Processing

Please wait...

Settings

Settings

Goto Application

1. FR2883298 - FRAGMENTS D'ACIDES NUCLEIQUES ET METHODE DE DETECTION SPECIFIQUE PAR IDENTIFICATION MOLECULAIRE DE DIFFERENTES ESPECES DE BACTERIES DU GENRE ACINETOBACTER

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ FR ]
FRAGMENTS D’ACIDES NUCLEIQUES ET METHODE DE DETECTION SPECIFIQUE PAR IDENTIFICATION MOLECULAIRE DE DIFFERENTES ESPECES DE BACTERIES DU GENRE ACINETOBACTER.
FRAGMENTS D’ACIDES NUCLEIQUES ET METHODE DE DETECTION SPECIFIQUE PAR IDENTIFICATION MOLECULAIRE DE DIFFERENTES ESPECES DE BACTERIES DU GENRE ACINETOBACTER
La présente invention concerne le domaine du diagnostic. Plus précisément, l’invention concerne une méthode pour l’identification moléculaire des bactéries du genre Acinetobacter par les techniques d’amplification et séquençage d’acides nucléiques à l’aide d’amorces oligonucléotidiques.
Les bactéries du genre Acinetobacter sont des bactéries apparaissant sous forme de cocco-bacilles Gram négatif, de croissance aérobie. On reconnaît actuellement presque 60 espèces et 2 sous espèces.
Ces bactéries sont essentiellement, mais pas uniquement, des agents d’infections nosocomiales. Leur spectre va de la simple colonisation à des infections mettant en jeu le pronostic vital, notamment des pneumonies, des infections urinaires, des bactériémies et des méningites (van Dessel et al., 2004). Leur excellente capacité de survie dans l’environnement extérieur de l’hôpital et leur capacité à développer rapidement des résistances à la majorité des antibiotiques sont des facteurs majeurs de leur émergence comme agent d’infections nosocomiales, notamment dans les unités de soin intensif (Bergogne-Berezin and Towner, 1996; Towner, 1997).
Bien que la plupart des espèces soient responsables d’infections chez l’homme, certaines espèces n’ont été isolées que dans l’environnement (Nemec et al., 2001, 2003; Carr et al., 2003).
Alors que dans le genre Acinetobacter 32 espèces ont été proposées (van Dessel et al., 2004), 24 espèces génomiques (" genomic species » selon la nomenclature en vigueur et abrégées ci-après « geno species » ou « g.sp. ») sont reconnues et seulement 17 espèces ont un nom validé (Nemec et al., 2003; Carr et al., 2003). Malheureusement, les membres de ce genre ont une très grande variabilité phénotypique intra-spécifique.et ne sont donc pas différentiables sur un plan phénotypique L’accroissement du nombre d’infections liées à ces agents a stimulé la recherche de méthodes d’analyse pour l’identification et la taxonomie de ces bactéries. Il a aussi été démontré que les méthodes d’identification basées sur les caractères phénotypiques et le séquençage du gène de l’ARN 16S ribosomique par comparaison à l’hybridation DNA-DNA n’étaient pas valables. Ainsi, la recherche de méthodes d’identification rapide de ces bactéries est toujours d’actualité (Gerner-Smidt et al., 1991; Ibrahim et al., 1997; Rainey et al., 1994). Notamment, les techniques moléculaires basées sur le séquençage du gène de l’ARN 16S ribosomique ne permettent pas de distinguer les espèces les plus proches, notamment en raison d’un manque de polymorphisme de ce gène dans ce genre. (Yamamoto and Harayama, 1998; Ochman and Wilson, 1987; Stackebrandt and Goebel, 1994). De plus, en raison de ce manque de polymorphisme, il y a nécessité de déterminer la séquence complète du gène 16S ARNr si l’on désire pouvoir identifier une espèce. Cela impose de séquencer la totalité du gène qui fait environ 1600 paires de bases. La conséquence pratique est que le séquençage doit s’appuyer sur un minimum de 6 réactions de séquençage en plus de la réaction d’amplification pour avoir un résultat évaluable. Des tentatives de phylogénies ont été faites en utilisant la comparaison des gènes ^rB (Yamamoto and Harayama, 1996; Yamamoto et al., 1999) et recA (Krawczyk et al., 2002) en alternative au gène de l’ARN 16S ribosomique (Ibrahim et al., 1997). Malheureusement, les séquences de ces gènes n’ont pas été déterminées sur les 10 espèces les plus récentes (Nemec et al., 2001, 2003; Carr et al., 2003).
Il existe donc toujours une demande d’un outil d’identification moléculaire des bactéries des espèces du genre Acinetobacter utilisable en routine au laboratoire de bactériologie, avec notamment un gène suffisamment polymorphique tel que la détermination d’une séquence courte (moins de 500 paires de bases) avec seulement 1 réaction d’amplification et, le cas échéant, soient identifiantes, c’est-à-dire amplifîable et séquençable par l’utilisation d’un seul jeu d'amorces .
Les inventeurs ont découvert et démontré selon la présente invention, que le gène rpo'Q et les séquences non codantes qui le bornent, à savoir les séquences non codantes en 5’ entre les séquences des gènes rp/L et rpoB (ciaprès dénommées "spacer rplL-rpoB " ou « fragment intergénique rp/LrpoB ») , et les séquences non codantes en 3’ entre les séquences des gènes rpoC et rpoB (ci-après dénommées " spacer rpoB-rpoC " ou « fragment intergénique rpoB-rpoC ») , constituent un marqueur génétique permettant la détection et l’identification spécifique de la bactérie de chaque espèce du genre Acinetobacter et, en particulier, les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (Espèce génomique2), espèce génomique 3, A. haemoljticus(tspbce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. bajiji, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus.
Les espèces génomiques 1 à 16 (“genomic species ») correspondent à des souches référencées dans GENEBANK, pour certaines (n°3, 6, 9, 10, 13 et 16) aucun nom ne leur ayant encore été attribuées.
Les inventeurs ont découverts certaines zones hypervariables entre les différentes espèces et donc spécifiques de chaque espèce, encadrées par des séquences conservées entre les différentes espèces, permettant de mettre en œuvre une méthode d’identification moléculaire des différentes espèces de bactéries Acinetobacter par amplification à l’aide d’amorces choisies dans les séquences conservées et hybridation et/ou séquençage des séquences spécifiques ainsi amplifiées.
Plus particulièrement, la présente invention concerne des séquences d’acides nucléiques spécifiques de chaque espèce du genre Acinetobacter citée cidessus dont la séquence nucléotidique est tirée du gène rpoY> des dites bactéries.
Selon Lazcano et al. [J. Mol. Evol. (1988) 27 :365-376], les ARN polymérases sont divisées en deux groupes selon leur origine, l’un constitué par les ARN polymérases virales ARNou ADN-dépendantes, et l’autre constitué par les ARN polymérases ADN-dépendantes d’origine eucaryote ou procaryotes (archaébactéries et eubactéries). Les ARN polymérases ADN-dépendantes eubactériennes sont caractérisées par une constitution multimérique simple et conservée notée " core enzyme ", représentée par αββ’, ou " holoenzyme " représentée par αββ’σ [Yura and Ishihama, Ann. Rev. Genet. (1979) 13 :59-97]. De nombreux travaux ont mis en évidence le rôle fonctionnel, au sein du complexe enzymatique multimérique, de la sous-unité β de l’ARN polymérase eubactérienne. Les ARN polymérases archaébactérienne et eucaryote présentent, pour leur part, une structure plus complexe pouvant atteindre une dizaine, voire une trentaine de sous-unités [Pühlet et al. Proc . Natl. Acad. Sci. USA (1989) 86 :4569-4573].
Les gènes qui codent les différentes sous-unités αββ’σ de l’ARN polymérase ADN-dépendante chez les eubactéries, respectivement les gènes rpoA, rpoB, rpoC et rpoD, sont classés en différents groupes comprenant les gènes codant pour des protéines constitutives des sous-unités ribosomiques ou pour des enzymes impliqués dans la réplication et la réparation du génome [Yura and Yshihma, Ann. Rev. Genet. (1979) 13 :59-97]. Certains auteurs ont montré que les séquences des gènes rpoB et rpoC pouvaient être utilisées afin de construire des arbres phylogénétiques [Rowland et al. Biochem. Soc. Trans. (1992) 21 :40S] permettant de séparer les différents embranchements et sousembranchements parmi les règnes du vivant.
Avant d’exposer plus en détail l’invention, différents termes, utilisés dans la description et les revendications, sont définis ci-après:
par " acide nucléique extrait de bactéries " on entend soit l’acide nucléique total, soit l’ADN génomique, soit les ARN messagers, soit encore l’ADN obtenu à partir de la transcription inverse des ARN messagers ;
un " fragment nucléotidique " ou un " oligonucléotide " sont deux termes synonymes désignant un enchaînement de motifs nucléotidiques caractérisé par une séquence informationnelle des acides nucléiques naturels (ou éventuellement modifiés) et susceptibles de s’hybrider, comme les acides nucléiques naturels, avec un fragment nucléotidique complémentaire ou sensiblement complémentaire, dans des conditions prédéterminées de stringence stricte. L’enchaînement peut contenir des motifs nucléotidiques de structure différente de celle des acides nucléiques naturels. Un fragment nucléotidique (ou oligonucléotide) peut contenir par exemple jusqu’à 100 motifs nucléotidiques. Il contient généralement au moins 10, de préférence de 18 à 35, motifs nucléotidiques et peut être obtenu à partir d’une molécule d’acide nucléique naturelle et/ou par recombinaison génétique et/ou par synthèse chimique, un motif nucléotidique est dérivé d’un monomère qui peut être un nucléotide naturel d’acide nucléique dont les éléments constitutifs sont un sucre, un groupement phosphate et une base azotée choisie parmi l’adénine (A), la guanine (G), l’uracile (U), la cytosine (C), la thymine (T) ;
ou bien le monomère est un nucléotide modifié dans l’un au moins des trois éléments constitutifs précédents ;
à titre d’exemple, la modification peut intervenir soit au niveau des bases, avec des bases modifiées telles que l’inosine, qui peut s'hydrider avec toute base A, T, U, C ou G, la méthyl-5-désoxycytidine, la désoxyuridine, la diméthylamino-5-désoxyuridine ou toute autre base modifiée capable d’hybridation, soit au niveau du sucre, par exemple le remplacement d’au moins un désoxyribose par un polyamide [Nielsen PE et al., Science (1991) 254 :1497-1500], soit encore au niveau du groupement phosphate, par exemple par remplacement par des esters choisis notamment parmi les diphosphates, les alkylphosphonates et les phosphorothioates, par " hybridation ", on entend le processus au cours duquel, dans des conditions appropriées, deux fragments nucléotidiques ayant des séquences suffisamment complémentaires sont susceptibles de s’associer par des liaisons hydrogène stables et spécifiques, pour former un double brin. Les conditions d’hybridation sont déterminées par la " stringence ", c’est à dire la rigueur des conditions opératoires. L’hybridation est d’autant plus spécifique qu’elle est effectuée à plus forte stringence. La stringence est fonction notamment de la composition en bases d’un duplex sonde/cible, ainsi que par le degré de mésappariement entre deux acides nucléiques. La stringence peut également être fonction des paramètres de la réaction d’hybridation, tels que la concentration et le type d’espèces ioniques présentes dans la solution d’hybridation, la nature et la concentration d’agents dénaturants et/ou la température d’hybridation. La stringence des conditions dans lesquelles une réaction d ‘hybridation doit être réalisée dépend notamment des sondes utilisées. Toutes ces données sont bien connues et les conditions appropriées peuvent éventuellement être déterminées dans chaque cas par des expériences de routine. En général, selon la longueur des sondes utilisées, la température pour la réaction d’hybridation est comprise entre environ 20 et 65°C, en particulier entre 35 et 65°C dans une solution saline à une concentration d’environ 0,8 à 1 M. une " sonde " est un fragment nucléotidique possédant une spécificité d’hybridation dans des conditions déterminées pour former un complexe d ‘hybridation avec un acide nucléique ayant, dans le cas présent, une séquence nucléotidique comprise soit dans un ARN messager, soit dans un ADN obtenu par transcription inverse dudit ARN messager, produit de transcription ;
une sonde peut être utilisée à des fins de diagnostic (notamment sondes de capture ou de détection) ou à des fins de thérapie, une sonde peut être immobilisée ou immobilisable sur un support solide par tout moyen approprié, par exemple par covalence, par adsorption, ou par synthèse directe sur un solide. Des exemples de supports comprennent les plaques de microtitration et les puces à ADN, une "sonde" est en général marquée au moyen d’un agent marqueur choisi par exemple parmi les isotopes radioactifs, les enzymes, en particulier les enzymes susceptibles d’agir sur un substrat chromogéne, fluorigène ou luminescent (notamment une peroxydase ou une phosphatase alcaline), les composés chimiques chromophores, les composés chromogènes, fluorigènes ou luminescents, les analogues des bases nucléotidiques .Ce marquage peut être directe entre l’ADN et le dit marqueur ou indirecte c’est à dire par l’intermédiaire de ligands tels que la biotine ou autre molécule apte à se lier à des agents de marquage, une " sonde d’espèce " est une sonde permettant l’identification spécifique de l’espèce d’une bactérie d'un genre donné, en l'espèce ici acinetobacter, une "sonde de genre" est une sonde permettant l'identification spécifique du genre de la bactérie quelque soit l'espèce de la bactérie dudit genre, une " amorce " est une sonde comprenant par exemple 10 à 100 motifs nucléotidiques et possédant une spécificité d’hybridation dans des conditions déterminées pour les réactions d'amplification enzymatique, par "réaction d'amplification" on entend une réaction de polymérisation enzymatique, par exemple dans une technique d’amplification telle que la PCR, initiée par des oligonucléotides amorces et utilisant une ADN polymérase. par "réaction de séquençage", on entend une réaction conduisant à la détermination de la séquence d'un fragment d'acide nucléique ou d'un gène complet par un procédé de polymérisation abortive à partir d'amorces oligonucléotidiques et utilisant lesdits didésoxynucléotides (Sanger F, Coulson AR (1975), J.Mol.Biol. 94 : 441) ou par hybridations multiples avec des sondes multiples fixées sur support solide telles qu’utilisées dans les puces ADN par exemple,ou d’autres techniques connues de l’homme de l’Art.
Les inventeurs ont déterminé les séquences complètes des gènes rpo¥> et des sequences non codantes flanquantes qui le bornent et le séparent des gènes rp/L et rpoC (" fragment intergénique rpÎL-rpoü " et " fragment intergénique rpoli-rpoC ") de 24 espèces du genre Acinetobacter. A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(e.sipè.ze. génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwojjii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus.
Pour arriver à déterminer lesdites séquences complètes de rpoB et ses séquences flanquantes de la totalités des espèces de bactéries Acinetobacter , les inventeurs ont du, après un grand nombre d'essais infructueux, déterminer tout d’abord 51 amorces (Tableau 2), à partir de la seule séquence rpoB et des zones non codantes qui la bornent de bactéries du genre Acinetobacter des de séquences correspondantes de bactéries qu’ils ont identifiées comme proches disponibles sur GENBANK, à savoir Acinetobacter sp. ADP1 (GeneBank accession number NC_005966), Vseudomonas syringae pv.tomato str.DC3000 (GeneBank accession number NC 004578) et P. putida KT2440 (GeneBank accession number NC 006347) .
La souche Acinetobacter sp.ADPl est une souche qui n’avait pas été caractérisée avant l’invention et qui ne correspond à aucune des souches décrite dans la présente demande de brevet et listées ci-après.
La présente invention a donc pour objet un gène complet rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumanniï (espèce génomique 2), espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. townerï, A. parvus. caractérisé en ce que sa séquence comprend ,et plus particulièrement consiste en une séquence choisie parmi les séquences telle que décrite dans les séquences SEQ.ID. n°9 à 32 respectivement, et les séquences présentant au moins au moins 98% de similitude, ainsi que leurs séquences inverses et séquences complémentaires.
La présente invention a également pour objet les fragment d’acide nucléique comprenant ,et plus particulièrement consistant dans un fragment non codant encadrant le gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(e.spècz génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend, et plus particulièrement consiste en une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°121 à 144 respectivement, et les séquences SEQ.ID. n°165 à 188 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences inverses et séquences complémentaires.
Les dites séquences présentant des taux de similitude d’au moins 98% avec les dites séquences SEQ. ID. 9 à 32, 121 à 144 et 165 à 188 correspondent aux variations possibles entre les différentes souches d’une même espèce correspondant éventuellement à des sous-espèces. Ainsi, les séquences SEQ. ID. n°145 à 164 et 189 à 208 correspondent à diverses souches d'A. baumannii présentant au moins 98% d'homologie avec, respectivement, les séquences SEQ. ID. n°122 et 166.
Les séquences SEQ. ID. n° 121 à 144 correspondent aux séquences flanquantes en 5’ représentant le fragment intergénique rpÎL-rpoB complet qui borne le gène rpoB entre les gènes rp/L et rpoB, d'une longueur comprise entre 301 et 310 pb, pour chaque espèce de la bactérie du genre Acinetobacter, pour les 24 espèces mentionnées ci-dessus.
Les séquences SEQ. ID. n° 165 à 188 correspondent aux séquences flanquantes en 3’ représentant le fragment intergénique rpoB-rpoc complet qui borne le gène rpoB entre les gènes rpoB et rpoC, d'une longueur comprise entre 86 et 177 pb, pour chaque espèce de la bactérie du genre Acinetobacter, pour les 24 espèces mentionnées ci-dessus.
Les fragments intergéniques rpoB-rpoC et rp/L-rpoB qui bornent le gène rpoB et la séquence complète du gène rpoB peuvent être utilisées pour identifier la bactérie pas seulement à titre de sonde et/ou par l'étude de sa séquence primaire, mais aussi, par l'étude des structures secondaire et tertiaire de l'ARN messager provenant de la transcription de la séquence complète d'ADN.
Dans ces gènes rpoB et les séquences non codantes qui les bornent (fragment intergénique rpÎL-rpoB et fragment intergénique rpoB-rpoC) d’ Acinetobacter, les inventeurs ont mis en évidence des séquences consensus SEQ. ID. n°l, 2, 3, 4, 5, 6, 7 et 8 (Tableau 3) qui sont des séquences conservées entre toutes les bactéries du genre Acinetobacter, c’est-à-dire pouvant être utilisées comme amorces permettant d’amplifier la même portion du gène rpoB et les zones non codantes qui le bornent (fragment intergénique rplL-rpoB et fragment intergénique rpoB-rpoC) de toutes lesdites bactéries Acinetobacter., à savoir : SEQ. ID. n°l, et 2 pour une première zone du gène rpoB, SEQ. ID. n°3, et 4 pour une seconde zone du gène rpoB, SEQ. ID. n°5, et 6 pour le fragment intergénique rpfL-rpoB, et
SEQ. ID. n°7, et 8 pour le fragment intergénique rpoB-rpoC -SEQ. ID. n° 1 à 4 et 6-7 sont à l’intérieur du gène rpoB, avec : SEQ. ID. n° 8 et 6 sont à proximité des extrémités 5’ des gènes rpoB, et respectivement rpoC. SEQ. ID. n° 7 et 5 sont à proximité des extrémités 3’ des gènes rp/L et respectivement rpoB.
La présente invention fournit donc des oligonucléotides qui présentent des séquences conservées d’une bactérie Acitenobacter choisie parmi les dites 24 espèces comprenant une séquence d'au moins 12, de préférence d’au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n°l à 8 suivantes, leurs séquences inverses et séquences complémentaires, de préférence consistant dans les dites séquences: SEQ. ID. n° 1 : 5'-TAYCGYAAAGAYTTGAAAGAAG-3', SEQ. ID. n° 2 : 5'-CMACACCYTTGTTMCCRTGA-3\. SEQ. ID. n° 3 : 5’-GTGATAARATGGCBGGTCGT-3', SEQ. ID. n° 4 : 5’-CGBGCRTGCATYTTGTCRT-3’, SEQ. ID. n° 5 :5’-GAAGARCTTAAGAMDAARCTTG-3’ SEQ. ID. n° 6 : 5’-CGTTTCTTTTCGGTATATGAGT-3’, SEQ. ID. n° 7 : 5'GTTCTTTAGGTATCAACATTGAA -3', SEQ. ID. n° 8 : 5'GACGCAAGACCAATACGRAT -3', dans lesquelles : -D représente A, G ou T, Y représente C ou T, B représente C, G ou T, R représente A ou G, et M représente A ou C. A la position correspondant à un nucléotide D, Y, B, M ou R dans les séquences SEQ. ID. n°l 2, 3, 4, 5 et 8 on trouve dans les séquences cibles complémentaires des nucléotides variables en fonction de l'espèce de la bactérie considérée, mais tous les autres nucléotides sont conservés dans toutes les espèces des bactéries du genre Acinetobacter.
Les séquences SEQ. ID. n° 1, 3, 5 et 7 sont utilisées à titre d'amorces sur le brin direct et les séquences SEQ. ID. n°2, 4, 6 et 8 sont utilisées à titre d'amorce sur le brin indirect. Les séquences SEQ. ID. n°2, 4, 6 et 8 correspondent donc à des séquences inverses complémentaires de celles du brin direct.
Pour être utilisés à titre d’amorces consensuelles, ces oligonucléotides de séquences SEQ. ID. n°l, 2, 3, 4, 5 et 8 sont donc mis en œuvre, en fait, sous forme de mélanges équimolaires d'oligonucléotides de séquences différentes, lesdits oligonucléotides de séquences différentes répondant pour chaque séquence SEQ. ID. n°l à 8 aux diverses définitions possibles des séquences respectivement n°l, 2, 3, 4, 5 et 8.
Ces mélanges équimolaires d'oligonucléotides sont obtenus en mettant en oeuvre, lors de la synthèse oligonucléotidique, des mélanges équimolaires des différents nucléotides concernés respectivement : A, G et T pour D, C et T pour Y, C, G et T pour B, A et G pour R, A et C pour M.
Les mélanges d'oligonucléotides, répondant aux nucléotides de définition des séquences SEQ. ID. n°l 2, 3, 4, 5 et 8, peuvent donc s'hybrider avec les différentes séquences complémentaires cibles incluses dans les gènes rpoB et aux extrémités des gènes rp/L et rpoC encadrant les zones non codantes qui les bornent (fragment intergénique rplL-rpoB et fragment intergénique rpoB-rpoC) de toutes les espèces de bactéries du genre Acinetobacter et, plus particulièrement, les 24 espèces citées ci-dessus.
La capacité de ces amorces à amplifier des fragments de gènes rpoB et des zones non codantes qui les bornent (fragment intergénique rplL-rpoB et fragment intergénique rpoB-rpoC), de toutes les espèces d’Acinetobacter permet de considérer que ces amorces seront efficaces pour l'identification d'espèces & Acinetobacter additionnelles qui seraient décrites dans le futur.
La présente invention a donc également pour objet un mélange d'oligonucléotides caractérisé en ce qu'il comprend un mélange équimolaire d’oligonucléotides de séquences différentes comprenant au moins 12, de préférence au moins 18 motifs nucléotidiques consécutifs inclus dans l'une des séquences SEQ. ID. n° 1 à 5 et 8 ou les oligonucléotides de séquences inverses ou séquences complémentaires.
Plus particulièrement, la présente invention a pour objet les mélanges d'oligonucléotides suivants : un mélange équimolaire de 8 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°l, ou des oligonucléotides de séquences inverses ou séquences complémentaires. un mélange équimolaire de 16 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°2 ou des oligonucléotides de séquences inverses ou séquences complémentaires. un mélange équimolaire de 6 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n°3 ou des oligonucléotides de séquences inverses ou séquences complémentaires. un mélange équimolaire de 24 oligonucléotides de séquences différentes consistant dans la séquence SEQ. ID. n° 4 ou des oligonucléotides de séquences inverses ou séquences complémentaires. un mélange équimolaire de 24 oligonucléotides de séquences différentes 5 consistant dans la séquence SEQ. ID. n° 5 ou des oligonucléotides de séquences inverses ou séquences complémentaires. oligonucléotide de séquence consistant dans la séquence SEQ. ID. n°6 ou séquence inverse ou séquence complémentaire. oligonucléotide de séquence consistant dans la séquence SEQ. ID. n°7 10 ou séquence inverse ou séquence complémentaire. un mélange équimolaire de 2 oligonucléotides de séquences différentes consistant dans la séquence SEQ.ID. n°8 ou des oligonucléotides de séquences inverses ou séquences complémentaires.
Les oligonucléotides ou mélanges d'oligonucléotides comprenant une 15 séquence incluse dans l'une des séquences SEQ. ID. n° 1 à 8 selon l'invention, peuvent être utilisés à titre de sonde de genre des bactéries du genre acinetobacter.
Comme mentionné précédemment, en outre, les séquences consensus SEQ. ID. n°l, 2, 3, 4, 5 et 8, ainsi définies, encadrent des séquences hyper 20 variables dont la séquence est spécifique pour chaque espèce des bactéries du genre Acinetobacter.
Les inventeurs ont ainsi pu mettre en évidence des séquences spécifiques d'espèces pour chacune des 24 espèces de bactéries citées ci-dessus, correspondant aux séquences :
25 SEQ. ID. n°33 à 56, encadrées par les séquences consensus SEQ. ID. n°l et 2 (ci-après "zone 1 de rpoB");
SEQ. ID. n°77 à 100, encadrées par les séquences consensus SEQ. ID. n°3 et 4 (ci-après "zone 2 de rpoB");
SEQ. ID. n°121 à 144, encadrées par les séquences consensus SEQ. ID. n°5 et 6 (ci-après "fragment intergénique rpo/L-rpoB"); et
SEQ. ID. n°l65 à 188, encadrées par les séquences consensus SEQ. ID. n°7 et 8 (ci-après "fragment intergénique rpoB-rpoC");
Les oligonucléotides de séquences encadrées par les SEQ. ID. n°l 2, 3, 4, 5, 6, 7 et 8, peuvent donc être utilisés à titre de sonde d'espèce des bactéries du genre Acinetobacter.
Lesdites séquences hyper variables spécifiques SEQ. ID. n°33 à 56 encadrées par les séquences SEQ. ID. n°l et 2, représentent un fragment du gène rpoB d'une longueur de 350 pb avec moins de 96% de similitude entre les différentes espèces (tableau 7) à l’exception des couples A. baylii/geno. species 11 et A. grimontii/A. junii, de sorte qu'elles constituent une courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus, à l’exception des couples A. baylii/geno. species 11 et A. grimontiil A. junii,.
Lesdites séquences hyper variables spécifiques SEQ. ID. n°77 à 100 encadrées par les séquences SEQ. ID. n°3 et 4, représentent un fragment du gène rpoB d'une longueur de 450 pb avec moins de 96% de similitude entre les différentes espèces (tableau 8) à l’exception des couples A. baylii/geno. species 11 et A. grimontii/A. junii, de sorte qu'elles constituent une deuxième courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus, à l’exception des couples A. baylii/geno.species 11 et A. grimontii/A. juni .
Lesdites séquences hyper variables spécifiques SEQ. ID. n° 121 à 164 encadrées par les séquences SEQ. ID. n°5 et 6, représentent le fragment intergénique rplh-rpoB qui borne le gène rpoB d'une longueur comprise entre 301 et 310 pb avec moins de 97% de similitude entre les différentes espèces (voir tableau 5 ci-après) à l’exception des couples A. baylii/geno.species 11, A. grimontii/A. junii, et A. Iwoffi/geno.species 9, de sorte qu'elles constituent une troisième courte séquence spécifique cible, à tout le moins connue, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus, à l’exception des couples A. bajlii/geno.species 11, A. grimontii!A. junii, et A. Iwojjijgeno.species 9.
Enfin, lesdites séquences hyper variables spécifiques SEQ. ID. n° 165 à 188 encadrées par les séquences SEQ. ID. n°7 et 8, représentent le fragment intergénique rpoB-rpoC qui borne le gène rpoB d'une longueur comprise entre 86 et 177 pb avec moins de 97% de similitude entre les différentes espèces (voir tableau 6 ci-après) à l’exception des couples A. grimontiiIA. junii et des espèces du groupe Acb (A. baumannii, A ; calcoaceticus et genospecies 3, de sorte qu'elles constituent une qua trième courte séquence spécifique cible, pour identifier spécifiquement chaque espèce de la bactérie du genre Acinetobacter, plus précisément pour les 24 espèces mentionnées ci-dessus , à l’exception des couples A. grimontii!A. junii et des espèces du groupe Acb (A. baumannii, A ; calcoaceticus et genospecies 3.
Un autre objet de la présente invention est donc un fragment de gène rpoB d'une bactérie du genre Acinetobacter choisie parmi les 24 espèces: A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemoljticus(es]>èce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, caractérisé en ce que sa séquence comprend ou, plus particulièrement consiste en une séquence choisie parmi les séquences telles que décrites dans les séquences SEQ. ID. n° 33 à 56 respectivement, et les séquences SEQ. ID. n°77 à 100 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences inverses et séquences complémentaires.
Les dites séquences présentant des taux de similitude d’au moins 98% avec les dites séquences SEQ. ID. n°33 à 56 et 77 à 100 correspondent aux variations possibles entre les différentes souches d’une même espèce correspondant éventuellement et plus particulièrement à des sous-espèces. Ainsi les séquences SEQ. ID. n°57 à 76 et 101 à 120 correspondent à diverses souches de A. baumannii présentant au moins 98% d'homologie avec, respectivement, SEQ. ID. n° 34 et 78.
La présente invention a donc également pour objet rutilisation à titre de sonde d’espèce d’un fragment de gène rpoB, rp/1 ou rpoC selon l'invention d'un oligonucléotide de séquences spécifiques d’une dite espèce de bactérie Acinetiobacter selon l’invention.
Plus précisément, la présente invention fournit un procédé de détection par identification moléculaire d'une bactérie de l'une des espèces du genre Acinetobacter caractérisé en ce qu'on utilise :
le gène rpoB complet de ladite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°9 à 32, ou de préférence consistant en une dite séquence SEQ. ID. n°9 à 32, ou les séquences inverses, séquences complémentaires, ou séquences présentant au moins 98% de similitude, d’un fragment de gène rpoB d'une dite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°33 à 56 ou 77 à 100, ou consistant en une dite séquence SEQ. ID. n°33 à 56 ou 77 à 100 les séquences inverses, séquences complémentaires, ou séquences présentant au moins 98% de similitude, d’un fragment de gène rpoB d'une dite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°77 à 100, ou, de préférence, consistant en une dite séquence SEQ. ID. n°77 à 100, ou les séquences inverses, séquences complémentaires, ou séquences présentant au moins 98% de similitude, un fragment de gène comprenant un fragment intergénique rplL-rpoB ou rpoB-rpoC complet de ladite bactérie selon l'invention, comprenant une dite séquence SEQ. ID. n°121 à 144 ou 165 à 188, ou de préférence consistant en une dite séquence SEQ. ID. n°121 à 144 ou 165 à 188, les séquences inverses ou les séquences complémentaires ou séquences présentant au moins 98% de similitude. un oligonucléotide présentant une séquence spécifique d’une bactérie Acitenobacter choisie parmi les 24 espèces ci-dessus de préférence d’au moins 18 , de préférence encore de 18 à 35, motifs nucléotidiques consécutifs inclus dans l'une des séquences choisie parmi les séquences telles que décrites dans les séquences : SEQ. ID. n°33 à 56 respectivement, SEQ. ID. n°77 à 100 respectivement, SEQ. ID. n°121 à 144 respectivement, SEQ. ID. n°165 à 188 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences inverses et séquences complémentaires ;
ou un oligonucléotide ou mélange équimolaire d'oligonucléotides selon l'invention, comprenant une séquence d'au moins 12, de préférence 18 nucléotides consécutifs inclus dans l'une des séquences SEQ. ID. n°l 2, 3, 4, 5, 6, 7 et 8 ou les séquences inverses ou séquences complémentaires, ou de préférence consistant dans l'une desdites séquences SEQ. ID. n°l 2, 3, 4, 5, 6, 7 et 8.
Dans un premier mode de réalisation d’un procédé de détection d’une bactérie selon l'invention, on cherche à détecter spécifiquement une espece donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticusipspbce. génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. bajlyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus , procédé dans lequel : 1on met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un oligonucléotide ou un fragment de gène selon l'invention, de préférence un fragment de gène consistant respectivement dans l'une desdites séquences choisie parmi : SEQ. ID. n°33 à 56 respectivement, 5 SEQ. ID. n°77 à 100 respectivement, SEQ. ID. n°121 à 144 respectivement, SEQ. ID. n°165 à 188 respectivement, et les séquences présentant au moins 98% de similitude et leurs séquences inverses et séquences complémentaires. 10 2on détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques de l'échantillon, et on détermine ainsi la présence de ladite espèce de Acinetobacter dans l'échantillon s'il y a formation d'un complexe d'hybridation.
Dans un deuxième mode de réalisation d'un procédé de détection d'une 15 bactérie du genre Acinetobacter d'une espèce spécifique, on réalise les étapes dans lesquelles : 1on met en contact des amorces d'amplification comprenant desdits mélanges d'oligonucléotides selon l'invention, avec un échantillon contenant ou susceptible de contenir des acides nucléiques d'au moins une telle bactérie du 20 genre Acinetobacter, et on réalise une amplification d'acides nucléiques par réaction de polymérisation enzymatique comprenant : · comme amorce 5', au moins un oligonucléotide ou mélange d'oligonucléotides selon l’invention comprenant une séquence incluse dans l’une des séquences SEQ. ID. n° 1, 3, 5 et 7 de préférence consistant dans ladite 25 séquence SEQ. ID. n°l, 3, 5 et 7 complète ou les séquences complémentaires, et comme amorce 3', au moins un oligonucléotide ou mélange d'oligonucléotides selon l’invention comprenant des séquences incluses dans l’une des séquences SEQ. ID. n° 2, 4 6, et 8 respectivement, de préférence consistant dans ladite séquence SEQ. ID. n°2, 4, 6, et 8 complète ou respectivement une séquence complémentaire. 2et on détermine l'apparition ou l’absence d'un produit d'amplification, et on détermine ainsi la présence ou l'absence de ladite bactérie dans l'échantillon si un produit d'amplification est ou n'est pas apparu respectivement.
Plus particulièrement, on cherche à détecter une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus (espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwojfii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus., et, à l'étape 2 ci-dessus, on détermine la présence ou l'absence de l'espèce donnée d’une dite bactérie en effectuant les étapes dans lesquelles : a) on réalise une réaction de séquençage d'un fragment de gène amplifié avec des dites amorces, et b) on compare la séquence dudit fragment amplifié obtenu avec la séquence d'un fragment de gène de ladite bactérie comprenant respectivement : lesdites séquences SEQ. ID. n° 33 à 56, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 1 et 2 respectivement les dites séquences SEQ. ID. n° 77 à 100, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 3 et 4 respectivement, et les dites séquences SEQ. ID. n° 121 à 144, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 5 et 6 respectivement, et les dites séquences SEQ. ID. n° 165 à 188, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement.
Dans une autre variante dudit deuxième mode de réalisation d'un procédé de détection d'une bactérie du genre Acinetobacter d'une espèce spécifique, dans lequel, on cherche à détecter une espèce donnée d'une bactérie Acitenobacter choisie parmi les 24 espèces suivantes : A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylji, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A. parvus, à l'étape 2 cidessus on détermine la présence ou l'absence de l'espèce donnée d’une dite bactérie par en effectuant les étapes dans lesquelles : aon met en contact un échantillon contenant ou susceptible de contenir des acides nucléiques amplifié d'au moins une telle bactérie, avec au moins une sonde d'espèce consistant dans un fragment de gène rpoB ou un oligonucléotide spécifique selon l’invention, de préférence un fragment consistant respectivement dans l'une desdites séquences choisie parmi : SEQ. ID. n°33 à 56 respectivement, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 1 et 2 respectivement SEQ. ID. n°77 à 100 respectivement, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 3 et 4 respectivement, et SEQ. ID. n°121 à 144 respectivement, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 5 et 6 respectivement, et SEQ. ID. n°165 à 188 respectivement, lorsque les dites amorces 5’ et 3’ sont des oligonucléotides de séquences incluses dans les séquences SEQ. ID. n° 7 et 8 respectivement, et. bon détermine la formation ou l'absence d'un complexe d'hybridation entre ladite sonde et les acides nucléiques amplifié de l'échantillon, et on détermine ainsi la présence ou l’absence de ladite espèce de Acinetobacter dans l'échantillon s'il y a formation ou non d'un complexe d'hjdmdation.
Dans un mode préféré de réalisation d’un procédé selon l’invention, on réalise les étapes comprenant : 1une première amplification de l'acide nucléique dudit échantillon avec un couple d'amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon l’invention, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n°l et SEQ. ID. n°2, de préférence consistant dans lesdites séquences SEQ. ID. n°l et 2, ou les séquences complémentaires, et 2une première détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d’au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiais obtenus à l'étape 1 avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°33 à 56 et 34 à 76 respectivement, et -si à cette étape 2 on détermine la présence des espèces A. grimontii ou A. junii, on réalise en outre: 3a une seconde réaction d’amplification avec des amorces 5' et 3' choisi parmi desdits mélanges d'oligonucléotides selon l’invention, comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n°3 et SEQ. ID. n°4, de préférence consistant dans lesdites séquences SEQ. ID. n°3 et 4, ou les séquences complémentaires, et 4aune détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d’au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiats obtenus à l’étape 3a avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°77 à 100 respectivement, ou si à la première étape 2 on détermine la présence des espèces Λ. baylii ou A. espèce génomique 11, on réalise en outre : 3bune seconde réaction d’amplification avec des amorces 5' et 3' choisis parmi desdits mélanges d'oligonucléotides selon l’invention comprenant des séquences incluses respectivement dans les séquences SEQ. ID. n°7 et SEQ. ID. n°8, de préférence consistant dans lesdites séquences SEQ. ID. n° 7 et 8, ou les séquences complémentaires, et 4bune détermination de l'apparition ou l'absence d'un produit d'amplification comprenant des acides nucléiques d’au moins une dite bactérie, par hybridation ou le cas échéant séquençage et comparaison des amplifiais obtenus à l’étape 3b avec les fragments consistant respectivement dans l'une desdites séquences choisie parmi SEQ. ID. n°165 à 188 respectivement.
Les séquences SEQ. ID. n°l à 208 peuvent être préparées par génie génétique et/ou par synthèse automatique ou synthèse chimique en utilisant les techniques bien connues de l’homme du métier.
Les sondes selon l’invention peuvent être utilisées, à des fins de diagnostic, comme mentionné précédemment, par la détermination de la formation ou de l’absence de formation d'un complexe d'hybridation entre la sonde et un acide nucléique cible dans un échantillon, selon toutes les techniques d’hybridation connues et notamment les techniques de dépôt ponctuel sur filtre, dites " DOT-BLOT " [Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor], les techniques de transfert d’ADN dites " SOUTHERN BLOT " [Southern E.M., J. Mol. Biol. (1975) 98 :503], les techniques de transfert d’ARN dites " NORTHERN BLOT ", ou les techniques dites " sandwich ", en particulier avec une sonde de capture et/ou une sonde de détection, lesdites sondes étant capables de s’hybrider avec deux régions différentes de l’acide nucléique cible, et l’une au moins desdites sondes (généralement la sonde de détection) étant capable de s’hybrider avec une région de la cible qui est spécifique de l’espèce, étant entendu que la sonde de capture et al sonde de détection doivent avoir des séquences nucléotidiques au moins partiellement différentes. L’acide nucléique à détecter (cible) peut être de l’ADN ou de l’ARN (le premier obtenu après amplification par PCR). Dans le cas de la détection d’une cible de type acide nucléique double brin, il convient de procéder à la dénaturation de ce dernier avant la mise en oeuvre du procédé de détection. L’acide nucléique cible peut être obtenu par extraction selon les méthodes connues des acides nucléiques d’un échantillon à examiner. La dénaturation d’un acide nucléique double brin peut être effectuée par les méthodes connues de dénaturation chimique, physique ou enzymatique, et en particulier par chauffage à une température appropriée, supérieure à 80°C.
Pour mettre en œuvre les techniques d’hybridation précitées, et en particulier les techniques " sandwich ", une sonde de l’invention, appelée sonde de capture est immobilisée sur un support solide, et une autre sonde de l’invention, appelée sonde de détection, est marquée avec un agent marqueur. Les exemples de support et d’agent marqueur sont tels que définis précédemment.
De manière avantageuse, une sonde d’espèce est immobilisée sur un support solide, et une autre sonde d’espèce est marquée par un agent marqueur.
Une autre application d’un dit mélange d'oligonucléotides de l’invention est son utilisation comme amorce nucléotidique comprenant un oligonucléotide monocaténaire choisi parmi les oligonucléotides ayant une séquence d’au moins 12 motifs nucléotidiques incluses dans l'une des séquences SEQ. ID. n°l à 8, qui est utilisable dans la synthèse d'un acide nucléique en présence d'une polymérase par un procédé connu en soi, notamment dans des méthodes d’amplification utilisant une telle synthèse en présence d’une polymérase (PCR, RT-PCR, etc.). En particulier, une amorce de l’invention peut être utilisée pour la transcription inverse spécifique d’une séquence d’ARN messager de bactérie d’une espèce du genre Acinetobacter pour obtenir une séquence d’ADN complémentaire correspondante. Une telle transcription inverse peut constituer le premier stade de la technique RT-PCR, le stade suivant étant l’amplification par PCR de l’ADN complémentaire obtenu.
Selon un cas particulier, ladite amorce comprenant un oligonucléotide de l’invention comprend en outre la séquence sens ou anti-sens d’un promoteur reconnu par une ARN polymérase (promoteurs T7, T3, SP6 par exemple [Studier FW, BA Moffatt (1986) J. Mol. Biol. 189 :113] : de telles amorces sont utilisables dans des procédés d’amplification d’acide nucléique faisant intervenir une étape de transcription, tels que, par exemple, les techniques NASBA ou 3SR [Van Gemen B. et al. Abstract MA 1091, 7th International Conférence on AIDS (1991) Florence, Italy].
Un autre objet de l’invention est une amorce nucléotidique comprenant un mélange d'oligonucléotides monocaténaires choisis parmi les oligonucléotides ayant des séquences comprenant l’une des séquences SEQ. ID. n°l à 8 ou de préférence, consistant dans l’une des séquences SEQ. ID. n°l à 8 qui est utilisable pour le séquençage total ou partiel du gène rpoB ou du fragment intergénique rplL-rpoB ou du fragment intergénique rpoB-rpoC d’une quelconque espèce du genre Acinetobacter.
Le séquençage du gène rpoB partiel ou complet ou du fragment intergénique rplL-rpoB ou du fragment intergénique rpoB-rpoC chez toute bactérie du genre Acinetobacter permet l'identification de toute bactérie Acinetobacter par analyse bioinformatique de cette séquence et la reconnaissance de nouvelles espèces de bactéries Acinetobacter inconnues.
De préférence, dans une utilisation comme amorce ou pour le séquençage des gènes rpoB, ou du fragment intergénique rpfL-rpoB ou du fragment intergénique rpoB-rpoC on utilise des dits mélanges d'oligonucléotides de séquence SEQ. ID. n°l et 2,
La présente invention a également pour objet une trousse de diagnostic utile dans un procédé selon l'invention comprenant au moins un dit fragment de gène rpoB ou du fragment intergénique rp[L-rpoB ou du fragment intergénique rpoB-rpoC selon l'invention, comprenant ou consistant dans l'une des séquences SEQ. ID. n°9 à 188 ou un oligonucléotide ou dit mélange d'oligonucléotides équimolaires selon l'invention, comprenant des séquences incluses dans les séquences SEQ. ID. n°l à 8, et les oligonucléotides et fragments de gènes rpoB ou du fragment intergénique rpfL-rpoB ou du fragment intergénique rpoB-rpoC de séquences inverses et séquences complémentaires, tels que définis ci-dessus, ainsi que, de préférence, des réactifs utiles dans les réactions d’hybridations ou réactions d’amplification ou séquençage le cas échéant.
Dans la présente description, on entend par "séquence inverse et séquence complémentaire" les séquences suivantes : la séquence inverse de ladite séquence, la séquence complémentaire de ladite séquence, et la séquence complémentaire de la séquence inverse de ladite séquence.
Comme mentionné dans les définitions, un oligonucléotide ou fragment d'acide nucléique selon l'in\rention peut être sous forme d'un acide désoxyribonucléique (ADN) ou d'un acide ribonucléique (ARN) pour lesquels dans ce cas T est remplacé par U.
Enfin, un dernier objet de l’invention est une sonde de thérapie génique pour traiter les infections provoquées par une souche appartenant à une espèce du genre Acinetobacter, ladite sonde comprenant un oligonucléotide tel que défini précédemment. Cette sonde de thérapie génique, capable de s’hybrider sur l’ARN messager et/ou sur l’ADN génomique desdites bactéries, peut bloquer les phénomènes de traduction et/ou transcription et/ou de réplication.
Le principe des méthodes de thérapie génique est connu et repose notamment sur l’utilisation d’une sonde correspondant à un brin anti-sens : la formation d’un hybride entre la sonde et le brin sens est capable de perturber au moins l’une des étapes du décryptage de l’information génétique. Les sondes de thérapie génique sont donc utilisables comme médicaments antibactériens, permettant de lutter contre les infections causées par les bactéries des espèces du genre Acinetobacter. D'autres caractéristiques et avantages de la présente invention apparaîtront et l'invention sera mieux comprise à l’aide de l’exposé ci-après qui concernent les expériences effectuées et résultats obtenus dans le but de réaliser l’invention et qui sont donnés à titre purement illustratif.
Le tableau 1, ci-après, reprend la liste des espèces d'Acinetobacter pour lesquelles des séquences rpoV> et le fragment intergénique rplL-rpo¥> et le fragment intergénique rpo9>-rpoQ ont été déterminées, les souches mentionnées proviennent de la Collection de l’Institut Pasteur (CIP), les séquences SEQ. ID. n° 1 à 208 sont décrites dans le listage de séquences annexé à la description.
Dans le tableau 2, sont listées les différentes amorces utilisées pour l'amplification et le séquençage des gènes rp<?B.
Dans le tableau 2, lorsque l'on présente des séquences comprenant des nucléotides W, H, Y, V, R, B, Μ, K, S ou D, ceux-ci ont les significations connues de l'homme de l'art et, de manière également conventionnelle, ces amorces sont en fait utilisées sous forme de mélange équimolaire d'oligonucléotides de séquences différentes à l'emplacement des dits nucléotides comme expliqué ci-dessus.
Le tableau 3 présente des comparaisons de similitudes des séquences des gènes 16S ARNr et rpoB entre les deux sous-espèces C. affermentans et entre les 11 couples d'espèces considérées comme proches pour lesquelles les similitudes entre séquences de gènes 16S ARNr sont supérieures ou égales à 98,5%, avec comparaison statistique des moyennes de similitude obtenues.
La figure 1 est une représentation graphiques du taux de variabilité (range site variability : RSV (axe des Y)) des séquences des gènes rpo¥> et séquences flanquantes des différentes espèces du genre Acinetobacter. étudiées par fenêtres de 50 nucléotides (axe des X). Les régions hyper variables, bordées par les régions conservées, utilisée pour l’identification d’espèce à l’aide des amorces consensus sont encadrées.
La figure 2 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du "neighbour-joining". L’arbre a été construit par l’alignement des séquences du gène rpo¥>. Les valeurs d'échantillonnage de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres, sont indiquées à chaque nœud, seules les valeurs supérieures ou égales à 75% sont indiquées
La figure 3 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du "neighbour-joining". L’arbre a été construit par l’alignement des séquences hypervariable (zone 1 et zone 2) du gène rpoB. Les valeurs de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres sont indiquées à chaque nœud.
La figure 4 est un dendogramme représentant les relations phylogéniques des différentes espèces de A. cinetobacter par la méthode du "neighbour-joining".
Les 4 arbres ont été construits par l’alignement des séquences des gène rpoB, 16SRNA, rpoB, gyrB, recA Les valeurs d'échantillonnage de "bootstrap" (probabilité d'exactitude des nœuds en pourcentage) calculées sur une base d'un échantillon de 1000 arbres, sont indiquées à chaque nœud, seules les valeurs supérieures ou égales à 75% sont indiquées 1Matériels et méthodes. 1.1Souches bactériennes.
Les souches bactériennes utilisées sont listées dans le tableau 1. Toutes les souches ont été cultivées sur géloses Columbia 5% de sang de mouton et ont été incubée 48 h à 37 °C en condition d’aérobie. 1.2amplification et séquençage du gène rpoB et des fragment intergéniques rplL-rpoB et rpoB-rpoC.
La séquence du gène rpoB et des fragments intergéniques qui le bordent des espèces les plus proches, ont été alignées afin de produire une séquence consensus. Les séquences choisies étaient celles d ' Acinetobacter sp. ADP1 (GeneBank accession number NC_005966), Pseudomonas syringae pv.tomato str.DC3000 (GeneBank accession number NC 0045781 and P. putida KT2440 (GeneBank accession number NC 0063471. La séquence consensus a permis de déterminer les amorces utilisées ensuite pour les PCR, la technique de marche sur le génome (“genome walking”) et pour le séquençage. Certaines amorces ont été déterminées ultérieurement à l’analyse des résultats obtenus. Les amorces sont présentées au tableau 2 ci-après. L'ADN bactérien a été extrait de suspensions des souches par QIAamp blood kit (Qiagen, Hilden, Germany) selon les recommandations du fabricant. Tous les mélanges réactionnels de PCR comportaient 2.5 X 10 2 U de polymerase Taq par μΐ, IX tampon Taq, 1.8 mM MgCl2 (Gibco BRL, Life Technologies, Cergy Pontoise, France), 200 μΜ de dATP, dCTP, dTTP et dGTP (Boehringer Manheim GmbH, Hilden, Germany), et 0.2 μΜ de chaque amorce (Eurogentec, Seraing, Belgium). Les mélanges réactionnels de PCR ont été soumis à 35 cycles de dénaturation à 94°C pendant 30 s, une hybridation des amorces pendant 30 s, et une extension à 72°C pendant 2 min. Chaque programme d’amplification débutait par une étape de dénaturation à 95°C pendant 2 min. et terminait par une étape d’élongation à 72°C pendant 10 min. La détermination de la séquence des extrémités des gènes a été réalisée par l’utilisation du Universal GenomeWalker Kit (Clontech Laboratories, Palo Alto, CA). Brièvement, l’ADN génomique était digéré par Eco RV, Dra I, Pvu II, Stu I et Sca I. Les fragments d’ADN été liés avec le GenomeWalker adaptor, La PCR été réalisée en incorporant l’amorce "adaptor primer" fournie par le fabricant et les amorces spécifiques. Pour l’amplification, 1.5 U d’enzyme ELONGASE (Boehringer Manheim) été utilisée avec 10 pmol de chaque amorce, 20 mM de chaque dNTP, 10 mM Tris-HCl, 50 mM KC1, 1.6 mM MgCl2 et 5 μΐ d'ADN digéré pour un volume final de 50 μΐ. Les amplicons ont été purifiés à l’aide du "QIAquick spin PCR purification kit" (Qiagen). Les réactions de séquence ont été réalisées à l’aide des réactifs du séquenceur ABI Prism 3100 ADN séquencer (dRhod.Terminator RR Mix, Perkin Elmer Applied Biosystems).
Ces conditions d’extraction de l’ADN et amplification PCR et séquençage ont été décrites dans Khamis et al 2003. 1.3Détermination des séquences partielles discriminantes dans le gène rpoB.
Afin de détecter les portions de séquence avec une haute variabilité entourées de régions conservées, on a utilisé le programme SVARAP (for Sequence VARiability Analysis Program, Hypertext link “Téléchargement” at the URL: http://ifr48.free.fr/recherche/jeu cadre/jeu rickettsie.html). Une fois cette analyse faite, les zones les plus polymorphiques du gène rpoB ont été déterminées et des amorces universelles, choisies dans les zones bordantes conservées, ont été désignées après différents essais infructueux. Les conditions de PCR qui incorporaient les amorces universelles étaient les mêmes que précédemment mentionnées. Ces amorces ont été utilisées pour l’amplification et le séquençage des 4 zones hyper variables pour toutes les souches étudiées.
Ces amorces sont présentées au tableau 3 ci-après et figure 1. 1.4Analyse des séquences rpoB et des fragments intergéniques qui le bordent.
Les fragments de séquences des gènes rpoB et des fragment intergéniques qui le bordent obtenus dans cette étude, ont été analysées à l’aide de "Sequence Analysis Software" (Applied Biosystems), et les séquences partielles ont été combinées en une seule séquence consensus à l’aide du "Sequence Assembler Software" (Applied Biosystems). Toutes les références de dépôt des souches à la Collection de l’Institut Pasteur (« CIP ») (France, Paris) sont listées dans le tableau 1. Les alignements multiples et les pourcentages de similitude entres les gènes des différentes espèces ont été réalisés par CLUSTAL W sur le serveur EMBL-EBI (http: / / www.ebi.ac.uk/ clustalw/i (Thompson et al.1994). Des arbres phylogéniques ont été réalisés à partir des séquences par la méthode du "neighbor-joining"(Felsenstein et al.1989). Les "bootstraps" ont été réalisées pour évaluer la solidité des nœuds en utilisant SEQBOOT dans le logiciel PHYLIP. 2Résultats a. Séquences complètes des gènes rpoB des différentes espèces d ’ Acinetobacter
Les amorces désignées ont permis d’amplifier les régions tests de toutes les souches du travail; la taille du gène complet est de 4089 pb pour toutes les espèces. Les pourcentages de similitude entre les souches varient de 83 à 94 %, excepté 2 paires d’espèces (tableau 4). En effet, 2 paires d’espèces, A. juniî/A. grimontii et A. baylyi!espèce génomique 11 ont des similitudes de 99%. Les autres espèces ont moins de 95% de similitude entre elles. b.
Identification des différentes espèces d’Acinetobacter basées sur les séquences partielles du gène rpoB.
Le programme SVARAP a permis l’identification de 2 zones variables bordées par des zones conservées qui ont permis de générer des amorces universelles: -zone 1 : entre les positions 2900 et 3250, et -zone 2 : entre les positions 3250 et 3700 bp (Figure 1).
Ces zones sont amplifiées à l’aide des amorces suscitées chez toutes les espèces à’Acinetobacter et toutes les souches d’A. baumannii. La taille de la zone 1 est de 350 pb et la zone 2 est de 450 pb. Le pourcentage de similitude entre les différentes espèces de la zone 1 varie de 78,6 à 95,4% pour toutes les espèces excepté 2 paires. En effet, comme pour la séquence complète, A. bajlyi/ espèce génomique 11 et A. punit/A. grimontii ont les valeurs de similitude plus élevées, respectivement 98 et 99,1%, alors que les autres espèces ont moins de 96%. Le pourcentage de similitude la zone 2 est entre 75,8 et 95,3% pour toutes les espèces excepté, là encore, les espèces A. junii/A. grimontii et A. bajlyi!espèce génomique 11 qui ont de plus hautes similitude, respectivement 98,8 et 99,6%, alors que les autres espèces ont moins de 96% entre elles.
La similitude intra-spécifique des différentes souches d’A. baumannii pour la zone 1 varie de 98,3 à 100% à l’exception de la souche CIP 103655. En effet, cette souche ne possède qu’entre 94,9 et 95,7% avec les autres souches. De la même façon, la zone 2 varie de 98,7 à 100% pour toutes les souches de A.Baumanii à l’exception de la souche CIP 103655. Cette souche a des similitudes comprises entre 93,6 et 94,4% avec les autres souches de l’espèce. Les espèces les plus proches d’A. baumannii sont espèce génomique 3 pour la zone 1 et A. calcoaceticus pour la zone 2 avec des similitudes respectives de 95,1% et 93,6%. Ce sont des valeurs nettement inférieures à la variabilité intraspécifique à l’exception de la souche CIP 103655 pour la quelle la souche d’A. baumannii la plus éloignée possède 94,9% et 93,6% de similitude, respectivement dans les zones 1 et 2.
Au total, la variabilité de séquence est de 0,4 à 24,2% pour les séquences partielles contre 0,8 à 16,9% pour les séquences complètes de rpoB. Les 2 séquences partielles permettent donc une identification non ambiguë des 24 espèces. c. Analyse des zones flanquantes du gène rpoB (fragment intergénique rplL-rpoB et fragment intergénique rpoB-rpoC).
La taille des 2 fragments intergéniques est variable en fonction des espèces. La taille du fragment intergénique entre rplL et rpoB varie de 301 à 310 pb (Tableau 1). Entre les espèces, le taux de similitude de ce fragment intergénique rplL-rpoB varie de 80,8 à 96,9%, excepté que le fragment intergénique est identique entre A. junnii et A. grimontïi., et les couples d’espèces comme yl. bayly/-espèce génomique 11 et A. Iwojfii-espèce génomique 9 ont des taux de similitude comprises entre 98,4 et 99,7%.
La taille du fragment intergénique entre rpoB et rpoC varie de 86 à 177 pb (Table 1) avec des taux similitude entre les espèces comprises entre 70,2 et 96,5%, excepté pour A. junnii/A. grimontii qui ont une similitude élevée de 99,5%, et au sein du complexe Acb (A. calcoaceticus, A. baumannii and espèce génomique 3) dont les taux de similitude sont compris entre 98,5 et 99,0% pour le fragment intergénique rpoB-rpoC. En revanche, par rapport au fragment intergénique rplL-rpoB, A. baylyi-espèce génomique 11 et A. Iwojjii-espèce génomique 9 n’ont que 83,8 et 87,9% respectivement de taux de similitude pour le fragment intergénique rpoB-rpoC.
Au sein de l’espèce A. baumannii, la taille du fragment intergénique rpfLrpoB est de 305 pb pour toutes les souches à l’exception de la souche CIP 103655 pour laquelle la taille est de 304 pb. Le fragment intergénique rpoB-rpoC a une taille de 86 pb pour toutes les souches . Toujours dans cette espèce, le pourcentage de similitude dans le fragment intergénique rpolL-rpoB varie de 99 à 100% pour toutes les souches à l’exception de la souche CIP 103655. Cette souche possède entre 96,1 et 96,4% de similitude avec les autres souches. L’autre fragment intergénique rpoB-rpoC est 100% similaire pour toutes les souches à l’exception de la souche CIP 103655 qui est 97,7 à 98,8% similaire aux autres souches. L’espèce la plus proche d’A. baumannii est espèce génomique 3 pour le fragment intergénique rplL-rpoB et A. calcoaceticus pour le fragment intergénique rpoB-rpoC avec des similitudes respectives de 95,9% et 98,5%. Ce sont des valeurs nettement supérieures à la similitude intra-spécifique à l’exception de la souche CIP 103655 pour laquelles les espèces d’A. baumannii sont des similarités de 96,1% et 97,7% respectivement pour les fragment intergéniques rplL-rpolS et rpoïï-rpoC.
En fait, comme il ressort des positions des amorces des séquences SEQ. ID. n°5, 6, 7 et 8, les fragments correspondant aux amplifiais obtenus à l'aide de ces amorces ont des séquences qui dépassent celles des fragments intergéniques proprement dits aux extrémités 5' et 3', mais les séquences SEQ. ID. n°121 à 144 et 165 à 188 données dans le listage de séquences annexé à la présente description, correspondent aux fragments intergéniques complets et ne débordent pas dans les gènes rp/L, rpoB et rpoC respectivement. d. Analyse phylogénique des espèces d’Acinetobacter. L’arbre phylogénique construit avec les séquences complètes du gène rpoü> construit par la technique du neighbour-joining est supporté par de très hautes valeurs de bootstrap (Figure 2). Le nombre de valeurs de bootstrap A 75% est de 17/22 en utilisant le gène rpoY> complet alors qu’il est de seulement 7/22 par l’utilisation du gène 16S rRNA (p< 0.01). Toutes les espèces sont bien séparées en différents groupes. L’arbre basé sur le gène rpoB partiel (zone 1 et zone 2 concaténées) montre un groupement homogène des souches d’A. baumannii. La souche CIP 103655 apparaît dans le même groupe mais est clairement séparée des autres isolats d’A. baumannii. Ce regroupement est supporté par une valeur de bootstrap de 85%. 2.4Discussion. A l’exception du gène 16S rRNA, il n’existe actuellement aucune séquence de gène de ménage réalisée sur toutes les espèces d’Acinetobacter. Les séquences des gènes gyrB et recA ne sont pas disponibles pour les 10 espèces les plus récemment décrites. En effet, Yamamoto et al (1996, 1999) et Krawczyk et al (2002) ont séquencé les gènes gyrR et recA de 14 espèces et ont comparé cette technique à l’hybridation DNA-DNA (Bouvet and Jeanjean, 1989; Bouvet and Grimont, 1986; Tjernberg and Ursing, 1989). Par construction d’un arbre basé sur le gène rpoB qui incorpore 14 espèces, aucune congruence n’est observée entre les différentes espèces. Toutefois, l’arbre basé sur le gène rpo¥> a de façon significative plus de valeurs de bootstrap >_ 75% (11/12) que celui basé sur le gène 16S rRNA (4/12), gyrü> (5/12) et recA (6/12) (p < 0,01, p = 0,01 et p = 0,02 respectivement) (Figure 4). Cela démontre la robustesse de l’arbre basé sur le gène rpoB. A. Iwoffi et Acinetobacter espèce génomique 9 sont 100% identiques sur le gène ^rB, mais sont séparés sur la séquence de gyrD et recA (Yamamoto et al., 1999; Krawczyk et al (2002). Les espèces mal délimitées par le gene rpoY> sont les couples A. grimontiilA. junii et A. baylii!espèce génomique 9. Malheureusement il est impossible de les comparer en ^rB et recA, les séquences de A. grimontii et A. baylii n’étant pas disponibles.
Pour l’identification moléculaire en routine des Acinetobacter, chacune des séquences partielles du gène rpoB et des 2 fragments intergéniques qui le bordent, peut être utilisée en raison de son pouvoir discriminant et de sa longueur. L’inconvénient de l’utilisation d’une seule de ces séquences est l’absence de bonne discrimination entre les paires A. grimontii!A. junii et A. baylii!espèce génomique 9 (Table 4 à 11). Cependant, cet inconvénient peut être réduit en combinant la séquence d’au moins 2 de ces séquences hypervariables. En raison de sa taille nous pensons qu’il est préférable de débuter par la séquence de la zone 1 car elle permet d’identifier parfaitement 20 espèces sur 24. Si les séquences obtenues sont celles de A. grimontii/A. junii, il vaut mieux par la suite réaliser la séquence de la zone 2 qui différencie mieux ces 2 espèces. Sî la séquence obtenue est plus proche de A. baylii!espèce génomique 9, il sera préférable de déterminer la séquence du fragment intergénique rpoB-rpoC qui discrimine mieux ces 2 espèces.
La variabilité intra-spécifique des courts fragments observée au sein de l’espèce A. baumannii montre qu’à l’exception de la souche CIP 103655, tous les isolats ont des similitudes nettement inférieures à celles que l’on peut observer entre A. baumannii et les espèces qui en sont le plus proches. Toutefois, les similitudes faibles observées entre la souche d’A. baumannii CIP 103655 et les autres isolats de l’espèce montrent que l’identification de certains isolats de cette espèce peut rester ambiguë. L’espèce A. baumannii est l’espèce la plus fréquente en affection chez l’homme .Les résultats montrent que la souche CIP 103655 est une souche différentes des 24 espèces répertoriées et n'est vraisemblablement pas une souche d'espèce A. baumannii.
En conclusion, les résultats obtenus par l’utilisation des séquences partielles du gène rpoB et les fragments intergéniques rplL-rpoB et rpoB-rpoC montrent que ces outils sont efficaces pour l’identification moléculaire de routine des souches d’Acinetobacter. Cependant, en raison de la forte similitude entre certaines espèces, des travaux complémentaires étudiant les similitudes intra-spécifiques dans plusieurs espèces seront nécessaires. De même, le statut de certaines souches comme la souche d’A. baumannii CIP 103655 et de certaines espèces comme A. grimontii et A. baylii, devra être étudié par hybridation ADNADN et séquences d’autres gènes de ménage (recA and gyrB). FR 2 883 298 A1 (oy La présente invention concerne des gènes rpoB complets, fragments de gènes rpoB SEQ. ID. n°9 à 32 et fragments de séquences hypervariables desdits gènes rpoB SEQ. ID. n°33 à 56 et 77 à 100 et fragments d’acide nucléique de séquences hypervariables non codants encadrant le gène rpoB de séquences SEQ. ID. n°121 à 144 et 165 à 188, ainsi que des oligonucléotides de séquences spécifiques d’une espèce tirés desdits fragments de séquences hypervariables ainsi que des oligonucléotides consensus entre les différentes espèces de bactéries acinetobacter des séquences SEQ. ID. n°1 à 8 pour les 24 espèces suivantes: A. calcoaceticus (espèce génomique 1), A. baumannii (espèce génomique 2), espèce génomique 3, A. haemolyticus(espèce génomique 4), A. junii (espèce génomique 5), espèce génomique 6, A. johnsonii (espèce génomique 7), A. Iwoffii (espèce génomique 8), espèce génomique 9, espèce génomique 10, espèce génomique 11, A. radioresistens (espèce génomique 12), espèce génomique 13, espèce génomique 16, A. schindleri, A. ursingii, A. baylyi, A. bouvetii, A. gerneri, A. grimontii, A. tandoii, A. tjernbergiae, A. towneri, A.parvus. La présente invention a également pour objet l’utilisation desdits oligonucléotides, dits fragments de gènes ou dits gènes complets rpoB dans une méthode de détection par identification moléculaire desdites espèces de bactéries acinetobacter.
Tableau 1. Souches à’Acinetobacter étudiées. fragments intergéniquescomplets U O CQ Taille 86 86 98 Ό X Ό X I 98 98 Ό X 98 98 98 98 98 NO X 98 98 98 98 1 98 I 98 98 98 1 98 I SEQ. ID. 165 166 681 061 191 1 192 I 193 194 LO Ch 961 197 861 661 O 0 01 102 (N O <N CO O (N O O] LO O O] NO O O] L0Z X O <N rNO (¾ O Taille 305 305 LO O co 305 LO O cO iO O CO Γ 305 LO O rO iO O cO LO O cO 305 LO O CO 305 LO O cO LO O cO LO O CO iO O CO LO O CO LO O CO LO O cO O cO O cO LO O cO SEQ. ID. n° Ici 122 144 lo >rH Ό r—i 147 148 149 150 t-h lO T--1 152 153 LO 155 O LO ΓiO 1 158 Ch LO T—l 160 NO r-< 162 cO NO T—1 £Zl SEQ. ID. rpoB zone 2 77 78 r-i O Ol O t—1 CO O T—< 104 105 106 ro T—1 108 109 OU 111 cil CO rH H '-t T-H T"H 115 911 117 118 119 120 79 SEQ. ID rpoB zone 1 33 34 Γιο X UO Cs LO 09 J Ό 62 £9 64 S9 Ό O L9 89 69 70 ZL 73 74 75 NO Γ35 SEQ. ID. rpoB complété CN O r-4 Souche 00 00 Ph f—1 U cO O r£ U 1072.1 (ref) CIP 53.77 CIP 53.79 CIP 54.97 CIP 54.147 CIP 64.1 CIP 68.38 CIP 70.8 CIP 70.9 CIP 70.10 CIP 70.21 CIP 70.22 CIP 70.24 CIP 70.28 CIP 70.32 CIP 70.33 CIP 70.35 CIP 103572 CIP 103655 CIP 105742 CIP 70.15 espèce espèce génomique 1, A. calcoaceticus espèce génomique 2, baumannii espèce génomique 3 fragments intergéniquescomplets U m Taille 172 149 OZT 141 177 O LO Th tJt-h Th LO 89 Tt* LO CO iO t—< 159 9£l 00 00 Ό LO OZT O lO AC LO CO τΓ ^H ΓΙΟ T-H cO τΓ SEQ. ID. 168 169 170 r172 CO ΓTf ΓTH LO rτ—< 176 LLl 8Z.I CA Γ— T-H 081 T““* 00 rH (N 00 T-H CO CO T-H 184 LO OC ^H 981 ΓΟΟ T-H 00 00 T-H U Taille 00 O cO 308 1_ CO O co 301 308 Ό O cO z.oe Th O CO 304 CA O cO 309 310 308 Th O cO LO O cO 309 00 O CO Ό O CO r— o cO Γ— o cO 00 o cO SEQ. ID. n° 124 125 Ό M T“H LZl 128 CA Ol O cO r—* cO 132 [ 133 134 135 NO cO 137 138 CA CO T-H O Th ^H H Th 142 CO Th T—H Th Th T-H SEQ. ID. rpoB zone 2 O 00 00 O} CO 83 84 LO CO aû 00 87 88 Ca 00 06 CA Ol CA 93 94 95 96 rCA 00 CA CA CA 100 SEQ. ID rpoB zone 1 36 ___________ 00 cO 39 40 Th Ol Th CO Th 44 1 45 46 Γ—· Tt* 00 Th CA Th 50 LO στ cO LO 54 LO LO AO LO SEQ. ID. rpoB complété (N T-H ro tJ^h LO t-H \Û t—1 Γ00 61 20 t—l (N 22 CO Ol 24 LO (N sO (N 27 28 I 29 30 T-H CO (N CO Souche CIP 64.3T CIP 64.51 CIP Al65 CIP 64.6 ' ‘O T-H TÎ* AO Ph HH U CIP 64.7 CIP 70.12 CIP 63.46 00 00 ΓγΟ O T“H P-I 1—1 U CIP 70.18 CIP 64.2 K co Ol ro PU HH U CIP 107286T Th ΓTh r— O HH Ph HH U CIP 107468T CIP 107464'· CIP 107470T Sn AO Th Γ— O T-H PU HH U γιΟ AO Th ro Pu HH U N Γ— "Φ Γo T-H Pu HH U CIP 108168T espèce espèce génomique 4, A. haemolytkus espèce génomique 5, A. junü espèce génomique 6 espèce génomique 7, A. johmsomi — % espèce génomique 8, A. Iwoffii espèce génomique 9 espèce génomique 10 espèce génomique 11 espèce génomique 12, A. radioresistens espèce génomique 13 espèce génomique 16 A. schindlen ' *V1 ©/· P: t A. bouvetü £: g —4 Sç I A. tandoü .¾ -¾ g .'L. «Ls 1 A. parvus
Tableau 2. : Amorces utilisées pour amplifier le gène rpoB et ses zones flanquantes
. No Amorce séquence (5’-3’) Position Tm (°C) 1. AcintF' GGTAAAGTDACRCCTAAAGGT 60°C 2. AcintlT GT AT G A A CGTGGGDCA GATT 58°C 3. Ac28F GTDGGTACVGGYATGGAA 52°C 4. Acl754Ra GAACGYGCRTGCATYTTGTCA 60°C 5. Ac822F CGYAAAGA YTT GAAAGA AGA 54°C 6. Ac840R CTTCTTTCAARTCTTTRCGRT 60°C 7. Ac660F GA Y GTD A A A GA YT CAT CTTTA 54°C 8. Acl720R GAACGYGCRTGCATYTTGT 60°C 9. Ac660R CGTAAAGATGARTCTTTHAC 54°C 10. Acl700F GACAARATGCAYGCRCGTT 60°C 11. Ac696F* TAYCGYAAAGAYTTGAAAGAAG 60°C 12. Acl093R* CMACACCYTTGTTMCCRTGA 60°C 13. Acl055F* GTGATAARATGGCBGGTCGT 60°C 14. Acl598R* CGBGCRTGCATYTTGTCRT 58°C 15. AcintlF1’ AAGAAGCWGGYGCTAMAG 55°C 16. Acint2Fb CTKGGYCTKAAAGAAGCYAA 58°C 17. Acint3Fb CTGCT GC Y GYT GTT G AA GA 58°C 18. AcintlRb GGTAGTTRATGGTTTCMGG + 56°C 19. Acint2Rb GTTRATGGTTTCMGGCTTYTT + 59°C 20. Acint3Rb GGTTTCMGGCTTYTTAACTT + 56°C 21. AclF ATGGCWTACTCAYATACYGA 1 57°C 22. Ac4Fa GCWTACTCATAYACYGARAA 4 56°C 23. Ac8Fa ACTCATAYACYGARAARAAAC 8 56°C 24. Ac361F GARCAAGAAGTMTACATGGG 361 58°C .No Amorce séquence (5’-3’) Position Tm (°C) 25. Acl215F GTTCAACCGYCGTWTSGGT 1215 59°C
26. Acl503F GATCAACGCCAAGCCDGT 1503 57°C 27. Ac2071F GGYTCRAACATGCAGCGT 2071 56°C 28. Ac2267F GYGTVGAYATCTACAACCT 2267 55°C 29. Ac3684F TGAYGGHCGTACDGGYG 3684 56°C 30. Ac3753F CCAYTTRGTDGAYGACAAAAT 3753 56°C 31. Ac3850F TTCGGTGGTCAGCGYTTC 3850 57°C 32. Ac28R GITTYTTYTCRGTRTATGAGT 28 56°C 33. Ac55R GCAA YTTRCYAAARTY CTT 55 59°C 34. Ac211R CA GC ATT GCCRGARTARCT 211 57°C 35. Ac380R CCCATGTAKACTTCTTGYTC 380 58°C 36. Acl221R GTTGAACTTCATVCGDCCWA 1221 55°C 37. Acl523R GCFIACHGGCTTGGCGTT 1523 56°C 38. Ac2093R GCCTGACGCTGCATGTT 2093 55°C 39. Ac2314Ra TGTTCTGGTTBGAACGVGT 2314 56°C 40. Ac2928Ra GHGCHGCTTCTTCRAAGA 2928 55°C 41. Ac2936Ra CGYTCACGHGCHGCTTCT 2936 55°C 42. Acll70F GCTTCCATYTGGCGHACRT 1170 58°C 43. Acl705F GTACGTCACGBACYTCRAA 1705 58°C 44. Ac1804F T C C ATRAACT GD GA YA A YT G 1804 56°C 45. Ac2231F GTATCACGYGCDACACAHGA 2231 60°C 46. Ac2348F GT CAT GAA Y GCD A CRC G CA 2348 58°C 47. Acl379R CGGTTACCYAARTGRTCRAT 1379 58°C 48. Acl391R GAACGNACRCGVCGGTrA 1391 58°C 49. Ac2325R GTTRATAC AD GTRTTYT GGTT 2325 56°C 50. Ac2439R GAAC GCRACRC GCATGTT 2439 56°C 51. Ac2442R CATGAACGCRACRCGCAT 2442 56°C
Tableau 3 : Amorces utilisées pour amplifier et séquencer la zone 1 et la zone 2 du gène rpoB ainsi que les fragments intergéniques qui la bordent des espèces d’Acinetobacter de la présente étude.
amorces SEQ. ID. n° séquence (5’-3’) Position* Tm (°C) Cible Ac696F 1 TAYCGYAAAGAYTTGAAAGAAG +2916 60°C rpoB zone 1 Acl093R 2 CMACACCYTTGTTMCCRTGA +3267 60°C rpoB zone 1 Acl055F 3 GTGATAARATGGCBGGTCGT +3263 60°C rpoB zone 2 Acl598R 4 CGBGCRTGCATYTTGTCRT +3773 58°C rpoB zone 2 AcintLBF 5 G A A GA RCTTA AGAMD A ARCTT G -361 60°C Spacer rplLrpoB AcintLBR 6 CGTTTCTTTTCGGTATATGAGT +29 60°C Spacer rplLrpoB AcintBCF 7 GTTCTTTAGGTATCAACATTGAA +4048 60°C Spacer rpoBrpoC AcintBCR 8 GACGCAAGACCAATACGRAT +4207 59°C Spacer rpoBrpoC
* il s'agit de la position du premier nucléotide de la séquence amorce par rapport au gène rpoB ο
in OJ υ ,QJ CU in OJ
n υ -i-j G <υ U 'V
(Λ O <υ vh 4-» d v
x> CU c\ 00 O
PS 0 Oh U <u d '<L> Üû d TJ <υ d 6 <u TJ X d C3
d Tî d o in c3 VH eua 0 U
ci o r . ·** “ ^ Tî
ri ('J O M CN X UN CN n ri 00 CN X On n PT r~ CN r} X CN CN X CO hX Φ NO d d rrX X X X Γ'o UN o d d d UN K X X X X X NO o Φ hCN Φ '— d d d d K d X X X X X X LT, UN hX CN ri rΦ d NO d d K d d ON X X X X X X Φ cN rCN Φ Cn nO ρΛ CN d d d d K d d ON ON X X X X X X cn Φ Φ rO CN o pt Φ CO X X X d d K X X X X X X X X X n o NO CN Φ o Φ n pN Φ X 00 d NO ce NO d d d d d 00 X X X X X X X X X 00 Nû Φ ro pT UN CN CN NO UN UN UN d d d d d d CO 00 X X X X X X X X X o NO pr m CN PO UN CN ri Φ UN UN o LT, d UN NO NO d d d K K K ON 00 CO X X X X X X X X X ON CN Φ rO o rUN Φ r— CN ri pT ro Φ s6 UN UN UN d d d d K K CN ON 00 00 X X X X X X X X X co n rpo 00 n CN Φ pr NO X n γΛ On d Φ NO UN UN UN d d d d K Cs CN ON 00 00 X X X X X X X X X rO Φ oo Φ NO (N rΦ UN n NO CN NO Φ o O O CN .n d ir> UN NO UN d d d S S CN ON ON 00 00 X X X X X X X X X X Ό rO O Φ Φ ri CN Φ UN o NO CN n rPO ri ri ri H N.O 00 NO NO K d 00 K K X r·' ON ON ON CN CN CO X X X X X X X X X X UN rO hoo 00 UN Φ rT— CN X o Φ ro rCN rT T— CN LT, d NO UN NO d d d d ON CN ON ON CN 00 00 X X X X X X X X X X Φ On Φ On 00 o LT) 00 CO UN X ri n UN Φ NO Φ CN d Φ T— T— ri d ln d NO NO d d d K d θ' ON ON CN CN CN CN oo X X X X X X X X X X pT Φ o O Φ o Ό UN nO n n CN Cn rrn pT pT nO ON On o CN 00 00 CN d UN d NO UN NO UN d K K ου 00 ON 00 00 00 00 00 00 X X X X X X X X X X rl CO r<*N UN o On OO cN 00 n X pr Φ r~ n o nO CN CN hcn 00 00 C7n ON 1^ K cd d UN NO NO NO d UN d d d d d ON CO 00 00 00 00 00 00 00 00 X X X X X X X X X X ON o NO CN Φ Φ run o 00 00 NO UN ro Φ UN nO nO UN rO ri 00 rC7N ON K K CO d NO UN UN NO UN d d d d d ON ON CO 00 CO 00 00 00 00 CO 00 X X X X X X X X X X NO CN o CN o CN o o O A U A υ ’Aj υ Ά υ S U *5 U U .¾ U u ‘δ u u «2 § » ·<* 53 vT u I C’A s ^"2 5» $ ô•A r> 1° ,Sà C3 'r :§ Q> cL •A g> CL Ά C o 'to 1 1 Ih cL •A Π cL ’Λ ‘g ζ sl *-* SL bi. *0 ‘S SL <a SL <2 =-. < < bJj bt N n 1 1 N N N X rh\ A. ursinyi 85.7 86.0 85.6 85.4 85.7 85.9 86.3 85.3 85.3 86.2 86.5 84.3 85.5 85.1 84.9 85.2 85.3 86.5 85.3 85.5 85.3 86.1 24} A. radioresistense 84.2 84.5 84.9 84.6 84.4 84.4 84.1 84.4 84.2 84.4 84.2 83.1 83.2 84.6 84.3 84.9 84.6 83.9 84.1 84.0 83.7 84.3 85.2 X ni
ni CI :
Comparaison des taux de similitude(%) des séquences (301-310 pb) fragments intergénique rplL-rpo¥> CS •K* tu s;
* ts» O ni σ' x Γ— Ό LT, x O)
O
Cn 00 Ι- Ο φ
X
00 ci Cn Ιm ΟΝ ni σν CN CN η] nC Φ un cd 00 CO CC
LO 2 Cl I i X) d H
T3 (A v u ,<o Cu <Λ V V) V Ui c <ü U 'U Mh <-h • Ή -o C/3 V CI P Cn Φ xi fd CN O O Φ TO rd rd O CN CN rxi rd xi ni CN cn Cs CN O M cd nO Φ ni cd CN CN CN CN CN Φ 1— Φ φ rTχ x rd X xi fd o CN c\ CN Cn CN Φ Cn O un un Φ ni rd d LT) p p xi p Cn CN CN CN CN Cn Cn un 00 LO un Φ Φ LO cd d d 'd 'd 00 00 d o 00 oo CO CO CO CO CO 00 p 00 Φ cd TΦ Φ rΦ lTÎ d Γd r— 00 00 1— ΓCn CO ΟΟ oo 00 00 00 00 ΟΟ 00 Ό O x O un i— Ι00 ni O "Φ o rd LfS K Γtd Γcn Cs 00 00 00 00 00 ΟΟ CO ΟΟ
m τΦ m d Ι— 1— CN CN X X X Φ p x Ό X ΓΦ CN CN d ΟΟ X X X X m ni m X rn d p fd tri x d 00 CN CN X X CN un Φ x m 00 ni r— p ΓCn Cn Ln d r— CN ΟΟ 00 X X X X Cs ni ΓΦ Φ ni x Ln p Γ00 cd ud un r— CN CN ΟΟ 00 X X X X Φ ni 00 P o ni X 00 d P cd CN CN d d cd Cn CN Cn CO X X X X X 00 in oo uo P X) rr— p id Ln Ln in ni Φ Φ ni ni rt00 00 00 CO 00 X X X X X x s0 x ni Φ X m X p LT, Φ td d ni in Φ p ni fd 00 00 oo 00 00 X X X X X m χ Φ m P p Ό o m d x r— d ni Φ Φ fd Φ d CO 00 00 00 00 X X X X X Ln Ln Φ Ln P p p p Cd d un Γd ni Φ Φ fd Φ d 00 00 ΟΟ 00 00 X X X X X
ni ni X ni r— 'Φ cd r— p X td td id d ni 1— X ni fd td X X X X X X X X X X p r— NC X X X Ό Φ rP fd ni fd d d d fd ni ni ''t X X X X X X X X X X 00 p X ni 'tf X X p p X Ln "«t X X ni id "φ fd "Φ id X X X X X X X X X X p o Ό p p -Φ X X tf fd rd tt p rd p p 'tf X X X X X X X X X X X Ln X P X o X p d d cd d d K td fd X X X X X X X X X X X X X r— X p X X 'Φ r— p d d K d d td td ni ni TjX X X X X X X X X X r— X r— X p m r— p p r— d K 1— d d ni fd *t X X X X X X X X X X X X Ό Ό Cn c 3 -r c 3 zr C 5, ü 3 T c 3 cr ü 3 zr 1 ε C -u 11 B -Si B c S ^ C "go -¾ -S c 'S • o u U •CJ Cu X ’J l u 1 B <5 -3 SC c u 3 ‘^1 s g « 1 δ ^ s .§ .y ^0 c. SC 3 u 'ü r., -¾ ^5 > «s g 'ü § •S I •a» SC «J u -¾ 'C . CX '&amp; X O X ^ ^ s X c ^ Z ni X "dX NC r— x ô° t m X Φ X nQ ' r-1 X CN o tni
V 3 zr | c ο si c U O G. x D
j22| ^4. gerneri 86.8 85.5 85.8 83.0 84.6 83.6 84.9 85.2 85.2 83.6 84.0 88.4 88.4 87.7 88.7 85.5 88.4 88.1 91.5 91.8 92.8 |23| v4. radioresistense 86.2 87.1 88.4 86.8 87.4 86.2 86.8 87.7 87.7 86.8 85.2 86.8 86.2 85.8 86.2 84.9 86.5 84.9 83.0 83.3 86.5 86.5 |24| Λ. ursingi___85.8 84.9 85.5 85.2 86.5 84.9 86.8 85.5 85.5 84.9 85.2 85.5 85.5 84.9 87.7 85.5 85.8 86.2 85.2 85.5 86.8 87.7 90.3
(N X CU ΓΓ- ο 00 U O eu U PQ <u 3 tr * ^ a 60 J-l U h-> p a OJa bC ci 1-1 -O eu O r-1 m o CO <u o p <υ p u* '1) X V2 <u 73
<υ P
OJ 73 X P <3 H <U υ a,
0 P d OJ 1 I X> P H
p a> U '!U
ζΛ (U od 00 ni Th m <N b od X r— es Cs oo Cl b sd b x X Γo x ni Th ΟΟ Cl b en sd sd x f— X Γes oq oq X Th ΟΟ *— b b b mi b 1x X X 1— 00 Cs en oq oq es X T— ni b b en vd b Cs r— x x x r— t— ni h:
en en ni en ni b b b sd b b ni ΓΓΓr— r— x r— Ό r— Γη ΟΟ ΟΟ en X CS en TTtsd b un b sd b b r— r— r— t— r— t— x X m-, X ren en ni oq en es en Tb o i_r, un ni cd 00 iri b X t— 1—· ιΓΓr— X r— -h X X en en Γη ΟΟ η Cs Cs Th T— en ni ni en b b ni mi b iri X x x X x x x x es X en X en en Γ-;
X m ni x en •h oq ni tt in b b cd b ni ni sd b X X ΓΓ— r— r— t'x x x 1— ni τΓ es en ΓX oq x en x oq es X mi m tjηϊ sd b b sd b en b b X X X r— t'x x r— X x X t— , X 00 Tf en x en Th es x en x Th Th Cs 00 b b b LT, b un sd b ni en od r— î— X X x 1— x x ΓX x es X o Tt en en rh en 00 ni m en ΟΟ en en es Th b b sd r— es b b b mi b b b mi CS C'r— x r— X r— x X t— f— x Cs x σ' es Cs en X rf X 00 en Tf Th en X CS X mi sd b sd sd r— b iri b b en ni en b ni X X X Γx r— t'1— Cs es r— x X X x 00 LO Th Tf CO ΟΟ x m en Γ— Tf es ni en en Th en sd sd sd CS sd b r— b b b X en b ni od b σ' X X 1— l'x r— r— rx X r— x X x X rCs es Tf Th Th es Cs Tf es Tf es CS Th Tf Th es es ni b b en b oo b b oo b b b b b b b b Cv Cs es Cs es X x x x x X es X es es es CS Ό tn Tt tJTf Th Th Tf σ' es t|Tt Cs CN Th Th Th es Th X en ni b en b es b b X o O b b b b b b CN es Cs Cs σ' CS X x x x Cs Cs es x CS Cs es CS LO o LT5 CN CS Tf TiTf tjTf Cs Th Th Cs es Th Th Th es es On 00 ni T'b en b X oô cd cd b b b b b b b b CN CS CS es Cs es CS X X X x x X es x es es Cs CS tîTh σ' Tf m m en oq m en X X x X en ni t'en en Th en U b b b X b U sd es b b sd b un en en b b mi b Cs Cs Cs r— rX X ΓΓx l'r— x r— r— rX r— x f— co in Tf Cs Th X X X en ΟΟ ΟΟ en en en en r— r— ni X x Th X Cs ,—1 b U X b CS b in 00 b b b b b ni b b cd iri b ;c$ Cs Cs CS r— rrX i— r— x rΓx rr— r— x r— x l'Π Th es Cs CS Cs m en en X X en x x m X r— l'X x en Th en b b Cs CS Cs uni LTl CTS b b rb b b cd en en b b b sd uri XI X 00 X X rrrX rrx r— rr— Γr— Ιrr— x 1— Tf Tf Cs Tf CS Tf en en en en ni ni X en en en Ιni Γη X r— Th en ri O b O b b sd iri CS b Tf Tt ni cd b X Ο b un sd b sd b Cs CS Cs Cs CS Cs r— r— rX rf— x r— rrr— r— t— rr— X ren sO Cs O en y 3 or y 3 or U 3 σ* U 3 CT ü 3 X o 3 X y 3 C «te 1 i § g ·>« g ‘g §ï g g ‘g ·$ c ’§ M <1 ‘j 1 u «o %*. 3 ^ *^N «0 *0 12 $5 .¾ * y te y υ ΌΙ b •Λ U S Si * X c 'V te y u • e U r. V C ' u te y u e CX υ 1 go «te .δ H^S 1 1 .§ 1 'J: a c 'CJ -¾ te M υ -¾ '3 . eu c 'V te e u Ό) a Y, O ’tî «te 1 Ë S -¾ 1 ’ε: 1 § ·*$ .¾ 1 C •y te y y 'y •f, y % x ,¾ δ 1 Ί $ $ 1 ^ Γ1 en Tt m sQ rx" es" O El m en Th ltT ^ |16] 10 F7 X Cs o ni £1 ni m en m Th ni fO ri CO τ
U o a O] pi 0 00 N o p Γ— P] d d 00 00 u TJ © p fO © s, rd vd © u © 00 00 *—H υ 00 © p p p "-W © vd vd d co 00 00 00 rt Οp fP © rχ QJ vd d d © d 00 OO CO 00 00 U a o TP P p p U id © vd d fd d 3 CO 00 00 cO où 00 QH MU 1X5 p p — © © © Si © cd d vd vd d pi co oo oo oo 00 oo co en V T3 νφ o o p o p p o oo © od rvd d d pi X--s © © oo oo co oo oo oo XJ Oh rp © Γρ P p © p o p <3, *— Ttid vd id id vd vd pi d oo co co 00 00 co co 00 oo LO PI fP p p © © o p p © s vd ud id 'd ’d id vd d d pi oo co oo co oo oo oo oo oo oo <D υ 0 rfP T p rp Γ© p © © p © U © id id id rd P) id d d d d 0 © 00 co co CO 00 00 co co CO co cr VU O p o T— T— Hf © © © © © p T— 'Si Γ© [-^ id ld d vd d d d d ΟΟ © 00 co co co 00 00 oo co CO co Si <u TJ © Τp p p p p p 'Φ © r— T Γ—Ο K © vd vd id vd d d vd d d d ^^ Os oo oo oo oo oo oo oo co oo oo co oo o N 00 p p p © p T— p p T— p p ü X d K cd T T id id d d d d d Cv © 00 © 00 00 00 co oo oo oo co co co T3 0 -4-5 Γ^© fP p © p Tj· © © © p p • d X ci 00 © 00 LO LO id d vd d d d d • yH © Cv © 00 00 00 co 00 00 00 00 00 co co co G © T Φ φ cO T © © p © © p © p © © Si LO d © P) © pi K vd id ^d d d vd d d pi © © X © oo © oo oo oo CO oo oo 00 oo 00 CO V Ti LD νφ © T P T p © © p p © p p p © x © © Cv Cv © d Γ00 'd id fd cd d fd d d O OO © oo oo OO oo ΟΟ oo oo oo oo ce oo oo 0O oo oo PS ’ r·4 4—1 X νφ fH fp Φ © © O φ tp p Tp p — © Si ô\ o p © © c> K K © id id id d © fd fd d d U © Cv Cv Cv Cs © 00 oo oo oo oo co co oo oo co co 00 T3 3 f-H s rP o T— © p P p T © ^© Ό © © p p νφ p U 00 d d T id T LO pi LO pi pi pi y-L © pi pi fd d pi 0 <ü 00 oo CO CO 00 00 00 00 00 00 00 00 CO 00 co oo oo oo oo s υ • /U Λ Oh PI o Ό fP p ΓCv P fP © P p p p p © p p <— © O LH ex © © © T ΙΟ vd d vd pi LO ’d T T T pi d d d © pi eu <U © 00 CO 00 CO 00 00 00 00 oo OO co 00 oo 00 oo oo oo oo oo G Si u fP Tp © T rrp p © © p rp © o +j d CO d © 50 K K id K cd T id id vd pi d d fd d pi U © CO CO CO CO CO 00 oo oo ce 00 CO oo oo oo oo co oo ce oo co C <υ LH rVU Lm rP o fP Ό T o © O V 3 ci Lm p3 CJ 3 or V 3 zr CJ c CT υ 0 zr ü 3 zr c 3 3CJ 3 3" CO Ü Tî SJ s; <5 | C '05 § ;2 $ $ | 'V te | c Ό g .¾ «U <5 | c 'V te 1 f 1 '5: <1 .¾ pv, | c • U te | © te | C © te 1° H PQ § O U <5. .§ C U U C U V, o U 'C § -¾ -¾ c U 'V ¢( V U 'V 05 U © à 1 .g § <55 f •*0 P , C-, C1 CCC1 'Λ υ X ü d 1 X V 1 1 X υ 1 X 0) 1 X υ 1 1 U cT m T LT) o rôô" © O PI m Ό F00 © o PI Pl_ PI PJ
[23] A. tandoii 83.4 82.6 82.0 88.6 88.3 89.4 90.0 86.9 88.0 88.3 86.9 88.0 85.7 83.4 83.7 85.4 82.3 87.4 85.1 85.7 84.9 83.7 |24j .4. radioresistense_79.7 78.9 78.6 82.0 81.1 82.0 82.0 80.0 79.4 81.7 80.6 79.4 82.0 78.6 79.4 80.3 79.7 83.1 80.0 80.0 78.6 80.0 83.4 υ Τ3 <Ν α ο Ν υ Τ3 VH rt Οη V υ d <υ 3 cr '(L) <υ 2" Oi O LD d- 1) υ d <l> d cr VCL) (ü (U TJ d υ -d d OJ -d d o in d VH cS Oh V υ 'ü Oh
0 U CO d ci <U 3 ci H
C/5 ü -t-J d <υ VH v(U
ü "d PQ
(N d CS
3 3 • 3 O. Π CO CN Ό d Cs fO p 00 °9 p un un oo oo en o p Γd d ΟΟ co co rp rp p rp sd d d d oo oo co 00 rp rp cq *— 00 d d d d co oo oo co oo en rp C d d d d d d oo 00 oo 00 oo oo r— ri CO en en ri d d ri d ci d 00 00 00 oo 00 r— 00 ri Cs »— ce en p rd ri d d d d ce ri Cs oo oo oo oo oo Γoo p rp o cq ’Cf °9 ΟΟ c d d d ri d ri d CS d 00 00 00 00 oo OO 00 r00 rp p O en 00 p 00 Ιroo co 00 d d d d Ο d d 00 00 00 00 00 OO 00 00 00 00 Cs co Tfp O 00 en ri O d d d d d d d d ci co Cs 00 oo 00 00 00 00 00 00 ΓrO en Tf 00 CO rri 00 co 00 η sO 00 d d d d d ri d d d 00 d 00 co 00 00 00 00 00 00 00 00 r— 00 en m O Tjen Cs en rp 00 sO ri LO d d d d d Γri d d d ci d o 00 co 00 co 00 ΟΟ 00 00 00 co Ι00 Ό Os en O rten CS en rp °® Ο ri d d Γd d d d K ri d d d d d Os Cs ΟΟ 00 00 co 00 00 00 00 00 00 00 00 (N ri Os p rp ri o ri SO T“ en o ri 00 d d d d d d d d d d ri ri ci d co 00 co co 00 00 oo co 00 00 00 oo co r00 p ri ri m Ό en roo es rco sO SO d d d r— LTÎ d d d d ri d ri ri d ci d o 00 00 00 CO 00 00 00 00 00 00 00 00 00 Γ00 sq vq °0 O en O ce p Cs rO "Φ o η ri d d un d d d d d d d d d ri ri ri ri ri es CS 00 00 00 00 oo 00 00 00 oo 00 00 00 co 00 00 co m Ό CS ^J· p co so oo Ό 'p SO en m o sO n d d d d d 'd d d in d d d d d d ri d ri C?N CS CS co 00 00 co co co 00 00 co 00 00 00 00 00 ce TjO •p cr ri oo 00 en O T— sO o r— sO 00 d d d d d d d d d d d ri d d d ri d d 02 00 00 00 00 00 00 00 00 00 oo 00 00 00 00 00 00 00 ce O r— ΓΓp p ri 00 rp o o ΓsO o rp sO d o ΟΟ ΟΟ d d d un un d d d d Η d d ri d d c> Cs 00 CO 00 00 00 00 00 00 co 00 co co 00 00 00 00 00 en O rj Tjrp ri p ri es rp o p 00 ri p en C2 <x> Cs d d CO CO d d d d ri d d d d ri d d ri d O oo Cs 00 00 00 CO 00 00 00 00 00 oo oo oo oo ce oo oo oo en O rO Cs sO CJ υ CJ 3 cr D zr 3 or 3 Ο3 zr 3 cr | s? £ | Ι | § | c '3 te 3 U '3 p &amp; -¾ ,5j 0 te 3 υ -3 p , 5 1 c '3 te 3 u '0) p c 'CJ te CJ υ Ό CL «a ‘C =1 •S .johnsonii s 'ü te CJ U o α'à1 -â i:
1 ‘5! s;
à -1 § G '3 te 3 U '3 α'1° b $ 1 s, x 3 X 3 X X CJ X CJ χ CJ χ ü d ln so~ r00 cT cT d: n en d" LD Ό r— 00 Cs <5" n ri n ri [231 Æjunii 80.4 80.9 81.6 81.6 81.1 82.4 82.9 80.4 80.4 81.3 78.4 79.6 80.7 80.9 81.8 81.3 83.6 84.2 85.6 86.0 80.9 98.0 [24] Λ. radioresistense_75.8 76.0 77.1 77.1 76.9 78.0 77.8 78.7 78.2 78.7 77.1 78.2 76.0 80.7 79.6 80.4 79.1 80.2 80.4 81.8 81.6 83.6 82.4 o ri
Tableau 9 :
Comparaison des taux de similitude (%) des séquences (350 pb) des séquences partielles de la zone ' 'Vi « s ts as « <Ü A υ 2 0 (A Vj υ M a <u U S(U U-, Cm *3 ce <υ TJ PQ 05 a;
Tl
CA ce rl r- tri i -Φ m
M
r-es LO es Cs bΦ Φ cs CA LO CA CS CS
o r -Φ -Φ d ca es uS O CA Cs GS r“T ^—1 ^—1 Cs Cs Cs Gs UA CA Cs CA CA On
rΦcâ câ CA CA
b' o es O CS O O O o O Φ Φ UA UA UA O es Cs CO CO CO o Cs Cs Cs Cs es Ο:
ο ο o -Φ φ ro m O O O O Cs CS 00 CO OOOOCsCsCsCs 1;
ro r o cô ^ Gs Gs gs es t ^ ^ Γ Cs Cs CS Cs Cs Cs Cs Cs Cs Cs
Tf rΤ'CÂ CA UA Cs Gs Cs
Af rCs Cs LO Cs Cs C
•Φ Cs Cs Φ CA Cs Cs Cs C od od od Cs Cs Cs O Os Os CS o 00 CO 00 O Cs C Cs -φ -φ UA C'A r-A Cs Cs CÔ 00 CÔ Cs Cs Cs Cs Cs O O -φ Φ uA en uA O O es es 00 00 00 o o es c es es es ΟΟΟ-ΦΦιΤιηπΑ OOOCACSCOCOOÔ OOOCSCCSCSC UA CO es O Φ r-, Φ Φ O C C C C C C C td O CS CS CA CA CA CA CA es 1 Φ Φ CA SO CA sO so CA Ό câ CA 00 00 CG 00 od od cd ua Cs CA Cs CA Cs CA CA CA CA CA r-; sq UA sq en ua so en CA Cs es CA cd oo oo oo cd od od Φ Cs Cs CA Cs CA CA Cs CA CA CA Cs r-^ sq UA sq en en sq en CA Cs es CA cd CG oo CG ce oo CG Φ Cs Cs CA CA CA CA CA CA CA cs CA hso ua sq en en sq en es Cs Cs c cd cd od CG CG od od T* es es es CA CA CA en CA CA CA CA b^ b^ Φ b~ Φ TirΦ Φ d Cs CA C c c C cs C C id es Cs CA CA es CA CA CA CA CA CA , Φ h-; Φ Φ h-; Φ Φ es es es es es C C C CA C LO es es CA CA CA CA CA CA CA CA CA O CA CA CA CA Φ oo es CA c OO C cd od C cd id CA CS CA CA CA CA CA CA CA CA CA se , es CA es CA Φ oo es CÀ C cd c cd cd C od td es es CA CA CA CA CA CA CA CA CA o CA , es CS | CS Φ 00 es C C oo C cd oo C oo td Cs Cs CA CA CA CA CA CA CA CA CA sO r— , CA , CA CA . CA Φ cd CA Cs C 00 C cd cd C od LO Cs es CA Cs Cs CA CA CA CA CA CA sO CA CA CA , CA Φ cd CA C C 00 C od od C od «d es CA CA CA CA CA es CA CS CA CS
ua Π Φ bun o CA b' 00 ΓCs UA Φ m 00 en Φ n rr-~ rΦ O ri rri 00 n lo en (N ri (N b~ UA en un UA s0 m Φ so d rd rd LIA d rΦ UA O rd oo SO d rrd LIA Tf UA d ro d rd rd bd bO o ri m Φ m o roô" cT o1 (N AA dLIA sO roo CA O ri CM o ri φ Φ ©
Tableau 10 : Comparaison des taux de similitude (%) des séquences (450 pb) des séquences partielles de la zone *V4 'SI 55 Si S 5$
TJ Si OJ J3 υ 3 0 co co V 4—) G <υ u '0) U-) VW • T3 ω T3 PQ <s OJ T3 (N © © © p Φ © © © O Cs C?s Φ θ' Cn o
o — o © © © pO G* © © © © © © © O en © en © en © © © PO © © © © , 00 un en © © © © © en © en © PO © O © , © © , co Φ d o © © © © © © en © en © PO © o o © © © co m d o d o en © © © © © en © en © PO © 00 00 00 rO © po PO © © ni en © en © en © en © cd © © © en © cd © PO © 00 o o o © © © co = © © d o d o d o en © © © en © en © en © PO © 00 © 00 00 00 oo pO 00 CO ro CO o © © en © en © en © en © © © en © © © en © © © rd © o 00 © 00 oc CO CO PO 00 CO fO 00 © © © © © en © en © en © © © en © © © en © en © © © po © o o oc © CO CO 00 00 pO 00 00 pO 00 oc o o © © ©N © en © en © en © en © en © en © en © © © en © po © o o o 00 © 00 00 00 00 pO 00 CO pO 00 n© o o © © © © © © © en © © © en © © © en © © © en © © © rd © ro ro en m © rO © © © r-© ri © ©N ©N en © en © en © en © en © en © en © en © en © cd © en © © © en © Φ © © m rO m m , © , , , r© Ol m ©S ©N © © © © © © en © en © cd © © © en © en © en © oo © en © en © en © Φ © ro ro © © © © m , ro ro ro ro PO 00 ce co ΓΙ Φ en ©N en © en © en © ©N © ©N © © © © © en © en © © © en © © © © © en © en © Φ © o ro ro © © © © ro , m fO ro m PO 00 00 00 (N pO o o CA ©N en © en © © © ©> © en © en © en © en © en © en © en © en © © © en © en © Φ © 00 00 m m m ro © T© © © o ni © © en © © © en en en © © © ©s © © © en © 00 © © © © © en © en © en © en © © © © © Φ © o 00 00 ' ro ro m m © , , © © © o o o © O en ©S en ©S en ©N © © en © © © ©s © en © CO © © © en © © © © © en © © © © © en © Φ © souches o o Γ" ni o rni ro ni 1"m ro O orrd m ni ni o nni m O t-Φ ro ό r*oo en 00 © n φ Φ in © pO in © o hΦ © ro ro d hCl Φ hL(C O © Φ lO 00 d hΦ ri o bLO rO d o co (N O hLO LO © PO © nT rô" Φ ITT ©* F" ôô" © © ni ro Φ ιΟ ©' hCO © © Ol OJ o Cl
Tableau 11 : Comparaison des taux de similitude (%) des séquences du fragment intergénique rp/T^-rpoB de
Ni ' Ni δ ss -¾ <υ Ό CΛ V Λ U 3 0 50
d CTS
o ηd sd o CN
o m ro d sd O Cs CS O O en ΓΟΟ Cs O O O O Cs p p p en rO O O CS sd O O O CS CS CO (ü -M c oj u Ό-» •sh Cm LT) O O o o m nd d d d es d o o o o es OS 7—1 7—1 Tf O o o o o en nd d d d d d d o O o o o es os m o o o O o o en rd d d d d d d d o o CJ o o o os os T— 1 ni o o o o o o o m hT—l d d d d d d d d o o O c_> o O O os os *“1 o o O O O o O O m rd d d d d d d d d -d o o o o o o o o es es o o o o o o o o o o en rd d d d d d d d d d d co o o o O o o O O es e T— Cs O O O o o O o o O o en nd d d d d d d d d d es d o o o o o o o o o o es Cs r— 11 r— CO o o o O o o O O O o O m hd d d d d d d d d d d d d o o o o o o o o o o es os 1 1 T— 11 Γo o o o o o o o o o o o en n~ d d d d d d d d d d d d d d o o o c_> o f_' O o o o o o es Cs T— 7—1 Ό o O o o O O O o o o O O Q m nd d d d d d d d d d d d d d d o O o o o o C_) o O O O o os es T—' ' 7—1 »— 1 in O O O O O o o o o O O o o o en n d d d d d d d d d d d d d d d on O O CJ> O CJ> o O o o o O o o 5J> es Cs *“ »— 1 r-* tîo o o o O o o O O O o O o O o en nd d d d d d d d d d d d d d d d d o O o o O o o O o o O O o o o es e T— *" r— en O o O o O O O o O o O O O O o o en rd d d d d d d d d d d d d d d d d d O O O O O O O o O O o o O o o es os î— »— T—1 (N nn rrr|N. Γn n rrr-. n rnro Th Cs Cs Cs Cs Cs os es es es es Cs es Cs es es es es d d Cs Cs Cs Cs es es es es Cs es es es Cs es es es es Cs Cs rO O O O o O o o o o o o O o o o o en rCs o d d d d d d d d d d d d d d d d d d Cs o o o co o o-> o o o o o o o o o o es es V, en rO X en ri ”Τ rLTî o ri Γ"un m o rd LO rO ni en X ni t|ni ni ni ni o n Cs Cs rnes en ni r-~ LO Ln o en JC U d rO Γod o d o tJLn O nd n d nd rd rd Γ'd nd un en Ln en Ln d nd no o ni m d LT) o nX Cs o ni en us Ό nX es [20] nî
CO V P σ* d ν<υ «) u υ P QJa fcO <3
JD Cu O cO O cd (Λ a; υ P <u P σ* υ j) 00 a; "T3 cx υ P •w ' ^ G d CO <U XJ ’ *>*» K s: P s: ci 4-1 S CO D Xî on CO ’xi CO CS QJ eu Jfl G U G P 0 0 U CO CO V <di M t—1 P a> P Ul '0J Um OJ U_i »—( • —H -Q T3 H <υ υ ο Μ un en
(N o d o ο ο ο GO CO ο ο 00 Ο οό ο cn ο ο ο GO 00 ο Ο Ο Ο 00 Ο Ο Ο od Ο Ο Ο Cn
Ο Ο Ο Ο Ο0 Ο Ο Ο Ο 00 C*· CU CN
O O O O O CO O O O O O 00 O O O O O CN
O O O O O O ο d ο ο ο o O O O O O O
O O O O O O O d ο ο o d ο o O O O O O O O o o o o dodo o o o o Ο o d d o o o d o o d o
oo CO CN 00 00 Cn
CO CO CN o o d d o o o o dodo o o o o o o o o d d d d o o o o o o o o dodo o o o o o o d d
00 00 CN
O O oo d d oo o O CN CN 00 ίο uO m CN υ 3 1Λ O o O o O O o O o o O 00 d d d d d d d d d d d od o o O O O O O o O O O Cn t— T— T— 7—1 7 1 O o o O O O O o o O O O 00 d d d d d d d d d d d d od o o o o o o o o o o <_> o CN 7—1 7—1 7—1 7—1 7—1 o o o o o o o o o o o o o 00 d d d d d d d d d d d d d od o o o o o o o o o o o O O CN 7—1 7—1 7—1 7—1 7—1 7—1 7—1 7—1 7-7 o o o o o O o o o o o O o O 00 d d d d d d d d d d d d d d od o O o o O o o o O O O o o O CN o o O o o o o o o O O O o o O oo d d d d d d d d d d d d d d d od o o o o o o o o o o o o o o o CN *— 7—1 o o o o o o o o o o o o o o o o 00 d d d d d d co d d d d d d d d d od o o o o o o O O O O O O o O o O Cn r— T“ 7—1 7—1 7-1 T— 7-1 7—1 T— o O o O O o o o O O o O o O o O o 00 d d d d d d d d d d d d d d d d d od o o o o o o o o O O O o o o O O O CN 7—1 7—1 7-1 7-1 7—1 7—1 7-1 7—1 1—1 7—1 7—1 00 00 00 00 00 00 00 00 00 00 00 00 00 oo 00 00 00 00 rCO C0 00 od oo od oo oo oo oo od oo oo od od oo oo oo d CN CN CN CN CN CN CN c· CN CN CN CN CN CN CN CN CN CN Cn 00 d o o o o o O o o o o o O o o o o o 00 od d d d d d d d d d d d d d d d d d d od CN o o o o o o o O o o o o o o o o o o CN ΙΓι CM CM 't un hrCN LOS o en o o nri en en 'fr en LO rO ri l'un m o (N en 00 (N CM CM CM Cn CO 00 en d d Cn Γrrd LO d rO rd O Γ-O Γ"o O d rd rd rd rO rd rod NO d NO d LT) en un en m CM m \0 Γ00 CN o rCM CO LO NO roo' CN O U- Références bibliographiques 1. Bouvet PJ, Jeanjean S. Délinéation of new proteolytic espèce génomique in the genus Acinetobacter. Res Microbiol. 1989 MayJun; 140 (4-5) :291-9. 2. Bouvet, P.J.M., and Grimont, P.A.D. Taxonomy of the genus Acinetobacter with the récognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter Iwojjii. Int. J. Syst. Bacteriol., 1986, 36, 228-240. 3. Carr EL, Kampfer P, Patel BK, Gurtler V, Seviour RJ. Seven novel species of Acinetobacter isolated from activated sludge. Int J Syst Evol Microbiol. 2003 Jul;53(Pt 4):953-63. 4. Felseinstein 1989 1989. PHYLIPphylogeny inference package (version 3.2). Cladistics 5:164-166. 5. Gerner-Smidt P, Tjernberg I, Ursing J. Reliability of phenotypic tests for identification of Acinetobacter species. J Clin Microbiol. 1991 Feb;29(2):277-82. 6. Gerner-Smidt P. Ribotyping of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex. J Clin Microbiol. 1992 Oc t;3 0(10):2680-5. 7. Ibrahim A, Gerner-Smidt P, Liesack W. Phylogenetic relationship of the twenty-one DNA groups of the genus Acinetobacter as revealed by 16S ribosomal DNA sequence analysis. Int J Syst Bacteriol. 1997 Jul;47(3):837-41. 8. Khamis A, Colson P, Raoult D, Scola BL. Usefulness of rpoB gene sequencing for identification of Afipia and Bosea species, including a strategy for choosing discriminative partial sequences. Appl Environ Microbiol. 2003 Nov;69(l 1):6740-9. 9. Krawczyk B, Lewandowski K, Kur J. Comparative studies of the Acinetobacter genus and the species identification method based on the recA sequences. Mol Cell Probes. 2002 Feb;l6(1):1-11. 10. Nemec A, De Baere T, Tjernberg I, Vaneechoutte M, van der Reijden TJ, Dijkshoorn L. Acinetobacter ursingii sp. nov. and Acinetobacter schindleri sp. nov., isolated from human clinical specimens. Int J Syst Evol Microbiol. 2001 Sep;51(Pt 5):1891-9 11. Nemec A, Dijkshoorn L, Cleenwerck I, De Baere T, Janssens D, Van Der Reijden TJ, Jezek P, Vaneechoutte M. Acinetobacter parvus sp. nov., a small-colony-forming species isolated from human clinical specimens. Int J Syst Evol Microbiol. 2003 Sep;53(Pt 5):1563-7. 12. Ochman and Wilson AC. R Evolution in bacteria:
evidence for a universal substitution rate in cellular genomes. J Mol Evol. 1987;26:74-86. 13. Stackebrandt, E., and B. M. Goebel. 1994. Taxonomie note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the présent species définition in bacteriology. Int. J. Syst. Bacteriol. 44:846-849. 14. Rainey, F. A., E. Lang, and E. Stackebrandt. 1994. The phylogenetic structure of the genus Acinetobacter. FEMS Microbiol. Lett. 124:349-353. 15. Tjernberg I, Ursing J.Clinical strains of Acinetobacter classified by DNA-DNA hybridization. APMIS. 1989 Jul;97(7):595-605. 16. Towner KJ. Clinical importance and antibiotic résistance of Acinetobacter spp. Proceedings of a symposium held on 4-5 November 1996 at Eilat, Israël. J Med Microbiol. 1997 Sep;46(9):721-46. 17. Van Dessel H, Dijkshoorn L, Van Der Reijden T, Bakker N, Paauw A, Van Den Broek P, Verhoef J, Brisse S. Identification of a new geographically widespread multirésistant Acinetobacter baumannïi clone from European hospitals. Res Microbiol. 2004 Mar;
155(2):105-12. 18. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivitv of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.22:4673-4680 19. Yamamoto, S., and S. Harayama. 1996. Phylogenetic analysis of Acinetobacter strains based on the nucléotide sequences of gyrB genes and on the amino acid sequences of their products. Int. J. Syst. Bacteriol. 46:506-511. 20. Yamamoto, S., and S. Harayama. 1998. Phylogenetic relationships of Pseudomonas putida strains deduced from the nucléotide sequences of gyrP>, rpoO and 16S rRNA genes. Int. J. Syst. Bacteriol. 48:813-819. 21. Yamamoto, S., P. J. Bouvet, and S. Harayama. 1999.
Phylogenetic structures of the genus Acinetobacter based on gyrB sequences: comparison with the grouping by DNA-DNA hybridization. Int. J. Syst. Bacteriol. 49:87-95.