Processing

Please wait...

Settings

Settings

Goto Application

1. MXMX/a/2007/010672 - HUMANIZED L243 ANTIBODIES

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ ES ]
ANTICUERPOS L243 HUMANIZADOS

Referencia Cruzada con Solicitudes Relacionadas
La presente solicitud reclama el beneficio bajo 35 U.S.C. §119(e) de la Solicitud Provisional de Patente Norteamericana Serie No. 60/657,695, presentada el 3 de marzo del 2005. La solicitud antes mencionada está incorporada en su totalidad para todos los propósitos, a la presente invención como referencia.
Campo de la Invención
La presente invención se refiere a anticuerpos humanizados dirigidos a un epítope reconocido por el anticuerpo monoclonal de murino L243. En una modalidad, la presente invención se refiere a composiciones y métodos para preparar y utilizar dichos anticuerpos. En particular, la presente invención proporciona un anticuerpo monoclonal humanizado, hL243, el cual es específico para el antígeno de leucocito humano (HLA) codificado en la región D del grupo de genes HLA del complejo de histocompatibilidad mayor (MHC), conocido de otra forma como el HLA-DR. El anticuerpo inhibe la proliferación de células HLA-DR+ e induce la expresión y liberación de moléculas TNF.
Antecedentes de la Invención
En humanos, el complejo de histocompatibilidad mayor (MHC) es la agrupación de genes de antígeno de leucocito humano (HLA) en el cromosoma 6, el cual se divide en regiones denominadas D, B, C, y A. La región D contiene genes para las proteínas clase II, las cuales están implicadas en la cooperación e interacción entre células del sistema inmune. La región D ha estado implicada en muchas enfermedades incluyendo la mayoría de las enfermedades autoinmunes.
Un anticuerpo, L243 (en lo sucesivo mL243) es un anticuerpo anti-HLA-DR lgG2a de murino. Este anticuerpo puede ser de uso potencial en el tratamiento de enfermedades tales como enfermedades autoinmunes dirigiendo la región D del gen de ratón HLA. mL243 demuestra la supresión potente de infección inmune ín vitro y es monomórfica para todos HLA-DR. Sin embargo, existen problemas con la administración de anticuerpos de ratón a pacientes humanos, tales como la inducción de una respuesta de anticuerpo anti-ratón de humano (HAMA). Existe la necesidad de anticuerpos con especificidad antigénica de mL243, que puedan ser administrados a sujetos humanos.
Breve Descripción de la Invención
Una modalidad de la presente invención proporciona una molécula de anticuerpo humanizado recombinante que tiene especificidad para el epítope reconocido por el anticuerpo monoclonal de murino mL243. Este epítope puede ser un dependiente determinante antigénico en la cadena DR-α. De acuerdo con esta modalidad, el anticuerpo puede ser un anticuerpo injertado con CDR humanizado.
Por ejemplo, en una modalidad, la molécula de anticuerpo humanizado que tiene especificidad para el epítope reconocido por el anticuerpo monoclonal de murino mL243, tiene un sitio de enlace de antígeno en donde al menos una de las regiones de determinación de complementariedad (CDRs) del dominio variable, es derivada del anticuerpo monoclonal de ratón mL243 (MAb L243) y las partes derivadas de inmunoglobulina restantes de la molécula de anticuerpo humanizada, se derivan de una inmunoglobulina humana o un análogo de la misma. En una modalidad particular de la presente invención, los tres CDR de cadena ligera y pesada de un anticuerpo humanizado se derivan de mAb mL243. En otra modalidad de la presente invención, la molécula de anticuerpo humanizada puede ser conjugada a un efector o una molécula reportera.
En un ejemplo, la presente invención proporciona un anticuerpo L243 humanizado que tiene un dominio variable de cadena pesada en donde las regiones CDR1, CDR2, y CDR3, y uno o más residuos de la estructura 27, 38, 46, 68 y 91 del dominio variable, proceden de la cadena pesada del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de la estructura de inmunoglobulina proceden de una o más cadenas pesadas de humano. De acuerdo con este ejemplo, el anticuerpo puede enlazar al menos a un epítope de células HLA-DR en HLA-DR + , e incrementa la exterminación de las células. En una modalidad en particular, la exterminación de las células puede incrementarse cuando no se necesitan ni los sumandos citotóxicos ni los mecanismos efectos inmunológicos para la exterminación.
En otra modalidad de la presente invención, un anticuerpo

L243 humanizado puede incluir un dominio variable de cadena ligera en donde las regiones CDR1, CDR2, y CDR3, y uno o más de los residuos de la estructura 37, 39, 48 y 49 del dominio variable proceden de la cadena ligera de anticuerpo monoclonal de ratón mL243 y el resto de los dominios de la estructura de inmunoglobulina proceden de una o más cadenas ligeras humanas. De acuerdo con esta modalidad, el anticuerpo puede enlazar al menos a un epítope de las células HLA-DR en HLA-DR*, e incrementa la exterminación de las células. En una modalidad particular, la exterminación celular puede incrementarse cuando no se necesitan para la exterminación ni adendos citotóxicos ni mecanismos efectos inmunológicos.
En otra modalidad de la presente invención, un anticuerpo L243 humanizado puede incluir un dominio variable de cadena pesada y un dominio variable de cadena ligera, en donde las regiones CDR, CDR2, y CDR3, y uno o más de los residuos de las estructuras 27, 38, 46, 68 y 91 del dominio variable de cadena pesada, proceden de la cadena pesada del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de estructura de la cadena pesada de inmunoglobulina proceden de una o más cadenas pesadas humanas. De acuerdo con esta modalidad, el anticuerpo L243 humanizado puede incluir un dominio variable de cadena pesada y un dominio variable de cadena ligera en donde las regiones CDR, CDR2, y CDR3, y uno o más de los residuos de estructura 37, 39, 48 y 49 del dominio variable de cadena ligera proceden de la cadena ligera del anticuerpo monoclonal de ratón 243 y el resto de los dominios de estructura de cadena ligera de inmunoglobulina proceden de una o más cadenas ligeras humanas. Además, el anticuerpo puede enlazar al menos a un epítopo de las células HLA-DR en HLA-DR+, e incrementa la exterminación de las células. En una modalidad particular, la exterminación de las células puede incrementarse cuando no se necesita para la exterminación ni los adendos citotóxicos ni mecanismos efectores inmunológicos. En una modalidad de la presente invención, cualesquiera de los anticuerpos descritos supra pueden utilizarse en una composición farmacéutica. De acuerdo con esta modalidad, una composición farmacéutica que incluye uno o más anticuerpos aquí descritos puede contener agentes terapéuticos adicionales tal como se describirá más adelante.
Además, una modalidad de la presente invención proporciona moléculas de ácido nucleico que codifican una o más de las composiciones, conjugados, proteínas de fusión descritas tal como se describe infra.
Los vectores de expresión en células huésped que contienen estos ácidos nucleicos también están incluidos.
De acuerdo con estas modalidades, los métodos para elaborar los anticuerpos, tales como el uso de células huésped cultivadas en un número de crecimiento adecuado para la generación de anticuerpos, también pueden estar incluidos.
En una modalidad de la presente invención, se pueden utilizar uno o más de los anticuerpos descritos de la presente invención en una composición farmacéutica para propósitos terapéuticos y/o de diagnóstico.
Por ejemplo, se puede administrar uno o más anticuerpos en una composición terapéutica o farmacéutica a un sujeto que necesita de dicho tratamiento (por ejemplo un sujeto que tiene una enfermedad inmune, tal como enfermedad autoinmune).
En una modalidad más particular de la presente invención, el anticuerpo L243 humanizado tiene un dominio variable de cadena pesada que tiene la secuencia que se muestra en la figura 4 y/o un dominio variable de cadena ligera que tiene la secuencia que se muestra en la figura 3.
En otra modalidad, la composición farmacéutica puede contener además una o más moléculas de enlace adicionales, las cuales enlazan específicamente a uno o más antígenos seleccionados del grupo que consiste en CD4, CDS, CDS, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD66 (a.b.c.d,), CD74, CD80, CD126, CD138, CD154, B7, MUCI, MUC2, MUC3, MUC4, MUC16, 1a, HML24, tenascin, VEGF, EGFR, CEA, CSAp, ILGF, factor de crecimiento de placenta, Her2/neu, anhidrasa carbónica IX, IL-6, S100, MART-1, TRP-1, TRP-2, gplOO, amiloide y combinaciones de los mismos, en donde la molécula de enlace adicional se proporciona antes, con o después de cualquier composición farmacéutica aquí descrita que contiene una composición de anticuerpo L243 humanizado y/o un vehículo para administrar el anticuerpo.
En una modalidad, una composición farmacéutica para la administración a un sujeto que necesita de dicho tratamiento, puede contener un anticuerpo L243 humanizado y uno o más péptidos, lípidos, vehículos poliméricos, micelas, nanopartículas o combinaciones de los mismos; y uno o más efectores.
Uno o más de los métodos descritos de la presente invención, se puede utilizar para tratar una enfermedad que incluye pero no se limita a linfomas de no Hodgkin de células B, leucemias linfoides agudas y crónicas de célula B, linfoma de Burkitt, linfoma de Hodgkin, leucemia de célula peluda, leucemias mieloides agudas y crónicas, linfomas y leucemias de célula T, mieloma múltiple, macroglobulinemia de Waldenstrom, carcinomas, melanomas, sarcomas, gliomas, y cánceres de la piel. Los carcinomas pueden ser seleccionados del grupo que consiste en carcinomas de la cavidad oral, tracto gastrointestinal, tracto pulmonar, seno, ovario, próstata, útero, vejiga urinaria, páncreas, hígado, bilis de vejiga, piel y testículos. Además uno o más de los métodos descritos pueden ser utilizados para tratar una enfermedad autoinmune, tal como púrpura trombocitopénica idiopática aguda, púrpura trombocitopénica idiopática crónica, dermatomiositis, corea de Sydenham, miastenia gravis, lupus eritematoso sistémico, nefritis de lupus, fiebre reumática, síndromes poliglandulares, penfigoíde buloso, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis post-estreptococal, eritema nodoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, esclerosis múltiple, sarcoidosis, colitis ulcerativa, eritema multiforme, nefropatía de IgA, poliarteritis nodosa, espondilitis anquilosante, síndrome de Goodpasture, tromboangitis obliterans, síndrome de Sjogren, cirrosis biliar primaria, tiroiditis de Hashimoto, tirotoxicosis, escleroderma, hepatitis activa crónica, polimiositis/dermatomiositis, policondritis, penfigo vulgaris, granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsalis, arteritis/polimialgia de célula gigante, anemia perniciosa, glomerulonefritis de progreso rápido, psoriasis, o alveolitis fibrosante.
En una modalidad, una composición farmacéutica de la presente invención puede utilizarse para tratar a un sujeto que tiene leucemia, tal como leucemia linfocítica crónica, leucemia linfocítica aguda, leucemia mieloide crónica, o leucemia mieloide aguda.
En una modalidad, se puede utilizar una composición farmacéutica de la presente invención para tratar a un sujeto que tiene enfermedad metabólica, tal como amiloidosis, o una enfermedad neurodegenerativa, tal como enfermedad de Alzheimer. Además, se puede utilizar una composición farmacéutica de la presente invención para tratar a un sujeto que tiene un trastorno desregulador-inmune.
Otros objetos, características y ventajas de la presente invención podrán ser apreciados a partir de la siguiente descripción detallada. Sin embargo, deberá quedar entendido que la descripción detallada y los ejemplos específicos, aunque indican modalidades preferidas de la invención, se proporcionan únicamente a manera de ilustración, ya que los expertos en la técnica podrán apreciar diversos cambios y modificaciones dentro del espíritu y alcance de la presente invención, a partir de la descripción detallada.
Breve Descripción de los Dibujos
Los dibujos que se encuentran a continuación forman parte de la presente especificación y están incluidos para demostrar en forma adicional ciertas modalidades de la presente invención. Las modalidades pueden ser mejor comprendidas haciendo referencia a uno o más de los dibujos en combinación con la descripción detallada de las modalidades específicas aquí presentadas.

La figura 1 (también SEQ ID NO:1 y SEQ ID NO:2) ilustra una secuencia de codificación de ADN y de aminoácido de ejemplo de VK del anticuerpo anti-HLA-DR de ratón L243. Las regiones CDR putativas están subrayadas e indicadas. Se enumeran los residuos de nucleótidos en secuencias. Se utiliza numeración de molécula Ig de Kabat para los residuos de aminoácido. La numeración de los residuos con una letra (en la parte superior) es el número de residuos precedentes más la letra, por ejemplo, el número para T después de N52 es 52A; los números para N, N, y L después de 82, son 82A, 82B, y 82C, respectivamente.
La figura 2 (también SEQ ID NO:3 y SEQ ID NO:4) ilustra una codificación de ADN de ejemplo y secuencias de aminoácido de VH del anticuerpo anti-HLA-DR de ratón L243. Las regiones CDR putativas están subrayadas e indicadas. Se enumeran los residuos de nucleótidos en secuencias. Se utiliza numeración de molécula Ig de Kabat para los residuos de aminoácidos tal como se describió anteriormente.
La figura 3 (también SEQ ID NO:5 y SEQ ID NO:6) ¡lustra un ADN de ejemplo y secuencias de aminoácido de VR de L243 humanizado. Las secciones en negritas y subrayadas de las secuencias de aminoácidos indican los CDRs, tal como se define a través del esquema de numeración de Kabat.
La figura 4 (también SEQ ID NO:7 y SEQ ID NO:8) ilustra un ADN de ejemplo y las secuencias de aminoácidos para VH de L243 humanizado. Las secciones en letras negritas y subrayadas de las secuencias de aminoácidos indican los CDRs, tal como se define a través del esquema de numeración de Kabat.
La figura 5 (también SEQ ID NO:9, SEQ ID NO:10, SEQ ID

NO:11, y SEQ ID NO:12) ilustra una alineación de secuencia de aminoácido de ejemplo de RF-TS3 y NEWM humano (estructura 4), L243 de murino, y cadena VH hL243. Los puntos indican los residuos en L243 y su versión humanizada son idénticas a los residuos correspondientes en RF-TS3 ó NEWM. Las manchas representan brechas introducidas para ayudar a la alineación. Los cuadros representan las regiones CDR. Los residuos tanto N-terminal como C-terminal (subrayados) de hL243 están fijos mediante el vector de presentación utilizado. Por consiguiente, los residuos de terminal correspondiente de L243 no se comparan con los de la secuencia VH humana.
La figura 6 (también SEQ ID NO:13, SEQ ID NO:14, y SEQ ID NO:15) ilustra una alineación de secuencia de aminoácido de ejemplo de REÍ humano, L243 de murino, y cadenas hL243 VK. Los puntos indican los residuos en L243 que son idénticos a los residuos correspondientes en REÍ. Las manchas representan brechas introducidas para ayudar a la alineación. Los cuadros representan las regiones CDR. Los residuos tanto N-terminal como C-terminal (subrayados) de hL243 se fijan a través del vector de etapas utilizado. Por consiguiente, los residuos de terminal correspondiente de L243 no se comparan con los de la secuencia humana. Se utiliza el esquema de numeración de Kabat.
La figura 7, ilustra una especificidad de enlace de antígeno de ejemplo de hL243. Las células Raji, incubadas previamente con o sin una concentración saturada de mL234 (para bloquear los sitios del antígeno de superficie celular ("Ag")) se suspendieron en PBS que contiene BSA al 1% y 10 μg/ml de hL243 purificado y se incubaron durante 1 hora a una temperatura de 4°C. Después del lavado, las células fueron suspendidas nuevamente en PBS que contiene BSA al 1% y IgG anti-humano de cabra etiquetado con PE, anticuerpo específico de fragmento Fc. Después de la incubación adicional a una temperatura de 4°C durante 30 minutos, las células se contaron en un Guava PCA. (A) Muestra el enlace específico de hL243 a células de linfoma humano Raji (trazo rojo), el cual se bloqueó mediante la incubación previa de las células con mL243 (trazo azul). (B) Es un control de enlace negativo, llevado a cabo con anticuerpo anti-CEA (hMN-14) en lugar de hL243 bajo condiciones idénticas.
La figura 8, ilustra afinidades de enlace-Ag de ejemplo que compara hL243 y mL243 en un ensayo de enlace de superficie celular competitivo. Se mezcló una cantidad constante (100,000 cpm, -10 μCi/μg) de mL234 etiquetado con 125l (A) ó hL243γ4P (B), con concentraciones diversas (0.2-700 nM) de hL243γ4P etiquetado (A) ó mL2343 (*). Las muestras se agregaron a células Raji y se incubaron a temperatura ambiente durante 2 horas. Las células se lavaron para eliminar los anticuerpos no enlazados y se contó la radioactividad asociada con las células. hL243γ4P y mL234 se mostraron por competir entre sí para el enlace a la superficie celular Ag. En ambos casos, hL243γ4P pareció enlazar a células Raji más fuerte que mL243.
La figura 9, ilustra afinidades de enlace-Ag de ejemplo de hL243γ4P y mL243 determinados mediante el enlace de saturación de superficie celular directa y análisis de trazo Scachard. Se incubaron concentraciones diversas de mL234 (») etiquetado 125l ó hL243γ4P (A) se incubaron con 2x105 de células de linfoma humano Daudi a una temperatura de 4°C durante 2 horas, y se eliminó la radioactividad no enlazada de las suspensiones celulares mediante lavado. Se contó la radioactividad asociada con la célula, se calculó el enlace específico del anticuerpo radioetiquetado al antígeno de superficie celular, y posteriormente se aplicó un análisis de trazo Scatchard para determinar el número máximo de sitios de enlace por célula y la constante de actividad de enlace de antígeno aparente: el enlace máximo de mL234 ó hL243γ4P a la superficie celular de Daudi fue de 6x106 moléculas/célula. Las constantes de disociación determinadas para mL234 ó hL243γ4P fueron de 14 y 2.6 nM, respectivamente.

La figura 10, ilustra que un h243 de ejemplo es efectivo para exterminar células objetivo en la presencia de complemento de suero humano: se incubaron células Daudi con hL243, hL243γ4P, hA20 (un control positivo) y hMN-14 (un control negativo) en la presencia de complemento de suero humano. hL243γ4P mostró no producir alguna citotoxicidad inducida por complemento.
La figura 11, ilustra una liberación LDH de ejemplo (A) y el porcentaje de lisis celular (B) mediante ADCC tal como se observa para hL243, hL243γ4P, hA20 (control positivo) y 1 hMN-14 (control negativo).
Las figuras 12A-B ilustran un ensayo proliferativo in vitro de ejemplo en líneas de células Daudi y Raji al final de dos días.
Las figuras 13A-B, ilustran un ensayo proliferativo in vitro de ejemplo en líneas de células Daudi y Raji al final de tres días.
La figura 14, ilustra tiempos de supervivencia promedio de ejemplo para ratones SCID que contienen tumor, inyectados con hL243μ4P.
La figura 15, ilustra una inducción comparativa de ejemplo de apoptosis en células de linfoma de perro (medido como porcentaje de células con un contenido de ADN de subíase

GO/GI) originado por L243, hL243 (isotipo lgG4), hMN-14 (IgG MN-14 humanizado) y Ag8 (mAb derivado de mieloma de murino). L243 y hL243 originaron apoptosis cuando se reticularon con anticuerpos anti-ratón de cabra (GAM) y antihumano de cabra (GAH), respectivamente.
Las figuras 16A-B, ilustran efectos antiproliferativos de ejemplo de anticuerpos humanizados (hLL1, hLL2, Rituximab, hA20, hMN-14 y hL243 (isotipo lgG4) con y sin IgG anti-humano de cabra (GAH) en línea de célula de linfoma de célula-B humana de Namalwa tal como se determina a través de un ensayo de captación de 3H-timidina.
La figura 17, ilustra características de enlace de hL243γ4P con relación al murino de origen L243.
Las figuras 18A y 18B ilustran ensayos CDC en líneas de células Raji, Ramos, y Namalwa cuando se exponen a diversos anticuerpos aquí descritos.
La figura 19, ¡lustra ensayos ADCC y liberación AM de calceína cuando se exponen células SU_DHL-6 a diversos anticuerpos aquí descritos.
La figura 20A y 20B ilustra efectos antiproliferativos de hL243γ4P en diversas líneas celulares aquí descritas. A. estudios MTT y B. ensayos de captación de 3H-timidina. En una etiqueta del eje de B, hL243 se refiere a la forma γ4P.
Las figuras 21A y 21B ilustran la inducción de apoptosis de células muertas que son representadas por células claras y apoptóticas que se ilustran en sólido. A. medida de Sub GO DNA en SU-DHL-6 y células Namalwa, y B. anexina V/7-ADD en 4 y 24 horas. Las células utilizaron tuvieron 97% de viabilidad antes del tratamiento.
La figura 22, ilustra el potencial de membrana mitocondrial que utiliza un ensayo JC-1 en varias líneas celulares.
Las figuras 23A y 23B ilustran estudios de curso de tiempo de caspasa-3 (A) y P-AKT (B) disociados en células Daudi.
La figura 24, ilustra la terapia de ratones SCID, que contienen Raji con L243 y L243γ4P de murino.
Descripción Detallada de la Invención
En la siguiente sección, se describen varios métodos que detallan diversas modalidades de la presente invención. Será obvio para los expertos en la técnica que la práctica de diversas modalidades no requiere el empleo de todos o algunos de los detalles específicos aquí señalados, sino más bien, que las concentraciones, tiempos y otros detalles específicos pueden ser modificados con la experimentación de rutina. En algunos casos, no se han incluido métodos o componentes bien conocidos en la descripción, con el objeto de evitar el enmascaramiento innecesario de las diversas modalidades.
En una modalidad de la presente invención, se proporcionan anticuerpos de ratón humanizados que enlazan a HLA-DR. En una modalidad en particular, los anticuerpos mL243 humanizados pueden ser proporcionados para que enlacen a HLA-DR, pero que tengan inmunogenicidad reducida en comparación con los anticuerpos de murino correspondientes.

De acuerdo con esta modalidad, los anticuerpos pueden inhibir la proliferación de células (o inducir la exterminación celular) expresando moléculas HLA-DR, tal como células de linfoma. Como alternativa, los anticuerpos aquí descritos pueden ser utilizados para enlazar una molécula objetivo o incrementar la probabilidad de exterminio celular. Se proporcionan composiciones farmacéuticas que contienen los anticuerpos y métodos para tratar enfermedades asociadas con proliferación de HLA-DR + .
mL243 es un anticuerpo monoclonal descrito previamente por Lampson & Levy (J. Immunol. (1980) 125 293). Las secuencias de aminoácidos de las regiones variables de cadena ligera y pesada del anticuerpo, se muestran en las figuras 1 y 2 (también SEQ ID NO:1 y SEQ ID NO:2, respectivamente). mL243 ha sido depositado en el American Type Culture Collection, Rockville, MD, bajo el número de acceso ATCC HB55.
En la descripción que se muestra a continuación, se puede utilizar un número de términos y se proporcionan las siguientes definiciones para facilitar la comprensión de la presente invención.
Al menos que se especifique lo contrario, el término "un" o "uno", significa "uno o más".
Tal como se utiliza en la presente especificación, el término "sujeto" o "sujetos" pueden incluir aunque no se limita a mamíferos tales como humanos o mamíferos por ejemplo perros, gatos, hurones, conejos, cerdos, caballos, o ganado.
La frase "citotoxicidad transmitida por célula dependiente de anticuerpo" o "ADCC" es una reacción transmitida por células en la cual las células citotóxicas no específicas que expresan receptores Fc (células exterminadoras naturales, neutrófilos y macrófagos) reconocen anticuerpos enlazados en células objetivo y subsecuentemente originan la lisis de las células objetivo. Las células primarias para transmitir ADCC son las células exterminadoras naturales (que expresan únicamente FcDRIII) y monocitos (que expresan FcDRI, FcDRIl, y FcDRIII).

La frase "citotoxicidad dependiente de complemento" o

"CDC" se refiere al lisado de un objetivo en la presencia del complemento. La trayectoria de la activación del complemento se inicia enlazando el primer componente del sistema de complemento (Clq) a una molécula (por ejemplo, un anticuerpo) elaborado en compuesto con un antígeno cognato.
El "receptor Fc" o "FcR" se utiliza para describir un receptor que enlaza a la región Fc de un anticuerpo. Tanto CDC como ADCC requieren que la parte Fc de MAb y el efecto de ADCC puedan aumentarse incrementando la afinidad de enlace para FcyR (receptores IgG Fc) en células efectoras (Shinkawa y Asociados, J. Biol. Chem. 278:3466-3473, 2003; Shields y Asociados, J. Biol. Chem. 211:26733-26740, 2002; Shields y Asociados, J. Biol. Chem. 276:6591-6604, 2002; Davies y Asociados, Biotechnol. Bioeng. 74:288-294, 2001; y Umana y Asociados, Nature Biotechnol. 176-180, 1999). Una "célula efectora" se refiere a cualquier tipo de célula que tenga la capacidad de llevar a cabo la función(s) de célula efectora. Es bien sabido que las células efectoras que tienen diferentes funciones inmunes especializadas pueden ser distinguidas de otras sobre las bases de su expresión diferencial de una amplia variedad de antígenos de superficie celular, tal como muchos de los antígenos descritos a los cuales los polipéptidos de dominio de enlace pueden enlazar específicamente. Las células efectoras incluyen pero no se limitan a cualquier célula que tenga la capacidad de transmitir directamente una actividad la cual es un componente de la función del sistema inmuno, incluyendo células que tengan dicha capacidad en forma natural o como resultado de una construcción genética. Una célula efectora comprende un receptor de superficie celular de una inmunoglobulina, tal como un receptor para la región constante de inmunoglobulina, e incluye la clase de receptores comúnmente referidos, "receptores Fc" (FcR). Las células que tienen la capacidad de transmitir ADCC son ejemplos de células efectoras. Otros ejemplos incluyen células de exterminio natural (NK), linfocitos T de infiltración-tumor (TIL), linfocitos T citotóxicos (CTL), y células granulocíticas tales como células que comprenden mecanismos de respuesta alérgica. Las células efectoras también pueden afectar células de orígenes hematopoiéticos incluyendo células en diversas etapas de diferenciación dentro de los linajes mieloides y linfoides, y que pueden (aunque no es necesario) expresar uno o más tipos de superficie de células funcionales FcR, tales como linfocitos T, linfocitos B, células NK, monocitos, macrófagos, células dendríticas, neutrófilos, basófilos, eosinófilos, células mástil, plaquetas, eritrocitos, y precursores progenitores (por ejemplo, células madre hematopoiéticas), formas inactivas, activadas y maduras de dichas células. Otras células efectoras pueden incluir células de origen no hematopoiético que tienen la capacidad de transmitir funciones inmune, por ejemplo, células endoteliales, queratinocitos, fibroblastos, osteoclastos, células epiteliales y otras células. Las células efectoras inmunes también pueden incluir células que transmiten eventos citotóxicos o citoestáticos o eventos endocíticos, fagocíticos, o pinocitóticos o que efectúan la inducción de apoptosis, o efectúan la inmunidad microbiana o neutralización de infección microbiana, o células que transmiten reacciones alérgicas, inflamatorias, de hipersensibilidad, y/o autoinmunes.
Un anticuerpo que "inhibe el crecimiento" es uno que inhibe el crecimiento de células enfermas ¡n vitro y/o in vivo. Al inhibir el crecimiento de células enfermas, el porcentaje de células en la fase S se reduce. El porcentaje preferido de inhibición de crecimiento a través de un anticuerpo de la presente invención, puede ser mayor al 20%, preferentemente mayor al 50% en una concentración de anticuerpo de aproximadamente 0.5 μg/ml - 20 μg/ml in vitro, y en una dosis en pacientes adultos de aproximadamente 0.5 mg/kg - 15 mg/kg. Un "anticuerpo" tal como se utiliza en la presente invención se refiere a una molécula de ¡nmunoglobulina de longitud total (es decir, que ocurre naturalmente o que se forma a través de procesos de recombinación de fragmento de gen de inmunoglobulina normal) (por ejemplo, anticuerpo IgG), o una porción inmunológicamente activa (es decir, que enlaza en forma específica) o una molécula de inmunoglobulina, tipo un fragmento de anticuerpo. El término "anticuerpo" también incluye anticuerpos "humanizados" e incluso anticuerpos completamente humanos que pueden ser producidos mediante despliegue de fagos, métodos de transfección genética y de cromosomas, así como a través de otros medios. Este término también incluye anticuerpos monoclonales, anticuerpos policlonales, anticuerpos multivalentes, anticuerpos multiespecíficos (por ejemplo, anticuerpos biespecíficos).
Una "respuesta inmunogénica" o "respuesta antigénica" es una que da como resultado la producción de anticuerpos dirigidos a un compuesto después de que las células adecuadas han sido contactadas entre ellas. El compuesto que se utiliza para provocar una respuesta inmunogénica es referido como un inmunógeno o antígeno. Los anticuerpos producidos en la respuesta inmunogénica se enlazan en forma específica al inmunógeno se utilizan para provocar la respuesta.

El compuesto que se utiliza para provocar una respuesta inmunogénica es referido como un antígeno o inmunógeno. Un "epítope" o "determinante antigénica" es un área en la superficie de un inmunógeno que estimula una respuesta inmune específica dirigida al epítope. En proteínas, particularmente proteínas desnaturalizadas, un epítope se define normalmente y se representa a través de una secuencia de aminoácido contigua. Sin embargo, en el caso de proteínas no denominadas, los epítopes también incluyen estructuras, tales como sitios activos, que se forman a través del doblez tridimensional de una proteína de una forma tal que los aminoácidos de las partes separadas de la secuencia de aminoácidos de la proteína, se llevan en un contacto físico cercano entre sí.
Las moléculas de anticuerpo que ocurren naturalmente

(tipo natural) son moléculas en forma de Y que consisten en cuatro cadenas de polipéptido, dos cadenas pesadas idénticas y dos cadenas ligeras idénticas, las cuales se enlazan en forma covalente juntas mediante enlaces de disulfuro. Ambos tipos de cadena de polipéptido tienen regiones constantes, las cuales no varían o varían mínimamente entre los anticuerpos de una misma clase (por ejemplo, IgA, IgM, etc.), y regiones variables. Las regiones variables son únicas para un anticuerpo particular y comprenden un elemento de reconocimiento para un epítope. Las regiones carboxi-terminal de cadenas tanto pesadas como ligeras, se conservan en la secuencia y son denominadas las regiones constantes (también conocidas como C-dominios). Las regiones amino-terminal (también conocidos como V-dominios) son variables en secuencia y son responsables de la especificidad del anticuerpo. El anticuerpo reconoce en forma específica y enlaza a un antígeno principalmente a través de seis regiones cortas que determinan la complementariedad (CDRs) localizadas en los V-dominios.
Cada cadena ligera de un anticuerpo está asociada con una cadena pesada, y las dos cadenas están enlazadas a través de un puente de disulfuro formado entre residuos de cisteína en la región carboxi-terminal de cada cadena, la cual está distante de la región amino-terminal de cada cadena que constituye su parte del dominio de enlace de antígenos. Las moléculas de anticuerpos se estabilizan en forma adicional mediante puentes de disulfuro entre las dos cadenas pesadas en un área conocida como la región de articulación, en lugares más cercanos al término carboxi de las cadenas pesadas que en los lugares en donde los puentes de disulfuro en donde se elaboran los puentes de disulfuro entre las cadenas pesadas y ligeras. La región de articulación también proporciona flexibilidad para las partes de enlace de antígenos de un anticuerpo.
La especificidad de enlace de antígeno de un anticuerpo puede ser determinada a través de sus regiones variables localizadas en las regiones amino-terminal de las cadenas pesadas y ligeras. Las regiones variables de una cadena ligera y cadena pesada asociada forman un "dominio de enlace de antígeno" que reconoce un epítope específico; un anticuerpo que tiene por lo tanto dos dominios de enlace de antígenos. Los dominios de enlace de antígenos en un anticuerpo tipo natural se dirigen al mismo epítope de una proteína inmunogénica, y por lo tanto un anticuerpo tipo natural simple tiene la capacidad de enlazar a dos moléculas de la proteína inmunogénica al mismo tiempo. Por lo tanto, un anticuerpo tipo natural es monoespecífico (es decir, se dirige a un antígeno único) y bivalente (es decir, con la capacidad de enlazar dos moléculas de antígeno).
Los "anticuerpos policlonales" se generan en una respuesta inmunogénica a una proteína que tiene muchos epítopes. Una composición (por ejemplo, suero) de anticuerpos policlonales incluye por lo tanto una variedad de diferentes anticuerpos dirigidos al mismo y a diferentes epítopes dentro de la proteína. Los métodos para producir anticuerpos policlonales son conocidos en la técnica (ver por ejemplo la publicación de Cooper y Asociados, Sección lll del Capítulo 11 en: Short Protocols in Molecular Biology, 2a Edición, Ausubel y Asociados, editores, John Wiley and Sons, Nueva York, 1992, páginas 11-37 a 11-41).
Los "anticuerpos de antipéptido" (también conocidos como "anticuerpos monoespecíficos" se generan en una respuesta tumoral a un polipéptido inmunogénico corto (normalmente 5 a 20 aminoácidos) que corresponden a unos cuantos epítopes aislados (preferentemente uno) de la proteína de la cual se deriva. Una pluralidad de anticuerpos de antipéptido incluye una variedad de diferentes anticuerpos dirigidos a una parte específica de la proteína, es decir, a una secuencia de aminoácidos que contiene al menos uno, preferentemente únicamente un, epítope. Los métodos para producir los anticuerpos de antipéptido son conocidos en la técnica (ver, por ejemplo, publicación de Cooper y Asociados, Sección lll del Capítulo 11 en: Short Protocols in Molecular Biology, 2a Edición, Ausubel y Asociados, editores, John Wiley and Sons, Nueva York, 1992, páginas 11-42 a 11-46).
Un "anticuerpo monoclonal" es un anticuerpo específico que reconoce un solo epítope específico de una proteína inmunogénica. En una pluralidad de un anticuerpo monoclonal, cada molécula de anticuerpo es idéntica a las otras en la pluralidad. Con el objeto de aislar un anticuerpo monoclonal, una línea de célula clonal que expresa, despliega y/o segrega un anticuerpo monoclonal particular es identificada primero; esta línea de célula clonal puede ser utilizada en un método para producir los anticuerpos de la presente invención. Los métodos para la preparación de líneas de célula clonal y de anticuerpos monoclonales expresados de esta forma son conocidos en la técnica (ver por ejemplo, la publicación de Fuller y Asociados, Sección II del Capítulo 11 en: Short Protocols in Molecular Biology, 2a Edición, Ausubel y Asociados, editores, John Wiley and Sons, Nueva York, 1992, páginas 11-22 a 11-11-36).
Un "anticuerpo descubierto" es una molécula de anticuerpo intacta que no contiene modificaciones adicionales tales como conjugación con una toxina, o con un quelado para enlazar a un radionúclido. La porción Fc del anticuerpo descubierto puede proporcionar funciones efectoras, tales como fijación de complemento y ADCC (citotoxicidad de célula dependiente de anticuerpo) la cual ajusta mecanismos en acción que pueden dar como resultado la lisis celular. Ver por ejemplo la publicación de Markrides, Therapeutic inhibition of the complement system, Pharmacol. Rev. 50:59-87, 1998. En una modalidad, la acción terapéutica del anticuerpo puede requerir las funciones efectoras de la región Fc (ver la publicación de Golay y Asociados, Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regúlate complement-mediated cell lysis, Blood 95: 3900-3908, 2000).
En otra modalidad, la porción Fc puede no ser necesaria o en algunos casos deseada para el tratamiento terapéutico de un sujeto. De acuerdo con esta modalidad, se pueden invocar otros mecanismos, tales como apoptosis. Vaswani and Hamilton, Humanized antibodies as potential therapeutic drugs. Ann.

Allergy Asthma Immunol. 81:105-119, 1998.
Un "fragmento de anticuerpo" es una parte de un anticuerpo intacto tal como F(ab')a, F(ab)2, Fab', Fab, Fv, sFv, y similares. Sin importar la estructura, un fragmento de anticuerpo enlaza con el mismo antígeno que es reconocido por un anticuerpo de longitud total. Por ejemplo, un fragmento de anticuerpo monoclonal anti-CD20 enlaza con un epítope de CD20. El término "fragmento de anticuerpo" también incluye cualquier proteína construida en forma sintética o genética que actúa en forma similar a un anticuerpo enlazando a un antígeno específico para formar un complejo. Por ejemplo, los fragmentos de anticuerpo incluyen fragmentos aislados que consisten en regiones variables, tales como los fragmentos "Fv" que consisten en las regiones variables de las cadenas pesadas y ligeras, moléculas de polipéptido de cadena simple recombinantes en las cuales las regiones variables ligeras y pesadas están conectadas a través de un enlazador de péptido ("proteínas scFv") y unidades de reconocimiento mínimas que consisten en residuos de aminoácido que mímetizan la región hipervariable.
Los fragmentos de anticuerpo producidos por proteólisis limitada de anticuerpos tipo natural son denominados fragmentos de anticuerpo proteolítico. Estos incluyen, pero no se limitan a, los siguientes: "fragmentos F(ab')2" son liberados de un anticuerpo mediante exposición limitada del anticuerpo a una enzima proteolítica, por ejemplo, pepsina y ficina. Un fragmento F(ab')2 comprende dos "brazos", cada uno de los cuales comprende una región variable que se dirige a, y enlaza en forma específica a un antígeno común. Las dos moléculas Fab' están unidas mediante enlaces de disulfuro de cadena interna en las regiones de articulación de las cadenas pesadas; las moléculas Fab' pueden dirigirse hacia los mismos epítopes (bivalente) o epítopes diferentes (biespecíficos).
Los "fragmentos Fab1" contienen un solo dominio anti-enlace incluyendo un Fab y una parte adicional de la cadena pesada a través de la región de articulación.
Los "fragmentos Fab'-SH" normalmente se producen a partir de fragmentos F(ab')2, los cuales se mantienen juntos mediante enlace(s) de disulfuro entre las cadenas H y un fragmento F(ab')2. El tratamiento con un agente de reducción leve tal como, a manera de un ejemplo sin limitación, beta-mercaptoetilamina, rompe el enlace(s) de disulfuro, y se liberan dos fragmentos Fab' de un fragmento F(ab')2. Los fragmentos Fab'-SH son monovalentes y monoespecíficos.
Los "fragmentos Fab" (es decir, un fragmento de anticuerpo que contiene el dominio de enlace de antígeno que comprende una cadena ligera y parte de una cadena pesada puenteadas a través de un enlace de disulfuro) se producen mediante digestión de papaína de anticuerpos intactos. Un método conveniente es utilizar papaína inmovilizada en una resina de modo que la enzima pueda ser eliminada fácilmente y termine la digestión. Los fragmentos Fab no tienen el enlace(s) de disulfuro entre las cadenas H presentes en un fragmento F(ab')2.
Los "anticuerpos de cadena simple" son un tipo de fragmento de anticuerpo. El término anticuerpo de cadena simple con frecuencia se abrevia, "scFv" o "sFv". Estos fragmentos de anticuerpo se producen utilizando tecnología de genética molecular y ADN recombinante. Un anticuerpo de cadena simple consiste en una cadena de polipéptido que comprende tanto un dominio VH como VL el cual interactúa para formar un sitio de enlace de antígeno. Los dominios VH y VL normalmente son enlazados a un péptido de 10 a 25 residuos de aminoácido.
El término "anticuerpo de cadena simple" incluye además pero no se limita a, Fv enlazado por disulfuro (dsFv) en el cual los dos anticuerpos de cadena simple (cada uno de los cuales puede ser dirigido a un epítope diferente) se enlazaron juntos a través de un enlace de disulfuro; un aFv biespecífico en el cual dos scFvs independientes de diferente especificidad se conectan con un enlazador repetido; un diacuerpo (un sFv dimerizado formado cuando el dominio VH de un primer sFv ensambla con el dominio VH de un segundo sFv y el dominio VL del primer sFv se ensambla con el dominio VH del segundo sFv; las dos regiones de enlace de antígeno del diacuerpo pueden ser dirigidas hacia el mismo o diferentes epítopes); un triacuerpo (un sFv trimerizado formado en una forma similar a un diacuerpo, pero en el cual se crean tres dominios de enlace de antígeno en un solo complejo; los tres dominios de enlace de antígeno pueden ser dirigidos hacia el mismo epítope o diferentes epítopes).
La frase "péptidos de región de determinación de complementariedad" o "péptidos CDR" son otra forma de un fragmento de anticuerpos. Un péptido CDR (también conocido como "unidad de reconocimiento mínima") es un péptido que corresponde a una sola región de determinación de complementariedad (CDR), y se pueden preparar construyendo genes que codifican el CDR de un anticuerpo de interés. Dichos genes son preparados, por ejemplo, utilizando la reacción de cadena de polimerasa para sintetizar la región variable a partir del ARN de células que producen anticuerpos. Ver, por ejemplo, la publicación de Larrick y Asociados, Methods: A Companion to Methods in Enzymology 2:106, 1991.
En la frase "anticuerpos modificados por cisteína", se inserta un aminoácido de cisteína se sustituye en la superficie del anticuerpo mediante manipulación genética y se utiliza para conjugar el anticuerpo a otra molécula, por ejemplo, a través de un puente de disulfuro. Las substituciones o inserciones de cisteína para anticuerpos ya han sido descritas (ver la Patente Norteamericana No. 5,219,996). Los métodos para introducir los residuos Cys en la región constante de los anticuerpos IgG para utilizarse en la conjugación específica del sitio de anticuerpos, se describe en la publicación de Stimmel y Asociados (J. Biol. Chem. 275:330445-30450, 2000).
Un "anticuerpo humanizado" es una proteína recombinante utilizada para reducir la cantidad de proteína no humana en la cual los CDRs de un anticuerpo procedente de una especie; por ejemplo, un anticuerpo de roedor, cadenas variables pesadas y ligeras del anticuerpo del roedor se intercambian por ciertos dominios variables pesados y ligeros humanos, por ejemplo utilizando técnicas de ingeniería de proteínas. Los dominios constantes de la molécula de anticuerpo se derivan de los del anticuerpo humano. Ver la publicación de Gussow y Seemann, Humanization of monoclonal antibodies, Method Enzymol. 203:99-121, 1991 y Vaswani y Hamilton, Ann. Allergy Asthma Immunol. 81:105-119, 1998.
Producción de fragmentos de anticuerpo.
Algunas modalidades de los métodos reivindicados y/o composiciones pueden referirse a fragmentos de anticuerpo. Dichos fragmentos de anticuerpo pueden obtenerse mediante digestión de pepsina o papaína de anticuerpos completos a través de métodos convencionales. Por ejemplo, los fragmentos de anticuerpos pueden producirse mediante disociación enzimática de anticuerpos con pepsina para proporcionar un fragmento 5S denotado F(ab')2. Este fragmento puede ser disociado adicionalmente utilizando un agente de reducción de tiol, opcionalmente, un grupo de bloqueo para los grupos sulfhidrilo que resulta de la disociación de enlaces de disulfuro, para producir fragmentos monovalentes 3.5S Fab'. Como alternativa, una disociación enzimática utilizando pepsina, produce los fragmentos Fab monovalentes de un fragmento Fc. Los métodos de ejemplo para producir fragmentos de anticuerpo se describen en la Patente Norteamericana No. 4,036,945; Patente Norteamericana No. 4,331,647; Nisonoff y Asociados, 1960, Arch. Biochem. Biophys., 89:230; Porter, 1959, Biochem. J., 73:119; Edelman y Asociados, 1967, Methods in Enzymology, página 422 (Academic Press), y Coligan y Asociados (eds.), 1991, Current Protocols in Immunology, (John Wiley & Sons).
Otros métodos para disociar anticuerpos, tales como separación de cadenas pesadas para formar fragmentos de cadena ligera-pesada monovalente, disociación adicional de fragmentos u otras técnicas enzimáticas, químicas o genéticas también pueden ser utilizadas, siempre que los fragmentos se enlacen al antígeno que es reconocido por el anticuerpo intacto. Por ejemplo, los fragmentos Fv comprenden una asociación de cadenas VH y V . Esta asociación puede ser monovalente, tal como se describe en la publicación de Inbar y Asociados, 1972, Proc. Nati. Acad. Sci. EUA, 69:2659. Como alternativa, las cadenas variables pueden enlazarse a través de un enlace de disulfuro intermolecular o reticulación mediante químicos tales como glutaraldehído. Ver la publicación de Sandhu, 1992, Crit. Rev. Biotech., 12:437.
Preferentemente, los fragmentos Fv comprenden cadenas VH y VL conectadas a través de un enlazador de péptido. Estas proteínas de enlace de antígeno de cadena simple (sFv) se preparan construyendo un gen estructural que comprende secuencias de ADN que codifican los dominios VH y VL, conectados a través de una secuencia enlazadora de oligonucleótidos. El gen estructural es insertado en un vector de expresión que es introducido subsecuentemente en una célula huésped, tal como E. coli. Las células huéspedes recombinantes sintetizan una cadena de polipéptido simple con un péptido enlazador que puentea los dos dominios V. Los métodos para producir sFvs son bien conocidos en la técnica. Ver la publicación de Whitlow y Asociados, 1991, Methods: A Companion to Methods in Enzymology 2:97; Bird y Asociados, 1988, Science, 242:423; Patente Norteamericana No. 4,946,778; Pack y Asociados, 1993, Bio/Technology, 11:1271, y Sandhu, 1992, Crit. Rev. Bíotech., 12:437.
Otra forma de un fragmento de anticuerpo es un péptido que codifica una región de determinación de complementariedad simple (CDR). Los péptidos CDR ("unidades de reconocimiento mínimas") pueden obtenerse construyendo genes que codifican el CDR de un anticuerpo de interés. Dichos genes se preparan, por ejemplo, utilizando la reacción de cadena de polimerasa para sintetizar la región variable procedente de ARN de las células que producen anticuerpos. Ver la publicación de Larrick y Asociados, 1991, Methods: A Companion to Methods in Enzymology 2:106; Ritter y Asociados (eds.), 1995, Monoclonal Antibodies-Production, Engineering and Clinical Application, páginas 166-179 (Cambridge University Press); Birch y Asociados (eds.), 1995, Monoclonal Antibodies: Principies and Applications, páginas 137-185 (Wiley-Liss, Inc.).
En una modalidad, el anticuerpo humanizado puede enlazarse a una molécula efectora o reportera. Por ejemplo, se puede adherir un macrociclo para la quelación de un átomo de metal pesado, o una toxina tal como ricina, al anticuerpo humanizado a través de una estructura de puenteo covalente.
Como alternativa, el procedimiento de tecnología de ADN recombinante puede utilizarse para producir una molécula de anticuerpo humanizado en el cual el fragmento Fc, el dominio Cu3 ó Cn2 de una molécula de anticuerpo completa, ha sido reemplazado por o ha sido adherido al mismo a través de una ligadura de péptido de una proteína de no inmunoglobulina funcional, tal como una enzima o molécula de toxina.
En otra modalidad de la presente invención, el anticuerpo humanizado puede incluir una molécula de anticuerpo completa, que tiene cadenas pesadas y ligeras de longitud total; un fragmento del mismo, tal como un fragmento Fab, Fab', F(ab')2, ó Fv; un fragmento de anticuerpo de cadena simple, por ejemplo, una cadena Fv, un monómero o dímero de cadena ligera o cadena pesada; proteínas de enlace de antígeno monoespecífico multivalente que comprende 2, 3, 4 ó más anticuerpos o fragmentos de los mismos enlazados a cada uno de los otros a través de una estructura de conexión; o a un fragmento o análogo de cualquiera de estos o cualquier otra molécula con la misma especificidad que MAb mL243. En una modalidad particular, el anticuerpo puede incluir una molécula de anticuerpo completa, que tiene cadenas pesadas y ligeras de longitud total.
Anticuerpos L243 humanizados.
Anticuerpos quiméricos y humanizados.
Un anticuerpo quimérico es una proteína recombinante en la cual las regiones variables de un anticuerpo humano han sido reemplazadas por las regiones variables de, por ejemplo, un anticuerpo de ratón anti-L243, incluyendo las regiones de determinación de complementariedad (CDRs) del anticuerpo de ratón. Los anticuerpos quiméricos exhiben inmunogenicidad disminuida y estabilidad incrementada cuando se administran a un sujeto. Los métodos para construir anticuerpos quiméricos son bien conocidos en la técnica (ver, por ejemplo, Leung y Asociados, Hybridoma 13:469).
Un anticuerpo monoclonal quimérico puede ser humanizado transfiriendo los CDRs de ratón de las cadenas variables pesadas y ligeras de la inmunoglobulina de ratón en los dominios variables correspondientes de un anticuerpo humano. Las regiones de estructura de ratón (FR) en el anticuerpo monoclonal quimérico también se reemplazan con secuencias FR humanas. Para conservar la estabilidad y especificidad de antígeno del monoclonal humanizado, se pueden reemplazar uno o más residuos FR humanos por residuos de contraparte de ratón. Los anticuerpos monoclonales humanizados se pueden utilizar para tratamiento terapéutico de sujetos. La afinidad de anticuerpos humanizados para un objetivo, puede incrementarse mediante modificación seleccionada de las secuencias CDR (WO0029584A1 ). Las técnicas para producción de anticuerpos monoclonales humanizados son bien conocidas en la técnica. (Ver, por ejemplo, Jones y Asociados, 1986, Nature, 321:522; Riechmann y Asociados, Nature, 1988, 332:323; Verhoeyen y Asociados, 1988, Science, 239:1934; Cárter y Asociados, 1992, Proc. Nati. Acad. Sci. EUA, 89:4285; Sandhu, Crit. Rev. Biotech., 1992, 12:437; Tempest y Asociados, 1991, Biotechnology 9:266; Singer y Asociados, J. Immun., 1993, 150:2844).
Otras modalidades pueden referirse a anticuerpos de primate normalizados. Las técnicas generales para elevar anticuerpos terapéuticamente útiles en baboons fue descubierta, por ejemplo, en la publicación de Goldenberg y Asociados, WO 91/11465 (1991), y en Losman y Asociados, Int. J. Cáncer 46:310 (1990).

En otra modalidad, el anticuerpo puede ser un anticuerpo monoclonal humano. Dichos anticuerpos se obtienen de ratones transgénicos que han sido construidos para producir anticuerpos humanos específicos en respuesta a estimulación antigénica. En esta técnica, se introducen los locus de cadena pesada y ligera humana en cepas de ratón derivadas de líneas de célula madre embriónicas que contienen interrupciones dirigidas del lugar de cadena pesada y cadena ligera endógenas. Los ratones transgénicos pueden sintetizar anticuerpos humanos específicos para antígenos humanos, y los ratones pueden ser utilizados para producir hibridomas de segregación de anticuerpos humanos. Los métodos para obtener anticuerpos humanos a partir de ratones transgénicos, se describen en las publicaciones de Green y Asociados, Nature Genet. 7:13 (1994), Lonberg y Asociados, Nature 368:856 (1994), y Taylor y Asociados, Int. Immun. 6:579 (1994).
En una modalidad, el anticuerpo humanizado puede incluir las secuencias de región CDR de mL243 dentro de las secuencias de estructura de anticuerpo humano y con secuencias de región constante de anticuerpo humano. Más particularmente, los anticuerpos humanizados pueden incluir un dominio variable de cadena pesada (VH) que contiene los residuos mL243 VH de todos los de CDR1 (31 a 35), CDR2 (50 a 65) y CDR3 (95 a 102). En otra modalidad, los CDRs del dominio variable de cadena ligera (VL) que corresponden a los residuos mL243 VL de todos los CDR1 (24 a 34) CDR (50 a 56) y CDR3 (89 a 97). En otra modalidad particular de la presente invención, otros residuos L243 VH de murino retenidos en el diseño humanizado, están en una o más de las siguientes posiciones: F27, K38, K46, A68, y F91. En forma similar, los residuos L243 de murino en el VL retenidos en el diseño humanizado están en una o más de las siguientes posiciones: R37, K39, V48, F49, y G100.
En la Solicitud de Patente Norteamericana No. 09/988,013, presentada el 16 de noviembre del 2001, cuyo texto total está incorporado a la presente invención como referencia, se describen por ejemplo detalles adicionales de la humanización de secuencias de anticuerpos, reteniendo al mismo tiempo la especificidad antigénica del anticuerpo no humano original.
En una modalidad, la presente invención proporciona además una cadena pesada de anticuerpo humanizado con injerto de CDR que tiene un dominio de región variable que comprende estructuras aceptoras derivadas de una cadena pesada humana del subgrupo I y las regiones de enlace de antígeno derivadas del donante mL243, en donde la estructura comprende los residuos del donante mL243 en una o más de las posiciones F27, K38, K46, y F91. Ver las figuras 3 y 4, respectivamente.
En una modalidad de la presente invención, una cadena ligera de anticuerpo humanizado injertada con CDR puede proporcionarse teniendo un dominio de región variable que comprende estructuras aceptoras derivadas de una cadena ligera kappa humana del subgrupo I y un antígeno donante mL243 que enlaza a regiones en donde la estructura comprende los residuos del donante mL243 en una o más de las posiciones R37, K39, V48, F49, y G100.
En la molécula de anticuerpos humanizado injertada con CDR de las modalidades de la presente invención, las porciones derivadas de inmunoglobulina sin L243 restantes (aceptoras) pueden derivarse de cualquier inmunoglobulina humana adecuada, siempre que el anticuerpo humanizado pueda doblarse de modo que retenga la capacidad de enlazar en forma específica HLA-DR. Preferentemente el tipo de estructura humana (FR) utilizado es del mismo tipo/clase similar a la del anticuerpo donante.
En una modalidad de la presente invención, las estructuras humanas pueden elegirse para maximizar la homología con una secuencia de anticuerpo donante particularmente en las posiciones espacialmente cercanas o adyacentes a los CDRs. De acuerdo con esta modalidad, las estructuras (es decir, FR1-4) del L243 VH ó VL humanizado pueden derivarse de una combinación de anticuerpos humanos. Los ejemplos de estructuras humanas que se pueden utilizar para construir anticuerpos injertados con CDR son LAY, POM, TUR, TEI, KOL, NEWM, REÍ, RF, y EU; preferentemente RF-TS3 FR1-3 y NEWM FR4 se utilizan para la cadena pesada y REÍ FR1-4 se utiliza para la cadena ligera. El sistema de numeración de residuo de dominio V utilizado en la presente invención se describe en la publicación de Kabat y Asociados, (1991), Sequences of Proteins of Immunological Interest, 5a Edición, United States Department of Health and Human Services. Ver figura 5 para una alineación de secuencia de aminoácido comparativa de cadena RF-TS3 (FR1-3 y NEWM FR4), mL243, y hL243 VH humana. Ver la figura 6 para una alineación de secuencia de aminoácido comparativa para la cadena REÍ, mL243, y hL243 VL.
Los dominios variables de cadena ligera y pesada de la molécula de anticuerpo humanizada pueden fusionarse a dominios constantes de cadena ligera o pesada humanos según sea lo adecuado (el término "dominio constante de cadena pesada incluye regiones de articulación a menos que se especifique de otra manera). Los dominios constantes humanos de la molécula de anticuerpo humanizada, cuando se encuentran, se pueden seleccionar con respecto a la función propuesta del anticuerpo. En una modalidad, los dominios constantes humanos pueden ser seleccionados con base en la carencia de las funciones efectoras. Los dominios constantes de cadena pesada fusionados a la región variable de cadena pesada pueden ser los del IgA (cadena a1 ó a2), IgG (cadena 71, 72, j3>, ó y4) ó IgM (cadena u) humano. Preferentemente se utiliza una cadena y humana. Los dominios constantes de cadena ligera que pueden ser fusionados a la región variable de cadena ligera incluyen cadenas lambda y kappa humanas.
En una modalidad particular de la presente invención, se utiliza una cadena γ1. Aún en otra modalidad particular de la presente invención, se utiliza una cadena γ4. El uso de la cadena γ4 puede en algunos casos incrementar la tolerancia de un hL243 en sujetos (efectos secundarios y reacciones de infusión disminuidos, mayor tolerancia, etc.).
En una modalidad, se pueden utilizar análogos de los dominios constantes de humano. Estos incluyen pero no se limitan a, los dominios constantes que contienen uno o más aminoácidos adicionales al dominio humano correspondiente o a los dominios constantes en donde uno o más de los aminoácidos existentes del dominio humano correspondiente, han sido eliminados o alterados. Dichos dominios se pueden obtener, por ejemplo, mediante mutagénesis dirigida a oligonucleótidos.
Tal como se utiliza en la presente invención, el término "alterado" cuando se utiliza junto con la capacidad de un anticuerpo para fijar el complemento, indica una disminución en la capacidad del anticuerpo para fijar el complemento en comparación con el anticuerpo de partida no alterado. La alteración de un aminoácido adecuado altera la capacidad de un anticuerpo para fijar el complemento. Tal como se utiliza en la presente invención, la frase "substancialmente" reduce la fijación del complemento, denota que la fijación del complemento humano es preferentemente menor o igual al 30%, más preferentemente menor o igual al 20%, y lo más preferentemente menos o igual al 10% del observado con el anticuerpo tipo natural.
La capacidad de fijación del complemento alterada puede producirse mediante técnicas que son bien conocidas en el arte, por ejemplo, eliminación de residuos, inserción de un sitio de glucosilación en una posición adecuada en la molécula, o intercambio de regiones de baja articulación de anticuerpos de diferentes isotipos.
Preparación de genes que codifican los anticuerpos HL243.
Se puede utilizar cualquier técnica estándar de biología molecular conocida en la técnica para preparar secuencias de ADN que codifican los anticuerpos de acuerdo con la presente invención. Por ejemplo, las secuencias de ADN pueden ser sintetizadas completamente o en parte utilizando técnicas de síntesis de oligonucleótidos. Las técnicas de mutagénesis dirigida al sitio y La reacción de cadena de polimerasa (PCR) pueden utilizarse según sea lo adecuado. Los procesos adecuados incluyen el procedimiento de traslape de hebra PCR y mutagénesis PCR tal como se describe, por ejemplo, en la publicación de "PCR Technology Principies and Applications for DNA Amplification" (1989), Ed. H. A. Erlich, Stockholm Press, N. Y., Londres, y oligonucleotides directed mutagenesis (Kramer y Asociados, Nucleic. Acid. Res. 12:9441 (1984)).
También se puede utilizar cualesquiera técnicas estándar de biología molecular para preparar secuencias de ADN que codifican productos injertados con CDR. Por ejemplo, las secuencias de ADN pueden ser sintetizadas completamente o en parte utilizando técnicas de síntesis de oligonucleótido. Se pueden utilizar según sea lo adecuado, técnicas de mutagénesis dirigida al sitio o de reacción de cadena de polimerasa (PCR). La síntesis dirigida al oligonucleótido (Jones y Asociados (1986) Nature 321 522-525) y la mutagénesis dirigida al oligonucleótido de una región de dominio variable existente previamente (Verhoeyen y Asociados (1988) Science 23 1534-1536). También se puede utilizar relleno enzimático de los oligonucleótidos con brecha utilizando polimerasa de ADN T4 (Queen y Asociados (1989) Proc. Nati. Acad. Sci. EUA 86 10029-10033). También se puede utilizar cualquier sistema de vector de expresión/célula huésped adecuado para la expresión de las secuencias de ADN que codifican las cadenas pesadas y ligeras quiméricas o injertadas con CDR. Un "huésped recombinante" puede ser cualquier célula procariótica o eucariótica que contenga ya sea un vector de clonación o un vector de expresión. Este término también ¡ncluye las células procarióticas o eucarióticas, así como animales transgénicos que han sido construidos genéticamente para contener el gen(s) clonado en el cromosoma o genoma de la célula o células huésped. Las bacterias, por ejemplo, E. coli, y otros sistemas microbianos pueden ser utilizados de manera conveniente, en particular para la expresión de fragmentos de anticuerpo, por ejemplo, fragmentos Fv, Fab, y Fab', y fragmentos de anticuerpo de cadena simple, es decir, Fvs de cadena simple. También se pueden utilizar huéspedes eucarióticos, por ejemplo, sistemas de expresión de célula de mamífero para obtener anticuerpos de acuerdo con la presente invención, particularmente para la producción de productos de anticuerpo quimérico o injertado con CDR más grandes. Las células huésped de mamífero adecuadas incluyen células de mieloma, tales como células Sp2/0 y NSO, así como células de Ovario de Hámster Chino (CHO), líneas celulares de hibridoma y otras células de mamífero útiles para expresar los anticuerpos.
Un "vector de expresión" tal como se utiliza en la presente invención, es una molécula de ADN que incluye los genes de interés que se expresan en una célula huésped. Normalmente, la expresión genética se coloca bajo el control de ciertos elementos reguladores, incluyendo promotores constitutivos o inducibles, elementos o aumentadores de regulación específica del tejido. Se dice que dicho gen estará "enlazado en forma operable a" los elementos reguladores. En aspectos adicionales, una modalidad también incluye secuencias de ADN que codifican las cadenas pesada y ligera de los anticuerpos de la presente invención, vectores de clonación y expresión que contienen estas secuencias de ADN, células huésped transformadas con estas secuencias de ADN y procesos para producir las cadenas pesadas o ligeras y moléculas de anticuerpo que comprenden la expresión de estas secuencias de ADN en una célula huésped transformada.
Se puede obtener ADN que codifica las secuencias de ¡nmunoglobulina humana a través de cualquier medio conocido en la técnica. Por ejemplo, las secuencias de aminoácido de estructuras aceptoras humanas preferidas, tales como -LAY, POM, KOL, REÍ, EU, TUR, TEI, RE, y NEWM, están ampliamente disponibles. En forma similar, las secuencias de consenso de los subgrupos de cadena ligera y pesada humanos también están disponibles. Los expertos en la técnica están atentos de que las secuencias de codón múltiple pueden codificar el mismo aminoácido, y que en varias modalidades, las secuencias de ácido nucleico descritas pueden ser substituidas con una secuencia alternativa que codifica la misma secuencia de aminoácidos. Los expertos en la técnica también estarán atentos, dependiendo de la especie de origen de una línea celular utilizada para expresar una proteína de una secuencia de ácido nucleico, que el uso del codón puede ser optimizado para mejorar la expresión en las especies seleccionadas. Dichas especies de codón preferidas para las especies son bien conocidas en la técnica.

En una modalidad, el anticuerpo descrito en la presente invención puede ser un anticuerpo completo, o tal como se explica anteriormente, un fragmento del mismo, un monómero o dímero o una proteína de enlace de antígeno monoespecífica multivalente. Por ejemplo, además de un aspecto de la presente invención, se puede proporcionar una proteína de enlace de antígeno monoespecífica multivalente que comprende 2, 3, 4, o más fragmentos de anticuerpo de los mismos enlazados entre sí a través de una estructura de conexión, en donde la proteína no es una inmunoglobulina natural, teniendo cada uno de dichos anticuerpos o fragmentos una especificidad para el epítope reconocido por el MAb L243 de murino, siendo opcionalmente conjugada la proteína de enlace de antígeno con una molécula efectora o reportera.
De acuerdo con estas modalidades, cada anticuerpo o fragmento puede ser un anticuerpo o fragmento humanizado del mismo, tal como se definió anteriormente, y una proteína de enlace de antígeno monoespecífica multivalente puede ser una proteína de enlace de antígeno monoespecífica multivalente humanizada. Sin embargo, las proteínas de enlace de antígeno monoespecífica multivalente no humanizada, es decir de murino, pueden contemplarse y una modalidad puede extenderse a estas, cuando sea aplicable.
En una modalidad en particular, una proteína de enlace de antígeno multivalente puede proporcionar 2, 3, ó 4 anticuerpos o fragmentos de los mismos enlazados entre sí a través de una estructura de conexión. En otra modalidad, un proceso para producir el anticuerpo humanizado puede incluir: i) producción en un vector de expresión/secuencia de ADN que codifica una cadena pesada o ligera de anticuerpo que incluye un dominio variable, en donde al menos una de las CDRs del dominio variable pueden derivarse del mL243 MAb, y las partes restantes derivadas de inmunoglobulina de la cadena de anticuerpo se derivan de una inmunoglobulina humana; ii) producir en un vector de expresión una secuencia de ADN que codifica una cadena ligera o pesada de anticuerpo complementaria que incluye un dominio variable, en donde al menos una de las CDRs del dominio variable se deriva del MAb mL243 y las partes derivadas de inmunoglobulina restantes de la cadena de anticuerpo pueden derivarse de una inmunoglobulina humana; ¡ii) transfectar una célula huésped con las secuencias de ADN antes mencionadas; y iv) cultivar la línea de célula transfectada para producir la molécula de anticuerpo humanizada.
Producción de hL243 recombinante en una célula huésped.
En una modalidad, se utiliza un dominio de célula huésped para producir hL243 recombinante que puede ser transfectada con dos vectores, conteniendo el primer vector la secuencia de ADN que codifica el polipéptido derivado de cadena ligera, y conteniendo el segundo vector la secuencia de ADN que codifica el polipéptido derivado de cadena pesada. Preferentemente los vectores son idénticos excepto en cuanto a lo concerniente con las secuencias de codificación y marcadores seleccionables, para asegurar lo más posible que cada cadena de polipéptido se exprese de manera ideal. La transfección puede llevarse a cabo a través de cualquier técnica conocida por los expertos en el arte. Ver por ejemplo, la publicación de Maniatis y Asociados (1982) (Molecular Cloning, Cold Spring Harbor, Nueva York) y Primrose y Oíd (1980) (Principies of Gene Manipulation, Blackwell, Oxford). Una técnica particular de transfección puede ser electroporación. Otros ejemplos incluyen transfecciones transmitidas por fosfato de calcio, transfección transmitida por lípido catiónico o similares. En una modalidad alternativa, el vector simple puede ser utilizado, incluyendo el vector las secuencias de ADN que codifican polipéptidos derivados tanto de cadena ligera como de cadena pesada, y un marcador seleccionable.
Métodos generales para la producción de proteína de fusión recombinante que contienen fragmentos de anticuerpo.
Los fragmentos de anticuerpo que codifican secuencias de ácido nucleico que reconocen epítopes específicos pueden obtenerse mediante técnicas que son bien conocidas en el arte. Por ejemplo, anticuerpos que segregan hibridomas de una especificidad deseada pueden ser utilizados para obtener ADN que codifica el anticuerpo, que se pueden preparar utilizando técnicas conocidas, por ejemplo, mediante PCR o mediante técnicas de clonación de ADNc tradicionales. Como alternativa, se pueden construir bibliotecas de expresión Fab' o bibliotecas de despliegue de fagos de anticuerpos para clasificar los fragmentos de anticuerpos que tienen una especificidad deseada.
El ácido nucleico que codifica el fragmento de anticuerpo puede ser posteriormente ligado, en forma directa o a través de una secuencia que codifica un espaciador de péptido, al ácido nucleico que codifica ya sea DDD ó AD. Los métodos para producir secuencias de ácido nucleico que codifican estos tipos de proteína de fusión, son bien conocidos en la técnica y se describirán en forma adicional en los ejemplos que se encuentran más adelante.
En otra modalidad, se pueden agregar residuos de aminoácido adicionales ya sea al N-término ó C-término de la subunidad modular compuesta de A/DDD ó B/AD, en donde el sitio de fusión exacta puede depender de si el DDD o AD están adheridos al N-término ó C-término (o en una posición interna). Los residuos de aminoácido adicionales pueden comprender una etiqueta de péptido, un péptido de señal, una citocina, una enzima (por ejemplo, una enzima de activación de pro-fármaco), una hormona, una toxina, un fármaco de péptido, un péptido de interacción de membrana, u otras proteínas similares.
Se pueden sintetizar proteínas o péptidos, en su totalidad o en parte, en un soporte en solución o sólido de acuerdo con técnicas convencionales. Están comercialmente disponibles varios sintetizadores automáticos y se pueden utilizar de acuerdo con protocolos conocidos. Ver por ejemplo la publicación de Stewart y Young (1984, Solid Phase Peptide Synthesis, 2a Edición, Pierce Chemical Co.); Tam y Asociados (1983, J. Am. Chem. Soc, 105:6442); Merrifield (1986, Science, 232:341-347); y Barany y Merrifield (1979, The Peptides, Gross and Meienhofer, eds., Academic Press, Nueva York, páginas 1-284). Las secuencias de péptido corto, normalmente desde aproximadamente 6 hasta aproximadamente 35 hasta 50 aminoácidos, pueden ser fácilmente sintetizadas a través de dichos métodos. Como alternativa, se puede emplear tecnología de ADN recombinante en donde una secuencia de nucleótido que codifica un péptido de interés se inserta en un vector de expresión, se transforma o transfecta en una célula huésped adecuada y se cultiva bajo condiciones adecuadas para la expresión.
Los métodos para producir proteínas recombinantes en una célula huésped deseada, son bien conocidos en la técnica. Para facilitar la purificación, las estructuras atadas establemente pueden contener etiquetas de péptido adecuadas, tales como la secuencia FLAG o la secuencia poly-HIS, para facilitar su purificación con una columna de afinidad relevante. En una modalidad, los fragmentos Fv pueden incluir cadenas VH y VL conectadas con un enlazador de péptido. Estas proteínas de enlace de antígeno de cadena simple (sFv), se preparan construyendo un gen estructural que comprende secuencias de ADN que codifican los dominios VH y V , conectadas mediante una secuencia de enlace de oligonucleótidos. El gen estructural se inserta en un vector de expresión que es substancialmente introducido en una célula huésped, tal como E. coli. Las células huésped recombinantes sintetizan una sola cadena de polipéptido con un péptido enlazador que puentea los dos dominios V. Los métodos para producir sFvs son bien conocidos en la técnica. Ver las publicaciones de Whitlow y Asociados, 1991, Methods: A Companion to Methods in Enzymology 2:97; Bird y Asociados, 1988, Science, 242:423; Patente Norteamericana No. 4,946,778; Pack y Asociados, 1993, Bio/Technology, 11:1271, y Sandhu, 1992, Crit. Rev. Biotech. 12:437.
Otra forma de un fragmento de anticuerpo es un péptido que codifica una región de determinación de complementariedad simple 8CDR). Los péptidos CDR ("unidades de reconocimiento mínimo") pueden ser obtenidos construyendo genes que codifican la CDR de un anticuerpo de interés. Dichos genes se preparan, por ejemplo, utilizando la reacción de cadena de polimerasa para sintetizar la región variable procedente del ARN de células que producen anticuerpos. Ver las publicaciones de Larrick y Asociados, 1991, Methods: A Companion to Methods in Enzymology 2:106; Ritter y Asociados (eds.), 1995, Monoclonal Antibodies: Production, Engineering and Clinical Application, páginas 166-179 (Cambridge University Press); Birch y Asociados (eds.), 1995, Monoclonal Antibodies Principies and Applications, páginas 137-185 (Wiley-Liss, Inc.). Las células huésped de líneas celulares adecuadas para la expresión de las subunidades constituyentes de las estructuras atadas establemente, son conocidas para un experto en la técnica. El uso de una célula huésped humana puede permitir que cualesquiera moléculas expresadas sean modificadas con patrones de glucosilación humanos. Sin embargo, no hay indicación de que se esencial o preferida una célula huésped humana para los métodos descritos.
Anticuerpos y conjugados bi-específicos.
En ciertas modalidades, los ligandos L243 aquí descritos pueden utilizarse en combinación con otra molécula adherida al ligando. La adición puede ser ya sea covalente o no covalente. En algunas modalidades, se puede adherir un ligando L243 a un anticuerpo biespecífico, es decir, un anticuerpo que tiene dos diferentes sitios de enlace, uno para el ligando L243 y el otro para un antígeno objetivo relacionado con la enfermedad. Se puede dirigir cualquier enfermedad o condición que se relaciona con angiogénesis, cáncer, metástasis, o motilidad celular, incluyendo pero sin limitarse a, cáncer primario, cáncer metastático, hiperplasia, artritis reumatoide, enfermedad de intestino inflamatorio, enfermedad de Crohn, colitis ulcerativa, sarcoidosis, asma, edema, hipertensión pulmonar, formación y desarrollo de tejido de tumor, psoriasis, retinopatía diabética, degeneración macular, rechazo de injerto de córnea, glaucoma neovascular, angiogénesis al miocardio, neovascularización de placa, restenosis, formación de neoíntima después de trauma vascular, telangiectasia, articulaciones hemofílicas, angiofibroma, fibrosis asociada con inflamación crónica, fibrosis de pulmón, trombosis venosa profunda y granulación de heridas. Los métodos para la construcción y uso de anticuerpos biespecíficos y multiespecíficos se describen, por ejemplo, en la Publicación de Solicitud de Patente Norteamericana No. 20050002945, presentada el 2/11/2004, cuyo texto completo está incorporado a la presente invención como referencia.
Cuando se dirige en parte el anticuerpo biespecífico contra un antígeno asociado con tumor, se anticipa que también se dirigirá cualquier tipo de tumor y cualquier tipo de antígeno de tumor. Los tipos de tumores de ejemplo que pueden ser dirigidos incluyen leucemia linfoblástica aguda, leucemia mielogenosa aguda, cáncer biliar, cáncer de seno, cáncer cervical, leucemia linfocítica crónica, leucemia mielogenosa crónica, cáncer colo-rectal, cáncer de endometrio, cáncer esofageal, gástrico, cabeza y cuello, linfoma de Hodgkin, cáncer de pulmón, tiroides medular, linfoma de no Hodgkin, cáncer de ovario, cáncer pancreático, glioma, melanoma, cáncer de hígado, cáncer de próstata y cáncer de vejiga urinaria. Se prefieren tumores que tienen expresión constitutiva de L243, o que pueden ser estimulados para producir L243.
Se puede utilizar una variedad de métodos recombinantes para producir anticuerpos biespecíficos y fragmentos de anticuerpos. Por ejemplo, los anticuerpos biespecíficos y fragmentos de anticuerpos pueden ser producidos en leche de ganado transgénico (ver la publicación de Colman, A., Biochem. Soc. Symp., 63:141-147, 1998; Patente Norteamericana No. 5,827,690, cada una incorporada a la presente invención como referencia). Se preparan dos construcciones de ADN las cuales confieren, respectivamente, segmentos de ADN que codifican cadenas pesadas y ligeras en pares de inmunoglobulina. Los fragmentos se clonan en vectores de expresión que contienen una secuencia promotora que se expresa preferentemente en células epiteliales de mamífero. Los ejemplos incluyen, pero no se limitan a, promotores procedentes de genes de caseína de conejo, vaca y oveja, el gen de alfa-lactoglobulina de vaca, el gen de beta-lactoglobulina de oveja y el gen de proteína de ácido de suero de ratón. Preferentemente, el fragmento injertado está flanqueado en su lado 3' mediante secuencias genómicas cognatas procedentes de un gen específico-mamario. Esto proporciona un sitio de poliadenilación y secuencias estables de transcripción. Los cartuchos de expresión se inyectan en conjunto en los pronúcleos de huevos fertilizados, de mamífero los cuales posteriormente se implantan en el útero de una hembra receptora y se dejan gestar. Después del nacimiento, la progenie se clasifica con respecto a la presencia de ambos transgenes mediante análisis Southern. Con el objeto de que se presente el anticuerpo, los genes tanto de cadena pesada como ligera deben ser expresados en forma concurrente en la misma célula. La leche de hembras transgénicas se analiza con respecto a la presencia y funcionalidad del anticuerpo o fragmento de anticuerpo, utilizando métodos inmunológicos estándar conocidos en la técnica. El anticuerpo puede ser purificado a partir de leche utilizando métodos estándar conocidos en la técnica.
Pre-dirección.
Una estrategia para utilizar anticuerpos biespecíficos incluye metodologías de pre-dirección, en las cuales una molécula efectora, tal como un ligando anti-angiogénico o antitumor, se administra a un sujeto después de que se ha administrado un anticuerpo bi-específico. El anticuerpo biespecífico el cual puede incluir un sitio de enlace para un ligando L243 y uno para el tejido enfermo, localiza el tejido enfermo e incrementa la especificidad de localización del ligando L243 efector para el tejido enfermo (Solicitud de Patente Norteamericana No. 20050002945). Debido a que la molécula efectora puede ser despejada de la circulación en forma mucho más rápida que el anticuerpo biespecífico, los tejidos normales pueden tener una exposición disminuida a la molécula efectora cuando se utiliza una estrategia de predirección, que cuando la molécula efectora se enlaza directamente al anticuerpo de dirección de la enfermedad.
Los métodos de predirección han sido desarrollados para incrementar las proporciones de objetivo:soporte de agentes de detección o terapéuticos. Los ejemplos de predirección y métodos de biotin/avidin se describe, por ejemplo, en la publicación de Goodwin y Asociados, Patente Norteamericana No. 4,863,713; Goodwin y Asociados, J. Nucí. Med. 29:226, 1988; Hnatowich y Asociados, J. Nucí. Med. 28:1294, 1987; Oehr y Asociados, J. Nucí. Med. 29:728, 1988; Klibanov y Asociados, J. Nucí. Med. 29:1951, 1988; Sinitsyn y Asociados, J. Nucí. Med. 30:66, 1989; Kalofonos y Asociados, J. Nucí. Med. 31:1791, 1990; Schechter y Asociados, Int. J. Cáncer 48:167, 1991; Paganelli y Asociados, Cáncer Res. 51:5960, 1991; Paganelli y Asociados, Nucí. Med. Commun. 12:211, 1991; Patente Norteamericana No. 5,256,395; Stickney y Asociados, Cáncer Res. 51:6650, 1991; Yuan y Asociados, Cáncer Res. 51:3119, 1991; Patente Norteamericana No. 6,077,499; Serie Norteamericana No. 09/597,580; Serie Norteamericana No. 10/361,026; Serie Norteamericana No. 09/337,756; Serie Norteamericana No. 09/823,746; Serie Norteamericana No. 10/116,116; Serie Norteamericana No. 09/382,186; Serie Norteamericana No. 10/150,654; Patente Norteamericana No.

6,090,381; Patente Norteamericana No. 6,472,511; Serie Norteamericana No. 10/114,315; Solicitud Provisional Norteamericana No. 60/386,411; Solicitud Provisional Norteamericana No. 60/345,641; Solicitud Provisional Norteamericana No. 60/3328,835; Solicitud Provisional Norteamericana No. 60/426,379; Serie Norteamericana No. 09/823,746; Serie Norteamericana No. 09/337,756; y Solicitud Provisional Norteamericana No. 60/342,103, las cuales todas están incorporadas en su totalidad a la presente invención como referencia.
En ciertas modalidades, los anticuerpos biespecíficos y construcciones dirigibles pueden utilizarse en el tratamiento y/o generación de imágenes de tejidos y órganos normales o enfermos, por ejemplo utilizando los métodos que se describen en las Patentes Norteamericanas Nos. 6,126,916; 6,077,499; 6,010,680; 5,776,095; 5,776,094; 5,776,093; 5,772,981; 5,753,206; 5,746,996; 5,697,902; 5,328,679; 5,128,119; 5,101,827; y 4,735,210; cada una incorporada a la presente invención como referencia. Se describen métodos adicionales en la Solicitud Norteamericana Serie No. 09/337,756, presentada el 22 de junio de 1999 y en la Solicitud Norteamericana Serie No. 09/823,746, presentada el 3 de abril del 2001.
Usos terapéuticos y diagnóstico de hL243.
En otra modalidad, la presente invención también proporciona composiciones terapéuticas y de diagnóstico que contienen los anticuerpos de las modalidades de la presente invención. Dichas modalidades pueden incluir un anticuerpo de acuerdo con la presente invención junto con un excipiente, diluyente o vehículo farmacéuticamente aceptable, por ejemplo para uso in vivo.
Un "agente terapéutico" es una molécula o átomo que se administra por separado, en forma concurrente o en secuencias con una porción de anticuerpo que se conjuga para una porción de anticuerpo, es decir, anticuerpo o fragmento de anticuerpo o un subfragmento, y es útil en el tratamiento de una enfermedad. Los ejemplos de agentes terapéuticos incluyen anticuerpos, fragmentos de anticuerpos, fármacos, toxinas, enzimas, nucleasas, hormonas, inmunomoduladores, oligonucleótidos, ARN de interferencia, queladores, compuestos de boro, agentes fotoactivos o tintas y radioisótopos.
Un "agente de diagnóstico/detección" es una molécula o átomo que se administra enlazada a, o conjugada a una porción de anticuerpo, es decir, anticuerpo o fragmento de anticuerpo o subfragmento y es útil en el diagnóstico o detección de una enfermedad localizando las células que contienen el antígeno. Los agentes de diagnóstico/detección útiles incluyen, pero no se limitan a radioisótopos, tintas (tales como con el complejo de biotin-estreptavidin), agentes de contraste, compuestos fluorescentes o moléculas de agentes de aumento (por ejemplo, iones paramagnéticos) para generación de imagen de resonancia magnética (MRI), y partículas o líposomas como ejemplos de agentes utilizados para generación de imágenes de ultrasonido. Los agentes para aumentar el ultrasonido se describen en las Solicitudes de Patente Norteamericana Nos. US20040219203 A1, y US20050014207A1 , y por lo tanto, están incorporadas en su totalidad a la presente invención como referencia. Se prefieren los liposomas llenos con gas. Ver la publicación de Maresca, G. y Asociados, Eur. J. Radiol. Suppl. 2 S171-178 (1998); Demos, Sm. y Asociados, J. Drug Target 5 507-518 (1998); y Unger, E. y Asociados, Am. J. Cardiol. 81 58G-61G (1998). Como alternativa, se puede utilizar un anticuerpo biespecífico para dirigir el liposoma. En una modalidad, el liposoma es un liposoma lleno con gas con un DTPA-péptido bivalente adherido en forma covalente a la superficie externa de la membrana de lípido de liposoma. La Solicitud de Patente Norteamericana No. US20040018557A1 , describe dichos liposomas, y se incorpora en su totalidad a la presente invención como referencia.
La Patente Norteamericana No. 6,331,175 describe la técnica MRI y la preparación de anticuerpos conjugados para un agente de aumento MRI y está incorporada en su totalidad a la presente invención como referencia. En un método en particular, se pueden seleccionar agentes de diagnóstico/detección del grupo que consiste en radioisótopos, agentes de aumento para utilizarse en generación de imágenes de resonancia magnética, agentes de ultrasonido y compuestos fluorescentes. Con el objeto de cargar un componente de anticuerpo con metales radioactivos o iones paramagnéticos, puede ser necesario hacerlo reaccionar con un reactivo que tenga una cola larga a la cual se adhiera una multiplicidad de grupos de quelación para enlazar los iones. Dicha cola puede ser un polímero tal como una polilisina, polisacárido, u otra cadena derivada o que se puede derivar o que tiene grupos colgantes a los cuales se pueden enlazar los grupos de quelación, tales como, por ejemplo, ácido etilenodiaminotetra-acético (EDTA), ácido dietilenotriaminopenta-acético (DTPA), porfirinas, poliaminos, éteres corona, bis-tiosemicarbazonas, polioximinas, y grupos similares conocidos por ser útiles para este propósito. Los quelados pueden ser acoplados a los anticuerpos utilizando químicas estándar. El quelado puede ser enlazado al anticuerpo a través de un grupo que permite la formación de un enlace a la molécula con una pérdida mínima de inmuno-reactividad y una agregación y/o reticulación interna mínima. Otros métodos y reactivos, más inusuales, para conjugar los conjugados a los anticuerpo se describen en la patente Norteamericana No. 4,824,659 de Hawthorne, titulada "Conjugados de Anticuerpo", presentada el 25 de abril de 1989, cuya descripción está incorporada en su totalidad a la presente invención como referencia. En una modalidad particular, las combinaciones de metal-quelado útil pueden incluir 2-bencil-DTPA y sus análogos de monometilo y ciciohexilo, utilizados con isótopos de diagnóstico en un rango de energía general de

60 a 4,000 keV, tal como 1 η 2¿50.1, 1 π3-*1η1, 1 -2"3.I, 1 - 2"4.i, 6 "2,Cu, MCu, ηBF, inln, 67Ga; 68Ga, ' Te, 9 mTc, HC, 13N, 15O, 76Br, 97Zr, para generación de radio imagen. Los mismos quietados, cuando se hacen en compuesto con metales no radioactivos, tales como manganeso, hierro y gadolinio pueden ser útiles para MRI, cuando se utilizan junto con cualesquiera anticuerpos aquí descritos. Los quelados macrocíclicos tales como NOTA, DOTA y TETA son de uso con una amplia variedad de metales y radiometales, más particularmente cono radionúclidos de galio, itrio y cobre, respectivamente. Los complejos de metal-quelado pueden ser estabilizados diseñando el tamaño de anillo para el metal de interés. Otros quelados tipo anillo tales como poliéteres macrocíclicos, los cuales son de interés para enlazar establemente nucleótidos, tales como 223Ra para RAIT, están comprendidos en las modalidades de la presente invención.
Los ejemplos de agentes terapéuticos incluyen pero no se limitan a anticuerpos, fragmentos de anticuerpos, fármacos, incluyendo agentes quimioterapéuticos, toxinas, inhibidores de enzima, nucleasas, hormonas, antagonistas de hormonas, inmunomoduladores, citocinas, queladores, compuestos de boro, átomos de uranio, agentes fotoactivos y radionúclidos.
Los agentes de diagnóstico/detección incluyen, pero no se limitan a, radio-isótopos, tintas (tal como con el complejo de biotina-estraptavidina), materiales radiopacos (por ejemplo, compuestos de yodo, bario, galio y talio y similares), agentes de contraste, compuestos fluorescentes o moléculas de agentes de aumento (por ejemplo iones paramagnéticos) para generación de imagen de resonancia magnética (MRI). La patente Norteamericana No. 6,331,175 describe la técnica MRI y la preparación de anticuerpos conjugados a un agente de aumento de MRI y está incorporada en su totalidad a la presente invención como referencia. Preferentemente, los agentes de diagnóstico/detección se seleccionan del grupo que consiste en radio-isótopos para generación de imagen nuclear, detección intra-operativa y endoscópica; agentes de aumento para utilizarse en generación de imagen de resonancia magnética o en ultrasonografía; agentes radiopacos y de contraste para rayos X y tomografía computarizada; y compuestos fluorescentes para fluoroscopia, incluyendo fluoroscopia endoscópica.
Los agentes quimioterapéuticos, para el propósito de la presente invención, incluyen todos los agentes quimioterapéuticos conocidos. Los agentes quimioterapéuticos conocidos incluyen pero no se limitan a los taxanos, mostazas de nitrógeno, derivados de etileno-imina, alquilo sulfonatos, nitrosoureas, triacenos, análogos de ácido fólico, análogos de pirimidina, análogos de purina, oligonucleótidos anti-sentido, antagonistas inhibidores de factores de transcripción, ARNs de interferencia, alcaloides, antibióticos, enzimas, complejos de coordinación de platino, inhibidores COX-2, agentes apoptóticos, urea sustituida, derivados de hidracina de metilo, supresores adrenocorticales o antagonistas. En una modalidad más particular, los agentes quimioterapéuticos pueden incluir esteroides, progestinas, estrógenos, anti-estrógenos o andrógenos. En otra modalidad particular, los agentes quimioterapéuticos pueden incluir actinomicina, azaribína, anastrozole, azacitidina, bleomicina, briostatin-1 , busulfan, carmustina, Celebrex, clorambucil, cisplatina, irinotecan (CPT-11), carboplatina, cladribina, ciclofosfamida, citarabina, dacarbazina, docetaxel, dacarbazina, dactinomicin, daunorrubicina, dexametasona, dietilestilbestrol, doxorrubicina, estradiol de etinilo, estramustina, etopósida, floxuridina, fludarabina, flutamida, fluorouracil, fluoximesterona, gemcitabina, caproato de hidroxiprogesterona, hidroxiurea, idarrubicina, ifosfamida, L-asparaginasa, leucovorin, lomustina, mecloretamino, acetato de medroprogesterona, acetato de megestrol, melfalan, mercaptopurina, metotrexato, mitoxantrona, rinitramicina, mitomicina, mitotano, oxaliplatina, butirato de fenilo, prednisona, procarbazina, paclitaxel, pentostatina, estreptozocin de semustina, SN-38, tamoxifen, taxanos, taxol, propionato de testosterona, talidomida, tioguanina, tiotepa, teniposida, topotecan, mostaza de uracil, vinblastina, vinorelbina o vincristina.
Algunos agentes quimioterapéuticos adecuados se describen en la publicación de Remington Pharmaceutical

Sciences 19a Edición (Mack Publishing Co. 1995). Otros agentes quimioterapéuticos adecuados, tales como fármacos experimentales, son conocidos para los expertos en la técnica.

En una modalidad de la presente invención, una toxina puede incluir pero no se limita a ricina, abrina, ribonucleasa, DNasa 1, enterotoxina-A Staphylococcal proteína antiviral de fitolaca, gelonin, toxina de difterina, exotoxina de Pseudomonas, o endotoxinas de Pseudomonas.
En una modalidad de la presente invención, las enzimas también son agentes terapéuticos útiles y se pueden seleccionar del grupo que incluyen pero no se limitan a desodrigenasa de malato, nucleasa Staphylococcal, isomerasa delta-V-esteroides, deshidrogenasa de alcohol de levadura, deshidrogenasa a-glicerofosfato, isomerasa de fosfato de triosa, peroxidasa de rábano, fosfatasa alcalina, asparaginasa, oxidasa de glucosa, p-galactosidasa, ribonucleasa, ureasa, catalasa, deshidrogenasa de grupo glucosa-6-fosfato, glucoamilasa y acetilcolinesterasa.
Tal como se utiliza en la presente invención, el término "inmunomodulador" incluye citocinas, factores de crecimiento de factores de célula madre, linfotoxinas, tales como factor de necrosis de tumor (TNF), y factores hematopoyéticos, tales como interleucinas (por ejemplo interleucina-1 (IL-1), IL-2, IL-3, IL-6, IL-10, IL-12, IL-18 y IL-21), factores de estimulación de colonia (por ejemplo factor de estimulación de colonia de granulocito (G-CSF) y factor de estimulación de colonia de macrófago en granulocito (GM-CSF)), interferonas (por ejemplo ínterferonas- α, -β y -γ), el factor de crecimiento de célula madre designado como "factor S1", y eritropoyetina y trombopoyetina. Los ejemplos de porciones inmunomoduladores adecuadas incluyen IL-2, IL-6, IL-10, IL-12, IL-18, IL-21, ¡nterferón-γ, TNF-α, y similares. Como alternativa, los sujetos pueden recibir composiciones de la presente invención y una citocina administrada por separado, la cual puede ser administrada antes, en forma concurrente después de la administración de las composiciones aquí descritas. Las modalidades de la presente invención pueden incluir composiciones conjugadas a un inmunomodulador.
Una citocina, para los propósitos de la presente descripción, incluye cualesquiera citocinas incluyendo pero sin limitarse a IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21, interferón-α, interferón-β, e interferón-γ. También puede ser un factor de estimulación de colonia, tal como GM-CSF, G-CSF, eritropoyetina, trombopoyetina, y similares.
Además, un quelador puede incluir pero no se limita a DTP A, DOTA, TETA, o NOTA o in péptido adecuado, el cual se puede conjugar una etiqueta detectable, tal como una molécula fluorescente, o un agente citotóxico, tal como un metal pesado o radionúclido. Por ejemplo, se puede obtener un inmunoconjugado terapéuticamente útil conjugando un agente fotoactivo o tinta a un compuesto en anticuerpo. En la presente invención, se contempla que las composiciones fluorescentes, tales como fluorocromo, y otras cromogenos, o tintas, tales como porfirinas sensibles a luz visible, han sido utilizados para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto ha sido denominado, fotorradiación, fototerapia, o terapia foto-dinámica (Jori y asociados (eds.), Photodynamic Therapy of Tumors and Other Diseases (Librería Progetto, 1985); van den Bergh, Chem. Britain 22:430, 1986). Además, se contempla que los anticuerpos monoclonales acoplados con tintas fotoactivadas para lograr la fototerapia, pueden ser utilizados para propósitos de diagnostico o terapéuticos en la presente invención. Mewe/a/., J. Immunol. 130: 1473, 1983; idem., Cáncer Res. 45: 4380, 1985; Oseroff y asociados, Proc. Nati. Acad. Sd. E.U.A. 83: 8744, 1986; idem., Photochem. Photobiol. 46: 83,1987; Hasan y asociados, Prog. Clin. Biol. Res. 288: 471, 1989; Tatsuta y asociados, Lasers Surg. Med. 9: 422, 1989; Pelegrin y asociados, Cáncer 67: 2529,1991. Sin embargo, estos estudios anteriores no incluyeron el uso de aplicaciones de terapia endoscópica, especialmente con el uso de fragmentos o subfragmentos de anticuerpos. Por lo tanto, la presente invención se contempla en una modalidad el uso terapéutico de inmunoconjugados que comprenden agentes o tintas fotoactivos. Por lo tanto, los métodos terapéuticos de la presente invención pueden incluir el uso terapéutico de inmunoconjugados que comprenden agentes o tintas fotoactivos. Los métodos endoscópicos para detección y terapia se describen en las patentes Norteamericanas Nos. 4,932,412; 5,525,338; 5,716,595; 5,736,119; 5,922,302; 6,096,289; y 6,387,350, las cuales están incorporadas en su totalidad a la presente invención como referencia.
En una modalidad de la presente invención, se puede utilizar un nuclido. En una modalidad particular, los radionúclidos que tienen propiedades útiles de diagnóstico o terapéuticas, tales como indio- 111 o itrío-90, respectivamente, están contempladas en la presente invención. Otros núclidos útiles incluyen, pero no se limitan a F-18, P-32, Sc-47, Cu-62, Cu-64, Cu-67, Ga-67, Ga-68, Y-86, Y-90, Zr-89, Tc-99m, Pd-109, Ag-111, ln-111, 1-123, 1-125, 1-131, Sm-153, Gd-155, Gd-157, Tb-161, Lu-177, Re-186, Re-188, Pt-197, Pb-212, Bi-212, Bi-213, Ra-223, Ac-225, As-72, As-77, At-211, Au-198, Au-199, Bi-212, Br-75, Br-76B, C-11, Co-55Co, Dy-166, Er-169, F-18, Fe-52, Fe-59, Ga-67, Ga-68, Gd-154-158, Ho-166, 1-120,1-121,1-124, ln-110, ln-111, M194, Lu-177, Mn-51, Mn-52, Mo-99, N-13, O-15, P-32, P-33, Pb-211, Pb-212, Pd-109, Pm-149, Pr-142, Pr-143, Rb-82, Re-189, Rh-105, Sc-47, Se-75, Sr-83, Sr-89, Tb-161, Tc-94, Tc-99, Y-86, Y-90 o Zr-89. Por ejemplo, los radionúclidos de diagnóstico adecuados incluyen pero no se limitan a ln-110, ln-111, Lu-177, F-18, Fe-52, Cu-62, Cu-64, Cu-67, Ga-67, Ga-68, Y-86, Zr-89, Tc-94m, Tc-94, Tc-99m, 1-120, I-123, 1-124, 1-125, 1-131, Gd-154-158, P-32, C-11, N-13, 0-15, Re-186, Re-188, Mn-51, Mn-52m, Co-55, As-72, Br-75, Br-76, Rb-82m, Zr-89 y Sr-83. Un radionúclido de diagnostico típico emite partículas y/o positrones que tienen entre 25-10,000 keV. Además, los radionúclidos terapéuticos adecuados, incluyen pero no se limitan a ln-111, Lu-177, Bi-212, Bi-213, At-211, Cu-62, Cu-64, Cu-67, Y-90, 1 -125, 1 -131 , P-32, P-33, Sc-47, Ag-111, Ga-67, Pr-142, Sm-153, Tb-161, Dy-166, Ho-166, Re-186, Re-188, Re-189, Pb- 212, Ra-223, Ac-225, Fe-59, Se-75, As-77, Sr-89, Mo-99, Rh-105, Pd-109, Pr-143, Pm-149, Er-169, lr-194, Au-198, Au-199, Ac-225 y Pb-211. Un catión terapéutico típico emite partículas y/o positrones que tienen entre 20-10,000 keV.
Las energía de decaimiento máximas de núclidos de emisión de partículas beta útiles son preferentemente de 20-5,000 keV, más preferentemente 100-4,000 keV, y lo más preferentemente 500-2,500 keV. También preferidos son los radionúclidos que sustancialmente decaen con partículas de emisión Auger. Por ejemplo, Co-58, Ga-67, Br-80m, Tc-99m, Rh-103m, Pt-109, ln-111, Sb-119, 1 -125, Ho-161, Os-189m y lr-192. Las energías de decaimiento de núclidos de emisión de partículas Auger útiles son preferentemente < 1,000 keV, más preferentemente < 100 keV, y lo más preferentemente < 70 keV. También preferidos son los radionúclidos que decaen sustancialmente con la generación de partículas alfa. Dichos radionúclidos incluyen, pero no se limitan a Dy-152, At-211, Bi-212, Ra-223, Rn-219, Po-215, Bi-211, Ac-225, Fr-221, At-217, Bi-213 y Fm-255. Las energías de decaimiento de radionúclidos de emisión de partículas alfa útiles son preferentemente de 2,000-10,000 keV, más preferentemente 3,000-8,000 keV, y lo más preferentemente 4,000-7,000 keV.
Otros agentes terapéuticos útiles incluyen metales, tales como los que son parte de una terapia fotodinámica, y núclidos, tales como los valiosos en terapias basadas en procedimientos de captura de neutrones. Específicamente, el zinc, aluminio, galio, lutetio y paladio son útiles para terapia fotodinámica B-10, Gd-157 y U-235 son útiles para terapia de captura de neutrones.
En una modalidad, los metales pueden ser utilizados como agentes de diagnóstico, incluyendo los que son para técnicas de generación de imagen de resonancia magnética. Estos metales, incluyen, pero no se limitan a: gadolinio, manganeso, hierro, cromo, cobre, cobalto, níquel, disprosio, renio, europio, terbio, holmio y neodimio. Con el objeto de cargar un componente de anticuerpo con metales radioactivos o iones paramagnéticos, pueden ser necesarios hacerlo reaccionar con un reactivo que tenga una cola larga a la cual se adhiera una multiplicidad de grupos de quelación para enlazar los iones. Por ejemplo, dicha cola puede ser un polímero tal como una polilisina, polisacárido u otra cadena derivada o que se puede derivar que tiene grupos colgantes a los cuales se pueden enlazar grupos de quelación, tales como, por ejemplo, ácido etilenodiaminotetra-acético (EDTA), ácido dietilenotriaminopenta-acético (DTPA), porfirinas, poliaminas, éteres corona, bis-tiosemicarbazonas, polioximinas y grupos similares conocidos por ser útiles para este propósito. Además, los quelados pueden ser acoplados a los antígenos de péptidos utilizando químicas estándar. El quelado puede ser enlazado al anticuerpo a través de un grupo el cual permite la formación de un enlace a la molécula con una pérdida mínima de inmuno-reactividad y una agregación y/o reticulación interna mínima. Otros métodos y reactivos para conjugar quelados a anticuerpos se describen en la patente Norteamericana No. 4,824,659 de Hawthorne, titulada "Conjugados de Anticuerpo," presentada 25 de abril de 1989, cuya descripción está incorporada en su totalidad a la presente invención como referencia. En una modalidad particular, las combinaciones de metal-quelado útiles pueden incluir pero no se limitan a 2-bencil-DTPA y sus análogos de monometilo y ciciohexilo, utilizados con isótopos de diagnóstico en el rango de energía general de 20 a 2,000 keV. Los mismos quelados, cuando se hacen en compuesto con metales sin radioactivo tales como manganeso, hierro y gadolinio, son útiles para MRI, cuando se utilizan junto con los anticuerpos de las modalidades aquí descritas. Los quelados macrocíclicos tales como NOTA, DOTA y TETA pueden utilizarse con una variedad de metales y radiometales, más particularmente con radionúclidos de galio, itrio y cobre, respectivamente. Dichos complejos de metal-quelado pueden elaborarse en forma muy estable diseñando el tamaño del anillo para el metal de interés. Otros quelados tipo anillo tales como poliéteres macrocíclicos, los cuales son de interés para enlazar en forma estable núclidos, tales como 223Ra para RAIT, están comprendidos a través de las modalidades de la presente invención.
En una modalidad de la presente invención, los inmunoconjugados terapéuticamente útiles pueden ser obtenidos conjugando agentes fotoactivos o tintas a un compuesto de anticuerpo. Los materiales fluorescentes y otros cromógenos, o tintas, tales como porfirinas sensibles a luz visible, se han utilizados para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto ha sido denominado fotorradiación, fototerapia o terapia fotodinámica (Jori y asociados, eds., Photodynamic Therapy of Tumors and Other Diseases (Librería Progetto 1985); van den Bergh, Chem, Britain 22: 430,1986). Además, se han acoplado anticuerpos monoclonales con tintas fotoactivadas para lograr la fototerapia Mew y asociados, J. Immunol. 130: 1473, 1983; idem., Cáncer Res. 45: 4380, 1985; Oseroff y asociados, Proc. Nati Acad. Sci. E.U.A. 83: 8744, 1986; idem., Photochem. Photobiol 46:83, 1987; Hasan y asociados, Prog, Clin. Biol. Res. 288: 471, 1989; Tatsuta y asociados, Lasers Surg. Med. 9:422, 1989; Pelegrin y asociados, Cáncer 67:2529, 1991. Sin embargo, estos estudios anteriores no incluyen el uso de aplicaciones de terapia endoscópica, especialmente con el uso de fragmentos o sub-fragmentos de anticuerpo. Por lo tanto en una modalidad de la presente invención, se contempla el uso terapéutico de inmunoconjugados que comprenden agentes o tintas fotoactivas.
Los iones paramagnéticos adecuados para utilizarse en modalidades de la presente invención incluyen pero no se limitan a cromo (lll), manganeso (II), hierro (lll), hierro (II), cobalto (II), níquel (II), cobre (II), neodinimio (Hl), samario (lll), itterbio (lll), gadolinio (III), vanadio (II), terbio (III), disprosio (lll), holmio (lll) y erbio (III), con gadolinio siendo particularmente preferido.
Los iones útiles en otros contextos, tales como generación de imágenes de rayos X, incluyen pero no se limitan a tolantano (lll), oro (lll), cobre (II), y especialmente bismuto (lll). Las etiquetas fluorescentes incluyen rodamina, fluorescencia y renografina. La rodamina y fluorescencia con frecuencia son enlazadas a través de un intermediario de isotiacianato. Se utilizan materiales radiopacos y de contraste para intercambiar rayos X y tomografía computarizada, e incluyen compuestos de yodo, compuestos de bario, compuestos de galio, compuestos de talio, etc. Dichos compuestos específicos incluyen bario, diatrizoato, aceite de etiodized, citrato de galio, ácido iocármico, ácido iocetámico, yodamina, yodiparmida, ácido yodoxámico, iogulamida, iohexol, iopamidol, ácido iopanoico, ácido ioprocémico, ácido iosefámico, ácido iosérico, meglumina de iosulamida, ácido iosemético, iotasul, ácido iotétrico, ácido iotalámico, ácido iotróxico, ácido ioxaglico, ácido ioxotrizoico, ipodato, meglumina, metrizamida, metrizoato, propilyodona, y cloruro de talo. Por lo tanto, en otra modalidad, se puede proporcionar una composición terapéutica, farmacéutica o de diagnóstico que comprenda un anticuerpo aquí descrito, en combinación con un excipiente, diluyente o vehículo farmacéuticamente aceptable.
En otra modalidad de la presente invención, se puede proporcionar un proceso para la preparación de una composición terapéutica, farmacéutica o de diagnostico que comprende mezclar en adiciones un anticuerpo descrito en la presente invención junto con un excipiente, diluyente o vehículo farmacéuticamente aceptable.
Los anticuerpos y composiciones pueden ser para la administración en cualquier forma adecuada y cantidad de acuerdo con la terapia en la cual se empleen.
En una modalidad, la composición terapéutica, farmacéutica o de diagnóstico, puede tomar cualquier forma adecuada para inhalación, y preferentemente, está en una forma adecuada para administración parenteral, por ejemplo, mediante inyección o infusión, por ejemplo mediante inyección de bolo o infusión continua. Cuando el producto es para inyección o infusión, puede tomar la forma de una suspensión, solución o emulsión en un vehículo aceitoso o acuoso y puede contener agentes de formulación tales como agentes de suspensión, conservación, estabilización y/o dispersión. Como alternativa, el anticuerpo o composición pueden estar en forma seca, para reconstitución antes de utilizarse con un líquido estéril adecuado.
En la presente invención se contempla que los usos terapéuticos y de diagnostico pueden comprender administrar una cantidad efectiva de un anticuerpo de acuerdo con las modalidades aquí descritas a un sujeto humano. La dosis exacta que será administrada variará de acuerdo con el uso del anticuerpo y con la edad, sexo y condición del paciente, pero normalmente variará de aproximadamente 0.1 mg hasta 1000, por ejemplo desde aproximadamente 1 mg hasta 500 mg. El anticuerpo puede administrarse como una dosis simple o en una forma continua durante un período de tiempo. Las dosis pueden repetirse según sea lo adecuado.
En un ejemplo, los anticuerpos y composiciones aquí descritas pueden utilizarse para administración en cualquier forma adecuada y cantidad de acuerdo con la terapia en la cual se empleen. La dosis en la cual se administra el anticuerpo depende de la naturaleza de la condición que será tratada y de sí el anticuerpo está siendo utilizado en forma profiláctica o para tratar una condición existente.
La dosis también será seleccionada de acuerdo con la edad y condiciones del paciente. Una dosis terapéutica de anticuerpos puede ser, por consiguiente, por ejemplo entre preferentemente 0.1-25 mg/kg de peso corporal por dosis terapéutica simple y lo más preferentemente entre 0.1-10 mg/kg de peso corporal por dosis terapéutica simple.
En una modalidad, un anticuerpo aquí descrito puede ser formulado de acuerdo con la práctica convencional para administración a través de cualquier ruta adecuada y generalmente puede estar en una forma líquida (por ejemplo, una solución del anticuerpo en un regulador fisiológicamente aceptable) para administración, por ejemplo, a través de una ruta intravenosa, intraperitoneal, subcutánea o intramuscular.
Un "inmunoconjugado" aquí contemplado es un anticuerpo, proteína de fusión o fragmento del mismo conjugado al menos para un agente terapéutico y/o de diagnostico/detección. El agente de diagnóstico/detección puede incluir un radionúclido o no radionúclido, un agente de contraste (tal como generación de imagen de resonancia magnética, tomografía computarizada o ultrasonido) y el radionúclido puede ser un isótopo de emisión gamma, beta, alfa, electrón Auger o positrón.
Tal como se utiliza en la presente invención, el término "proteína de fusión de anticuerpo" es una molécula de enlace de antígeno producida en forma recombinante en la cual dos o más de los mismos o diferentes anticuerpos naturales, anticuerpos de cadena simple o segmentos de fragmentos de anticuerpo con las mismas o diferentes especificidades son producidos. La valencia de la proteína de fusión indica el número total de brazos de enlace o sitios que la proteína de fusión tiene con un antígeno o epítope; es decir, monovalente, bivalente, trivalente o multivalente. La multivalencia de una proteína de fusión de anticuerpo significa que puede tener la ventaja de múltiples interacciones en el enlace a un antígeno, incrementando de esta forma la avidez de enlace al antígeno. La especificidad indica cómo muchos antígenos o epítopes tiene una proteína de fusión de anticuerpo la capacidad de enlazar a ellos; es decir, monoespecífico, bis-específico, tri-específico o multi-específico. Utilizando estas definiciones, un anticuerpo natural, por ejemplo un IgG, es bivalente debido a que tiene dos brazos de enlace pero es monoespecífico debido a que enlaza a un antígeno. Las proteínas de fusión multivalente, monoespecíficas tienen más de un sitio de enlace para un epítope, pero únicamente enlazan con el mismo epítope en el mismo antígeno, por ejemplo un diacuerpo con dos sitios de enlace reactivos con el mismo antígeno. La proteína de fusión puede incluir una combinación multivalente o multiespecífica de diferentes componentes de anticuerpos múltiples copias del mismo componente de anticuerpo. La proteína de fusión puede incluir además un agente terapéutico, los ejemplos de agentes terapéuticos adecuados para dichas proteínas de fusión incluyen inmunomoduladores ("proteína de fusión anticuerpo-inmunomodulador") y toxinas ("proteína de fusión anticuerpo-toxina"). Una toxina preferida comprende una ribonucleasa (RNasa), preferentemente una RNasa recombinante.
En otra modalidad, se puede lograr un enlace selectivo utilizando un enlazador heterobifuncional tal como éster de maleimida-hidroxisuccinimida. La reacción del éster con un anticuerpo o fragmento puede derivar grupos aminos en el anticuerpo o fragmento, y el derivado posteriormente puede hacerse reaccionar, por ejemplo, con un fragmento Fab de anticuerpo que tiene grupos sulfhidrilo libres (o un fragmento más grande o anticuerpo intacto con grupos su If i h id ri lo adheridos al mismo, mediante por ejemplo reactivo de Traut). Dicho enlazador es menos probable que reticule grupos en el mismo anticuerpo y mejore la selectividad del enlace.
En una modalidad particular, los anticuerpos o fragmentos aquí descritos pueden ser enlazados a sitios remotos de los sitios de enlace de antígenos. Esto se puede lograr, por ejemplo, a través de enlace a los grupos sulfihidrilo de intercadena disociados, tal como se observó anteriormente.

Otro método comprende hacer reaccionar un anticuerpo que tiene una porción de carbohidrato oxidada con otro anticuerpo el cual tiene al menos una función de amina libre. Esto da como resultado un enlace de base Schiff (imina) inicial, el cual es estabilizada preferentemente mediante reducción a una amina secundaria, por ejemplo, mediante reducción de borohidruro, para formar el producto final. Dichos enlaces específicos de sitios se describen, para moléculas pequeñas, en la patente Norteamericana No. 4,671,958, y para adendos más grandes en la patente Norteamericana No. 4,699,784.
Los puentes de disulfuro de intercadena del fragmento F(ab') 2 que tiene especificidad objetivo pueden reducirse con cisteína, evitando el enlace de cadena ligera-pesada, para formar fragmentos Fab'-SH fragmentos. El grupo(s) el SH grupo(s) puede activarse con el exceso de enlazador de bis-maleimida (1,1'-15(metilenodi-4,1-fenilen)bís-malemida).
En una modalidad, los anticuerpos hL243 aquí descritos, así como otras moléculas de enlace con diferentes especificidades se pueden utilizar en terapia de combinación. Por ejemplo, los anticuerpos multi-específicos pueden incluir al menos un sitio de enlace para un epítope reconocido por el anticuerpo monoclonal de murino mL243, o antígeno, y al menos un sitio de enlace a otro epítope reconocido por el anticuerpo monoclonal de murino mL243, u otro antígeno. Además, los anticuerpos multivalentes (incluyendo múltiples sitios de enlace para el mismo epítope o antígeno) o los anticuerpos pueden ser tanto multivalentes como multi-específicos.
En una modalidad particular, una molécula de enlace puede ser una proteína de fusión. En una modalidad más particular, la proteína de fusión puede contener cuatro o más Fvs o Fab's de anticuerpos o fragmentos L243 humanizados, quiméricos, humanos o de murino tal como se describe en la presente invención. En otra modalidad, una proteína de fusión de anticuerpos puede contener uno o más Fvs o Fab's de los mAbs o fragmentos de L243 MAb humanizados, quiméricos, humanos o de murino tal como se describe en la presente invención. De acuerdo con estas modalidades, uno o más Fvs o Fab's de anticuerpos específicos de otro antígeno que es específico para un marcador celular, además del antígeno HLA, pueden ser incluidos. Por ejemplo, el antígeno sin HLA puede incluir un marcador de tumor seleccionado de antígeno de linaje de célula-B (por ejemplo CD19, CD20, o CD22 para el tratamiento de malignidades de célula-B). En otro ejemplo, el antígeno sin HLA puede también ser expresado en otras células que originan otros tipos de malignidades, tales como SI 00 en melanoma, etc. Además, el marcador celular puede ser un antígeno de linaje de célula no-B, tal como se selecciona del grupo que consiste en HLA-DR, CD30, CDS3, CD52, CD66, MUCI y TAC.
En una modalidad, el anticuerpo L243 descrito en la presente invención puede ser combinado con otros anticuerpos y utilizado para tratar a un sujeto que tiene o que se sospecha que está en desarrollo de una enfermedad. De acuerdo con esta modalidad, un anticuerpo L243 o composición de la misma puede combinarse con un anticuerpo monoclonal anti-cáncer tal como un anticuerpo monoclonal humanizado (por ejemplo hA20 (CD20 Mab)) y utilizarse para tratar cáncer. En una o más particular, un anticuerpo HLA-DR de L243 puede combinarse con un anticuerpo monoclonal anti-cáncer (por ejemplo hA20) y utilizarse para tratar a un sujeto que se tiene sospecha que puede desarrollar una enfermedad. En la presente invención se contempla que un anticuerpo hL243 se puede utilizar como una composición de anticuerpo separado en combinación con una o más de otras composiciones de anticuerpos separadas, así como también utilizarse como un anticuerpo bi-funcional por ejemplo uno de hL243 y el otro de hA20. De acuerdo con esta modalidad, el anticuerpo hL243 puede ser el HLA-DR de hL243. En otra modalidad particular, la enfermedad puede incluir dirigirse a una enfermedad de malignidad de célula-B en un sujeto que tiene dicha enfermedad. La malignidad de célula-B puede consistir en formas indolentes de linfomas de célula-B, formas agresivas del linfoma de célula-B, leucemias linfáticas crónicas, leucemias linfáticas agudas, macroglobulinemia de Waldenstrom, y mieloma múltiple. También existen trastornos de célula-B no malignos y enfermedades relacionadas, tales como muchas enfermedades de reguladoras inmunes y auto-inmunes, incluyendo septicemia y choque séptico, entre enfermedades de regulación inmune (ver también la solicitud Provisional Norteamericana No. 60/634,076 presentada el 8 de diciembre de 2004, por Goldenberg y Hansen, e incorporada en su totalidad a la presente invención como referencia. En particular, las composiciones aquí descritas son particularmente útiles para el tratamiento de varias enfermedades auto-inmunes, así como formas indolentes de linfomas de célula-B, formas agresivas de linfomas de célula-B, leucemia linfática crónicas, leucemias linfáticas agudas, mieloma múltiple y macroglobulinemia de Waldenstrom, así como otras malignidades hematopoyéticas, tales como leucemias mieloides crónicas y leucemias de células-T y linfomas. Por ejemplo, los componentes del anticuerpo hL243 e inmuno-conjugados puedan utilizarse preferentemente para tratar formas indolentes y agresivas de linfomas de no Hodgkin y leucemias linfoides.
Los antígenos asociados con tumor que pueden ser dirigidos incluyen, pero no se limitan a A3, antígeno específico para anticuerpo A33, antígeno-BrE3, CD1, CD1a, CD3, CD5, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD45, CD74, CD79a, CD80, HLA-DR, NCA 95, NCA90, HCG y sus subunidades, CEA (CEACAM-5), CEACAM-6, CSAp, EGFR, EGP-1, EGP-2, Ep-CAM, Ba 733, HER2/neu, factor inducible por hipoxia (HIF), KC4-antígeno, KS-1 -antígeno, KS1-4, Le-Y, factor inhibición de macrófago de (MIF), MAGE, MUC1, MUC2, MUC3, MUC4, PAM-4-antígeno, PSA, PSMA, RS5, S100, TAG-72, p53, tenascin, IL-6, IL-8, factor de crecimiento de insulina-1 (IGF-I), antígeno Tn, antígenos Thomson-Friedenreich, antígenos de necrosis de tumor, VEGF, 17-1 A-antígeno, un marcador de angiogénesis (por ejemplo, fibronectin ED-B), un marcador de oncógeno, un producto de oncógeno y otros antígenos asociados con tumor. Los reportes recientes con respecto a antígenos asociados con tumor incluyen la publicación de Mizukami y asociados, (2005, Nature Med. 11:992-97); Hatfield y asociados, (2005, Curr. Cáncer Drug Targets 5:229-48); Vallbohmer y asociados (2005, J. Clin. Oncol. 23:3536-44) y Ren y asociados (2005, Ann. Surg. 242:55-63), cada una incorporada a la presente invención como referencia.
Además, otra modalidad de la presente invención puede incluir anticuerpos bi-específicos o multi-específicos para preparar ¡nmunoconjugados y composiciones. De acuerdo con estas modalidades, los anticuerpos L243 o fragmentos o proteínas de fusión de anticuerpos de los mismos pueden enlazarse a un anticuerpo o fragmento de anticuerpo especifico para una sustancia marcadora de cáncer, un epítope en la superficie de un organismo de enfermedad infecciosa, una sustancia nociva en la sangre u otros fluidos corporales. Los anticuerpos bio-específicos y multi-específicos pueden ser útiles para inducir el despeje de una variedad de sustancias nociva. Por ejemplo, un anticuerpo bio-específico puede tener una o más especificidades para una sustancia nociva, tal como un organismo patógeno, y una o más especificidades para HLA-DR, la cadena invariante HLA clase-ll (li). La cadena invariante HLA clase-ll (li) se describe con detalle en la Serie Norteamericana No. 09/314,135, presentada el 19 de mayo de 1999, titulada "Terapéutico que Utiliza un Anticuerpo Bio-especifico", la cual está incorporada en su totalidad a la presente invención como referencia.
En otra modalidad, los inmunoconjugados y composiciones aquí descritos también pueden incluir un anticuerpo multivalente L243 de acuerdo con esta modalidad, una proteína de enlace de objetivo multivalente puede construirse mediante la asociación de un primer y un segundo polipéptido. El primer polipéptido puede incluir una primera molécula de cadena simple Fv enlazada en forma covalente a un primer dominio tipo de inmunoglobulina que es preferentemente un dominio de región variable de cadena ligera de inmuno-globulina. El segundo polipéptido puede incluir una segunda molécula de cadena simple Fv enlazada en forma covalente a un segundo dominio tipo inmunoglobulina que es preferentemente un dominio de región variable de cadena pesada de inmunoglobulina. Cada una de las primeras y segundas moléculas de cadena simple Fv forma un sitio de enlace objetivo, y el primero y segundo dominios tipo inmunoglobulina se asocian para formar un tercer sitio de enlace objetivo.
En una modalidad alternativa, se puede utilizar un anticuerpo monoclonal L243 humanizado, quimérico o humano para producir diacuerpos, triacuerpos y tetracuerpos específicos de antígenos. Por ejemplo, los diacuerpos, triacuerpos y tetracuerpos mono-específicos pueden enlazar en forma selectiva a antígenos dirigidos y conforme incrementa el número de sitio de enlace en la molécula, incrementa la afinidad para la célula objetivo y se observa un tiempo de residencia más largo en la ubicación deseada. Para diacuerpos, las dos cadenas que comprenden el polipéptido VH del L243 mAb humanizado conectado al polipéptido VK humanizado L243 mAb humanizado a través de un enlazador de cinco residuos de aminoácidos puede ser utilizado. Cada cadena forma una mitad del diacuerpo L243 humanizado. En el caso de triacuerpos, las tres cadenas que comprenden el polipéptido VH del L243 MAb humanizado conectado al polipéptido VK del L243 MAb humanizado a través de un no enlazador, pueden ser utilizadas. Cada cadena forma una tercera parte del triacuerpo hL243.
En otra modalidad, los inmunoconjugados y composiciones aquí descritos también pueden incluir anticuerpos de cadena simple bioespecíficos funcionales (bscAb) (ver por ejemplo la publicación de Mack y asociados, Proc. Nati. Acad. Sci. E.U.A., 92:7021-7025, 1995, incorporada a la presente invención como referencia). Por ejemplo se puede producir bscAb uniendo dos fragmentos de cadena simple Fv a través de un enlazador de glicina-serina utilizando métodos recombinantes. Los dominios de cadena ligera V (VL) y cadena pesada V (VH) de dos anticuerpos de interés, se pueden aislar utilizando métodos PCR estándar. Los ADNcs VL y VH de cada hibridoma, pueden unirse para formar un fragmento de cadena simple en un PCR de fusión de dos pasos. En un ejemplo, el primer paso PCR introduce el enlazador (Gly4-Ser1 )3, y el segundo paso une los amplicones VL y VH. Cada molécula de cadena simple puede ser clonada en un vector de expresión bacterial. Después de una amplificación, una de las moléculas de cadena simple puede ser cortada y subclonada en el otro vector, que contiene la segunda molécula de cadena simple de interés. Posteriormente, el fragmento bscAb puede ser sub-clonado en un vector de expresión eucariótico. La expresión de proteína funcional puede obtenerse transfectando el vector en células de Ovario de Hámster Chino. Se preparan otras proteínas de fusión bio-específica en una forma similar. Los anticuerpos de cadena simple bioespecíficos y proteínas de fusión bio-específicas pueden utilizarse para preparar los vehículos de fármaco.
Además, una modalidad puede incluir un diacuerpo tándem tetravalente (denominado tandab) con especificidad doble (Cochlovius y asociados, Cáncer Research (2000) 60: 4336-4341). Un tandab bioespecífico es un dímero de dos polipéptidos idénticos, comprendiendo cada uno cuatro dominios variables de dos diferentes anticuerpos (VH1, VL1, VH2, VL2) enlazados en una orientación para facilitar la formación de dos sitios de enlace potencial para cada una de las dos diferentes especificidades al momento de la auto-asociación.
En otra modalidad, el anticuerpo L243 myltivalente conjugado puede utilizarse para preparar el inmuno-conjugado o composición. Se pueden agregar residuos de aminoácido adicionales ya sea al N-término o C-término del primer y el segundo polipéptido. Los residuos de aminoácido adicionales pueden comprender una etiqueta de péptido, una señal de péptido, una citocina, una enzima (por ejemplo una enzima de activación de pro-fármaco) una hormona o un oligonucleótido, un ARN de interferencia, una toxina de péptido, tal como exotocina de Pseudomona, un fármaco de péptído, una proteína citotóxica u otras proteínas funcionales. Tal como se utiliza en la presente invención, una proteína funcional es una proteína que tiene una función biológica.
Aún en otra modalidad, el anticuerpo hL243, o fragmentos del mismo, se pueden utilizar para preparar un complejo de proteína polivalente, una proteína de fusión de anticuerpo novedosa que comprende tres o cuatro sitios de enlace de antígenos. De acuerdo con estas modalidades, uno o más sitios de enlace de antígenos pueden estar compuestos de los dominios variables hL243 y uno o más de los sitios de enlace de antígenos restantes pueden incluir dominios variables de otros anticuerpos específicos de antígenos, según se desee. Dichos complejos de proteína polivalentes se describen en la publicación PCT WO04094613A2 (Rossi y asociados, 2004). Cuando se combinan con una cadena variable de anticuerpo específica de antígeno adecuada, un complejo de proteína polivalente que comprende un dominio variable hL243, se puede utilizar para tratar una variedad de trastornos neoplásticos, infecciosos, metabólicos, neurodegenerativos, autoinmunes o de desregulación inmune.
En una modalidad de la presente invención, se pueden conjugar a una proteína de enlace objetivo multivalente, fármacos, toxinas, compuestos radioactivos, enzimas, hormonas, proteínas citotóxicas, oligonucleótidos ARNs de interferencia (por ejemplo moléculas ARNi) quelados, citocinas y otros agentes funcionales. De acuerdo con estas modalidades, las adiciones covalentes a estas cadenas de los residuos de aminoácido de la proteína de enlace objetivo multivalente pueden utilizarse, por ejemplo, grupos amina, carboxilo, fenilo, tiol o hidroxilo. Se pueden utilizar varios enlazadores convencionales para este propósito, por ejemplo, di-isocianatos, di-isotiocianatos, esteres de bis(hidroxisuccinimida), carbodi-imidas, esteres de maleimida-hidroxisuccinimida, glutaraldehído y similares. La conjugación de agentes para la proteína multivalente, preferentemente no afecta en forma significativa la especificidad de enlace de proteína o afinidad a su objetivo. Tal como se utiliza en la presente invención, un agente funcional es un agente el cual tiene una función biológica. Un agente funcional preferido es un agente citotóxico.
Aún en otra modalidad, la administración de terapéuticos o polímeros de profármacos dirigidos por el anticuerpo bíoespecífico a objetivos in vivo, se puede combinar con la administración de anticuerpos bioespecíficos de radionúclidos, de modo que se logre la combinación de quimioterapia y radio-inmunoterapia. Cada agente terapéutico puede ser conjugado a un conjugado dirigible y administrado en forma simultánea, o el núclido puede ser administrado como parte de un primer conjugado dirigible y el fármaco determinado en el último paso como un segundo conjugado dirigible. Los conjugados y fármacos dirigibles adecuados son conocidos en la técnica.
En otra modalidad, se pueden conjugar agentes citotóxicos a un vehículo polimérico, y el vehículo polimérico puede ser conjugado subsecuentemente a la proteína de enlace objetivo multivalente. Para este método, ver la publicación de Ryser y asociados, Proc. Nati. Acad. Sci. E.U.A., 75:3867-3870,1978, patente Norteamericana No. 4,699,784 y patente

Norteamericana No. 4,046,722, las cuales están incorporadas a la presente invención como referencia. La conjugación preferentemente no afecta en forma significativa la especificidad de enlace o afinidad de las proteínas de enlace multivalentes.
Anticuerpos Humanizados, quiméricos y Humanos Utilizados para Tratamiento y diagnóstico
Los anticuerpos monoclonales humanizados, quiméricos, y humanos aquí descritos, son adecuados para utilizarse en métodos terapéuticos y métodos de diagnóstico que utilizan en monoconjugados y composiciones tal como se describen en la presente invención. Por consiguiente, los inmunoconjugados o composiciones pueden incluir anticuerpos, humanizados, quiméricos y humanos descubiertos o anticuerpos que pueden ser conjugados a un vehículo, a un agente terapéutico o un agente de diagnóstico. Los inmunoconjugados pueden administrarse como una terapia multimodal. Por ejemplo, los agentes terapéuticos o de diagnóstico adicionales pueden administrarse antes, en forma simultánea o después de la administración del inmunoconjugado o composición. La eficacia de los inmunoconjugados o composiciones pueden aumentarse suplementando los inmunoconjugados o composiciones L243 humanizados, quiméricos y humanos con uno o más de otras moléculas de enlace (por ejemplo, mAbs para antígenos específicos, tales como CD4, CDS, CD8, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUC1, MUC2, MUC3, MUC4, MUC16, NCA66, antígenos necrosis, PAM-4, KS-I, Le(y), MAGE, 1a, IL-2, IL-6, tenascin, HM1.24, VEGF, EGFR, EGP-1, EGP-2, receptor de folato, gonadotropina coriónica humana, antígeno-p específica de colon (CSAp), factor de crecimiento tipo insulina (ILGF), factor de crecimiento de placenta (PIGF), fosfatasa de ácido prostético, PSA, PSMA, T101, TAG, TAG-72, Her2/neu, anhidrasa carbónica IX, IL-6, S100, alfa-fotoproteína, A3, CA125, antígeno carcinoembriónico (CEA), antígeno de reacción cruzada no específicos tales como CD66 (a,b,c,d), MART-1, TRP-1, TRP-2, gplOO, amiloides con anticuerpos hL243, o inmunoconjugados de los mismos, o anticuerpos para estos antígenos mencionados). Los antígenos asociados con célula-B preferidos incluyen los equivalentes a antígenos CD19, CD20, CD21, CD22, CD23, CD46, CD52, CD74, CD80, y CDS humanos. Los antígenos de célula-T preferidos incluyen los equivalentes a antígenos CD4, CDS y CD25 humanos (el receptor IL-2).
Como alternativa, la molécula sustituía para un antígeno HLA-DR puede utilizarse en el tratamiento de trastornos tanto de célula B como de célula T. En una modalidad particular, los antígenos de célula-B pueden ser equivalentes a antígenos CD19, CD22, CD21, CD23, CD74, CD80, y HLA-DR humanos. En otra modalidad particular, los antígenos de célula-T equivalentes a antígenos CD4, CDS y CD25 pueden ser utilizados. Como alternativa, se pueden utilizar antígenos CD46 y CD59 en la superficie de células cancerígenas que bloquean la lisis dependiente del complemento (CDC). En una modalidad, se pueden utilizar antígenos asociados con melanoma maligno, tales como equivalentes a MART-1, TRP-1, TRP-2 y gplOO. Además, en una modalidad en particular, los antígenos asociados a mieloma múltiples son los equivalentes a MUC1 , CD38, y CD74.
En un ejemplo, la molécula de enlace es suplementaria puede ser descubierta o conjugada con un vehículo, un gente terapéutico, agente de diagnóstico, incluyendo lípidos, polímeros, fármacos, toxinas, inmunomodulares, hormonas, enzimas oligonucleótidos, ARNs de interferencia y radionúclidos terapéuticos, etc. De acuerdo con esta modalidad, la molécula de enlace suplemental puede administrase en forma concurrente, en secuencias o de acuerdo con un régimen de dosificación pre-escrito, con los inmunoconjugados o composiciones L243 humanizados, quiméricas y humanas.
Además, la administración de un inmunoconjugado o composición para usos de diagnóstico o terapéuticos en linfomas de célula B, linfomas de célula T, y otras enfermedades o trastornos se contempla en la presente invención. Un inmunoconjugado, tal como se describe en la presente invención, puede ser una molécula que incluye una molécula de enlace conjugada a un vehículo. De acuerdo con esta modalidad, el inmunoconjugado puede utilizarse para formar una composición que incluye además un agente terapéutico de diagnóstico, el cual puede incluir un péptido que puede contener el agente de diagnóstico o terapéutico. Un inmunoconjugado retiene la ínmunoreactividad de la molécula de enlace (por ejemplo la porción de anticuerpo que tiene aproximadamente la misma capacidad o una ligeramente reducida para enlazar al antígeno cognato después de la conjugación tal como antes de la conjugación). Los inmunoconjugados pueden incluir moléculas de enlace conjugadas para cualquier segunda molécula adecuada (por ejemplo, lípidos, proteínas, carbohidratos que pueden formar estructuras ordenadas en forma superior, o estructuras ordenadas en forma superior por sí misma, tales como liposomas, mícelas y/o nanopartículas). Para facilitar la administración de ciertos efectores, puede ser recomendable conjugar el anticuerpo hL243 a una o más moléculas que tienen la capacidad de formar estructuras ordenadas en forma superior (por ejemplo, lípidos anfifílicos). Las moléculas anfifílicas también pueden ser recomendables para facilitar la administración de efectores que demuestran solubilidad limitada en soluciones acuosas.
En otra modalidad, se puede utilizar una amplia variedad de reactivos de diagnostico y terapéuticos para formar las composiciones e inmunoconjugados aquí descritos. Los agentes terapéuticos incluyen, por ejemplo, fármacos quimioterapéuticos tales como alcaloides vinca, antraciclinas, epidofilotoxinas, taxanos, antimetabolitos, agentes de alquilación, antibióticos, inhibidores Cox-2, anti-mitóticos, agentes anti-angiogénicos y apoptóticos particularmente doxorrubicin, metotrexato, taxol, CPT-11, campotecano y otros de éstas y otras clases de agentes anti-cáncer, y similares. Otros fármacos quimioterapéuticos de cáncer útiles para la preparación de inmunoconjugados y proteínas de fusión de anticuerpos incluyen mostazas de nitrógeno, sulfonatos de alquilo, nitrosoureas, triacenos, análogos de ácido fólico, inhibidores COX-2, análogos de pirimidina, análogos de purina, complejos de coordinación de platino, hormonas y similares. Los agentes quimioterapéuticos adecuados se describen en la publicación de Remington Pharmaceutical Sciences, 19a Edición (Mack Publishing Co. 1995), y en Goodman y Oílman The farmacological Basis of Therapeutics, 7a Edición (MacMillan Publishing Co. 1985), así como ediciones revisadas de estas publicaciones. Otros agentes quimioterapéuticos adecuados, tales como fármacos experimentales se pueden utilizar y son conocidos en la técnica.
Además, en otra modalidad, se puede conjugar un quelador tal como DTPA, DOTA, TETA, o NOTA a uno o más componentes de las composiciones aquí descritas. Como alternativa, un péptido adecuado incluyendo una etiqueta detectable (por ejemplo, una molécula fluorescente) o un agente citotóxico (por ejemplo un metal pesado o radionúclido) pueden asociarse en forma covalente, o no covalente o de otra manera con más componentes de las composiciones tal como se describe en la presente invención. Por ejemplo, un inmunoconjugado terapéuticamente útil puede obtenerse incorporando un agente fotoactivo o tinta, en la composición tal como se describe en la presente invención. Las composiciones fluorescentes, tales como fluorocromo, y otros cromógenos, o tintas, tales como porfirinas sensibles a luz visible, han sido utilizadas para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto ha sido denominado como un fotoradiación, fototerapia o terapia fotodinámica (Jori y asociados (eds.), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Librería Progetto 1985); van den Bergh, Chem. Britain 22:430 (1986)). Además, se han acoplado anticuerpos monoclonales con tintas fotoactivadas para lograr la fototerapia. Mew y asociados, J. Immunol. 130:1473 (1983); idem., Cáncer Res. 45:4380 (1985); Oseroff y asociados, Proc. Nati. Acad. Sci. E.U.A., 83:8744 (1986); idem., Photochem. Photobiol. 46:83, 1987; Hasan y asociados, Prog, Clin. Biol. Res. 288: 471, 1989; Tatsuta y asociados, Lasers Surg. Med. 9: 422, 1989; Pelegrin y asociados, Cáncer 61: 2529, (1991). También se contemplan aplicaciones endoscópicas. Los métodos de detección y terapia endoscópica se describen en las patentes norteamericanas números 4,932,412; 5,525,338; 5,716,595; 5,736,119; 5,922,302; 6,096,289; y 6,387,350, las cuales están incorporadas en su totalidad a la presente invención como referencia.
En una modalidad, se contempla en la presente invención que el uso terapéutico de composiciones de inmunoconjugado hL243 que comprenden agentes fotoactivos o cintas, y los métodos de diagnóstico/terapéuticos de la presente invención pueden incluir el uso de diagnóstico terapéutico de composiciones de inmunoconjugado hL423 que comprenden agentes o cintas fotoactivas. El inmunoconjugado también puede contener agentes de ultrasonido de los tipos descritos anteriormente. También se contempla el uso de agentes radioactivos y no radioactivos como agentes de diagnóstico en las composiciones de inmunoconjugado L423 humanizadas, quiméricas y humanas, tal como se describe en la presente invención. Un agente de diagnóstico no radioactivo adecuado es un agente de contraste adecuado para generación de imágenes de resonancia magnética, tomografía computarizada o ultrasonido. Los agentes de generación de imagen magnética incluyen, por ejemplo, metales no radioactivos, tales como manganeso, hierro y gadolinio, este es un compuesto con combinaciones de metal-quelado que incluyen 2-bencil-DTPA y sus análogos de monometilo y ciciohexilo, cuando se utilizan junto con los anticuerpos aquí descritos. (Ver por ejemplo la serie norteamericana número 09/921,290 presentada el 10 de octubre de 2001, la cual está incorporada en su totalidad a la presente invención como referencia).

En otra modalidad, una composición de inmunoconjugado L423 humanizada, quimérica y humana puede incluir un radioisótopo o un emisor de positrones útil para generación de imágenes de diagnóstico. Los radioisótopos adecuados pueden incluir los que están en un rango de energía de 60 a 4,000 keV. Los radioisótopos adecuados pueden incluir 18-F, 52-Fe, 62-Cu, 64-Cu, 67-Cu, 67-Ga, 68-Ga, 86-Y, 89-Zr, 94-Tc, 94m-Tc, 99m-Tc, 111-ln, 123-1, 124-1, 125-1, 131-1 y similares. (Ver por ejemplo la solicitud de patente norteamericana titulada "etiquetación de agentes de dirección con galio-68" de los inventores G. L. Griffiths y W. J. McBride (solicitud provisional norteamericana No. 60/342,104), la cual describe emisores de positrón, tales como 18-F, 68-Ga, 94m-Tc y similares, con propósitos de generación de imagen y las cuales están incorporadas en su totalidad a la presente invención como referencia).
En otra modalidad de la presente invención, una toxina, tal como exotoxina de Pseudomonas, puede encontrarse en los anticuerpos L243 humanizados, quiméricos y humanos o inmunoconjugados o composiciones de los mismos, tal como se describe en la presente invención. Por ejemplo, la toxina puede hacerse en compuesto con, o formar la parte del agente terapéutico de una proteína de fusión de anticuerpo del anticuerpo hL243 aquí descrito. Otras toxinas incluyen ricín, abrín, ribonucleasa (RNAse), DNAasal, enterotoxina-A estafilococal, proteína antiviral de fitolaca gelonin, peptina de dipterina, exotoxina de pseudomonas y endotoxina de pseudomonas y endotoxina de seudomonas. (Ver por ejemplo la publicación de Pastan y asociados., Cell 47:641 (1986), and Goldenberg, CA - A Cáncer Journal for Clinicians 44:43 (1994). Las toxinas adicionales adecuadas para utilizarse en la presente invención, son conocidas para los expertos en la técnica y se describe en la patente norteamericana número 6,077,499, la cual se ha incorporado en su totalidad a la presente invención como referencia).
Como alternativa, un inmunomodulador, tal como una citocina se puede encontrar en las composiciones de inmunoconjugado hL423 administradas, tal como se describe en la presente invención. Por ejemplo, se puede conjugar un inmunomodulador, o formar la parte del agente terapéutico de una proteína de fusión de anticuerpos o administrarse como parte de las composiciones de inmunoconjugado L423 humanizadas, quiméricas y humanas tal como se describe en la presente invención. Las citocinas adecuadas incluyen, pero no se limitan a, interferonas e interleucinas, tal como se describirá más adelante.
En una modalidad, se puede utilizar a un anticuerpo L243 humanizado como parte de la predirección, de una alternativa altamente selectiva, no inmunogénica para aplicaciones de diagnóstico y terapéuticos, en las cuales se emplea un anticuerpo bi-específíco que reconoce en forma conjunta un antígeno de tumor y uno o más haptenos en la molécula transportadora, en donde la molécula transportadora puede incluir una molécula efectora. Los anticuerpos biespecíficos (bsAb) tienen la ventaja de tener la capacidad de ser construidos como una proteína humanizada relativamente no inmunogénica. La afinidad de enlace de un bsAb puede depender de la afinidad de enlace del agente de dirección primario. Al utilizar un péptido divalente, se puede lograr un aumento de afinidad, lo cual puede mejorar en gran parte el enlace del péptido del sitio objetivo en comparación con un péptido monovalente. Ver por ejemplo la patente norteamericana número No. 5,256,395, cuyos contenidos están incorporados en su totalidad a la presente invención como referencia.
En una modalidad, la predirección con un hL243 bsAb puede incluir un brazo del bsAb derivado de las regiones variables del anticuerpo hL243 tal como se describe en la presente invención, y el segundo brazo del anticuerpo que reconoce una porción que contiene el agente de diagnóstico terapéutico (por ejemplo, un vehículo con un agente de diagnóstico o terapéutico junto con una "construcción dirigible"). Las construcciones dirigibles adecuadas y los métodos de uso se describen en la solicitud de patente norteamericana número 20050002945, cuyos contenidos están incorporados en su totalidad a la presente invención como referencia. La construcción dirigible puede, por ejemplo, ser (i) DOTA-Phe-Lys(HSG)-D-Tyr-Lys(HSG)-NH2; (ii) DOTA-Phe- Lys(HSG)-Tyr-Lys-(HSG)-NH2; o (iii) Ac- Lys(HSG)D-Tyr-Lys(HSG)-Lys(Tscg-Cys)-NH2, aunque los expertos en la técnica podrán apreciar que se pueden utilizar otras construcciones dirigibles. En otros sistemas, la construcción dirigible comprende una porción hapténica que es reconocida por el segundo brazo del anticuerpo y un agente terapéutico o de diagnóstico. Por ejemplo, un agente terapéutico puede ser un agente quimioterapéutico o una toxina, tal como se describió anteriormente.
Una modalidad particular incluye un sistema de predirección descrito por Janevik-lvanovska y asociados., el cual utiliza un anticuerpo dirigido contra el derivado de histamina, histamina-succinilo-glicilo (HSG), como el sistema de reconocimiento en el cual se pueden preparar una variedad de sustancias efectoras. Los anticuerpos L243 humanizados de la presente invención se pueden utilizar en dicho sistema. El sistema de predirección representa una ventaja significativa con respecto a sus sistemas de predirección en cuanto a que se puede utilizar con una variedad de diferentes agentes de generación de imagen o terapéuticos. En un ejemplo, este sistema puede estar basado en el uso de un anticuerpo dirigido contra DTP o HSG y el desarrollo de péptidos que contienen el residuo DTPA o HSG. Se pueden sintetizar péptidos que contienen DTPA que contienen HSG, y cuando el péptido DTPA, el péptido puede ser etiquetado con núclidos quelados, tales como In, Y o Lu, los cuales pueden ser útiles en terapia o diagnósticos. Los anticuerpos han sido generados contra la porción DTPA -. En otras modalidades, el sistema incluye péptidos y haptenos y/o queladores tales como DTPA, y los cuales pueden ser adecuados para la radioetiquetación con 90Y y 177Lu, así como 99mTc.
Preparación de Inmunoconjugados
Los inmunoconjugados aquí descritos pueden prepararse a través de métodos conocidos de enlace de anticuerpo con lípidos, carbohidratos, proteína u otros átomos y moléculas. Por ejemplo, las moléculas de enlace aquí descritas pueden ser conjugadas con uno o más de los transportadores aquí descritos (por ejemplo lípidos, polímeros, liposomas, micelas o nanopartículas) para formar el inmunoconjugado, y el inmunoconjugado puede incorporar un agente terapéutico o de diagnóstico ya sea en forma covalente, no covalente, o de otra forma. Además, se pueden conjugar cualesquiera de las moléculas de enlace aquí descritas, con uno o más agentes terapéuticos o de diagnóstico aquí descritos, y vehículos adicionales. Generalmente, un agente terapéutico o de diagnóstico se puede adherir a cada molécula de enlace, aunque se puede adherir más de un agente terapéutico o agente de diagnóstico a la misma molécula de enlace. En una modalidad, las proteínas de fusión de anticuerpos aquí contempladas pueden incluir dos o más anticuerpos o fragmentos de las mismas y cada uno de los anticuerpos ¡ncluye en esta proteína de fusión, pueden ser conjugados con uno o más de los vehículos aquí descritos. Además, uno o más de los anticuerpos de la proteína de fusión de anticuerpos pueden tener uno o más agentes terapéuticos o de diagnóstico adheridos. Además, el agente terapéutico no necesita ser el mismo, sino que pueden ser agentes terapéuticos diferentes. Por ejemplo, las composiciones aquí descritas pueden incluir un fármaco y un radioisótopo.
En un ejemplo, se puede radioetiquetar IgG con 131-1 y conjugar a un lípido, de modo que el conjugado IgG-lípido pueda formar un liposoma. De acuerdo con este ejemplo, el liposoma puede incorporar uno o más agentes terapéuticos o de diagnóstico (por ejemplo un fármaco tal como FUdR-dO). Como alternativa, además del vehículo, el IgG puede ser conjugado a 131-1 (por ejemplo en un residuo de tirosina) y un fármaco (por ejemplo, en el grupo amino del residuo de lisina) y el vehículo puede incorporar un agente de diagnóstico o terapéutico adicional. Los agentes de diagnóstico y terapéuticos pueden ser asociados covalentemente con la molécula de enlace, (por ejemplo conjugados a grupos de disulfuro reducidos, cadenas laterales de carbohidrato o cualquier otro grupo reactivo en la molécula de enlace.
En otra modalidad, se puede adherir, un vehículo, agente terapéutico o agente de diagnóstico en la región de articulación de un componente de anticuerpo reducido a través de una formación de enlace de disulfuro. Como una alternativa, se pueden adherir péptidos para un componente de anticuerpo utilizando un articulador heterobifuncional, tal como N-succinil 3-(2-piridilditio)proprionato (SPDP). Yu y asociados., Int. J. Cáncer 56: 244 (1994). Las técnicas generales para dicha conjugación son bien conocidas en la técnica. (Ver por ejemplo la publicación de Wong, Chemistry of Protein Conjugation and Cross-linking (CRC Press 1991); Upeslacis y asociados., "Modification of Antibodies by Chemical Methods," en Monoclonal Antibodies Principies and Applications, Birch y asociados, (eds.), páginas 187D230 (Wiley-Liss, Inc. 1995); Price, "Production and Characterization of Synthetic Peptide-Derived Antibodies," en Moniclonal Antibodies: Production, Engineerting and Clinical Application, Ritter y asociados, (eds.), páginas 60D84 (Cambridge University Press 1995)).
Como alternativa, el vehículo, agente terapéutico o el agente de diagnóstico pueden conjugarse a través de una porción de carbohidrato en la región Fc de un anticuerpo. El grupo carbohidrato se puede utilizar para incrementar la carga del mismo péptido que está enlazada al grupo tiol, o la porción de carbohidrato se puede utilizar para enlazar un péptido diferente.
Los métodos para conjugación de péptidos a componentes de anticuerpo a través de una porción de carbohidrato del anticuerpo son bien conocidos para los expertos en la técnica. (Ver por ejemplo las publicaciones de Shih y asociados., hit. J. Cáncer 41 : 832 (1988); Shih y asociados., Int. J. Cáncer 46: 1101 (1990); y Shih y asociados., Patente Norteamericana Número 5,057,313, de las cuales están incorporadas en su totalidad a la presente invención como referencia). Se puede utilizar química similar para conjugar un o más anticuerpos hL243, o componentes de los mismos, a uno o más vehículos, agentes terapéuticos o agentes de diagnóstico. En una modalidad, un método general implica hacer reaccionar un componente de anticuerpo que tiene una porción de carbohidrato oxidada con un polímero transportador que tiene al menos una función de amina libre y que está cargada con una pluralidad de péptidos. Esta reacción da como resultado una base ligadura de base Schiff inicial (imina), la cual puede ser estabilizada mediante reducción a una amina secundaria para formar el conjugado final.
En una modalidad, la región Fc puede estar ausente, por ejemplo, si la molécula de enlace hL423 es un fragmento de un anticuerpo. Como alternativa, se puede introducir una porción de carbohidrato en la región variable de cadena ligera de un anticuerpo de longitud total o fragmento de anticuerpo. (Ver por ejemplo las publicaciones de Leung y asociados., J. Immunol. 154: 5919 (1995); Hansen y asociados., Patente Norteamericana Número 5,443,953 (1995), Leung y asociados., patente norteamericana número 6,254,868 las cuales todas están incorporadas en su totalidad a la presente invención como referencia). De acuerdo con estas modalidades, la porción de carbohidrato construida puede utilizarse para adherir un transportador, un agente terapéutico o de diagnóstico.
Transportadores (lípidos. liposomas, micelas. polímeros v nanopartículas)
Se pueden utilizar cualesquiera de los métodos de formación de liposomas y mícelas y son conocidos en la técnica. (Ver por ejemplo las publicaciones de Wrobel y asociados., Biochimica et Biophysica Acta, 1235:296 (1995); Lundberg y asociados., J. Pharm. Pharmacol., 51:1099-1105 (1999); Lundberg y asociados., Int. J. Pharm., 205:101-108 (2000); Lundberg, J. Pharm. Sci., 83:72-75 (1994); Xu y asociados., Molec. Cáncer Then, 1:337-346 (2002); Torchilin y asociados., Proc. Nati Acad. Sci. USA, 100:6039-6044 (2003); Patente Norteamericana Número 5,565,215; Patente

Norteamericana Número 6,379,698 y la Publocación Norteamericano 2003/0082154). Las nanopartículas o nanocápsulas formadas a partir de polímeros, sílice o metales, que se contemplan en la presente invención para la administración de fármacos o generación de imágenes, han sido descritas en la literatura. (Ver por ejemplo la publicación de West y asociados., Applications of Nanotechnology to Biotechnology, 11:215-217 (2000); Patente Norteamericana Número 5,620,708; Patente Norteamericana Número 5,702,727; y Patente Norteamericana Número 6,530,944).
Inmunoliposomas
Algunos métodos para conjugar anticuerpos o moléculas de enlace a liposomas para formar un vehículo dirigido para agentes terapéuticos o de diagnóstico ya han sido descritos. (Ver por ejemplo las publicaciones de Bendas, Biodrugs, 15:215-224 (2001); Xu y asociados., Molec. Cáncer Ther., 1:337-346 (2002); Torchilin y asociados., Proc. Nati Acad. Sci., 100:6039-6044 (2003); Bally, y asociados., J. Liposome Res., 8:299-335 (1998); Lundberg, Int. J. Pharm., 109:73-81 (1994); Lundberg, J. Pharm. Pharmacol., 49:16-21 (1997); Lundberg, Anti-cancer Drug Design, 13:453-461 (1998)). Ver también la patente norteamericana número 6,306,393; serie norteamericana número 10/350,096; serie norteamericana número 09/590,284, y serie norteamericana número 60/138,284, presentada el 9 de junio de 1999. Todas estas referencias están incorporadas a la presente invención.
Excipientes farmacéuticamente aceptables
En una modalidad, los inmunoconjugados o composiciones pueden incluir uno o más excipientes farmacéuticamente aceptables, uno o más ingredientes seleccionados o combinaciones de los mismos.
En otra modalidad, el inmunoconjugado o composiciones aquí descritas pueden ser formulados de acuerdo con métodos conocidos para preparar composiciones farmacéuticamente útiles, mediante las cuales se combinan el inmunoconjugado o composiciones en una mezcla con un excipiente farmacéuticamente adecuado. La solución regulada por fosfato estéril es un ejemplo de un excipiente farmacéuticamente aceptable. Otros excipientes aceptables son bien conocidos para los expertos en la técnica. (Ver por ejemplo la publicación de Ansel y asociados., Pharmaceutical Dosage Forms and Drug Delivery Systems, quinta edición (Lea & Febiger 1990), y Gennaro (ed), Remington's Pharmaceutical Sciences, dieciochoava edición (Mack Publishing Company 1990), y ediciones revisadas de las mismas.
En otra modalidad, el inmunoconjugado o composiciones aquí descritas pueden ser formuladas para administración intravenosa, por ejemplo, a través de inyección de bolo o infusión continua.
Las formulaciones para inyección se pueden presentar, por ejemplo en forma de dosis unitaria, por ejemplo, en ampolletas o en contenedores de dosis múltiples, con un conservador agregado. Las composiciones pueden tomar formas tales como suspensiones, soluciones o emulsiones en vehículos aceitosos o acuosos, y pueden contener agentes de formulación tales como agentes de suspensión, estabilización y/o dispersión. Como alternativa, el ingrediente activo puede estar en forma de polvo para constitución con un vehículo adecuado, por ejemplo, pirógeno libre de agua estéril, antes de utilizarse. Se pueden emplear métodos farmacéuticos adicionales para controlar la duración de acción de conjugado terapéutico, de diagnóstico o anticuerpo descubierto. Por ejemplo, se pueden preparar preparaciones de liberación controlada a través del uso de polímeros al complejo o adsorber el inmunoconjugado o anticuerpo descubierto. En un ejemplo, los polímeros biocompatibles incluyen matrices de poli(etilen-co-vinil acetato) y matrices de copolímero de polianhídrido de un dímero de ácido esteárico y ácido sebásico. Sherwood y asociados., Bio/Technology 10: 1446 (1992). Algunos de los rangos de liberación de un inmunoconjugado o anticuerpo a partir de dicha matriz depende del peso molecular del inmunoconjugado o anticuerpo, la cantidad de inmunoconjugado, anticuerpo dentro de la matriz, y tamaño de partículas dispersas. Saltzman y asociados., Biophys. J. 55: 163 (1989); Sherwood y asociados., supra. Otras formas de dosificaciones sólidas se describen en la publicación de Ansel y asociados., Pharmaceutical Dosage Forms and Drug Delivery Systems, quinta edición (Lea & Febiger 1990), y Gennaro (ed.), Remington's Pharmaceutical Sciences, dieciochoava edición (Mack Publishing Company 1990), y ediciones revisadas de las mismas.

En una modalidad, el inmunoconjugado o composiciones también se pueden administrar a un mamífero en forma subcutánea o incluso a través de otras rutas parenterales. Además, la administración puede ser mediante infusión continua o mediante bolos simples o múltiples. En un ejemplo, la dosificación de un inmunoconjugado administrado, proteína de fusión o anticuerpo descubierto para humanos, variará dependiendo de factores tales como la edad del paciente, peso, sexo, altura, condición médica general e historial médico previo, etc. En una modalidad particular, al receptor se le puede administrar una dosis de inmunoconjugado o composición incluyendo el inmunoconjugado que esté dentro del rango de aproximadamente 1 mg/kg hasta mg/kg como una infusión intravenosa simple, aunque también se puede administrar una dosis más alta o más baja según lo indiquen las circunstancias. Esta dosificación puede repetirse según sea necesario, por ejemplo, una vez por semanas durante 4 a 10 semanas, preferentemente una vez por semana durante 8 semanas, y más preferentemente, una vez por semana durante 4 semanas. También se puede proporcionar al menos en forma menos frecuente, tal como una semana sí y una no durante varias semanas. La dosificación puede administrarse a través de diversas rutas parenterales, con el ajuste adecuado de la dosis y el programa.
En una modalidad, para propósitos de terapia, el inmunoconjugado o composición que incluye el inmunconjugado, se administra a un mamífero en una cantidad terapéuticamente efectiva. Un sujeto adecuado para los métodos terapéuticos y de diagnósticos aquí descritos puede ser un humano, aunque también se contempla un sujeto animal no humano.
En un ejemplo, se dice que una preparación de anticuerpo será administrada en una "cantidad terapéuticamente efectiva" si la cantidad administrada es fisiológicamente importante. Un agente es fisiológicamente importante si su presencia da como resultado un cambio detectado en la fisiología de un mamífero receptor. En particular, una preparación de anticuerpos es fisiológicamente significativa si su presencia invoca una respuesta antitumor o mitigan los signos y síntomas de un estado de enfermedad autoinmune. Un efecto fisiológicamente significativo también puede ser la evocación de una respuesta inmune humoral y/o celular en el mamífero receptor.
Métodos de tratamiento utilizando composiciones que incluyen anticuerpos L243 humanizados, quiméricos v humanos
En una modalidad, las enfermedades inmunológicas que serán tratadas con los anticuerpos de la presente invención pueden incluir, por ejemplo, enfermedades de articulaciones tales como espondilitis alquilosante, artritis reumatoide juvenil, artritis reumatoide; enfermedad neurológica tal como esclerosis múltiple y miastemia gravis; enfermedad pancreática tal como diabetes, especialmente diabetes de generación en jóvenes; enfermedad del tracto gastrointestinal tal como hepatitis activa crónica, enfermedad celiaca, colitis ulcerativa, enfermedad de Crohn, anemia perniciosa; enfermedades de la piel tales como psoriasis o escleroderma; enfermedades alérgicas tales como asma y condiciones relacionadas con transplantes tales como enfermedad de injerto versus huésped y rechazo de aloinjerto.
En otra modalidad de la presente invención, las composiciones y métodos que se proporcionan pueden incluir los anticuerpos aquí descritos, o inmunoconjugados de los mismos, para dirigirse a una enfermedad o trastornos autoinmunes. La inmunoterapia de trastornos autoinmune utilizando anticuerpos con células-B objetivos, se describen en la publicación de solicitud PCT número WO 00/74718, la cual reclama la prioridad de la solicitud provisional norteamericana serie número 60/138,284, cuyos contenidos están incorporados en su totalidad a la presente invención como referencia. Las enfermedades autoinmune de ejemplo incluyen pero no se limitan a púrpura trombocitopénica idiopática aguda, púrpura trombocitopénica idiopática crónica, dermatomiositis, corea de Sydenharm, miastemia gravis, lupus eritematoso sistémico, nefritis de lupus, fiebre reumática, síndromes poliglandulares, penfigoide ampollado, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis post-estreptococal, eritema nodoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, esclerosis múltiple, sarcoidosis, colitis ulcerativa, eritema multiforme, nefropatía IgA, poliarteritis nodosa, espondilitis alquilosante, síndrome de Goodpasture, tromboangitis obliterans, síndrome de Sjogren, cirrosis biliar primaria, tiroiditis de Hashimoto, tirotoxicosis, escleroderma, hepatitis activa crónica, polimíositis/dermatomiositis, policondritis, pénfigo vulgaris, granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsalis, arteritis/polimialgia de célula gigante, anemia perniciosa, glomerulonefritis de progreso rápido, psoriasis y alveolitis fibrosante.
En otra modalidad de la presente invención, las composiciones y métodos se proporcionan para tratar un trastorno seleccionado del grupo que consiste en un carcinoma, un sarcoma, un glioma, un linfoma, una leucemia o cáncer de la piel. El carcinoma puede ser seleccionado del grupo que consiste en un cáncer de piel, de esófago, gástrico, colónico, rectal, pancreático, de pulmón, de seno, de ovario, de vejiga urinaria, endometrial, cervical, testicular, renal, adrenal o hepático. La enfermedad relacionada con célula-B puede ser una forma indolente de un linfoma de célula-B, una forma agresiva de linfoma de célula-B, linfoma de no Hodgkin, una leucemia linfocítica crónica, una leucemia linfocítica aguda, una macroglobulinemia de Waldenstrom, o un mieloma múltiple. Además, la enfermedad relacionada con célula-B puede ser un tipo de enfermedad humana o veterinaria. Por otra parte, una enfermedad relacionada con célula-T puede incluir una leucemia o linfoma de célula^T de humano u otro mamífero, psoriasis de la piel, artritis psoriática o fungoides micosis. En un ejemplo, la enfermedad metabólica puede ser una amiloidosis. En un ejemplo, la enfermedad neurodegenerativa puede ser enfermedad de Alzheimer.
También en la presente invención se contemplan en una modalidad de la misma el uso de anticuerpos, incluyendo inmunoconjugados, como una composición para el tratamiento de cualesquiera de las enfermedades o trastornos que se encuentran más adelante, en donde la enfermedad o trastorno es seleccionado del grupo que consiste en una enfermedad de regulación inmune, una enfermedad autoinmune, rechazo de injerto de órganos, enfermedad de injerto versus huésped, enfermedad metabólica (por ejemplo amiloidosis) y enfermedad neurodegenerativa (por ejemplo enfermedad de Alzheimer). La enfermedad o trastorno maligno es seleccionado del grupo que consiste en un tumor sólido, un tumor hematopoyético (linfoma, leucemia, mieloma y similares). El tumor sólido es seleccionado del grupo que consiste en un melanoma, carcinoma y sarcoma y el carcinoma es seleccionado del grupo que consiste en un carcinoma renal, carcinoma de seno, carcinoma de pulmón, carcinoma gastrointestinal y carcinoma urogenital. La malignidad de célula-B es seleccionada del grupo que consiste en formas indolentes de linfoma de célula-B, formas agresivas de linfoma de célula-B, leucemias linfáticas crónicas, leucemias linfáticas agudas, macroglobulinemia de Waldenstrom y mieloma múltiple. También existe un trastorno de célula-B no malignos y enfermedades relacionadas, tales como muchas enfermedades de desregulación autoinmune e inmune, incluyendo septisemia y choque séptico entre enfermedades de desregulación inmune (se pueden contar una lista de enfermedades de desregulación inmune en la solicitud provisional norteamericana número 60/634,076 presentada el 8 de diciembre del 2004 de Goldenberg and Hansen, la cual está incorporada en su totalidad a la presente invención como referencia). En particular, las composiciones aquí descritas son particularmente útiles para el tratamiento de varias enfermedades autoinmune, así como formas indolentes de linfomas de célula-B, formas agresivas de linfoma de célula-B, leucemias linfáticas crónicas, leucemia linfáticas agudas, mieloma múltiple y macroglobulinemia de Waldenstrom, así como otras malignidades hematopoyéticas, tales como leucemias mieloides agudas y crónicas y leucemias y linfomas de célula-T. Por ejemplo, los componentes del anticuerpo hL243 e inmunoconjugados se pueden utilizar preferentemente para tratar formas tanto indolentes como agresivas de linfoma de no Hodgkin y leucemias linfoides.
En otra modalidad, los anticuerpos L243 humanizados, quiméricos y humanos de la presente invención también se pueden utilizar para tratar las enfermedades o trastornos antes mencionados según sea lo adecuado, en todos los mamíferos incluyendo humanos y mamíferos domésticos, incluyendo pero sin limitarse a perros, gatos, caballos y ganado.
En una modalidad particular, el método para tratar una malignidad de célula-B puede incluir administrar a un sujeto con una malignidad relacionada con célula-B, una composición terapéutica que incluye un vehículo, un agente terapéutico y un inmunoconjugado farmacéuticamente aceptable incluyendo un anticuerpo L243 o un componente del mismo (por ejemplo, un anticuerpo L243 humanizado, quimérico o humano o fragmento del mismo o una proteína de fusión de anticuerpos del mismo), en donde la malignidad de célula-B es un linfoma o leucemia. Más específicamente, la malignidad de célula-B son formas indolentes de linfoma de célula-B, formas agresivas de linfoma de célula-B, mieloma múltiple, leucemias linfáticas crónicas o leucemias linfáticas agudas. En una modalidad más particular, un inmunoconjugado o composición que incluye el inmunoconjugado puede administrarse en forma intravenosa o intramuscular en una dosis de aproximadamente 20-200 mg, que incluye además administrar el inmunoconjugado o composición antes, en forma simultánea o después de la administración de al menos un agente terapéutico o agente de diagnóstico adicional utilizado para detectar o tratar la malignidad de célula-B. Por ejemplo, un agente adicional puede incluir un inmunoconjugado adicional tal como se describe en la presente invención, incluyendo un agente terapéutico o de diagnóstico. De acuerdo con estas modalidades, un agente terapéutico puede incluir un anticuerpo descubierto, un inmunomodulador, una hormona, un agente citotóxico, una enzima y/o un anticuerpo conjugado al menos a un inmunomodulador, etiqueta radioactiva, hormona, enzima, oligonucleótido, ARN de interferencia o agente citotóxico o una combinación de los mismos. En un ejemplo en particular, un inmunomodulador puede ser una citocina y el agente citotóxico puede ser un fármaco o toxina. En una modalidad más particular, un anticuerpo que puede ser administrado en combinación con un anticuerpo descubierto o un inmunoconjugado suplemental, reacciona preferentemente con CD4, CDS, CDS, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54,CD74, CD80, CD126, CD138, CD154, B7, MUCI, MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrosis, PAM-4, KS-I, 90 Le(γ), MAGE, la, IL- 2, IL-6, tenascin, HMI.24, VEGF, EGFR, EGP-1, EGP-2, receptor de folato, gonadotropina coriónica humana, CEA, antígeno-p específico de colon (CSAp), factor de crecimiento tipo insulina (ILGF), factor de crecimiento de placenta (P1GF), fosfatasa de ácido prostético, PSA, PSMA, TIOI, TAG, TAG-72, Her2/neu, anhidrasa carbónica, IX, IL-6, SlOO, alfa fetoproteína, A3, CA125, antígeno carcinoembriónico (CEA), antígeno de reticulación específica tales como CD66 (a.b.c.d), MART-1, TRP-1, TRP-2, amiloide o gplOO.
También se contempla en la presente invención, que el tratamiento de una malignidad puede incluir administrar a un sujeto con una malignidad diferente a un linfoma o leucemia, una composición terapéutica que puede incluir: (1) un anticuerpo hL243, o un inmunoconjugado del mismo, y un vehículo; (2) un efector; e (3) un excipiente farmacéuticamente aceptable. La composición puede ser administrada en forma intravenosa o intramuscular en una dosis de 20-2000 mg. Además, la composición puede ser administrada antes, en forma simultánea o después de la administración de al menos un agente terapéutico o agente de diagnóstico adicional. Los agentes terapéuticos, tal como se describió anteriormente y a lo largo de la especificación, pueden incluir un inmunomodulador, una hormona, un agente citotóxico o una molécula de enlace (ya sea descubierta o conjugada para al menos un inmunomodulador, etiqueta radioactiva, enzima, hormona, agente citotóxico, oligonucleótido antisentido, ARN de interferencia o una combinación de los mismos, en donde el inmunomodulador es preferentemente una citocina y el agente citotóxico es preferentemente un fármaco o toxina). Un agente terapéutico o agente de diagnóstico puede incluir las composiciones o inmunoconjugados tal como se describe en la presente invención. En una modalidad particular, se puede administrar un anticuerpo en combinación con la composición terapéutica y/o de diagnóstico para tratar una malignidad que no es malignidad de célula-B, pero que probablemente reacciona con un marcador diferente al reconocido por el anticuerpo hL243, el cual se expresa por las células que comprenden la malignidad que es tratada, y el anticuerpo debe ser formulado en un vehículo farmacéuticamente aceptable. Los ejemplos de anticuerpos que pueden ser administrados para melanoma maligno asociado con antígeno son aquellos anticuerpos que reaccionan con MART-1, TRP-1, TRP-2 y gplOO. Además, los anticuerpos preferidos para antígenos asociados con mieloma múltiple incluyen los que reaccionan con MUC1, CD74 y CD38. Las composiciones para tratamiento pueden contener el anticuerpo WL243, o inmunoconjugados del mismo, solos o en combinación con otros anticuerpos, tal como otros anticuerpos humanizados, quiméricos o humanos.
En un ejemplo, las composiciones pueden incluir un inmunomodulador en la forma de un efector. Tal como se utiliza en la presente invención, el término "inmunomodulador" incluye citocinas, factores de crecimiento de célula madre, linfotoxinas, tales como factor de necrosis de tumor (TNF) y factores hematopoyéticos tales como interleucinas (por ejemplo interleucin-1 (IL-1), IL-2, IL-3, IL-6, IL-10, IL-12, IL-18 y IL-21), factores de estimulación de colonia (por ejemplo factor de estimulación de colonia de granulocito (G-CSF) y factor de estimulación de colonia de macrófago granulocito (GMDCSF)), interferonas (por ejemplo interferonas-α, β y γ), el factor de crecimiento de célula madre designado "factor SI", eritropoyetina, trombopoyetina o una combinación de los mismos. Los ejemplos de porciones inmunomoduladoras adecuadas incluyen IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21 y una combinación de las mismas, e interferón-α, β y γ, TNF-α y β y similares. En una modalidad, el inmunomodulador puede encontrarse en la composición, o como alternativa, el inmunomodulador puede administrarse antes, en forma simultánea o después de la administración de las composiciones terapéuticas y/o de diagnóstico. En una modalidad particular, el anticuerpo hL243 también puede conjugarse al inmunomodulador. El inmunomodulador también puede ser conjugado a un anticuerpo híbrido que consiste en uno o más anticuerpos que enlazan a diferentes antígenos.
En un ejemplo, las terapias multimodales aquí contempladas pueden incluir monoterapia con inmunoconjugados tales como anticuerpo hL243 suplementado con la administración de moléculas de enlace adicionales (por ejemplo anti-CD22, anti-CD19, anti-CD21, anti-CD20, anti-CD80, anti-CD23, anti-CD46 o HLA-DR, preferentemente los anticuerpos de dímero HLA-DR maduro en la forma de anticuerpos descubiertos, proteínas de fusión o como inmunoconjugados). Además, una micela, liposoma o nanopartícula tal como se describe en la presente invención, puede incluir moléculas de enlace además de anticuerpos hL243. Por ejemplo, los anticuerpos pueden ser anticuerpos policlonales, monoclonales, quiméricos, humanos o humanizados que reconocen al menos un epítope en las determinantes de antígenos observadas anteriormente. Además, los anticuerpos anti-CD19 y anti-CD22 son conocidos en la técnica. (Ver por ejemplo las publicaciones de Ghetie y asociados., Cáncer Res. 48:2610 (1988); Hekman y asociados., Cáncer Immunol. Immunother. 32:364 (1991); Longo, Curr. Opin. Oncol. 8:353 (1996) y patentes norteamericanas números 5,798,554 y 6,187,287, incorporadas en su totalidad a la presente invención como referencia).
En un ejemplo en particular, otra forma de terapia multimodal puede ser cuando los sujetos reciben inmunoconjugados hL243 junto con inmunoterapia de cáncer estándar. Por ejemplo, "CVB" (1.5 g/cm2 ciclofosfamida, 200-400 mg/m2 etopósido y 150-200 mg/m2 carmustina) es un régimen utilizado para tratar linfoma de no Hodgkin. Patti y asociados., Eur. J. Haematol. 51:18 (1993). Otros regímenes quimioterapéuticos de combinación adecuados son bien conocidos para los expertos en la técnica. (Ver por ejemplo la publicación de Freedman y asociados., "Non-Hodgkin's Lymphomas," in Cáncer Medicine, Volume 2, 3rd Edition, Holland y asociados, (eds.), páginas 2028-2068 (Lea & Febiger 1993)). Como una ilustración, los regímenes quimioterapéuticos de primera generación para el tratamiento de linfoma de no Hofdking de grado intermedio (NHL) incluye C-MOPP (ciclofosfamida, vincristina, procarbazina y prednisona) y CHOP (ciclofosfamida, doxorrubicín, vincristina y prednisona). En una modalidad particular de la presente invención, el régimen quimioterapéutico de segunda generación puede ser (metotrexato, bleomicín, doxorrubicín, ciclofosfamida, vincristina, dexametasona y leucovorín) aunque un régimen de tercera generación adecuado es MACAP-B (metotrexato, doxorrubicín, ciclofosfamida, vincristina, prednisona, bleomicín y leucovorín). Los terapéuticos adicionales pueden incluir butirato de fenilo y briostatín-1. En una terapia multimodal preferida, ambos fármacos quimioterapéuticos y citocinas se pueden administrar en conjunto con un anticuerpo, inmunoconjugado o proteína de fusión. Las citocinas, fármacos quimioterapéuticos y anticuerpo o inmunoconjugado pueden administrarse en cualquier orden, o en forma simultánea.
En una modalidad particular, se puede tratar NHL con infusiones cada 4 semanas del inmunoconjugado hL243 (por ejemplo, una composición terapéutica) en una dosis de 25-700 mg/m2 a la semana durante 4 semanas consecutivas o una semana sí y una semana no (iv durante de 2 a 8 horas), repetida según sea necesario durante los siguientes meses/años, más preferentemente en una dosis de 100-400 mg/m semana durante 4 semanas consecutivas o una semana sí y una semana no (iv durante 2-8 horas), repitiéndose según sea necesario en los siguientes meses/años. Además, NHL se puede tratar con infusiones cada cuatro semi-meses tal como se indicó anteriormente, pero combinarse con epatruzumab (anticuerpo humanizado anti-CD22) en los mismos días, en una dosis de 360 mg/m2, determinada como una infusión iv durante 1 hora, ya sea antes, durante o después de la infusión de inmunoconjugado de anticuerpo hL243. Como alternativa, HL se puede tratar con infusiones cada 4 semanas del inmunoconjugado de anticuerpo hL243 según se indicó anteriormente, en combinación con una o más inyecciones de CD22 mAb radioetiquetado con un isótopo terapéutico tal como itrio-90 (en una dosis de 90-Y entre 5 y 35 mCi/metro cuadrado, en la forma de una o más inyecciones durante un período de semanas o meses. En un ejemplo, cuando se utiliza en pacientes con respuestas inferiores a anticuerpos CD20, WL243 se puede combinar con dichos anticuerpos CD20 como rituximab o hA20. De acuerdo con este ejemplo, la última combinación puede administrarse en secuencias o en forma contemporánea, ya sea durante el mismo día o semana, en dosis diversas, tales como 375 mg/m2 una vez a la semana mediante infusión i.v. para rituximab o hA20 y 250 mg/m2 para hL243 también proporcionada una vez a la semana mediante infusión i.v. En todos los casos antes mencionados, las dosis pueden ser fraccionadas, administradas como infusiones continuas o mediante rutas parenterales conocidas en la técnica. También se pueden administrar a través de otras rutas, tal como en forma subcutánea.
Además, en una modalidad una composición terapéutica tal como se describe en la presente invención, puede contener una mezcla de moléculas híbridas de ¡nmunoconjugados, dirigidos a diferentes epítopes sin bloqueo, reconocidos por el anticuerpo hL243. De acuerdo con esta modalidad, las composiciones terapéuticas pueden incluir una mezcla de inmunoconjugados hL243 que enlazan en al menos dos epítopes reconocidos por el anticuerpo hL243. Asimismo, los inmunoconjugados descritos en la presente invención pueden contener una mezcla de anticuerpos hL243 con secuencias CDR diversas.
En una modalidad de la presente invención, los anticuerpos hL243 o inmunoconjugados de los mismos, se pueden mezclar para tratar linfoma de célula-B y leucemia, y otras enfermedades de células-B o trastornos así como otras malignidades en las cuales las células malignas afectadas o asociadas son reactivas con epítopes reconocidos por el anticuerpo hL243. Por ejemplo, los anticuerpos hL243 o inmunoconjugados de los mismos también se pueden utilizar para tratar enfermedad de desregulación inmune y enfermedades autoinmunes relacionadas, incluyendo pero sin limitarse a enfermedades autoinmune clase-I 11 tal como trombocítopenias transmitidas por sistema inmune, tal como púrpura trombocitopénica idiopática aguda y púrpura trombocitopénica idiopática crónica, dermatomiositis, síndrome de Sjogren, esclerosis múltiple, corea de Sydenham, miastemia gravis, lupus eritematoso sistémico, nefritis de lupus, fiebre reumática, síndromes poliglandulares, penfigoide ampollado, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis post-estreptococal, eritemia nodoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, sarcoidosis, colitis ulcerativa, eritema multiformas, nefropatía IgA, poliarterítis nodosa, espondilitis anquilosante, síndrome de Goodpasture, tromboangitis obliterans, cirrosis biliar primaria, tiroiditis de Hashimoto, tirotoxicosis, escleroderma, hepatitis activa crónica, polimiositis/dermatomiositis, policondritis, pénfigo vulgaris, granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsalis, arteritis/polimialgia de célula gigante, anemia perniciosa, glomerulonefritis de progreso rápido y alveolitis fibrosante.
En una modalidad más particular, los anticuerpos hL243 o inmunoconjugados o fragmentos de los mismos o proteína de fusión de anticuerpo de los mismos, se puede administrar a un sujeto con una o más de estas enfermedades autoinmunes. Los anticuerpos hL243 aquí descritos son particularmente útiles en el método para tratar trastornos autoinmune, descrito en la serie norteamericana también pendiente número 09/590,284, presentada el 9 de junio del 2000, titulada "inmunoterapia de trastornos autoinmune utilizada en anticuerpos que dirigen células-B", la cual está incorporada en su totalidad a la presente invención como referencia. En una modalidad particular, los anticuerpos hL243 pueden ser administrados en forma intravenosa o intramuscular en una dosis de 20-2000 mg. Además, los anticuerpos hL243 pueden ser administrados antes, durante o después de la administración de al menos un agente terapéutico o agente de diagnóstico. En una modalidad más particular, el agente terapéutico, tal como se describe en la presente invención, puede incluir un anticuerpo, un inmunomodulador, una hormona, una enzima, un agente citotóxico, un anticuerpo conjugado para al menos un inmunomodulador, etiqueta radioactiva, hormona, enzima o agente citotóxico, oligonucleótido antisentido un ARN de interferencia o una combinación de los mismos, en donde el inmunomodulador es una citocina y el agente citotóxico es un fármaco o toxina. Por ejemplo, el agente terapéutico puede incluir un inmunoconjugado tal como se describe en la presente invención. En una modalidad particular, los anticuerpos que pueden ser administrados en combinación como un anticuerpo descubierto o como un inmunoconjugado suplemental incluyen anticuerpos que reaccionan por ejemplo, con mAbs a antígenos específicos tales como CD4, CDS, CDS, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUCI, MUC2, MUC3, MUC4, MUC16, NCA66, antígeno de necrosis, PAM-4, KS-1, Le(y), MAGE, 1a, IL-2, IL-6, tenascin, HM1.24, VEGF, EGFR, EGP-1, EGP-2, el receptor de folato, gonadotropina .coriónica humana, antígeno-p específico de colon (CSAp), factor de crecimiento tipo insulina (ILGF), factor de crecimiento de placenta (PIGF), fosfatasa de ácido prostético, PSA, PSMA, T101, TAG, TAG-72, Her2/neu, anhidrasa carbónica 1X, IL-6, S100, fetoproteína alfa, A3, CA125, antígeno carcinoembriónico (CEA), agentes de reticulación no específicos tales como CD66 (a,b,c,d), MART-1, TRP-1, TRP-2, amiloide y gplOO formulados en un vehículo farmacéuticamente aceptable.
Tal como se utiliza en la presente invención, una

"composición farmacéutica se refiere a una composición que ¡ncluye un fármaco, en donde el transportador es un vehículo farmacéuticamente aceptable, en tanto que una "composición veterinaria" es una en donde el vehículo es un vehículo veterinariamente aceptable. El término "vehículo farmacéuticamente aceptable" o "vehículo veterinariamente aceptable" puede incluir cualquier medio o material que no sea biológica, o de otra forma, inyectable, es decir, el vehículo puede administrarse a un organismo junto con una composición o compuesto de la presente invención sin originar cualesquier efectos biológicos indeseables o interactuar en una forma perjudicial con el complejo o cualesquiera de estos componentes o el organismo. Los ejemplos de reactivos farmacéuticamente aceptables se proporcionan en la farmacopea de los Estados Unidos, The National Formulary, United States Pharmacopeial Convention, Inc., Rockville, MD 1990, incorporada en su totalidad a la presente invención como referencia, y en Pharmaceutical Dosage Forms & Drug Delivery Systems, séptima edición, Ansel et al., editores, Lippincott Williams & Wilkins, 1999.
Un fármaco (por ejemplo una construcción o complejo dirigible) puede incluirse en la composición farmacéutica en una cantidad suficiente para producir el efecto deseado en el paciente. Las composiciones farmacéuticas de la presente invención pueden comprender además otros componentes químicos, tales como dluyentes y excipientes. Un "diluyente" es un compuesto químico diluido en un solvente, preferentemente un solvente acuoso, que facilita la disolución del fármaco del solvente, y también puede servir para estabilizar la forma biológicamente activa del fármaco en uno o más de sus componentes. Las sales disueltas en soluciones reguladas se utilizan como diluyentes en la técnica. Por ejemplo, los diluyentes preferidos son soluciones reguladas que contienen una o más sales diferentes. Una solución regulada preferida es una solución salina regulada por fosfato (particularmente junto con composiciones proyectadas para administración farmacéutica), la cual mimetiza las condiciones de sal del cuerpo humano. Ya que las sales-regulador pueden controlar el pH de una solución en concentraciones bajas, un diluyente regulado rara vez modifica la actividad biológica de un péptido biológicamente activo.
En una modalidad de la presente invención, las composiciones farmacéuticas facilitan la administración de anticuerpos humanizados a un organismo, preferentemente un animal, preferentemente un mamífero. Los mamíferos particulares incluyen bovinos, caninos, equinos, felinos, ovinos y animales porcinos y primates no humanos. Los humanos son los particularmente preferidos. En la técnica existen múltiples técnicas de administración o suministro que incluyen pero no se limitan a, administración oral, rectal, (por ejemplo, un enema o supositorio) aerosol (por ejemplo, para suministro nasal o pulmonar), parenteral (por ejemplo, i.v., i.m., s.c.) y tópica. Preferentemente, se pueden administrar cantidades suficientes de la composición o compuesto para lograr el efecto proyectado. La cantidad particular de la composición o compuesto que será administrada dependerá de muchos factores, incluyendo el efecto que se logrará, el tipo de organismo al cual la composición se administra, ruta de administración, régimen de dosificación y la edad, salud y sexo del organismo. Por lo tanto, la dosis particular de una composición o compuesto de la modalidad aquí descrita en una formulación determinada, se deja al juicio de los expertos en la técnica (por ejemplo, el juicio del médico especialista).
Los expertos en la técnica podrán apreciar que cuando las composiciones farmacéuticas de la presente invención se administran como agentes para lograr el resultado biológico deseado en particular, el cual puede incluir un efecto(s) terapéutico o protector (incluyendo vacunación), puede ser necesario combinar la composición o compuestos aquí descritos con un vehículo farmacéutico adecuado. La elección del vehículo farmacéutico y la preparación de la composición o compuesto en la forma de un agente terapéutico o protector, dependerán del uso proyectado y el modo de administración. Las formulaciones y métodos de administración adecuados de agentes terapéuticos incluyen, pero no se limitan a los de administración oral, pulmonar, nasal, bucal, ocular, dérmica, rectal o vaginal.
Dependiendo del modo de administración empleado, la entidad funcional dependiente del contexto puede administrarse en una variedad de formas farmacéuticamente aceptables. Por ejemplo, la entidad funcional dependiente del contexto puede administrarse en la forma de un sólido, solución, emulsión, dispersión, micela, liposoma y similares, incorporarse en un pildora, cápsula, tableta, supositorio, aerosol, gota o rocío. Las pildoras, tabletas, supositorios, aerosoles, polvos, gotas y rocíos pueden tener estructuras de capas múltiples, complejas y tiene un gran rango de tamaños. Los aerosoles, polvos, gotas y rocíos pueden fructuar desde pequeños (aproximadamente 1 miera) hasta grandes (aproximadamente 200 mieras) de tamaño. Las composiciones farmacéuticas aquí descritas pueden ser utilizadas en la forma de un sólido, un polvo liofilizado, una solución, una emulsión, una dispersión, una micela, un liposoma y similares, en donde la composición resultante contiene una o más de las construcciones o complejos dirigibles con construcciones o complejos dirigibles de las modalidades de la presente invención, en la forma de un ingrediente activo, en mezcla en adiciones con un vehículo o excipiente orgánico o inorgánico adecuado para aplicaciones entérales o parenterales. El ingrediente activo puede estar compuesto, por ejemplo, con los vehículos farmacéuticamente aceptables, no tóxicos, usuales para tabletas, comprimidos, cápsulas, supositorios, soluciones, emulsiones, suspensiones y otras formas adecuadas para uso. Los vehículos que se pueden utilizar incluyen glucosa, lactosa, mañosa, acacia de goma, gelatina, manitol, pasta de almidón, trisilicato de magnesio, talco, almidón de maíz, queratina, sílice coloidal, almidón de papa, urea, triglicéridos de longitud de cadena media, dextranos y otros vehículos adecuados para utilizarse en la fabricación de preparaciones, en forma sólida, semisólida o líquida. Además se pueden utilizar agentes auxiliares, de estabilización, engrosamiento y coloración y perfumes. Los ejemplos de un agente de estabilización en seco incluye triulosa, preferentemente en concentraciones de 0.1% (ver por ejemplo la patente norteamericana número 5,314,695).
Aunque las necesidades individuales pueden variar, la determinación de rangos óptimos para cantidades efectivas de composiciones farmacéuticas está dentro de la experiencia en la técnica. Las dosis humanas pueden ser extrapoladas a partir de estudios animales (Katocs y asociados, capítulo 27 en: Remington's Pharmaceutical Sciences, 18° edición Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990). Generalmente, la dosis requerida para proporcionar una cantidad efectiva de una composición farmacéutica, la cual será ajustada por un experto en la técnica, variará dependiendo de la edad, salud, condición física, peso, tipo y grado de enfermedad o trastorno del receptor, frecuencia de tratamiento, la naturaleza de la terapia concurrente (si es que existe) y la naturaleza y alcance del efecto(s). Ver por ejemplo la publicación de Nies y asociados, capítulo 3 en: Goodman & Oilman's The Pharmacological Basis of Therapeutics, 9° edición, Hardman y asociados, eds., McGraw-Hill, Nueva York, N. Y., 1996).
La dosificación de composiciones terapéuticas depende de la severidad y respuesta del estado de enfermedad que será tratado, con el curso del tratamiento durando desde varios días hasta varios meses, o hasta que se lleve a cabo la curación o se logre una disminución del estado de la enfermedad. Los programas de dosificación óptimos pueden ser calculados a partir de medidas de acumulación de fármaco en el cuerpo del paciente. El término "paciente" pretende comprender animales (por ejemplo, gatos, perros y caballos), así como humanos. Los expertos en la técnica podrán determinar fácilmente las dosis óptimas, metodologías de dosificación y rangos de repetición. Las dosis óptimas pueden variar dependiendo de la potencia relativa de los agentes terapéuticos individuales, y pueden ser generalmente estimados con base en los ECSo encontrados como efectivos en modelos animales in vitro e in vivo.
El rango de dosis (la cantidad de construcción o complejos administrado dirigible) es amplio, ya que en general la eficacia de un efecto terapéutico para diferentes mamíferos varía ampliamente con dosis que son normalmente 20, 30 o incluso 40 veces más pequeñas (por unidad de peso corporal) en hombres que en ratas. En general, la dosis es de 0.01 μg a 100 mg por kg de peso corporal, preferentemente de 0.01 μg a 10 mg/kg de peso corporal, 0.01 μg a 50 μg/kg de peso corporal, 0.01 μg a 100 mg/kg de peso corporal, 0.01 μg a 10 mg/kg de peso corporal, 0.01 μg a 1 mg/kg de peso corporal, 0.01 μg a 100 μg/kg de peso corporal, 0.01 μg a 10 μg/kg de peso corporal, 0.01 μg a 1 μg/kg de peso corporal, 0.01 μg a 10 μg/kg de peso corporal, 0.01 μ a 1 μg/kg de peso corporal, 0.01 μg a 0.1 μg/kg de peso corporal, y rangos con base en los límites de los rangos de concentraciones anteriores. Por lo tanto, por ejemplo, la descripción anterior de las dosis comprende dosificaciones dentro del rango de 10 mg a 100 mg por kg de peso corporal, 1.0 mg a 100 mg/kg de peso corporal, 0.1 mg a 100 mg/kg de peso corporal, etc.
En una modalidad, las dosis pueden proporcionarse una vez o más al día, a la semana, al mes o al año, o incluso al día, a la semana, al mes o al año, incluso una vez cada 2 a 5 o más años. Los expertos en la técnica pueden estimar rangos de repetición para dosificación con base en tiempos de residencia y concentraciones medidas de la construcción o complejo dirigible en fluidos o tejidos corporales. Después de un tratamiento exitoso, puede ser recomendable tener al paciente en una terapia de mantenimiento para evitar la recurrencia del estado de enfermedad, en donde el agente terapéutico se administra en dosis de mantenimiento, que fructúan de 0.01 kg a 100 mg por kg de peso corporal, una o más veces al día a una vez cada 5 años.
En una modalidad, una dosis particular puede calcularse de acuerdo con el peso corporal aproximado o área de superficie del paciente. Otros factores para determinar la dosis adecuada pueden incluir la enfermedad o condición que esté siendo tratada o prevenida, la severidad de la enfermedad, la ruta de administración y la edad, sexo y condición médica del paciente. El refinamiento adicional de los cálculos necesarios para determinar la dosis adecuada para el tratamiento, se elabora en forma rutinaria por un experto en la técnica, especialmente a la luz de la información de dosis y ensayos aquí descrita. La dosis también puede ser determinada a través del uso de ensayos conocidos para determinar las dosis utilizadas junto con datos de respuesta-dosis adecuados.
En una modalidad, una dosis de paciente individual se puede ajustar conforme se monitorea el progreso de enfermedad. Los niveles sanguíneos de la construcción o complejo dirigible en un paciente pueden ser medidos para ver si la dosificación necesita ser ajustada para lograr los resultados deseados.
En un ejemplo, se pueden utilizar farmacogenómicos para determinar las construcciones y/o complejos dirigibles, y dosis de las mismas, y lo más probable para ser efectivo para un individuo determinado (Schmitz y asociados, Clínica ChimicaActa 308: 43-53, 2001; Steimer y asociados, Clínica ChimicaActa 308: 33-41, 2001).
La administración de los anticuerpos humanizados aquí descritos puede se parenteral, incluyendo intravenosa, intraarterial, intraperitoneal, intramuscular, subcutánea, intrapleural, intratecal, intracavidad mediante perfusión a través de un catéter o mediante inyección intralesión directa. De acuerdo con esta administración, los anticuerpos se pueden administrar una vez o más veces al día, una vez o más veces a la semana, una vez o más veces al mes y una vez o más veces al año.
Los contenidos de los artículos, patentes y solicitudes de patente y los otros documentos e información electrónicamente disponible mencionada o descrita en la presente invención, están incorporados en su totalidad a la presente invención como referencia, hasta el punto como si cada publicación individual fuera específica e individualmente indicada para estar incorporada como referencia. Los solicitantes se reservan el derecho de incorporar físicamente en esta solicitud cualquiera y todos los materiales e información referente de cualesquiera de dichos artículos, patentes, solicitudes de patente y otros documentos.
Las modalidades descritas en forma ilustrativa en la presente invención, pueden ser practicadas en forma adecuada en la ausencia de cualquier elemento o elementos, límite o limitaciones, no descritos en forma específica en la presente invención. Por lo tanto, por ejemplo, los términos "que comprende", "que incluye", "que contiene", etc., deben ser leídos en forma expansible y sin limitación. Además, los términos y expresiones empleados en la presente invención han sido utilizados como términos de descripción y no de limitación, y no existe intención en el uso de dichos términos y expresiones de excluir cualquier equivalente de las características mostradas y descritas o parte de las mismas, aunque se reconoce que son posibles varias modificaciones dentro del alcance de la presente invención reivindicada. Por lo tanto, deberá quedar entendido que aunque la presente ha sido descrita en forma específica a través de modalidades preferidas y características opcionales, las modificaciones y variaciones representadas aquí descritas pueden ser revisadas por un experto en la técnica, y que dichas modificaciones y variaciones se considera que están dentro del alcance de la presente invención.
Las modalidades de la presente invención han sido descritas ampliamente y en forma genérica en la misma. Cada una de las especies y agrupaciones subgenéricas estrechas que están dentro de la descripción genérica, también pueden formar parte de la presente invención. Esto incluye la descripción genérica de la presente invención con una provisión o limitación negativa que elimina cualquier materia del género, sin importar si el material extraído está mencionado en forma específica o no en la presente invención.
Además, cuando las características o aspectos se describen en términos de grupos Markush, los expertos en la técnica reconocerán que las modalidades también se describirán en términos de cualquier elemento o subgrupo de miembros individual del grupo Markush.
Las modalidades se ilustran en forma adicional a través de los ejemplos y protocolos detallados que se encuentran a continuación. Sin embargo, los ejemplos pretenden meramente ilustrar las modalidades y no se construyen para limitar el alcance de la presente invención. Los contenidos de todas las referencias y patentes publicadas y solicitudes de patente mencionadas a lo largo de la solicitud, están incorporadas a la presente invención como referencia.
Ejemplos
Ejemplo 1. Construcción de un anticuerpo L243 humanizado Clonación molecular de genes L243Vk y VH
En un método de ejemplo, el clon es célula de hibridoma que produce mAb mL243 fue cultivado en un medio HSFM (Life Technologies, Inc.) suplementado con 10% FBS (Hyclone). Los genes que codifican el VK (VK1 BACK/CK31) y VH (VH 1BACK/VH1 FOR) de mL243 fueron clonados mediante RT-PCR y las secuencias fueron determinadas mediante secuenciación de ADN. Se secuenciaron múltiples clones independientes para eliminar posibles errores que resultan de la reacción PCR.
Diseño de secuencia de genes hL243
En un ejemplo, en la búsqueda de las secuencias VK y VH humanas en la base de datos de Kabat, se descubrió que los FRs de mL243 VK y VH exhiben el mayor grado de homología de secuencia con REÍ VK y RF-TS3 VH humana, respectivamente. Una excepción es el FR4 de mL243VH, el cual mostró la homología de secuencia más alta con la de NEWM VH. Por consiguiente, una estructura REÍ humana de ejemplos utilizaron secuencias como el andamio para insertarlos CDRs de mL243VK (figura 5), y se utilizó una combinación de RF-TS3 y secuencias de estructura NEWM para hL243Vn (figura 6). De hecho, hL243 VH tiene las mismas de estructuras VH humanas que para otros Ab, hRS7 humanizados (Govindan y asociados, Breast Cáncer Res. Treat. 84,173-182, 2004). Existe un número de cambios de aminoácidos en cada cadena fuera de las regiones CDR, cuando se comparan con las estructura de anticuerpo humano de partida. Varios residuos de aminoácido en FRs de murino que flanquean las CRs putativas, se mantuvieron en hL243 Fv formados nuevamente con base en los lineamientos previamente establecidos (Qu y asociados, Clin. Cáncer Res. (1999) 5 3095s-3100s). Estos residuos son R37, K39, V48, F49 y G100 de mL243Vk y F27, K38, K46, A68 y F91 de mL243VH (figuras 3 y 4, respectivamente). También se debe observar la SEQ ID. 3 y 4 respectivamente para la secuencia de hL243 VL y hL243VH, respectivamente.
Construcción de secuencias hL243
Se utilizó una estrategia modificada a la que se describe en la publicación de Leung y asociados (Mol. Immunol. (1995) 32 1413-1427) para construir los genes VK y VH designados para hL243 utilizando una combinación de sintasas de oligonucleótido largas y PCR tal como se ilustra en la figura 4. Para la construcción del dominio hL243 VH, se sintetizaron dos oligonucleótidos largos, hL243VHA (175-mer) y VHB (168-mer) en un sintetizador de ADN automatizado (Applied Biosystem). hL243VHA representa nt 23 a 197 del dominio HL243VH.
5'-GGTCTGAGTT GAAGAAGCCT GGGGCCTCAG

TGAAGGTTTC CTGCAAGGCT TCTGGATTTA CCTTCACAAA CTATGGAATG AACTGGGTGA AGCAGGCCCC TGGACAAGGG CTTAAGTGGA TGGGCTGGAT AAACACCTAC ACTAGAGAGC CAACATATGC TGATGACTTC AAGGG-31 (SEQ ID NO: 16) hL243VHB representa la hebra menor del dominio hL243 VH complementado y para nt 176 a 343.
5'-ACCCTTGGCC CCAGTAGTCA AAACCCGTAG

GTACAACCGC AGTAATATCT CTTGCACAGA AATACACGGC AGTGTCGTCA GCCTTTAGGC TGCTGATCTG GAGATATGCC GTGCTGACAG AGGTGTCCAA GGAGAAGGCA AACCGTCCCT TGAAGTCATC AGCATATG-3' (SEQ ID NO: 17).
La secuencia 3'-terminal (residuos 22 nt) de hL243VHA y B son complementarios entre sí, tal como se subraya en las secuencias anteriores. En un ejemplo, de acuerdo con las condiciones PCR definidas, los extremos 3' de hL243VHA y B se endurecen para formar un ADN de hebra doble corto flanqueado por el resto de los oligonucleótidos largos. Cada extremo endurecido sirve como un sebador para la réplica del ADN de hebra simple en una reacción PCR, dando como resultado un ADN de hebra doble compuesto de nt 23 a 343 de hL243VH. Este ADN se amplificó adicionalmente en la presencia de un par de sebadores de oligonucleótido corto, hRS7VHBACK y hL243VHFOR, para formar el hL243VH de longitud total. Debido a la identidad de secuencia entre hRS7VH y hL243VH en esta región, hRS7VHBACK, se utilizó hRS7 Ab, previamente designado y utilizado para.
hRS7VHBACK δ'-GTGGTGCTGC AGCAATCTGG

GTCTGAGTTG AAGAAGCC-3' (SEQ ID NO: 18).
hL243 VHFOR 5'-TGAGG AGACG GTGACCAGGG

ACCCTTGGCC CCAGTAGT-3' (SEQ ID NO: 19).
En este ejemplo, se amplificó una cantidad mínima de hL243VHA y B (determinada en forma empírica) en la presencia de 10 μl de regulador 1Ox PCR (500 mM KCl, 100 mM Tris. HCL regulador, pH 8.3, 15 mM MgCI2), 2 μmol de hRS7VHBACK y hL243 VHFOR y 2.5 unidades de polimerasa de ADN Taq (Perkin Elmer Cetus, Norwalk, CT). Esta mezcla de reacción se sometió a 3 ciclos de reacción PCR que consisten en desnaturalización a una temperatura de 94°C durante 1 minuto, endureciendo una temperatura de 45°C durante 1 minuto, y polimerización a una temperatura de 72°C durante 1.5 minutos seguido de 27 ciclos de reacción PCR que consiste en desnaturalización a una temperatura de 94°C durante 1 minuto, endurecimiento a una temperatura de 55°C durante 1 minuto, y polimerización a una temperatura de 72°C durante 1 minuto. El producto amplificado por PCR de hebra doble para hL243VH fue purificado con gel, digerido por restricción con Pstl y BstEII y clonado en los sitios Pst/BstEII complementarios del vector de de presentación de cadena pesada, VHpBS4.
En un ejemplo, para construir el ADN de longitud total de la secuencia VK humanizada, se sintetizaron hL243 VKA (155-mer) y hL243VKB (155-mer) tal como se describió anteriormente. Se amplificaron hL243VKA y B a través de dos oligonucleótidos cortos hlmmu31 VKBACK y hlmmu31 VKFOR, tal como se describió anteriormente. Se designaron hlmmuSI VKB ACK y hlmmuSI VKFOR y se utilizaron previamente para un Ab anti-AFP humanizado (Qu y asociados, Clin. Cáncer Res. (1999) 5 3095-3100).
hL243VKA representa nt 21 a 175 del dominio hL243VD.
5'-TCCATCATCT CTGAGCGCAT CTGTTGGAGA

TAGGGTCACT ATCACTTGTC

GAGCAAGTGA GAATATTTAC AGTAATTTAG CATGGTATCG TCAGAAACCA

GGGAAAGCAC CTAAACTGCT GGTCTTTGCT GCATCAAACT

TAGCAGATGG

TGTGC-3' (SEQ ID NO:20)
hL243VKB representa la hebra menor del dominio hL243VK complementario para nt 154 a 312.
5' -CAGCTTGGTC CCTCCACCGA ACGCCCACGG

AGTAGTCCAA AAATGTTGAC

AATAATATGT TGCAATGTCT TCTGGTTGAA GAGAGCTGAT

GGTGAAAGTA TAATCTGTCC CAGATCCGCT GCCAGAGAAT CGCGAAGGCA CACCATCTGC
TAAGTTTGA-3 (SEQ ID NO:21)
hlmmu3 IVKBACK 5'-GACATTCAGC TGACCCAGTC TCCATCATCT CTGAGCGC-3' (SEQ ID NO:22)
hlmmu3 IVKFOR 5'-CCGGCAGATC TGCAGCTTGG

TCCCTCCACC G-31

(SEQ ID NO:23)
Los productos PCR purificados con gel para hL243VK en este ejemplo, fueron digeridos por restricción con Pvll y BglHI y clonados en los sitios Pvul/Bcll complementarios del vector de presentación de cadena ligera, VKpBR2. El vector de expresión final hL243pdHL2, se construyó mediante subclonación en secuencias de los fragmentos Xba1-BamHI y Xhol/Notl de hL243Vic y VH, respectivamente, en pdHL2 tal como se describió anteriormente.
Construcción de vectores de expresión para los anticuerpos hL243
En un ejemplo, se construyó un vector de expresión final hL243pdHL2 subclonando en secuencias los fragmentos Xba1-BamHI y Xhol/Notl de hL243Vx y VH, respectivamente, en pdHL2 tal como se describió previamente (Losman y asociados Cáncer, 80:2660 (1997)). El vector de expresión pdHL2 tal como lo describe Gilíes y asociados (J. Immunol. Methods 125:191 (1989), contiene la secuencia genómica de la cadena γ1 humana, por consiguiente, el hL243 es un isotipo lgG1/K.

En un método de ejemplo, para construir vectores de expresión de hL243 del otro isotipo, tal como lgG4/K, la secuencia genómica de la cadena γ1 humana se reemplazó con la de la cadena γ4, la cual se obtuvo mediante amplificación PCR. La plantilla utilizada fue el ADN genómico extraído de la célula ATCC CRL-11397 y el par de sebadores fue P-Sacll (5'-CCGCGGTCACATGGCACCA CCTCTCTTGCAGCTTCCACCA

AGGGCCC-31) (SEQ ID NO:24) y P-Eagl (5'-CCGGCCGTCG CACTCAT TTA CCCAGAGACA GGG-31) (SEQ ID NO:25). El producto PCR amplificado fue clonado en el vector de secuenciación TOPO-TA (Invitrogen) y la secuencia fue confirmada mediante secuenciación de ADN.
Un punto de mutación, Ser241Pro (con base en la numeración de Kabat) se introdujo en la región de articulación de la secuencia γ4 para evitar la formación de moléculas a la mitad cuando el lgG4 se expresa en cultivos de células de mamíferos (Schuurman y asociados, Mol. Immunol. 38:1 (2001)). La secuencia de la región de articulación γ4 humana entre los sitios de restricción Psl y Stul (56 bp) fue reemplazado con el fragmento de ADN sintético con sustitución del codón TCA para Ser241 a CCG de Pro. La secuencia genómica γ1 humana en hL243pdHL2 fue sustituida con la secuencia γ4 mutada, dando como resultado el vector de expresión final, designado como hL243γ4PpdHL2, para el isotipo lgG4 hL243.

Transfección y expresión de anticuerpos hL243
En un método de ejemplo, se linealizaron aproximadamente 30 μg del vector de expresión para hL243 o hL243γ4P mediante digestión con Sail y se transfectaron en células Sp2/0-Ag14 mediante electroporación (450V y 25 uF). Las células transfectadas se revestieron en placas de 96 depósitos durante 2 días y posteriormente se seleccionaron para resistencia a fármacos agregando MTX en el medio y a una concentración final de 0.025 pM. Las colonias resistentes a MTX emergieron en los depósitos a las 2 a 3 semanas. Los sobrenadantes de la selección de supervivencia de las colonias fueron clasificados con respecto a secreción Ab humana mediante ensayo de ELISA. En síntesis, se agregaron 100 μl de sobrenadantes a los depósitos de una placa de microtitulación recubierta con Ab específica de GAH-lgG, F(ab')2, y se incubaron durante 1 hora a temperatura ambiente. Se eliminaron las proteínas no enlazadas lavando tres veces con amortiguador de lavado (PBS que contiene polisorbato 20 al 0.05%). Se agregó a los depósitos el Ab específico de fragmento GAH-lgG, Fc conjugado con HRP. Después de una incubación a 1 hora, se lavó la placa. El Ab conjugado con HRP enlazado se reveló leyendo A4g0 nm después de la adición de una solución de substrato que contiene 4 mM y 0.04% H2O2. Los clones de célula positiva se expandieron y hL243 y hL243γ4P se purificaron a partir del sobrenadante de cultivo celular mediante cromatografía de afinidad en una columna de proteína A.
Especificidad enlace-Ag de hL243
En un ejemplo, se mostró la actividad enlace-Ag y especificidad de hL243 a través de un ensayo de enlace de superficie celular. Se incubaron células Raji en PBS/BSA (1%) que contienen una concentración saturada de hL243 purificada (20 μg/ml) durante 1 hora a una temperatura de 4°C. Después del lavado, se detectó el hL243 enlazado a la superficie celular incubando las células Raji en el amortiguador que contiene el segundo anticuerpo conjugado con PE (específico de fragmento Fc, IgG antihumano de cabra) y contando en un sistema Guave PCA (Guava Technologies, Inc., Hayword, CA). Tal como se muestra en la figura 7, el hL243 enlazado a un antígeno en células Raji reconocidos mediante mL243 debido a que el enlace es bloqueado específicamente mediante preincubación de las células con mL243, lo que indica que la especificidad de enlace-Ag de mL243 se conserva en la versión humanizada.
Actividad de enlace-Ag de hL243γ4P
En un método de ejemplo, se llevó a cabo un ensayo celular de competición para evaluar la inmunorreactividad de hL243γ4P con relación al mL243 de origen. Se incubó en una cantidad constante de L243 o hL243γ4P de murino etiquetado con 25l (100,000 cpm, -10μCi/μg) con células de linfoma humano (Raji, Daudi o Ramos) en la presencia de concentraciones diversas (0.2-700 nM) de hL243γ4P purificado o L243 de murino a una temperatura de 4°C durante 1 a 2 horas. Se eliminaron los Abs no enlazados lavando las células en PBS. La radioactividad asociada con la célula se determinó después del lavado. Tal como se muestra en la figura 8, el L243 y los hL243γ4P mAbs compitieron entre sí para el enlace al antígeno de la superficie celular, indicando que reconocieron la misma determinante antigénica. hL243γ4P mostró una avidez ~2 veces más fuerte aparente que mL243 debido a que compitió mejor que mL243 (ECso de ~7 vs. -16.5 nM).
La constante de afinidad de enlace de antígenos de hL243γ4P fue determinada mediante ensayo de enlace de superficie de célula para que los anticuerpos radioetiquetados y análisis de trazo Scatchard. Para medir el enlace de antígeno de superficie celular específico, se preparó en los grupos de células y se utilizaron en el ensayo para estimar el enlace no específico y total de las radioactividades, respectivamente. Las células de enlace no específico fueron incubadas previamente con una cantidad en exceso de Ab no etiquetado para bloquear todos los sitios de antígeno de superficie antes de agregar el anticuerpo radioetiquetado, aunque los del enlace total fueron incubados previamente en PBS. Después de la incubación previa, se agregaron diversas cantidades ya sea de 125l-hL243γ4P o 125l-mL243 y se incubaron con 2x105 de células de linfoma humano (Raji, Daudi o Ramos) a una temperatura de 4°C durante 2 horas y se eliminaron los anticuerpos no enlazados mediante el lavado. Se contó la radioactividad asociada con la célula. El enlace de superficie celular específico del anticuerpo radioetiquetado en una concentración determinada del anticuerpo radioetiquetado, se calculó en la siguiente forma: los conteos del enlace total se resta de los conteos del enlace no específico. Posteriormente se llevó a cabo un análisis de trazo Scatchard para determinar el número máximo de sitios de enlace hL243γ4P y mL243 por célula y las constantes de disociación aparente del enlace de equilibrio. Tal como se muestra en la figura 9, el enlace máximo de hL243γ4P y mL243 a célula Daudi fue virtualmente el mismo, -6x1 moléculas O5/células, lo que indica que enlazaron al mismo Ag. Se calcularon los valores constantes de disociación aparente de hL243γ4P y mL243, siendo 2.6 y 14 nM, respectivamente. Se obtuvieron resultados similares obtenidos con células Raji y Ramos (datos no mostrados).
Ejemplo 2. Estudios Funcionales hL243y4P
En un método de ejemplo, se llevaron a cabo estudios a base de células in vitro para determinar si hL243γ4P había retenido su efecto antiproliferativo y si se habían eliminado las funciones de enlace de complemento y célula efectora. En este estudio de ejemplo que se describió más adelante, se indica que se mantuvo el efecto antiproliferativo como en tanto que se eliminaron las funciones de enlace de complemento y célula efectora.

Ensayo de célula efectora
La meta de reemplazar la región Fc de hL243 con la región Fc de isótopo lgG4, fue eliminar las funciones de la célula efectora a través del receptor-Fey y el enlace de complemento. Se llevaron a cabo ensayos CDC y ADCC para evaluar estas funciones mediante hL243γ4P.
CDC
Se incubaron células Daudi con diluciones en serie de los anticuerpos hL243, hL243γ4P, hA20 (como otro control positivo) y hMN14 (control negativo) en la presencia de complemento humano durante 2 horas. Este estuvo seguido de la adición de resazurin para evaluar la viabilidad celular. Se incluyeron controles de lisis tanto no tratados como máximos. Se obtuvieron lecturas de fluorescencia 5 horas después de la adición de resazurin. El nivel de fluorescencia obtenido está directamente correlacionado con la cantidad de células viables. Se calculó un porcentaje de células viables a través de la fórmula (lisis prueba-máxima)/(lisis control no tratado -máximo) x 100. Los resultados indican que hL243γ4P no produce efecto citotóxico transmitido por complemento alguno en células en comparación con hL243 (EC50 = 2.6 nM) y hA20 (EC5o = 0.66 nM). Ver figura 10.
ADCC
Se incubaron células Daudi con A20, hL243, hL243γ4P y hMN-14 en 5 μg/ml. Se agregaron células efectoras en una proporción de 50:1. Después de 4 horas se ensayó la lisis celular mediante liberación LDH (figura 11A) y la lisis celular (figura 1 IB).
En estos resultados en donde se muestran los efectos del anticuerpo sólo en células efectoras, se puede observar que el KL243 indujo la lisís significativa de las células efectoras en tanto que hL243γ4P no lo hizo. Cuando las figuras de lisis específicas se corrigen con respecto al efecto en células efectoras hL243γ4P, se mostró una lisis muy reducida de las células objetivo en comparación con hL243 (12% vs 48%).
Ensayo de proliferación in vitro
Se llevaron a cabo ensayos colorimétricos múltiples utilizando tanto biorreducción MTS (para determinación del número de células viables) y BrdU (para cuantificación de proliferación celular con base en la medida de incorporación BrdU durante la síntesis de ADN). Se incubaron células Daudi y Raji con diluciones en serie de hL243γ4P durante 2 y 3 días. Se utilizaron mL243 y hMN-14 con controles positivos y negativos, respectivamente. Después de la incubación, se llevaron a cabo ensayos BrdU y MTS. Los resultados de los ensayos MTS se muestran más adelante. Los ensayos BrdU proporcionaron resultados similares.
En un método de ejemplo, se llevaron a cabo ensayos colorimétricos múltiples utilizando tanto biorreducción MTS (para determinación del número de células viables) como BrdU (para cuantificación de la proliferación celular con base en la medida de incorporación BrdU durante síntesis de ADN). Se incubaron células Daudi y Raji con diluciones en serie de hL243γ4P durante 2 y 3 días. Se utilizaron L243 y hMN14 de murino como controles positivos y negativos, respectivamente. Después de la incubación, se llevaron a cabo ensayos BrdU y MTS. Los resultados para ensayos MTS se muestran en las figuras 12 y 13. Los ensayos BRDU proporcionaron resultados similares (no mostrados). Estos resultados indican que hL243γ4P inhiben la proliferación de líneas de células Raji y Daudi. Sin embargo en experimentos similares en la línea de célula negativa EBV Ramos, la inhibición de la proliferación se observó únicamente en la presencia de un anti anti Fc (Fab)2 de reticulación.
Eiemplo 3: Comparación de eficacia in vivo de hL243γ4P y mL243 (lgG2a) en un modelo de xenoinjerto de linfoma de no Hodgkin humano
En un método de ejemplo, se llevó a cabo un estudio terapéutico para comparar la eficacia in vivo de isotipo de anticuerpo monoclonal L243-lgG4 humanizado y L243-lgG2a de un murino, en un modelo de xenoinjerto de linfoma de no Hodgkin humano (Raji). Los estudios in vitro previos han mostrado que el reemplazo de la región Fc de L243-lgG1 con un isotipo lgG4, elimina las funciones de la célula efectora (ADCC y CDC), reteniendo al mismo tiempo los efectos antiproliferativos.
Los estudios previos utilizaron anticuerpos anti-HLA-DR completamente humanos construidos en la forma de un isotipo lgG4, también mostraron minimizar los efectos secundarios debidos a las funciones efectoras transmitidas por la porción Fc, proporcionando al mismo tiempo excelente actividad tumurocidal in vitro, e in vivo en modelos de xenoinjerto de linfoma de no Hodgkin y modelos animales (monos cinomolgus) con efectos hematológicos no duraderos. Ver la publicación de Nagy y asociados, Nature Medicine, 8:801 (2002). Por lo tanto, este estudio ayudó a determinar si hL243-lgG4 puede mantener una eficacia antitumor significativa en un modelo de xenoinjerto. En la ausencia de una cantidad suficiente de hL243-lgG1, se utilizó mL243 lgG2a (lgG2a de murinos en equivalente de I gG 1 en la fijación de complemento, y efectúa ADCC).
Se inyectaron ratones SCID con 2.5 millones de células Raji. Se inició la terapia con hL243-lgG4 o mL243-lgG2a un día después de la administración de célula de tumor. Ambos grupos de ratones inyectados con solución salina o con anticuerpo de control no específico, hMN-14, tuvieron un tiempo de supervivencia medio (MST) de 17 días. Todos los grupos de ratones tratados ya sea con L243 humanizado o de murino, tuvieron una expansión de vida mejorada en forma significativa en comparación con ratones inyectados con solución salina o hMN-14 (PO.0001). El tratamiento con diversas dosis de hL243 lgG4 dio como resultado una relación de respuesta de dosis, en donde los ratones que recibieron mayores dosis tuvieron mejores tiempos de supervivencia. En el grupo de animales tratados con diversas dosis de mL243 lgG2a, el rango de curación estuvo en el rango de 80-100%. Ver figura 14.
Este estudio mostró la retención concurrente de eficacia antitumor y de eliminación de la actividad de enlace de complemento de la construcción lgG4 de L243. No obstante, este estudio se llevó a cabo en ratones, se pueden lograr beneficios terapéuticos significativos utilizando las construcciones antes mencionadas en todos los mamíferos que padezcan de enfermedades autoinmunes, linfomas o leucemias. En particular, las construcciones antes mencionadas que se pueden utilizar efectivamente en (i) animales domésticos, especialmente gatos, perros y caballos, para tratar enfermedades autoinmunes y linfomas/leucemias; e (ii) humanos, para el tratamiento de enfermedades autoinmunes, linfomas y leucemias, así como enfermedades de desregulación inmunológica, metabólicas y neurodegenerativas que implican la expresión HLA-DR.
Ejemplo 4: Comparación in vitro de hL243 con L243 y MAbs de célula anti-B en el tratamiento de linfomas humanos y de canino.
Se probó una muestra de 0.5 mg de hL243 (isotipo lgG4) con respecto a reactividad con líneas de célula de linfoma y un aspirado de linfoma de célula-B de perros en comparación con L243 de murino, así como en comparación con otras MAbs de anti-B. También se llevaron a cabo dos estudios funcionales. Se determinó la capacidad de hL243 para inducir apoptosis en el aspirado de linfoma de perro, y la actividad antiproliferativa de hL243 fue probar contra Namalwa, una línea de célula de linfoma humano reportado para ser resistente a rituximab.
El enlace de MAbs humanizados o quiméricos en linfoma de célula-B humano, se midió mediante citometría de flujo utilizando un Clasificador Fluorescence-Activated Cell (FACS) en el cual se mancharon los siguientes MAbs - hMN-14, hLL 1, hLL2, hA20, Rituxan y hL243 con IgG Fc anti-humano de cabra (GHA) FITC. Las líneas de células elegidas fueron Namalwa (una línea de célula de linfoma de célula-B humano resistente a rituximab), SU-DHL-6 (un linfoma de no Hodgkin de célula-B humana), WSU-FSCCL (una línea de célula de linfoma de célula-B humano de bajo grado negativo - EBV), células Raji, Daudi y Ramos: tal como se muestra en la tabla 2, hL243 enlazó a todas las líneas de células antes mencionadas. En particular, hL243 enlazó a las células Namalwa que no responden a CD20, lo que muestra un mayor enlace que otros MAbs humanizados. Ver la tabla 1. Además, hL243 demostró actividad antiproliferativa en la línea de célula de linfoma de célula-B humano resistente a rituximab, Namalwa, tal como se mide a través de un ensayo de captación de 3-H-timidina. El otro anticuerpo CD20, A20 humanizado (hA20), desarrollado por Immunomedics, Inc., mostró resultados similares con rituximab, un anti-CD20 quimérico conocido como Rituxan®. Ver la publicación de Stein y asociados (2004) Clin. Cáncer Res. 10: 2868-2878.
Tal como se muestra en la figura 16A-B, el hL243 produjo el 28% de inhibición de la proliferación cuando se proporciona solo; esto se incrementó al 51% cuando hL243 se proporcionó en combinación con el segundo anticuerpo IgG anti-humano. Cuando se utilizó en combinación con rituximab, la actividad se incrementó a un nivel mayor al de cualquier MAb solo. Ver figura 16-B.
Los estudios también han mostrado que hL243 tuvo mayor afinidad de enlace a las células de linfoma de perro que otros MAbs humanizados. Ver tabla 3. Además, KL243 tuvo la capacidad de inducir apoptosis en las células de linfoma de perro cuando se reticularon con el segundo anticuerpo IgG antihumano, medido como el porcentaje de células con un contenido de ADN de subíase GO/G1. Ver figura 15.
Eiemplo 5: combinaciones de anticuerpo hL243 y sus efectos

Métodos
Anticuerpos
En un método de ejemplo, el clon de célula de hibridoma que produce el anticuerpo monoclonal anti-HLA-DR, L243, se obtuvo en ATCC (número ATCC HB-55). Las células se cultivaron en un medio HSFM (Life Technologies, Inc.) suplementado con FBS al 10% (Hyclone). Los genes que codifican los genes VK y VH de L243 fueron clonados mediante RT-PCR. El L243 humanizado (isotipo lgG1/κ), hL243γ1, fue generado en forma similar, tal como ha sido descrito previamente (Leung y asociados, Hybridoma 13:469 (1994); Leung y asociados, Mol. Immunol. 32:1413 (1995); Stein y asociados, Blood 104:3705 (2004); Govindan y asociados, Breast Cáncer Res. Treat. 84:173 (2004)).
El isotipo lgG4/κ de hL243, hL243y4p, se puede construir reemplazando la secuencia de codificación de región constante de cadena pesada de la cadena γ1 humana con la de la cadena γ4. Una mutación de punto, Ser241Pro (basada en numeración de Kabat) fue introducida en la región de articulación de la secuencia γ4 con el objeto de evitar la formación de medias moléculas cuando se expresa el anticuerpo y se produce en cultivos de células de mamíferos (Schuurman y asociados Mol Immunol. 38:1 (2001)). Otros MAbs utilizados en los estudios fueron rituximab, comprados por ejemplo en IDEC Pharmaceuticals Corp. (San Diego, CA)5 y hMN-14, y hMN-14 o labetuzumab (I gG 1 de antígeno anti-carcinoembriónico humanizado), proporcionado por Immunomedics, Inc. La construcción y caracterización de hMN-14, aquí utilizada como un control de isotipo negativo, se ha descrito previamente.

Células
Las líneas celulares de ejemplo fueron utilizadas en diversos estudios. Por ejemplo, las líneas de linfoma de Burkitt, Daudi, Raji y Ramos se compraron en la Recolección de Cultivo Tipo Americano (Mannassas, VA). Se obtuvieron líneas de célula de linfoma de no Burkitt tal como se indica a continuación. RL y SU-DHL-16 que contienen la translocación cromosomal t( 14 ; 18), se obtuvieron con el Dr. John Gribben (Dana-Farber Cáncer Institute, Boston, MA) y el Dr. Alan Epstein (University of Southern California, Los Angeles, CA), respectivamente. Las líneas celulares SU-DHL-4, SU-DHL-10 y Karpas422 fueron proporcionadas por el doctor Myron Czuczman (Roswell Park Cáncer Institute, Buffalo, NY) y las líneas celulares WSU-FCCL y DoHH2 fueron obtenidos con el doctor Mitchell Smith (Fox Chase Cáncer Center, Philadelphia, PA). Las células se crecieron en la forma de cultivos de suspensión en DMEM (Life Technologies, Gaithersburg, MD), suplementado con suero de bovino fetal a 10%, penicilina (100 U/ml), estreptomicina (100 μg/ml) y L-glutamina (2-nM) (medio completo).
Especificidad de enlace de antígenos de MAbs hL243
La actividad de enlace de antígeno y especificidad de hL243γ1 se mostró a través de un ensayo de enlace de superficie celular. Se incubaron células Raji en PBS/BSA (1%) que contienen una concentración saturada de hL243 purificado (20 μg/ml) durante 1 hora a una temperatura de 4°C. Después del lavado, se detectó el hL243γ1 enlazado a la superficie celular incubando las células Raji en el amortiguador que contiene un segundo anticuerpo conjugado-PE, segundo anticuerpo (IgG anti-humano de cabra, específico de fragmento fc), y contando por ejemplo, en un sistema Guave PCA (Guava Technologies, Inc., Hayword, CA).
Se llevó a cabo un ensayo de enlace celular de competición para evaluar la realidad de hL243y4P con relación al mL243 de origen. Una cantidad constante de L243 ó hL243y4P de murino etiquetado con 125l (100,000 cpm, -10 μCi/μg) se incubó con células de linfoma humano (Raji, Daudi o Ramos) en la presencia de concentraciones diversas (0.2-700 nM) de hL243γ4P purificado o L243 de murino a la temperatura de 4°C durante de 1 a 2 horas. Se eliminaron los MAbs enlazados lavando las células en PBS. Se determinó después del lavado la radioactividad asociada con las células.
En un ejemplo, la constante de afinidad de enlace de antígenos hL243y4P fue determinada mediante ensayo de enlace de superficie celular directo de los anticuerpos radioetiquetados y análisis de trazo Scatchard. Para medir el enlace de antígeno de superficie celular, se prepararon dos grupos de células y se utilizaron en el ensayo de enlace para estimar el enlace no específico y total de radioactividades, respectivamente. Las células para el enlace no específico fueron incubadas previamente con una cantidad en exceso de MAb no etiquetado para bloquear todos los sitios de antígeno de superficie antes de agregar el anticuerpo radioetiquetado, en tanto que los del enlace total se incubaron previamente en PBS. Después de la incubación previa, se agregaron diversas cantidades ya sea de 125l- hL243γ4P ó 125l-mL243 y se incubaron con células de linfoma humano 2x105 (Raji, Daudi o Ramos) a una temperatura de 4°C durante 2 horas y se eliminaron los anticuerpos no enlazados mediante lavado. Se contó la radioactividad asociada con las células. EL enlace de superficie celular específico del anticuerpo radioetiquetado a una concentración determinada de anticuerpo radioetiquetado, fue calculado como se indica a continuación: los conteos del enlace total se restan de los conteos de enlace no específico. Ensayos de citometría de flujo
Inmunofenotipificación: Se llevaron a cabo ensayos de inmunofluorescencia indirecta con el panel de línea celular descrito anteriormente, utilizando IgG anti-humano FITC-cabra (Tago, Inc., Burlingame, CA) esencialmente tal como se describe anteriormente, y se analizaron mediante citometría de flujo utilizando un FACSCaliber (Becton Dickinson, San José, CA).
Análisis de apoptosis de Ejemplo: Se llevó a cabo el análisis citométrico de flujo ADN celular después de la tinción con yoduro de propidio. Las células se colocaron en placas de 24 depósitos (5x10 células/depósito) y posteriormente se trataron con MAbs (5 μg/ml). Se prepararon tres depósitos cada uno con MAb para estudiar los efectos de reticulación con segundos anticuerpos anti-ratón de cabra o anti-humano de cabra. Después de una incubación de 20 minutos con los MAbs primarios (37°C, 5% CO2), se agregó el segundo anticuerpo específico de IgG Fcy de anti-ratón de cabra F(ab')2 (Jackson Laboratories, West Grove, PA) a un depósito procedente de cada MAb primario para ajustar la concentración del segundo anticuerpo a 20 μg/ml. Se agregó en forma similar específico IgG Fcy anti-humano de cabra F(ab')2 (Jackson Laboratories) al segundo depósito procedente de cada MAb primario, y se ecualizó el volumen del tercer grupo mediante la adición de medio. Después de 48 horas de incubación (37°C, 5% CO2), las células se transfirieron a tubos de prueba, se lavaron con PBS, y posteriormente se suspendieron nuevamente en una solución de yoduro de propidio hipotónica (50 mg/ml de yoduro de propidio en 0.1% de citrato de sodio, 0.1% Tritón X-100). Las muestras se analizaron mediante citometría de flujo utilizando un FACSCaliber. Se definió el porcentaje de células apoptóticas como el porcentaje de células con tinción de ADN antes del pico G1/G0 (hipodiploide).
Construcción de caracterización de hL243
En un método de ejemplo, se generaron dos MAbs anti-DR humanizados. Se designo hL243γ1 para tener regiones constantes lgG1/κ de humano, y se construyó hL243γ4p reemplazando la secuencia de codificación de región constante de cadena pesada de la cadena γ1 humana con la de la cadena γ4 humana. Se introdujo una mutación de punta, Ser241Pro, en la región de articulación de la secuencia γ4 con el objeto de reducir la formación de moléculas a la mitad cuando el anticuerpo se expresó y produjo en cultivo de células de mamíferos (Schuurman y asociados, Mol Immunol. 38:1 (2001)). En las figuras 7, 8 y 17 se muestra la capacidad de los dos anticuerpos L243 humanizados, γ1 y γ4P, de enlazar a células Raji. En la figura 7, hL243γ1 se enlaza a células Raji, se bloqueó en forma específica mediante incubación previa de las células con el L243 de murino de origen (mL243), que indica que la especificidad de enlace de antígeno de mL243 se conservan en la versión humanizada.
En un ejemplo, la reactividad de hL243γ4P con relación al mL243 de origen se evaluó y se llevó a cabo un ensayo de enlace de células de competición. Una constante de mL243 ó hL243γ4P etiquetadas con 25l se incubó con células de linfoma humano (Raji, Daudi o Ramos) en la presencia de diversas concentraciones de hL243γ4P ó mL243 purificado. Tal como se muestra en la figura 8, los MAbs mL243 y hL243γ4P compitieron entre sí para el enlace al antígeno de superficie celular, que indica el reconocimiento de una determinante antigénica común. hL243γ4P una avidez de enlace aparente aproximadamente 2 veces más fuerte L243 (EC50 de -7 vs. -16.5 nM). El número máximo en sitios de enlace hL243γ4P y mL243 por célula y las constantes de disociación aparentes del enlace de equilibrio, se determinaron mediante análisis de trazo Scatchard. Tal como se muestra en la figura 17, el enlace máximo de hL243γ4P y mL243 a células Daudi, fue virtualmente idéntico, aproximadamente 6x105 moléculas/célula, consistente con el enlace a un antígeno común. Los valores constantes de disociación aparente para hL243γ4P y mL243 se calcularon para ser 2.6 nM y 14 nM, respectivamente. Se obtuvieron resultados similares con células Raji y Ramos (datos no mostrados).
Expresión de antígenos de célula de linfoma cultivado
En un método de ejemplo, se llevó a cabo análisis de citometría de flujo utilizando tinción de inmunofluorescencia indirecta para mostrar que hL243γ4P se enlaza a un panel de línfoma de célula B humanas cultivadas. Se muestra una comparación con otros antígenos de superficie. Tal como se muestra en la Tabla 4, el MAb hL243γ4P enlaza a todas las líneas celulares probadas. Se observó una expresión más fuerte en Daudi y Raji, aunque el nivel de tinción fluorescente es más fuerte en todas las líneas celulares. Se comparó el enlace al de los MAbs humanizados contra otros antígenos de célula-B (CD74, CD22, CD20), el rituximab MAb anti-CD20 quimérico de murino-humano, y MAb anti-CEA humanizado (control negativo). La tinción con hL243γ4P es marcadamente mayor que la de CD22 y CD74 en las siete líneas celulares. Fue más variable la tinción CD20, tal como se muestra mediante reactividad con los MAbs humanizados (hA20) y quiméricos (rituximab). Las líneas de Burkitt, Daudi, Raji, y Ramos, expresan niveles intermedios de CD20, mientras que variaron las líneas evaluadas de linfoma de célula-B grandes foliculares y difusas. En comparación con la expresión HLA-DR medida a través de enlace hL243γ4P, SU-DHL-6 tuvo una mayor expresión CD20, Namalwa, y expresión CD20 inferior WSU-FSCCL, y RL una expresión aproximadamente igual de ambos antígenos.
Ensayos de célula efectora
En un ejemplo, Se reemplazó la región de Fc hL43 con una región Fc de isotipo lgG4 para eliminar las funciones de la célula efectora a través del receptor-Fe y enlace de complemento. Se llevaron a cabo ensayos CDC y ADCC para evaluar estas funciones.
En otro método de ejemplo, se incubaron células Daudi CDC con diluciones en serie de anticuerpos hL243γ1, hL243γ4P, hA20 (como otro control positivo) y hMN14 (control negativo, anti-CEA) en la presencia de complemento humano durante 2 horas. Esto estuvo seguido de la adición de resazurin para evaluar la viabilidad celular. Se incluyeron controles de lisis tanto máximos como no tratados. Se obtuvieron lecturas de fluorescencia 5 horas después de la adición de resazurin. El nivel de fluorescencia obtenido está directamente correlacionado con el número de células viables. Los resultados en la presente invención indican que hL243γ4P no produce un efecto citotóxico transmitido por complemento en células en comparación con hL243γ1 (EC50 = 2.6 nM) y hA20 (EC50 = 0.66 nM) en donde se observó CMC (figura 10 y 18).
La inducción de ADCC también se midió en Raji, Daudi, y SU-DHL-6 mediante liberación AM de calceína. La actividad de hL243γ4P se comparó con la de L243 de murino y rituximab, como un control positivo. Tal como se espera, el rituximab y el L243 de murino indujo en forma significativa mayor lisis celular que los controles negativos (sin MAb y MN-14 de murino y humanizado) y hL243γ4P no lo hizo (figura 19).
Efectos anti-proliferativos in vitro
En un ejemplo, el efecto de hL243 en proliferación celular fue evaluado utilizando un ensayo de captación de 3H-timidina en Raji, FSCCL, y Namalwa (Figura 20B y Tabla 5). Se comparó el efecto de hL243γ4P con el de rituximab y de rituximab combinado con hL243γ4P, en la presencia o ausencia de anticuerpo anti Fc de reticulación. En FSCCL, que mostró previamente ser relativamente insensible a rituximab, hL243γ4P produjo una inhibición de proliferación significativamente mayor que rituximab. En Ramos, la actividad hL243 y rituximab fueron similares, y la combinación fue más efectiva que cualquiera solo. La combinación puede tener un efecto sinérgico. La reticulación con un anticuerpo Fc anti-humano es requerida para la actividad anti-proliferativa significativa observada en Ramos. En Namalwa, como con FSCCL, hL243γ4P produjo una inhibición de proliferación significativamente mayor que rituximab y la combinación de rituximab y hL243γ4P produjo una inhibición significativamente mayor que la proliferación de cualquier MAb solo.
Evaluación de Inducción de Apoptosis
En un método de ejemplo, se evaluó el mecanismo de los ensayos que se llevaron a cabo de muerte celular inducidos por hL243γ4P, midiendo varios marcadores de apoptosis. Estos incluyeron la inducción de fragmentación de ADN, tinción Annexin V/7-AAD, medición de caspasa-3 activada, pérdida de potencial de membrana mitocondrial y activación de la trayectoria de supervivencia AKT.
En otro ejemplo, se evaluó la fragmentación de ADN mediante citometría de flujo en SU-DHL-6 y Namalwa. Las células se cultivaron con las MAbs durante 48 horas con o sin un segundo MAb para reticulación, seguido de tinción de ADN con yoduro de propidio. Las células se analizaron mediante citometría de flujo, y la fluorescencia positiva debajo de la región G1 representa la fragmentación de ADN y es una medida de apoptosis. Se comparó la actividad de hL243γ4P con la de MAbs humanizados contra otros antígenos de célula-B, incluyendo anti-CD74 (hLL1), anti CD22 (hLL2, epratuzumab), anti-CD20 (hA20), así como la del rituximab de MAb quimérico de murino-humano. Los controles no incluyeron el primer MAb y el MAb anti-CEA humanizado control negativo, hMN-14. hL243γ4P indujo la apoptosis en ambas líneas celulares, en niveles similares a o mayores a los de los otros MAbs anti-célula B (Figura 21A y 21B).
En una modalidad en particular, se utiliza un equipo (por ejemplo el equipo Guava NexinTM) para diferenciar entre células muertas apoptóticas y no apoptóticas en células Daudi. En este ejemplo, el equipo utiliza Annexin-V-PE para detectar la fosfatidilserina (PS) en la membrana externa de las células apoptóticas y la tinta impermeable a células 7-AAD como un indicador de la integridad estructural de la membrana. 7-AAD se excluye de células vivas, saludables y células con apoptosis temprana, pero permeabiliza las células apoptóticas y muertas de etapa tardía. Tal como se muestra en la figura 21B los resultados de este estudio indican que la apoptosis inducida por hL243γ4P similar a mL243 siguió después de un tratamiento de 4 horas y 24 horas. En contraste, el MAb anti-CD20 no induce la apoptosis medible en Daudi. Por consiguiente, se puede utilizar hipereticulación a través de un agente secundario, tal como IgG anti-humano, o proteína A para inducción de apoptosis mediante MAbs anti-CD20 en muchas líneas celulares incluyendo Daudi.
En otro ejemplo, los efectos de L243 humanizado y de murino potencial mitocondrial se estudio en diferentes células, a saber, SU-DHL-6, Daudi, Raji, WSU-FSCCL, RL, y Namalwa.

Los resultados se representan en la figura 22, la cual indica que se observaron cambios apoptóticos en el potencial de membrana mitocondrial con MAbs L243 tanto de murino como humanizados. La reticulación con un segundo anticuerpo puede no ser necesaria, pero puede incrementar el efecto en 2 de 6 líneas celulares evaluadas, FSCCL y Namalwa. La pérdida de potencial de membrana mitocondrial inducida por hL243γ4P, fue mayor que la del MAb anti-CD20 (hA20), sin un agente de reticulación. Con la reticulación, los niveles de hA20 se incrementaron a los de hL243γ4P en 3 de 6 líneas celulares (RL, SU-DHL-6, y Daudi).
En un ejemplo, la inducción de caspasa-3 activada mediante L243 humanizada y murino se ensayó mediante citometría de flujo en un panel de línea celular de linfoma. El resultado resumido en la Tabla 6 representa que L243 tanto de murino como humanizado induce la activación de caspasa-3, en niveles similares, en la ausencia de reticulación con un segundo anticuerpo. La inducción de caspasa-3 activada con los MAbs L243 es mayor en todas las líneas celulares que la de hA20. Con un segundo anticuerpo, estos niveles se incrementaron y el efecto de hA20 es similar al de hL243γ4P, excepto en Namalwa y FSCCL, dos líneas celulares que observamos rutinariamente como relativamente insensible a MAbs anti-CD20. La caspasa-3 disociada también fue ensayada en Daudi durante un tiempo de 2 días (figura 23A). La actividad continúa incrementando 2 días después de la incubación de L243γ4P. Los puntos de tiempo menores a 1 no fueron tomados en cuenta.
En un ejemplo, la implicación de AKT en el mecanismo de acción de L243 fue ensayada en 6 líneas celulares mediante citometría de flujo. Las células se incubaron con diversos MAbs durante 2 días, y posteriormente se ensayaron para fosfo-AKT. Los resultados descritos en la Tabla 7, muestran que L243 activa AKT en todas las líneas celulares. Los niveles fosfo-AKT en anti-CD20, hA20, células tratadas, así como células tratadas con CD74 y anti-CD22 (no mostrado), son similares a células no tratadas en todas las líneas celulares. Para determinar el transcurso de tiempo de la activación P-AKT, se incubaron células Daudi con MAbs para diversos tiempos, MAbs se eliminaron (mediante centrifugación) en los puntos de tiempo de 0 minutos hasta alrededor de 2 días (figura 23B). Estos resultados representan que la activación AKT mediante L243 puede ocurrir en forma más rápida que lo que se puede medir en este ensayo, debido a que incluso en el punto de tiempo 0, los niveles P-AKT son iguales a los del punto de tiempo de 2 días.
Eficacia terapéutica in vivo de hL243 en un modelo de xenoinjerto de linfoma de no Hodgkin (Raji)
En un método de ejemplo, se llevó a cabo un estudio terapéutico para comparar la eficacia in vivo de anticuerpos monoclonales hL243γ4P y mL243 (isotipo lgG2a), en un modelo de xenoinjerto de linfoma de no Hodgkin humano (Raji). El objetivo de este estudio puede determinar si hL243γ4P puede mantener una eficacia antitumor significativa en un modelo de xenoinjerto. Se inyectaron ratones SCID con 2.5 x 106 células Raji. Se inició la terapia con hL243γ4P o mL243 1 día después de la administración de célula de tumor. Los resultados se muestran en la figura 24. Ambos grupos de ratones inyectados con solución salina o con anticuerpo de control no específico, hMN14, tuvieron un tiempo de supervivencia promedio (MST) de 17 días. Todos los grupos de ratones tratados ya sea con L243 humanizado de murino tuvieron una extensión debida mejorada en forma significativa en comparación con ratones inyectados con solución salina o hMN14 (P<0.0001). El tratamiento con diversas dosis hL243γ4P dio como resultado una relación de respuesta dosis, con ratones que reciben mayores dosis que tienen mejores tiempos de supervivencia. En el grupo de animales tratados con diversas dosis de mL243 lgG2a, el rango de curación estuvo dentro del rango de 80-100%.
Tabla 1. Comparación de enlace de MAbs humanizado y de murino en Namalwa
MAbs PROMEDIO GEO MAbs de PROMEDIO GEO
Humanizado Fluorescencia Múrido Fluorescencia 2d°.
de 2"°. AB :FITC Ab: FITC GAM
GAH
Ninguno 2.52 Ninguno 2.91
HMN14 2.49 Ag8 3.64
hRS7 2.47 MN14 3.32
hLL1 10.06 RS7 3.39
HLL2 6.76 LL1 17.31
hA20 6.28 LL2 10.46
Rituximab 7.33 1F5 3.83
HL243 324.16 m2B8 6.16
L2 3 594.96 Tabla 2. Fenotipificación de líneas celulares (enlace de

MAbs humanizadas o quiméricas en líneas de células-B mediante ensayo FACS).
Ensayo indirecto utilizando tinción de 2do. Ab FITC-GAH Fc
Flourescencia Promedio Geométrica Rituxim
ninguna hMN14 hLL1 hA20 ab HL243

Namalwa 2.5 2.36 7 .81 6.4 10. .11 14.12 260.8

SU-DHL-6 4.6 4.94 17 .29 11 1199 .34 1308.89 572.2

WSU-FSCCL 2.6 2.66 8 .66 4.1 8. .91 12.45 466.7

Raji 6.8 6.96 95 .10 22 267 .09 394.57 971.9

Daudi 3.1 3.16 48 .77 51 240. .96 380.45 937.4

Ramos 3.1 3.13 23 .25 14 203. .65 374.98 277.5

Tabla 3. Fenotipificación aspirado de linfoma de perro

MAbs de Múrido MAbs Humanizado
% FL Promedio % FL Promedio ninguno 3.85 3.37 ninguno 4.48 3.24

Ag8 2.81 3.04 hMN-14 4.63 3.24

L243 77.77 10.41 hL243 26.33 5.47 m2B8 2.61 3.11 hA20 3.96 3.25

LL1 6.69 4.01 hLL1 4.71 3.33

LL2 5.05 3.73 hLL2 4.85 3.37
Tabla 4. Enlace de MAbs humanizados o quiméricos en líneas de célula-B. Se llevó a cano un ensayo de citometría de flujo indirecto utilizando tinción con 2do. anticuerpo específico FITC-GAH.

Fluorescencia Promedio Geométrica
anti-CEA anti-CD74 anti-CD22 anti-CD20 anti-CD20 anti-HLA-DR ninguna
(hMN14) (hLL1) (hLL2) (hA20) (Rituximab) (hL243γ4P)

Daudi 3.2 3.2 48.8 51.7 241.0 380.5 937.4

Namalwa 2.6 2.4 7.8 6.4 10.1 14.1 260.9

Raji 6.9 7.0 95.1 22.6 267.1 394.6 972.0

Ramos 3.1 3.1 23.3 14.6 203.7 375.0 277.6

RL 2.4 2.8 7.9 5.1 127.5 147.8 112.2

SU-DHL-6 4.6 4.9 17.3 11.0 1199.3 1308.9 572.3

WSU-FSCCL 2.7 2.7 8.7 4.2 8.9 12.5 466.8 Tabla 5. Resumen de actividad antiproliferativa de MAbs con y sin reticulación (% de Inhibición de captación de 3-H-Timidina)

Rituximab+hL243 Rituximab hL243γ4P

Actividad antiproliferativa de MAbs sin reticulación
Ramos 18.2±4.9 -7.9±3.6 10.1±11.9
(0.0001 )a (0.3619)
FSCCL 75.9±10.2 13.4±12.3 78.9±1.7
(0.0028) (0.6611)
Namalwa 50.1 ±1.1 13.8±5.6 27.8±3.3
(0.0061) (0.0038)

Actividad antioroliferativa de MAbs en la presencia de 2d0 Ab anti-humano
Ramos 69.0±7.0 50.5±9.4 56.8±0.8
(0.0519) (0.0073)
FSCCL 94.5±0.9 28.1±9.6 94.5±0.8
(0.0067) (0.9984)
Namalwa 58.1 ±2.1 14.7±7.0 51.5±3.0
(0.0050) (0.0416)
aLos números en los paréntesis representan valores P de los MAbs simples en comparación con la combinación de rituximab + hL243γ4P.

Tabla 6. Ensayo de Caspasa- -3 Disociada

Caspasa-3 asociada (%arriba de control MAb)
MAb s Humanizado MAbs de mu rido

Sin reticulación hL243γ4P hA20 hMN-14 mL243 mMN-14

Ramos 26.9 3.2 0.8 15.8 39

Namalwa 18.4 -0.1 0.2 9.4 0.5

FSCCL 46.4 0.7 0.3 26.2 -0.7

Daudi 48.1 7.9 0.9 45.8 1.0

RL 22.5 1.5 -0.1 18.2 -0.3

SU-DHL-6 52.2 30.9 2.3 46.5 0.2

Raji 22.5 1.5 -0.1 18.2 -0.3

con 2do. Ab
Ramos 71.7 67.8 7.3 40.3 3.0

Namalwa 72.2 20.4 7.9 25.2 -0.3

FSCCL 86.7 20.0 8.4 55.0 1.5

Daudi 68.9 72.0 2.9 51.2 0.0

RL 37.3 24.2 4.0 4.0 0.7

SU-DHL-6 72.1 75.8 5.5 51.4 -0.9

Raji 59.8 37.4 2.8 20.4 -0.3

Tabla 7. Ensayo P-AKT

% arriba de control si in Mab
MAbs Humanizado MAbs de múrido
hL243γ4P hA20 hMN-14 mL243 mMN-14
Namalwa 8.4 -2.8 1.3 3.5 -4.4
FSCCL 25.1 -1.4 3.9 16.3 -1.7
Daudi 34.9 1.0 -1.4 24.5 -2.1
RL 5.9 1.8 0.0 1.3 1.3
SU-DHL-6 29.8 0.2 1.2 26.1 -0.5
Raji 5.1 -0.9 -1.6 17.2 -4.2

Todas las COMPOSICIONES y/o MÉTODOS y/o APARATOS descritos y reivindicados en la presente invención, pueden ser elaborados y ejecutados sin una experimentación indebida a la luz de la presente descripción. Aunque las composiciones y métodos de la presente invención han sido descritas en términos de modalidades preferidas, los expertos en la técnica podrán apreciar que la variación puede aplicarse a las COMPOSICIONES y/o MÉTODOS y/o APARATOS y en los pasos o en las secuencias de los pasos de métodos aquí descritos sin apartarse del concepto, espíritu y alcance de la presente invención. En forma más específica, se podrá apreciar que ciertos agentes los cuales son tanto química como fisiológicamente relacionados pueden ser substituidos por los agentes aquí descritos obteniéndose al mismo tiempo los mismos resultados o resultados similares. Todos de dichos substitutos y modificaciones apreciados por los expertos en la técnica, están considerados dentro del espíritu, alcance y concepto de la presente invención tal como se define a través de las reivindicaciones adjuntas.