferir expresión específica en semillas de plantas transgénicas, hasta el momento se han aislado, caracterizado y utilizado promotores pertenecientes sobre todo a genes vegetales que codifican proteínas de reserva, u otros productos expresados exclusivamente en semillas durante diversas etapas del desarrollo [véanse por ejemplo las siguientes referencias bibliográficas y patentes, así como otros documentos citados en ellas: Thomas TL, en Plant Cell, vol 5, pp 1401-1410, 1993; Gatehouse JA, y Shirsat AH, en Control of Plant Gene Expression, pp 357-375, CRC press, 1993; y las patentes USA números: 5530192, 5530194 y 5420034]. Esto ha permitido por ejemplo la obtención de nuevas plantas transgénicas con semillas modificadas en su contenido de ácidos grasos y de proteínas de reserva [véanse por ejemplo:

Voelker TA, Worrell AC, Anderson L.Bleibaum J, Fan C, Ha kins DJ, Radke SE y Davies HM, en Science, vol. 257, pp.72-74, 1992; y Saalbach I, Pickardt T, Machemehl F, Saalbach G, Schieder O, y Muntz K, en Molecular and General Genetics 242: 226-236, 1994]. Para el desarrollo del enorme potencial de esta técnica, pudieran ser útiles otros promotores con distintas especifidades de tejido en la semilla y diversos patrones temporales de expresión. Recientemente en nuestro grupo, y otros laboratorios, hemos descrito la expresión en semillas de genes que codifican proteínas de choque térmico de bajo peso molecular (sHSPs: small heat-shock proteins). Uno de estos genes, Ha hsp17.7 G4 , muestra, en plantas transgénicas de tabaco, patrones de expresión adecuados para su posible uso en la modificación de semillas mediante ingeniería genética: dicho gen se expresa desde etapas tempranas de la maduración de la semilla, y con una especificidad de tejido asociada a los cotiledones [Coca MA, Almoguera C, Thomas TL, y Jordano J, en: Plant Molecular Biology 31 : 863-876, 1996]. Sin embargo el gen Ha hspU.7 G4, al igual que otros genes vegetales sHSP expresados en semillas, también se expresa en respuesta al calor (choques térmicos) en tejidos vegetativos de la planta tras la germinación de las semilla. Esto último imposibilita su uso en ingeniería genética cuando se requieren secuencias de ADN reguladoras que garanticen que no haya expresión de los genes quiméricos fuera de la semilla: por ejemplo, cuando la expresión fuera de lugar de estos genes pueda afectar a la viabilidad, el crecimiento o la salubridad de las plantas transgénicas. Para solucionar estos problemas hemos modificado las secuencias reguladoras del gen Ha hsp17.7 G4 de forma que genes quiméricos que contengan estas secuencias mantengan su expresión en semillas y pierdan su inducción por calor; procedimiento utilizable para la modificación y uso similar de secuencias reguladoras de otros genes sHSP expresados en semillas [Almoguera, Prieto-Dapena y Jordano, solicitud de patente #9602746 (Oficina Española de Patentes)]. De forma alternativa, también hemos propuesto un uso similar para el promotor y las secuencias reguladoras del gen de girasol Ha hsp17.6 G1, que únicamente se expresa en semillas. Dicho gen no responde ai calor o a otro tipo de estrés (frío, desecación, tratamiento hormonal con ABA) en tejidos vegetativos [Carranco, Almoguera y Jordano, solicitud de patente #9701215 (Oficina Española de Patentes).
En la presente solicitud proponemos usos análogos alternativos para el promotor y las secuencias reguladoras del gen LEA de girasol Ha ds10 G1. El gen Ha ds10 G1 está incluido en un clon genómico correspondiente a un ADNc descrito previamente (Ha ds10, número de acceso X50699) cuyos patrones de expresión se conocían de forma incompleta [Almoguera y Jordano, Plant Mol. Biol. 19:781-792, 1992]. El promotor y secuencias reguladoras de este gen (Ha ds10 G1) han sido clonados y se describen, caracterizan y utilizan por primera vez en los ejemplos de esta solicitud. El gen Ha ds10 G1 pertenece a la familia de genes LEA (Late Embryogenesis Abundant) de Clase I (tipo D-19 ó LEA-I). Estos genes codifican proteínas altamente conservadas en varias especies vegetales, y su expresión está generalmente restringida a semillas y a fases tempranas de la germinación [ver por ejemplo las siguientes revisiones: Dure III, L., Structural motifs in Lea proteins, en Plant Responses to Plant Dehydration During Environmental Stress., Cióse TJ and Bray EA Eds., Current Topics in Plant Physiology 10: 91-103, 1993; y Delseny M, Gaubier P, Hull G, Saez-Vasquez J, Gallois P, Raynal M, Cooke R, Grellet F., Nuclear Genes expressed during seed desiccation: relationship with responses to stress , en Stress-induced Gene Expression in Plants (Basra, A. S., ed.), pp. 25-59, Harwood Academic Publishers, Reading, 1994]. Los promotores de los genes LEA no han sido considerados como buenos candidatos para su uso en proyectos de modificación de sustancias de reserva en semilla, ya que en general presentan actividad en fases posteriores a la maduración de la semilla, como durante la desecación del embrión [ver las consideraciones de Kridl JC, Knauf VC, Thompson GA, en Control of Plant Gene Expression. pp. 481-498, CRC press,1993]. Sin embargo se conocen genes LEA que se activan en fases de maduración anteriores a la desecación, como los genes de algodón denominados LEA-A [Hughes DW y Galau GA, The Plant Cell 3:605-618, 1991]. También dentro los genes LEA de clase I se conocen ejemplos de activación anterior a la desecación, como en el caso de los genes At Em1, emb564, y embl [respectivamente en arabidopsis, maíz y zanahoria: Gaubier P, Raynal M, Hull G, Huestis GM, Greilet F, Arenas C, Pages M, y Delseny M, Mol. Gen. Genet, 238: 409-418, 1993; Williams B, y Tsang A, Plant Mol. Biol., 16: 919-923, 1991 ; Wurtele ES, Wang H, Durgerian S, Nikolau BJ, y Ulrich TH. Plant Physiol. 102:303-312, 1993]. Estos ejemplos indicarían el posible uso de secuencias reguiadoras de genes de esta familia para la modificación de semillas. No obstante, su uso concreto estaría limitado tanto por los niveles de expresión alcanzados en cada caso y en cada fase del desarrollo; como por las distintas especificidades de tejido. Así por ejemplo, aunque en Arabidopsis el gen At Em1 se activa tempranamente, su expresión esta fundamentalmente restringida a tejidos provasculares de los cotiledones y a tejidos corticales externos del eje embrionario [Gaubier, P., Raynal, M., Hull, G., Huestis, GM., Grellet, F., Arenas, C, Pages, M., y Delseny, M., Mol. Gen. Genet., 238: 409-418, 1993]. En el caso del gen embl de zanahoria, sus ARNm se localizan preferente en los meristemos del embrión, particularmente en el procambium [Wurtele ES, Wang H, Durgerian S, Nikolau BJ, y Ulrich TH. Plant Physiol. 102:303-312, 1993]. No se han publicado las secuenciasgenómicas del genemb564, y se desconoce la localización precisa de sus ARNm [Williams B, y Tsang A, Plant Mol. Biol., 16: 919-923, 1991].
La expresión del gen de girasol Ha ds10 G1, así como su promotor y secuencias reguladoras presentan, como se describe a continuación, unas características únicas entre las de otros miembros de la familia LEA-I; lo que hace que dichas secuencias sean potencial mente utilizables en la modificación de semillas mediante ingeniería genética.

DESCRIPCIÓN DE LA INVENCIÓN
Con la presente invención aislamos y caracterizamos en plantas transgénicas de tabaco, el promotor y las secuencias reguladoras de un gen LEA-I de girasol, Ha ds10 G1. Estas secuencias (Ejemplo 1 ) presentan unas características muy apropiadas para su uso en la modificación de semillas (por ej. de sustancias de reservas). Las ventajas de su posible uso en plantas transgénicas se muestran mediante otros ejemplos: A.- Estudios de la acumulación y localización del ARNm Ha ds10 en el sistema homólogo (Ejemplo 2). Estos estudios muestran tanto los elevados niveles de expresión alcanzados durante la embriogénesis desde fases tempranas de la maduración, como sus absoluta especificidad de semilla, acompañada de una localización homogénea en embriones que acaba restringiéndose fundamentalmente al parénquima en empalizada de los cotiledones, un tejido especializado en la acumulación de sustancias de reservas en el girasol. B.- En el ejemplo 3, ilustramos también el posible uso de dichas secuencias mediante la construcción y análisis en plantas transgénicas de distintos genes quiméricos; usando el promotor y combinaciones de distintas secuencias reguladoras de Ha ds10 G1 (5'-flanqueantes, codificantes, intrón y 3'-flanqueantes), con el gen indicador (repórter) de la β-glucuronidasa bacteriana (GUS). Estos ejemplos demuestran en un sistema heterólogo modelo (tabaco) la utilidad de los distintos genes quiméricos ensayados: alto nivel de expresión y especifidad de semillas desde fases tempranas de la maduración, así como la contribución funcional de las distintas secuencias ensayadas. Mediante los ejemplos adjuntos mostramos que la especifidad de semillas está conferida fundamentalmente por el promotor y secuencias 5 '-flanqueantes de Ha ds10G1 (incluyendo secuencias no-transcritas y transcritas: como el 5'-UTR y parte de la secuencia codificante). Adicionalmente las secuencias 3'-flanqueantes incrementan los niveles de expresión en semillas; y el intrón los reduce de forma específica en tejidos no-embrionarios. Dada la conservación de la regulación de la expresión de genes embrionarios en semillas de plantas, incluidos los genes LEA-I [Thomas TL, en The Plant Cell 5:1401-1410, 1993]; estas secuencias podrían usarse tanto en el sistema homólogo (el girasol) como en otros sistemas heterólogos de gran importancia económica (por ejemplo la colza, la soja, el maíz, etc).
La realización práctica de esta invención, representada con los ejemplos y figuras adjuntos, utiliza técnicas convencionales de Biología Molecular, Microbiología, ADN recombinante; y de producción de plantas transgénicas, que son de uso común en laboratorios especializados en estos campos. Estas técnicas están explicadas con suficiente detalle en la literatura científica [véanse por ejemplo: Sambrok J, Fritsch EF, y Maniatis T, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory Press, 2a Edición, 1989;

Glover DM, DNA Cloning, IRL Press , 1985; Lindsey K., Plant Ηssue Culture Manual, Kluwer Academic Publishers, 1993; y Gelvin SB, Schilperoort RA, Verma DPS, Plant Molecular Biology Manual, Kluwer Academic Publishers , 1992]. Para otros detalles mas específicos, se citan las referencias bibliográficas pertinentes en el lugar correspondiente de esta solicitud.

EJEMPLO 1 : clonación, determinación del mapa de restricción, secuencia nucleotídica. v análisis del promotor de Ha ds10 G1.
Para obtener el clon Ha ds10 G1 se rastreó la genoteca de ADN genómico de girasol descrita por Coca et al. [Plant Mol. Biol. 31 : 863-876, 1996], con la sonda correspondiente al ADNc completo Ha ds10 [Almoguera y Jordano, Plant Mol. Biol. 19: 781-792, 1992]; usando las condiciones de hibridación y procedimientos estandard de clonación molecular descritos con suficiente detalle en la primera de estas referencias (Coca et ai, 1996). Así, aislamos un fago (IGEM11) con un inserto de ADN genómico de girasol de aproximadamente 16.5 Kb cuyo mapa parcial se muestra en la Figura 1. Mediante análisis de restricción, determinamos que dos fragmentos adyacentes de Sac I (de 4.2 y 9.3 Kb) contienen las secuencias que hibridan con el ADNc. Se determinó un mapa de restricción detallado del primero de estos fragmentos, y de parte (A4 Kb) del segundo (Figura 1 ). Distintos subfragmentos de ADN genómico, correspondientes a la región mapeada, se clonaron en el vector pBluescript SK+, dando lugar a los plásmidos cuyo nombre e inserto se indica en la Figura 1. A partir de estos plásmidos se determinó, en ambas cadenas del ADN y por el método de Sanger (dideoxi), la secuencia nucleotídica de 3617 bp entre los sitios de Sac I y Sma I (Figura 1 , parte inferior). Estos datos se presentan en la SEQ N° 1. Mediante comparaciones de secuencia confirmamos que parte de la secuencia genómica determinada se corresponde con la del ADNc Ha dslO [Almoguera y Jordano, Plant Mol. Biol. 19: 781-792, 1992; número de acceso en GenBank X59699]. La secuencia de aminoácidos de la proteína codificada por el gen Ha ds10 G1 se indica bajo las secuencias nucleotídicas correspondientes. En el ADN genómico, la zona codificante está interrumpida por un intrón anómalamente largo (de 1024 bp), aunque situado en una posición conservada en otros genes LEA de clase I [ver datos revisados por Simpson GC, Leader DJ, Brown JWS y Franklin T, en Charasteristics of Plant pre-mRNA Introns and Transposable Elements; Plant Mol. Biol. LabFax, pp. 183-252; Croy RRD Ed., Bios Scientific Publishers Ltd. 1993]. La única diferencia, entre las secuencias genómicas que codifican el ARNm y las del ADNc, fue una inversión de dos nucleótidos (GC en vez de CG) dentro del segundo exón (en las posiciones +1176 y +1177 desde el codón de iniciación); lo que provoca un cambio de un aminoácido (S en vez T) en la secuencia de la proteína. La diferencia se debe a un error (debido a una compresión) en la lectura inicial de las reacciones de secuencia del ADNc. Las secuencias de Ha ds10 G1 que hemos determinado incluyen también 1576 bp, del promotor del gen y secuencias 5'-flanqueantes; y 553 bp de secuencias genómicas 3'-flanqueantes no presentes en el ADNc original.
Mediante la técnica de extensión del cebador (primer extensión), se determinaron tres posibles sitios de iniciación de la transcripción en el promotor de Ha dslO G1. Dos de estos sitios han sido confirmados mediante otras técnicas (sitios 1 y 2, indicados por flechas en la SEQ N° 1 ). Para ello se utilizó, según el procedimiento descrito por Domon et al. [Domon C, Evrard JL, Pillay DTN, y Steinmetz A. Mol. Gen. Genet. 229:238-244, 1991], ARN total de embriones de girasol hibridado con el cebador sintético: 5'-CTCCTGTTCCGGAATTTTGCGTGT-3'; cuya secuencia corresponde a la de la cadena no codificante de Ha ds10 G1, entre las posiciones +25 y +48, desde el codón de iniciación. Las hibridaciones con el cebador se hicieron a 62°C. Los híbridos se extendieron con transcriptasa reversa de AMV, durante 90 min. a 42°C. Los productos de extensión se analizaron en geles de secuenciación PAGE al 6%, junto con reacciones de secuencia producidas usando el mismo cebador. Los sitios de iniciación 1 y 2 (en las posiciones -33 y -25; ver SEQ N° 1 ) son funcionales, y se detectan de forma independiente usando la técnica de protección frente a la ribonucleasa A (RNAsa A, ver Figura 3A). Un tercer sitio de iniciación (sitio 3, en la posición -119 de la SEQ N°1) no fue confirmado claramente, mediante dicha técnica. Estos sitios de iniciación delimitan funcionalmente el extremo 3' del promotor del gen Ha ds10 G1.

El análisis de las secuencias proximales del promotor del gen Ha ds10G1 mostró que dos de los sitios de iniciación detectados (los sitios 1 y 2) se encuentran a una distancia apropiada de una posible secuencia TATA (en la posición -86). El posible sitio mas distal (sitio 3, -119) no tiene secuencias TATA claras situadas en su proximidad. Además de estos elementos del promotor, se observaron dos posibles "cajas" RY (RY1 e RY2 en las posiciones -129 y -65 de la SEQ N° 1 ), como las que participan en regulación de la expresión en semillas de numerosos genes de plantas [Dickinson CD, Evans RP, y Nielsen RC, en NucleicAcids Research 16: 371, 1988 ].
Hemos modificado la caja RY1 situada en -129; verificando, mediante experimentos de expresión transitoria en embriones de girasol, su requerimiento funcional para la trans-activación del promotor de Ha ds10G1 por factores transcripcionales de tipo ABI3 [Giraudat J., Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM en The Plant Ce// 4: 1251-1261 , 1992]. Para ello, preparamos modificaciones de las fusiones ds10::GUS construidas para estudios en plantas transgénicas (ver el Ejemplo 6.3 y la Figura 5). Los genes quiméricos contenidos en dos de estas fusiones (ds10F1 ds10F2) se purificaron como fragmentos de ADN que se subclonaron por ligación en el vector pBluescript SK+ (Promega); cambiando así las secuencias del vector binario por otras de menor tamaño, mas útiles para realizar experimentos de expresión transitoria. Así, usando el fragmento Sal I - Eco Rl (con el gen quimérico obtenido a partir de ds10F1), obtuvimos el plásmido pSKds10F1. En el caso de ds10F2, el fragmento de Sph I - Eco Rl (desde la posición -125 en Ha ds10 G1, hasta el extremo 3' de nos) se ligó al fragmento complementario (que contiene el promotor y secuencias 5 'flanqueantes de Ha ds10 G1), purificado tras la digestión de pSKds10F1 con Sph I y Eco Rl, resultando en el plásmido pSKds10F2. Finalmente a partir de los plásmidos pSKds10F1 y pSKds10F2 (mapas no mostrados) se obtuvieron versiones mutagenizadas de los mismos tras la digestión de su ADN con Sph I, haciendo romos los extremos resultantes mediante tratamientos con ADN polimerasa de T4, seguidos de re-ligación del ADN. De esta forma obtuvimos los plásmidos pSKds10F1 ERY y pSKds10F2 ERY (mapas no mostrados). Estos plásmidos difieren únicamente en una deleción de 5 nucleótidos entre las posiciones -126 y -122 del promotor de Ha ds10 G1. Estos cambios destruyeron la caja RY1 presente en los genes quiméricos ds10F1 y ds10F2 (ver Figuras 1 , 2 y 5), lo que se verificó mediante reacciones de secuenciación por el método de Sanger (dideoxy), usando el cebador 5OTCCTGTTCCGGAATTTTGCGTGT3' (cadena no codificante de Ha ds10G1, entre las posiciones +25 y +48 ).
Los experimentos de trans-activación en expresión transitoria se realizaron mediante el bombardeo de embriones de girasol con proyectiles cubiertos de mezclas de ADN de distintos plásmidos. Estas mezclas contienen un plásmido de referencia, pDO432 [Ow DW, Wood KV, deLuca M, de Wet JR, Helinski D y Howell SH. Science 234: 856-859, 1996], con el gen de la luciferasa (LUC) de luciérnaga (Photinus pyralis) bajo el control del promotor CaMV 35S; la fusión ds10::GUS ensayada en cada caso (con las secuencias RY1 intactas o modificadas),y un plásmido efector, pABI3, que expresa el factor ABI3 bajo el control del promotor CaMV 35S. pABI3 se obtuvo sustituyendo el ADNc de Pv ALF en el plásmido pALF [Bobb AJ, Eiben HG, y Bustos MM en The Plant Journal 8: 331-343, 1995], por el ADNc de ABI-3. El ADNc de ABI3 se clonó como un fragmento Xba I (hecho romo con klenow) - Eco Rl (parcial), purificado a partir del plásmido pcabi3-4F [Giraudat J., Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM en The Plant Cell 4: 1251-1261 , 1992]. El plásmido pABI3 se añade a la mezcla, o se omite, para probar el efecto del factor ABI3 sobre la expresión GUS de la fusión ensayada. Los experimentos se realizaron esencialmente como se describe por Bobb et al., [Bobb AJ, Eiben HG, y Bustos MM en The Plant Journal 8: 331-343, 1995], con las siguientes modificaciones. Los embriones de girasol (17-20 dpa) se prepararon como sigue. Las semillas de girasol se esterilizan con lavados en etanol 70% durante 1 min, y en 2% de hipoclorito sódico con una gota de Tritón X-100 durante 40 min, finalizados con varios lavados con agua destilada; tras los que se pelan en condiciones estériles. Los embriones se cortan longitudinalmente (separando sus dos cotiledones) y se colocan con la superficie cortada, sobre placas con medio sólido MS, que contiene 2% sacarosa y 0.5 M sorbitol. A continuación se precultivan durante 2-4 h en oscuridad y temperatura ambiente (25°C). Todos los plásmidos fueron purificados usando el Quantum midiprep kit (Biorad).

Normalmente se usaron para cada disparo: 0.2 μg del plásmido de referencia, 1 μg del plásmido ds10::GUS y 1 μg del plásmido efector (o la misma cantidad del plásmido pJIT82 en los controles negativos). Para la preparación de las partículas de oro, así como la precipitación del ADN sobre las mismas, se siguió el método descrito por Chern et al. [Chern MS, Bobb AJ y Bustos M. The Plant Cell 8: 305-321 , 1996]. El bombardeo de partículas se llevó a cabo con el sistema Biolistic PDS-1000 He (Biorad). Las condiciones de bombardeo fueron: Membrana de ruptura de 1550 psi, partículas de oro de 1.6 μm de diámetro, distancia de la membrana de ruptura al macrocarrier de 8 mm, distancia del macrocarriera la rejilla de 6 mm; y distancia al tejido a bombardear de 6 cm. Los cotiledones bombardeados se incubaron durante 24 h a 28 °C en la oscuridad; tras lo cual se ensayó la actividad GUS (referida a la actividad LUC), como se describe por Bobb et al. [Bobb AJ, Eiben HG, y Bustos MM en The Plant Journal 8: 331-343, 1995].
La adición del plásmido efector pABI3 tuvo un efecto claro sobre la expresión relativa de GUS/LUC en bombardeos con la fusión pSKds10F2 (incremento medio de actividad relativa A46.2X). En cambio, si la transactivación se hace con el mismo plásmido mutado en la caja RY1 (pSKdsl 0F2 ERY1 ), se observó un descenso significativo del incremento medio de actividad relativa debido al efecto de ABI3 (A26.3 X). Este resultado, mostrado en la figura 2, confirma el requerimiento funcional de la secuencia RY1 (posición -129 en la SEQ N° 1). Por lo tanto esta caja RY participa en la activación transcripcional en semillas del promotor Ha ds10 G1, por factores del tipo ABI3 [Giraudat J., Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM en The Plant Cell 4: 1251-1261 , 1992]. Otras secuencias del promotor (por ej. RY2 en -65) también pudieran contribuir al efecto de transactivación observado, ya que la mutación ensayada no destruye completamente el efecto activador de ABI3.

EJEMPLO 2: Acumulación v localización específica del mRNA Ha ds10 en embriones de girasol:

Los patrones de acumulación de los ARN mensajeros del gen Ha ds10G1 se determinaron mediante la técnica de la protección frente a la Ribonucleasa A (RNAsa A), descrita con detalle por Almoguera et al. [Almoguera C, Coca MA, Jordano J. Plant Physiol. 107: 765-773, 1995]. Para ello, se utilizaron muestras de ARN total preparadas a partir de embriones de semillas en distintos estados de desarrollo en condiciones normales de crecimiento [Almoguera y Jordano, Plant Mol. Biol. 19: 781-792, 1992; Coca et al., Plant Mol. Biol. 25: 479-492, 1994]; de germínulas de 3 días tras la imbibición (dpi); y de distintos órganos de plantas adultas antes de la floración. Los ARN de germínulas y plantas se prepararon a partir de material vegetal obtenido tanto en condiciones de crecimientro controlado [Almoguera y Jordano, Plant Mol. Biol. 19: 781-792, 1992; Coca MA, Almoguera C, y Jordano J. Plant Mol. Biol. 25: 479-492, 1994; Coca MA, Almoguera C, Thomas TL, y Jordano J. P/a/7f Mol. Biol. 31 : 863-876, 1996], como tras tratamientos de estrés: déficit de agua [Almoguera C, Coca MA, y Jordano J. Plant J. 4: 947-958, 1993; Coca MA, Almoguera C, Thomas TL, y Jordano J. Plant Mol. Biol. 31 :863-876, 1996]; o tras la adición de hormonas como el ácido abscísico [Almoguera C y Jordano J. Plant Mol. Biol. 19: 781-792, 1992; Coca MA, Almoguera C, Thomas TL, y Jordano J. Plant Mol. Biol. 31 : 863-876, 1996]. Las condiciones empleadas en cada tratamiento se describen con detalle en las referencias citadas en cada caso. La ribosonda usada para detectar los ARNm de Ha ds10 G1 tiene una longitud de 396 nucleótidos, de los cuáles 63 son secuencias del vector pBluescript SK+ y el resto la secuencia de la cadena no-codificante de Ha ds10 G1 entre las posiciones +212 y -121 (Sph I). Esta sonda híbrida con el extremo 5' de los ARN mensajeros de Ha ds10 G1, sobrepasando el sitio mas distal de iniciación de la transcripción (sitio 3, SEQ N° 1 ), lo que permite detectar ARN mensajeros (ARNm) producidos a partir de los tres sitios de iniciación y la verificación experimental de las posiciones de iniciación. Esta ribosonda se preparó por transcripción in vitro, usando la ARN polimerasa T3, y como molde ADN del plásmido ds10G1S3 E4.4. (Figura 1) que contiene las secuencias de Ha ds10G1 entre -1576 (Sal I) y +212, clonadas en el vector pBluescript SK+.

Los resultados en la Figura 3 muestran que los ARN mensajeros de Ha ds10 G1 se detectan únicamente en semillas. Los niveles mayores de acumulación se observan en torno a 18-20 dpa, detectándose la expresión del gen a partir de los 10 dpa y desapareciendo tras la germinación (Figura 3). Los tratamientos con ABA, o déficit de agua no indujeron la acumulación de los ARN mensajeros de Ha ds10 G1 (datos mostrados para ABA en germínulas; Figura 3). Como control positivo en las muestras de ARN analizadas para los distintos tratamientos, realizamos hibridaciones (datos no mostrados) con otra ribosonda de 651nucleótidos del gen Ha hsp17.7 G4, descrita anteriormente [Coca et al., Plant Mol. Biol. 31 : 863-876, 1996]; ya que dicho gen se expresa en respuesta a los distintos tratamientos ensayados. Estos análisis demostraron que los ARNm de Ha ds10 G1 se acumulan exclusivamente en semillas, en condiciones normales del desarrollo y desde etapas tempranas de la maduración, confirmándose la iniciación a partir de al menos los sitios 1 y 2 (indicados en SEQ N° 1). La banda indicada por el número 3 (Figura 3) no coincide bien con el tamaño esperado para el sitio de iniciación 3 (SEQ N°1). Esta banda pudiera deberse a la protección de secuencias de ARN mensajeros de un gen muy homólogo; o bien del mismo Ha ds10 G1, conteniendo secuencias del intrón (ARNm sin procesar).
La distribución de los ARNm de Ha ds10 G1 en embriones de girasol, fue investigada mediante experimentos de localización por hibridación in situ. Para ello los embriones se incluyeron en parafina, fijaron, seccionaron, e hibridaron con sondas específicas; esencialmente como se describe por Molinier [en la tesis: Diplome D' Etudes Approfondies de Biologie Cellulaire et Moleculaire, Université Louis pasteur, Strasbourg, 1995]. El tiempo de fijación se incrementó, desde 16 h a 4°C hasta 5 dias, aumentando según la edad de los embriones. La deshidratación de los embriones fijados se hizo por incubaciones sucesivas (2 veces cada una durante 30-90 min.) en etanol al 10%,20%,30%,40%,50%,60%,70%,95%, y 100%; seguidas de ¡mmersión en tolueno al 100% (1-3h, 2 veces). Los embriones fijados se incluyeron primero en tolueno: parafina (1:1 ), a 65°C durante 6-15 h, seguido de 5 inclusiones consecutivas en parafina, a 60°C durante 5-15 h. Las prehibridaciones e hibridaciones con las sondas se hicieron a 45°C. La ribosonda específica de Ha ds10 G1, correspondiente al extremo 3'- del ARNm, se preparó como sigue. El plásmido ds10G1S1 (Figura 1) se usó como molde para preparar dos sondas por transcripción in vitro [Almoguera C, Coca MA y Jordano J. Plant Physiol. 107: 765-773, 1995] marcando con DIG-UTP. La sonda ds10-3'(-) se obtiene digiriendo el ADN del plásmido con Pvu II y efectuando la transcripción con ARN polimerasa T3. Esta sonda corresponde a la cadena no-codificante de Ha ds10 G1 entre las posiciones +1202 (Pvu II en el segundo exón) y +1592 (extremo 3'). La segunda sonda [ds10-3' (+), usada como control], se preparó digiriendo el ADN de Ha ds10 G1S1 con Bam Hl (en el polylinker); y efectuando la transcripción con ARN polimerasa T7. La sonda ds10-3'(+) contiene la cadena codificante de Ha ds10 G1, entre las posiciones +870 y +1592. La especifidad de hibridación se determinó mediante experimentos de Southern similares a los descritos por Almoguera y Jordano [Plant Mol. Biol. 19: 781-792, 1992]. Mientras la hibridación con una sonda del ADNc completo detecta bandas correspondientes a unos 4-5 genes distintos en el genomio de girasol [Almoguera C, y Jordano J. Plant Mol. Biol. 19: 781-792, 1992]; usando la sonda ds10-3'(-) podemos detectar un único gen (con una ligera hibridación cruzada con otro; datos no mostrados).
Los resultados obtenidos en los experimentos de localización de ARN se muestran en la Figura 4. La sonda ds10-3'(-) es complementaria y de polaridad opuesta a los ARNm de Ha ds10 G1, lo que permite su detección. Los resultados obtenidos concuerdan con los datos de protección mostrados en la Figura 3, y muestran su acumulación en embriones desde los 12-15 dpa (Figura 4A) hasta los 21-28 dpa (Figuras 4C, F y H). Esta acumulación ocurre a niveles altos, lo que se deduce del corto tiempo preciso para su detección histoquímica (2-4 horas). En embriones inmaduros (Figura 4A) la distribución de los ARNm de Ha ds10 G1 es homogénea y comparable (Figura 4B) a la del ARNr 18S, que se detecta usando otra ribosonda correspondiente al fragmento G (Eco Rl) del gen 18S de rábano [descrito por Delcasso-Tremousaygue D, Grellet F, Panabieres F, Ananiev E D, y Delseny, M. En Eur. J. Biochem. 172: 767-776, 1988]. En embriones mas maduros (21 dpa, Figura 4C) los ARNm de Ha ds10 G1 se localizan también bastante homogéneamente, comenzando a detectarse una acumulación mas intensa en los haces vasculares (procambium), algo que no se observa con la sonda del ARNr 18S ni en éste ni en otros estadios del desarrollo (Figuras 4D, B y G). Finalmente a los 28 dpa, los ARNm de Ha ds10 G1 se localizan preferente en el parénquima en empalizada, un tejido especializado en la deposición de sustancias de reserva, situado en la cara interna de los cotiledones (Figuras 4F y H). Las local izaciones con la sonda ds10-3' (+), de la misma polaridad que los ARNm de Ha ds10 G1, no dieron señales de hibridación; lo que controló los experimentos descritos anteriormente (comparar las Figuras 4C y E). Estos experimentos demostraron que los patrones de expresión de los ARNm de Ha ds10 G1 en girasol son muy especiales. La expresión observada en semillas, con altos niveles de acumulación desde etapas tempranas de la maduración embrionaria (10-12dpa), se combina con distribuciones espaciales que cambian desde la homogeinad hasta la mayor abundancia en tejidos de deposición de sustancias de reserva (parénquima en empalizada). La distribución y patrones de acumulación de los ARNm de Ha ds10 G1 es distinta a la que presentan otros genes vegetales pertenecientes a la misma familia [Wurtele ES, Wang HQ, Durgerian S, Nikolau BJ y Ulrich TH. Plant Physiol. 102: 303-312, 1993; Gaubier, P., Raynal, M., Hull, G., Huestis, GM., Grellet, F., Arenas, C, Pages, M., y Delseny, M., Mol. Gen. Genet., 238: 409-418, 1993]. Estos resultados indican la posible utilidad, para la modificación de semillas por Ingeniería genética, de genes quiméricos que incorporen las secuencias reguladoras de Ha ds10 G1.

EJEMPLO 3: Construcción de genes guiméricos ds10G1 ::GUS v su análisis en plantas transgénicas de tabaco:.
Como ejemplo para los posibles usos del promotor y las secuencias reguladoras del gen Ha ds10 G1,en la construcción de genes quiméricos con expresión específica en semillas de plantas transgénicas, describimos a continuación la construcción y el análisis en plantas transgénicas de tabaco de 4 fusiones traduccionales ds10G1::GUS (Figura 5). Dichas fusiones contienen, para su análisis funcional, el promotor y distintas combinaciones de secuencias flanqueantes e intragénicas del gen Ha ds10 G1. Estas 4 fusiones proporcionan elevados niveles de expresión del gen indicador (GUS) en semillas desde etapas tempranas de la maduración (Figura 6), confirmando nuestras observaciones en el sistema homólogo (Ejemplo 2, Figuras 1 -4).
La primera de estas construcciones, ds10F1 (Figura 5) se obtuvo a partir del plásmido ds10G1S3 (Figura 1 ), que contiene las secuencias genómicas de Ha ds10 G1 entre Sal I (-1576) y Eco Rl (+1086), subclonadas en los sitios de restricción correspondientes del vector pBluescript SK+ (Promega). Mediante tratamiento con Exonucleasa III del ADN de ds10G1 S3 (previamente digerido con Hind III y Pst I), se delecionaron las secuencias de Ha ds10 G1 entre Eco Rl (+1086) y la posición +98 (en el primer exón), dando lugar al plásmido ds10G1S3 E10.5 (Figura 1 ). Dicho plásmido de digirió con Bam Hl (diana de restricción del polylinker situada immediatamente adjacente a la posición +98 de Ha ds10 G1), rellenándose a continuación los extremos del ADN digerido usando el fragmento de Klenow de la ADN polimerasa I. A continuación el ADN se digirió con Sal I, purificándose el fragmento de 1679 p.b. que contiene las seuencias de Ha ds10 G1 entre Sal I (-1576) y el extremo relleno de Bam Hl. Este fragmento se clonó entre los sitios de Sal I y Sma I del vector binario pBI 101.2, resultando en ds10F1 , una fusión traduccional que contiene 1576 nucieótidos de secuencias 5 '-flanqueantes de Ha ds10 G1 (desde el ATG) y los primeros 98 nucleótidos de la zona codificante, en fase con el gen GUS (Figura 5). La fusión ds10F2 se derivó a partir de ds10F1 mediante la inserción de un fragmento de ADN genómico de Ha ds10G1 comprendido entre las posiciones (Figura 1) de +1205 (Pvu II), y Eco Rl (A+4670). Dicho fragmento contiene parte del segundo exón y Á3370 nucleótidos de secuencias 3'-flanquentes (a partir de codón de terminación en la posición +1301); y reemplaza a las secuencias nos-3' en la fusión ds10F1. El inserto Pvu II- Eco Rl se purificó a partir de ADN del plásmido ds10G1S2 (Figura 1). Para la inserción de dicho fragmento, el ADN de ds10F1 se digirió con Sac I y los extremos del ADN se hicieron romos mediante tratamiento con la ADN polimerasa I de T4. A continuación, el ADN así tratado se digirió con Eco Rl, purificándose el fragmento con las secuencias de Ha ds10G1. Este fragmento se ligó al inserto Pvu II- Eco Rl anteriormente descrito (con las secuencias 3'-flanqueantes de Ha ds10 G1), resultando en la fusión ds10F2 (Figura 4). La fusión ds10F2 E (Figura 4) se obtuvo a partir de ds10F2, mediante la delección de las secuencias 3'-flanqueantes de Ha ds10G1 entre Xba I (A+2830) y Eco Rl (A+4670). Para ello, el ADN de ds10F2 se digirió con ambos enzimas; religándose, tras hacer romos los extremos de ADN resultantes con el fragmento de Klenow de la ADN polimerasa I. Finalmente, la cuarta fusión (ds10F3, Figura 5) se obtuvo a partir de un fragmento de ADN genómico de Ha ds10 G1 entre Sal I (-1576) y Pvu II (+1204), purificado a partir del plásmido ds10G1S6 (Figura 1 ) tras la digestión con ambas enzimas de restricción. Este fragmento se ligó con ADN del vector pBI101.3, digerido previamente con Sal I y Sma I. La fusión ds10F3 contiene de esta forma el promotor y las mismas secuencias 5' -flanqueantes de Ha ds10 G1 presentes en la fusión ds10F1 , así como el primer exón (de +1 a +145), el intrón completo (de +146 a +1169) y parte del segundo exón de Ha ds10 G1 (de+1170 a +1204), fusionado en fase con el gen GUS de pBI 101.3. En todos los casos la secuencia de nucleótidos correspondiente a la zona de fusión, entre las secuencias GUS y las de Ha ds10 G1, se comprobó mediante reacciones de secuenciación con el método de Sanger (dideoxi), usando como cebador las secuencias de GUS: S'-ACGCGCTTTCCCACCAACGCTG-S'.
El ADN-T en las fusiones ds10F1 , ds10F2, ds10F2/E, y ds10F3 (Figura 5) fue movilizado desde A. Tumefaciens (LBA 4404), obteniéndose distintas plantas transgénicas de tabaco con integraciones independientes de cada gen quimérico. Estas plantas fueron obtenidas y caracterizadas mediante procedimientos estándard que se describen con detalle por Coca MA, Almoguera C, Thomas TL y Jordano J, [en Plant Molecular Biology , 31 : 863-876, 1996]. En dichas plantas, la expresión del gen GUS se analizó tanto en semillas en desarrollo en condiciones normales de crecimiento (sin estrés exógeno); como en tejidos de germínulas, investigándose en este último caso los cambios de expresión inducidos por tratamientos con ABA y de desecación. Los análisis de semillas se realizaron con las plantas transgénicas originales (T0); mientras que para los de germínulas se utilizaron descendientes de estas plantas (T1), segregantes para los genes quiméricos. Se hicieron tanto estudios cuantitativos, mediante el análisis fluorimétrico de los niveles de expresión GUS y de sus patrones temporales, como estudios cualitativos analizando histoquímicamente los patrones espaciales de expresión (especificidad de tejido). Estos estudios se hicieron como se describe con detalle por Coca MA, Almoguera C, Thomas TL y Jordano J, [en Plant Molecular Biology, 31 : 863-876, 1996]. En total se obtuvieron y analizaron los siguientes números (entre paréntesis) de plantas transgénicas de tabaco, TO "funcionales", con los genes quiméricos ds10F1

(14), ds10F2 (7), ds10F2 E (8) y F3 (23). Estas plantas mostraron elevados niveles expresión del gen GUS en semilla (como consecuencia de la actividad del promotor y secuencias reguladoras del gen Ha ds10 G1), según se ilustra en la Figura 6 (paneles A-C). La integración de los distintos genes quiméricos en el ADN de las plantas transgénicas fue caracterizada mediante Southerns genómicos usando sondas de la región codificante de gen GUS; amplificaciones PCR de las secuencias próximas al empalme ds10::GUS, usando los cebadores S'-ACGCGCTTTCCCACCAACGCTG-S' (GUS) y 5'- GAGTGAACAgAATtcCATCACAACAGGG-3' (dslOEco Rl); o mediante test de segregación de la resistencia a la Kanamicina (conferida por el gen nptll ), relizados según se describe en [Jordano J, Almoguera C, y Thomas TL, The Plant Cell 1 : 855-866, 1989]. Estos análisis determinaron que las plantas TO seleccionadas para los estudios de expresión en semillas contenían de 1 a 5 integraciones independientes del gen quimérico correspondiente. La Figura 6 (adjuntada con esta solicitud) ilustra los resultados mas relevantes, obtenidos en el estudio de la expresión en plantas trangénicas de los genes quiméricos analizados. Estos resultados se describen con detalle a continuación.
La expresión GUS durante la maduración de las semillas en condiciones de crecimiento controladas (sin estrés exógeno), se analizó mediante ensayos fluorimétricos (Figura 6A) e histoquímicos (resumen en Figuras 6B-E). Los ensayos fluorimétricos se realizaron con semillas en estadios definidos de maduración, a los 12, 16, 20, 24 y 28 días post-anthesis (dpa). Por cada planta TO y estadio de maduración se preparan extractos de dos cápsulas florales distintas, y se ensayó la actividad GUS con Methilumbeliferilglucoronido (MUG) por duplicado (en total cuatro determinaciones de actividad por estadio de desarrollo y planta transgénica individual). La significación estadística de las diferencias observadas con las distintas fusiones GUS se determinó, tras la normalización logarítmica de los datos obtenidos, mediante análisis de la varianza [ANOVA, ver: Nap JP, Keizer P, y Jansen R, en Plant Molecular Biology Repórter 11 : 156-164, 1993]. Los ensayos histoquímicos se hicieron con material diseccionado a partir de semillas, en estadios de desarrollo definidos, procedentes de los siguiente números de plantas transgénicas: d10F1 , 5; ds10F2, 6; ds10F2 E, 6; y dsF3, 19. El endopermo y los embriones diseccionados a partir de semillas individuales se tiñeron con X-gluc, durante 150 min a 25°C, analizándose de esta forma aproximadamente 150 semillas de cada planta transgénica.
Todos los genes quiméricos produjeron niveles elevados de expresión GUS en semillas, alcanzándose valores máximos medios de 1.65 x 106 pmol MU/ mg x min (Figura 6A: a los 24 dpa). Los ensayos histoquímicos confirmaron estos altos valores de actividad, ya que tanto los embriones (Figuras 6B y C) como el endospermo (Figura 6C) se tiñeron fuertemente a partir de los 12 dpa (Figura 6B), y con sólo 150 min de reacción. En ambos casos se observaron distribuciones espaciales de la actividad GUS bastante homogéneos (Figura 6B-C). Además, estos patrones de expresión no difirieron cualitativamente entre las plantas transgénicas de los distintos genes quiméricos (datos no mostrados).
Los ensayos fluorimétricos revelaron interesantes diferencias cuantitativas entre las distintas fusiones ds10::GUS. Estas diferencias dependen de las secuencias de Ha ds10 G1 presentes en las fusiones. En algunos casos se ha podido mostrar la significación estadística de estas diferencias (con un nivel de confianza del 95%), lo que demuestra experimentalmente la contribución de las distintas secuencias ensayadas (promotor y secuencias 5'-flanqueantes, secuencias codificantes, 3'-flanqueantes, y del intrón) a los patrones de expresión embrionaria observados. La presencia en las fusiones de sequencias 3'-flanqueantes de Ha ds10 G1 incrementa los niveles de expresión GUS en semillas entre 20 y 28 dpa (comparar las fusiones ds10F2 y ds10F2 E, con ds10F1 en las Figuras 5 y 6A). Esta diferencia es estadísticamente significativa (por ejemplo a 28 dpa: F= 5.397, P=0.0213), y está causada por las secuencias de Ha ds10 G1 presentes en la fusión ds10F2 E (ver Figura 5); ya que no se encontraron diferencias significativas entre la actividad GUS de ds10F2 y ds10F2 E (por ejemplo, también a los 28 dpa, F=0.274, P=0.6015; ver Figura 6A). En el caso de ds10F2 E, el efecto estimulador de las secuencias 3'-flanqueantes también se produce, y es altamente significativo, en etapas mas tempranas de la maduración embrionaria (Figura 6A, 16 dpa; F=16.607, P=0.001 ). En cambio, en estas etapas (entre 12 y 16 dpa) las actividades GUS de ds10F1 y ds10F2 no difieren significativamente entre sí (por ejemplo, a 16 dpa: F=2.762, P= 0.0983; ver Figura 6A). En conjunto estos resultados muestran que ds10F2 E es la fusión construida y ensayada que funciona mejor en semillas de tabaco desde los 16dpa; y que esto se debe al efecto de las sequencias 3'-flanqueantes de Ha ds10 G1 incluidas en ella. Desconocemos si este efecto se produce por mecanismos de activación transcripcional, estabilización de ARNm, o por combinación de ambos tipos de mecanismos. En cualquier caso el efecto es claro, y de posible utilidad para diseñar nuevos genes quiméricos de expresión mas eficiente en semillas, desde etapas relativamente tempranas de la maduración embrionaria (veáse también el apartado de "Otros Ejemplos").
Por otra parte, la comparación entre las actividades GUS de las plantas con las fusiones ds10F1 y ds10F3 nos permitió investigar los posibles efectos de la presencia del intrón (y/o de las secuencias codificantes de Ha ds10 G1 en las que difieren estas fusiones, Figura 5) sobre la expresión de ambas. En semillas de tabaco transgénico estas comparaciones demuestran que la presencia del intrón (mas el primer exón completo y parte del segundo exón) no tiene efectos positivos sobre la expresión GUS, que por lo tanto debe de estar básicamente conferidas por el promotor y secuencias de Ha ds10 G1 presentes en ds10F1 (Figura 6A). Así por ejemplo, las actividades de ds10F1 y ds10F3 no difieren estadísticamente entre 12 y 28 dpa, salvo a los 20 dpa (F= 4.73, P=0.031 ), y entonces la presencia de las secuencias adicionales en ds10F3-redujo significativamente la actividad GUS observada. Por lo tanto, aunque es altamente probable que el intrón se procese correctamente en semillas de sistemas heterólogos como el tabaco (carecemos de una prueba formal de ello), su posible papel regulador en el desarrollo embrionario no está claro. Sin embargo otras observaciones no excluyen que las secuencias adicionales de Ha ds10 G1 en ds10F3 (incluyendo el intrón) puedan tener papeles reguladores en otros tejidos (ver, mas adelante, el efecto de éstas secuencias sobre la expresión residual de las fusiones ds10::GUS en el polen y en germínulas).
La especifidad embrionaria (en semillas) de la expresión GUS conferida por las secuencias Ha ds10 G1 en plantas transgénicas de tabaco se investigó verificándola en otros tejidos; tanto en ausencia de estrés, como tras tratamientos de desecación o con ABA. En el caso de las plantas TO, el único tejido en el que, tanto mediante ensayos fluorimétricos como histoquímicos, se detectó actividad GUS fue en el polen maduro. En otros tejidos las actividades detectadas apenas superaron las del fondo (plantas de tabaco no transformadas). Por ejemplo, en hojas de plantas TO de unos dos meses de edad: 0-50 pmol MU/ mg x min. Las actividades detectadas en polen son marginales (casi tres órdenes de magnitud inferiores) comparadas con las de semillas de las mismas plantas transgénicas. Además dicha expresión pudiera ser artefactual y depender del uso, como indicador, del gen GUS en las fusiones [según Uknes S, Dincher S, Friedrich L, Negrotto D, Williams S, Thompson-Taylor H, Potter S, Ward E, y Ryals J, en the Plant Cell 5: 159-169, 1993]. Sin embargo, de forma sorprendente, observamos que la actividad medida en el polen de 9 plantas ds10F3 fue (136 ±64 pmol MU/ mg x min) significativamente inferior a la de 5 plantas ds10F1 (6427 ±1294 pmol MU/ mg x min; F= 72.573, P= 0.0001 ). Esto último pudiera indicar que, a diferencia de lo que ocurre en semillas durante la mayor parte de la maduración del embrión (Figura 6A), la presencia de las secuencias adicionales de Ha ds10 G1 en ds10F3 (incluyendo el intrón) pudiera reducir la expresión, de genes quiméricos que las contengan, en otros tejidos o momentos del desarrollo.
Adicionalmente, se verificó si la expresión de las fusiones ds10::GUS puede inducirse por hormonas (ABA) o tratamientos de estrés (déficit de agua) en plantas transgénicas (T1) de tabaco en distintos momentos de su ciclo vegetativo. Para ello seleccionamos, tras germinación en medio MS con 300 μg/ml de kanamicina, descendientes de 8 plantas originales distintas conteniendo las fusiones ds10F1 , ds10F2/Ε y ds10F3; y otras 6 con ds10F2. Las germínulas resistentes se transplantaron a medio MS. Se realizaron distintos experimentos con germínulas, tanto a 8 como a 15 días tras la imbibición. Para los tratamientos con ABA, las germínulas se transplantaron a placas de MS suplementadas con 100 μM ABA y se cultivaron en dicho medio durante 4 días a 25 °C y con iluminación. Las germínulas control también se transplantaron a medio MS sin ABA. El estrés hídrico se provocó colocando a las germínulas durante unas 5-6 horas dentro de una cabina de flujo entre dos papeles de filtro. Tras los distintos tratamientos, las germínulas se procesaron bien individualmente (para los ensayos histoquímicos con X-gluc, mediante incubaciones de 14 h a 25 °C); o conjuntamente (pool analysis), para los ensayos fluorimétricos de la actividad GUS, realizados como se ha descrito anteriormente. Los tratamientos de plantas transgénicas adultas, se hicieron usando plantas individuales propagadas como clones vegetativos obtenidos de cada planta original. Para ello, las germínulas seleccionadas de cada planta transgénica se transplantaron a vermiculita embebida con medio Hoagland 0.5X. De cada germínula se obtuvieron tres explantes completos, que tras recuperarse se pusieron en cultivo hidropónico en medio Hoagland líquido (0.5X). Los experimentos se realizaron cuando las plantas se habían recuperado por completo del proceso de propagación, y tenían raíz, tallo y unas 10-12 hojas. Por lo tanto, para los distintos tratamientos se usaron plantas idénticas genéticamente procedentes de cada germínula transgénica seleccionada. Los tratamientos con ABA se hicieron añadiendo la hormona al medio (100 μM), analizándose la actividad GUS en las plantas a las 24h. El estrés hídrico se indujo retirando la raíz del contenedor con el medio, analizándose igualmente las plantas a las 24h tras iniciar el tratamiento. El efecto de los distintos tratamientos se analizó en tres experimentos independientes realizados con los siguientes números de plantas T1 para cada fusión (entre paréntesis el número de plantas T0 de las que proceden en cada caso): ds10F1 , 11 (6); ds10F2, 10 (5); ds10F2 E, 5 (3); y ds10F3, 10 (5).
Los experimentos realizados tanto con germínulas como con plantas adultas confirmaron la especificidad embrionaria de la expresión conferida por las secuencias de Ha dslO G1 a las distintas fusiones; aportando además indicios adicionales sobre el posible papel regulador de las secuencias de Ha ds10 G1 presentes en ds10F3 (incluyendo el intrón) mencionadas anteriormente. Así, tanto en plantas adultas control, como tratadas, se detectaron actividades GUS mínimas (de 3 a 300 pmol MU/ mg x min) en todos los tejidos analizados (raiz, tallo, hojas y meristemo apical). Estos niveles de actividad están ligeramente por encima de los valores de fondo y pueden detectarse sólo fluorimetricamente (datos no mostrados).
En germínulas de 8 dpi la expresión de todas las fusiones es unos dos órdenes de magitud inferior a los valores máximos alcanzados en semillas. Esta expresión decrece rápidamente entre los 8 y 15 dpi (por ej. ds10F1 pasa de 2864 ±182 a 813±104 pmol MU/ mg x min); y se restringe exclusivamente en los tejidos embrionarios (cotiledones), sin detectarse en otros tejidos vegetativos (radícula, hipocótilo, hojas) diferenciados tras la germinación (Figuras 6D y E, y datos no mostrados para las otras fusiones). Estos resultados confirman, en plantas transgénicas de tabaco, la especificidad embrionaria de la regulación por secuencias de Ha ds10 G1. Además de la reducción general de los valores de actividad GUS mencionada anteriormente, se observaron diferencias entre los valores de las distintas fusiones, algunas de ellas estadísticamente significativas. Estas diferencias son similares cualitativamente a las observadas en semilla (Figura 6A). Entre ellas, y por su posible interés aplicado, ilustramos la reducción de la expresión tras la germinación, mediada por las secuencias de Ha ds10 G1 presentes en ds10F3 (incluyendo el intrón). Este efecto se observa, como una reducción significativa de actividad GUS al comparar los patrones de expresión de plantas ds10F1 y ds10F3 (Figuras 6D y E). El análisis estadístico de los datos cuantitativos de ds10F1 y ds10 F3 confirmó la significancia de esta diferencia, tanto a los 8 dpi (F= 4.36, P= 0.04) como a los 15 dpi (F= 4.39, P= 0.039). Adicionalmente, con las germínulas de ds10F1 se observó a los 8dpi una moderada inducción de GUS por los tratamientos con ABA que es estadísticamente significativa (de 2864 ±182 a 5790 ±733 pmol MU/ mg x min; F= 5.413, P= 0.023). En el caso de ds10F3 no hubo inducción significativa por el mismo tratamiento (de 1502 ±195 a 2338 ±211 pmol MU/ mg x min; F= 2.58, P= 0.11 ). Los distintos tratamientos no afectaron substancialmente la especificidad de tejidos, o el orden de magnitud de la expresión observada para las distintas fusiones ds10::GUS (datos no mostrados).

OTROS EJEMPLOS:
Igualmente pueden obtenerse, de forma análoga a la descrita con detalle en el ejemplo anterior, otros genes quiméricos que contengan secuencias 5'-flanqueantes, y(o) 3'-flanqueantes (terminadores), y(o) codificantes, procedentes del Ha ds10 G1, combinadas con secuencias procedentes de otros genes. Estos ejemplos no suponen complicaciones técnicas adicionales a los descritos con mas detalle en los apartados anteriores, por lo que son fácilmente realizables por personas con conocimientos suficientes en el sector de la técnica de la invención. Así por ejemplo, en las fusiones ds10::GUS, las secuencias Ha ds10 G1 pudieran haber incluido otras secuencias 5 '-flanqueantes (Figura 1 ) mas largas del mismo gen para aumentar su nivel de expresión en semillas, como describimos por ejemplo en [Coca MA, Almoguera C, Thomas TL, y Jordano J, en Plant Molecular Biology , 31 : 863-876, 1996]. Igualmente, las secuencias GUS podrían ser substituidas por otras que codifiquen distintas proteínas o péptidos (naturales o artificiales), cuya producción regulada en semillas de plantas pudiera ser de interés industrial. Ejemplos de estas últimas posibilidades, dados de forma no exclusiva, serían la fusión a secuencias de Ha ds10 G1 de secuencias codificantes de genes implicados en la biosíntesis de ácidos grasos en semillas [Voelker TA, Worrell AC, Anderson L, Bleibaum J, Fan C, Hawkins DJ, Radke SE y Davies HM, en Science, 257:72-74, 1992], de proteínas de reserva con composiciones ricas en determinados aminoácidos [Saalbach I, Pickardt T, Machemehl F, Saalbach G, Schieder O, y Muntz K, en Molecular and General Genetics 242: 226-236, 1994], o de péptidos con actividades antigénicas o farmacológicas [Vandekerckhove J, Van Damme J, Van Lijsebettens M, Botterman J, De Block M, Vandewiele M, De Clercq, Leemans J Van Montagu, M y Krebbers E, en BioTechnology 7: 929-932, 1989]. Estas fusiones se realizarían y utilizarían de forma análoga a como se describe en las publicaciones citadas a título de ejemplo (dados de forma no excluyente) en cada caso. Para facilitar estas posibilidades, hemos construido un plásmido (ds10EC1) que contiene una cassette de expresión que incluye el promotor y las secuencias 5'- y 3'- flanqueantes de Ha ds10 G1 presentes en ds10F2 E (ver Figura 5). Entre ambas secuencias y mediante mutagénesis dirigida [Chen E y Przybiia AE, en BioThecniques 17: 657-659, 1994] hemos añadido un sitio de restricción de Eco Rl, que permite la inserción de secuencias de genes, o correspondientes a péptidos, como los mencionados anteriormente (disponibles en otros laboratorios, o que pudieran diseñarse o sintetizarse). El plásmido ds10EC1 se construyó a partir de ds10G1 S3 E10.5 (Figura 1 ). A partir de dicho plásmido, amplificamos por PCR las secuencias de Ha ds10 G1 entre las posiciones -1574 (Sal I) y +98; usando ADN polimerasa Pfu y los cebadores 5'-ATTAACCCTCACTAAAG-3, (T3) y 5'-GAGTGAACAgAATtcCATCACAACAGGG-3' (dslOEco Rl). En este último los tres cambios de secuencia (señalados en minúscula) introducen el nuevo sitio de Eco Rl en la posición del codón de iniciación. Tras la PCR se purifica un fragmento de ADN de 199 pb (megaprimer), que junto con el cebador 5'-AATACGACTCACTATAG-3' (T7) se usa para una segunda amplificacición por PCR de ds10G1S3 E10.5. El ADN amplificado (795 pb) se digirió con Eco Rl y Sph I. El fragmento de ADN resultante (125 pb), con las secuencias de Ha ds10 G1 entre Sph I (-126) y el nuevo sitio de Eco Rl, se purificó y ligó; reemplazando en ds10G1 S3 las secuencias de Ha ds10 G1 (Figura 1 ) entre las posiciones -126 (Sph I) y 1086 (Eco Rl). Tras este paso, la secuencia amplificada por PCR se verificó mediante secuenciación (método de Sanger) usando el cebador T3. Finalmente se insertó en el plásmido obtenido en el paso anterior un fragmento del ADN genómico de Ha ds10 G1 (Figura 1 ), con secuencias entre +1086 (Eco Rl) y A+3000 (Xba I), obteniéndose la cassette ds10EC1 (Figura 4), clonada en el plásmido pBluescript SK+. El extremo 3' del ADN de ds10EC1 difiere del de ds10F2 E únicamente en 119 nucleótidos adicionales, correspondientes a secuencias del intrón y del segundo exón de Ha ds10 G1 . Además, las secuencias de Ha ds10 G1 en ds10EC1 difieren de las correspondientes en ds10F2 E en la ausencia de los nucleótidos 1 -98 del primer exón (Figura 5).

Dado que la presencia de secuencias adicionales de Ha ds10 G1 en ds10F3 (incluyendo el intrón, el primer exón y parte del segundo exón) redujo la expresión de este gen quimérico específicamente en tejidos no embrionarios (Ejemplo 3, Figuras 6D-E), es concebible que dichas secuencias pudieran utilizarse para conferir especifidad de semillas a otros genes quiméricos con distintos promotores. El diseño de dichos genes quiméricos no ofrece difcultades técnicas adicionales a las descritas en apartados anteriores: ver por ejemplo los procedimientos detallados para el uso de intrones de plantas con el fin de impedir la expresión de genes quiméricos en Agrobacterium [Mankin SL, Alien GC y Thompson WF. Plant Molecular Biology Repórter 15: 186-196, 1997]
Los genes quiméricos que contengan secuencias reguladoras de Ha ds10G1 podrían ser transformados a otras plantas distintas de tabaco (el sistema modelo usado en el ejemplo 3). Entre las mismas hay plantas de gran importancia económica como por ejemplo: el girasol, la soja, la colza, la "cañóla", el maíz, el trigo, la cebada, el arroz, la "casava", la judía, el cacahuete, etc; cuya transformación genética es posible y está documentada suficientemente en la literatura científica: veáse por ejemplo Lindsey K, Ed. (1993). [Plant Tissue Culture Manual. Kluwer Academic Publishers]; y la revisión por Christou [Trends in Plant Science. 1 : 423- 431 , 1996]. Los resultados mostrados en el ejemplo 3 demuestran que, en tabaco, los genes construidos con secuencias reguladoras de Ha ds10 G1 tienen una elevada actividad desde etapas relativamente tempranas de la maduración embrionaria, manteniendo además la especificidad de semillas característica de la expresión de Ha ds10 G1 en girasol. Estos resultados podrían obtenerse también con otras plantas, como las mencionadas anteriormente.

DESCRIPCIÓN DE LAS FIGURAS:
Figura 1. Parte superior: mapa de restricción de las secuencias genómicas de Ha ds10 G1 que flanquean a su región codificante. Las líneas continuas sobre el mapa indican los distintos fragmentos de ADN genómico que han sido subclonados en el vector pBluescript SK+ (los nombres de los plásmidos respectivos se indican sobre cada fragmento). Los plásmidos preparados mediante deleciones con Exo III se indican sobre el plásmido de partida (ds10G1S3 ESaci), indicando en cada caso el extremo de la deleción. En la parte inferior de la figura se incluye un mapa de restricción detallado de la región cuya secuencia nucleotídica ha sido determinada. La extensión de las distintas reacciones, usadas para ensamblar las secuencias de ambas cadenas de ADN, se indican mediante flechas horizontales (sobre el mapa para la cadena codificante, y bajo el mapa para la no-codificante). Los sitios de iniciación de la transcripción se indican por flechas. Se incluyen barras de escala para ambos mapas.

Figura 2. Implicación funcional de las secuencias RY1 (-129) en la transactivación del promotor Ha ds10 Gl. Experimentos de expresión transitoria realizados tras el bombardeo de embriones de girasol con micro-proyectiles cubiertos de ADN. Se representan los resultados de 5 experimentos independientes en los que las distintas mezclas de plásmidos (detalladas en el Ejemplo 1 ) se bombardearon por quintuplicado en cada experimento. Se representan las medias de las actividades β-glucoronidasa (GUS) normalizadas con la actividad luciferasa (LUC), así como los errores standard (indicados por barras). Clave: F2, pSKds10F2; F2 ERY1 , pSKds10F2 ERY1 ; ABI3, muestras con el plásmido efector. Se aprecia una disminución significativa de la actividad relativa GUS/LUC, consecuencia de la mutación en la caja RY1. Las actividades básales para pSKds10F2 (sin incluir el plásmido efector) son del orden de 46±8.

Figura 3. Patrones de acumulación de los ARNm del gen Ha ds10 G1 en girasol. La autoradiografía mostrada corresponde a ensayos de protección frente a la RNAsa A, tras hibridar una ribosonda del gen con distintas muestras de ARN total. Se observa la acumulación de mensajeros producidos a partir de los sitios de iniciación de la transcripción de Ha ds10 G1 (como fragmentos protegidos indicados por las flechas numeradas). Estos fragmentos se detectan sólo en embriones (Emb) desde 10 a 20 dpa, y en semillas maduras (25 dpa); pero no en otras muestras analizadas, como germínulas (Germ) o germínulas tratadas con ABA (Germ + ABA). El carril tRNA corresponde a hibridaciones control con ARN t de levadura. Se indican con números y flechas las bandas correspondientes a los mRNAs producidos a partir de los distintos sitios se iniciación. El sitio de iniciación número 3 (indicado entre paréntesis) no ha sido confirmado experimentalmente mediante primer extensión. En el margen izquierdo se incluyen marcadores moleculares de tamaño (pBR322/Hpa III).

Figura 4. Localización de ARNm en secciones de embriones de girasol a los 12 (A y B), 21 (C-E), y 28 dpa (F-H). En cada caso se usaron las siguientes ribosondas : ds10 (-), A, C, F, H; ds10 (+),E, y 18S ARNr, B, D, G. Barras de escala = 500 μm (Savo en F, 125 μm). Parénquima en empalizada= pp. Las flechas señalan el procambium.

Figura 5. Mapas de restricción de las fusiones ds10::GUS y de la cassette de expresión optimizada ds10 EC1 , construidas en los Ejemplos 3 y 4. Mediante distintos sombreados se indican las secuencias de Ha ds10 G1 y de otros genes contenidas en cada caso. Los sitios de iniciación de la transcripción a partir del promotor de Ha ds10 G1 están indicados por flechas.

Figura 6. [Expresión de las fusiones ds10::GUS en semillas de plantas trasgénicas de tabaco. Panel A: Compendio de todos los datos cuantitativos

(determinaciones fluorimétricas). Se muestra el promedio de las actividades

GUS observadas en semillas de las plantas transgénicas (TO) y su evolución en distintos momentos del desarrollo embrionario. Los datos correspondientes a cada fusión se indican mediante los símbolos en el inserto de la parte superior izquierda. La barras indican los errores estándard. Paneles B-E: selección representativa con resultados de los experimentos de localización histoquímica de la actividad GUS: B.- embriones a los 12 dpa (plantas ds10F2 E, TO). C-embriones y endospermo a los 16 dpa (plantas ds10F2 E, TO). D.- germínulas a los 15 dpi en condiciones control (plantas ds10F1 , T1). E.- germínulas a los 15 dpi en condiciones control (plantas ds10F3, T1 ). En los paneles D y E, las flechas señalan los tejidos vegetativos sin actividad GUS (hojas e hipocótilo).