Processing

Please wait...

Settings

Settings

Goto Application

1. ES2665422 - Anticuerpos L243 humanizados

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ ES ]
DESCRIPCIÓN
Anticuerpos L243 humanizados
Campo de la invención
La presente invención se refiere a un anticuerpo L243 humanizado o un fragmento de unión con el antígeno del mismo, una composición farmacéutica que comprende el anticuerpo L243 humanizado o un fragmento de unión con el antígeno del mismo, una composición que comprende el anticuerpo L243 humanizado o un fragmento de unión con el antígeno del mismo para uso en el tratamiento de una enfermedad, una composición farmacéutica que comprende el anticuerpo L243 humanizado conjugado, y un kit que comprende la composición. El anticuerpo es específico para el antígeno leucocitario humano (HLA) codificado en la región D del grupo de genes HLA del complejo principal de histocompatibilidad (MHC), también conocido como HLA-DR. El anticuerpo inhibe la proliferación de células HLA-DR+ e induce la expresión y la liberación de moléculas de TNF.
Antecedentes de la invención
En los seres humanos, el complejo principal de histocompatibilidad (MHC) es el grupo de genes del antígeno leucocitario humano (HLA) en el cromosoma 6, que se divide en regiones denominadas D, B, C y A. La región D contiene genes para proteínas de clase II, que están involucradas en la cooperación e interacción entre las células del sistema inmunitario. La región D se ha visto implicada en muchas enfermedades, incluidas la mayoría de las enfermedades autoinmunitarias.
Un anticuerpo, L243 (en lo sucesivo mL243), es un anticuerpo murino anti-HLA-DR IgG2a. Este anticuerpo puede ser de uso potencial en el tratamiento de enfermedades tales como enfermedades autoinmunitarias, dirigiendo la región D del gen HLA de ratón. El mL243 demuestra una potente supresión de la función inmunitaria in vitro y es monomórfico para todos los HLA-DR. Sin embargo, existen problemas con la administración de anticuerpos de ratón a pacientes humanos, tales como la inducción de una respuesta de anticuerpo humano anti-ratón (HAMA). Hay necesidad de anticuerpos con la especificidad antigénica de mL243, que se puedan administrar a sujetos humanos. La solicitud de patente internacional WO 94/29451 se refiere a anticuerpos humanizados que tienen especificidad para el epítopo reconocido por el anticuerpo monoclonal murino L243, a procesos para preparar dichos anticuerpos y a composiciones farmacéuticas y usos médicos de dichos anticuerpos.
Compendio de la invención
La presente invención, como se define en las reivindicaciones, proporciona una molécula de anticuerpo humanizado recombinante que tiene especificidad para el epítopo reconocido por el anticuerpo monoclonal murino mL243. Este epítopo es un determinante antigénico que depende de la cadena DR-α.
Como se define en las reivindicaciones, la molécula de anticuerpo humanizado que tiene especificidad para el epítopo reconocido por el anticuerpo monoclonal murino mL243 tiene un sitio de unión con el antígeno donde al menos una de las regiones determinantes de complementariedad (CDRs) del dominio variable se deriva del anticuerpo monoclonal de ratón mL243 (MAb L243) y las restantes partes derivadas de la inmunoglobulina de la molécula de anticuerpo humanizado se derivan de una inmunoglobulina humana o un análogo de la misma. De acuerdo con la presente invención, como se define en las reivindicaciones, las tres CDRs de cadena pesada y ligera de un anticuerpo humanizado se derivan del mAb mL243. En una realización de la presente invención, la molécula de anticuerpo humanizado puede conjugarse con un efector o una molécula repórter.
En un ejemplo, la presente descripción proporciona un anticuerpo L243 humanizado que tiene un dominio variable de cadena pesada en el que las regiones CDR1, CDR2 y CDR3, y uno o más restos 27, 38, 46, 68 y 91 del dominio variable son de la cadena pesada del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de estructura de inmunoglobulina son de una o más cadenas pesadas humanas. De acuerdo con este ejemplo, el anticuerpo se puede unir al menos a un epítopo de HLA-DR en células HLA-DR+ y aumenta la muerte de células En una realización particular, la muerte celular puede aumentar cuando no se necesitan para la muerte sumandos citotóxicos ni mecanismos efectores inmunológicos.
También se describe que un anticuerpo L243 humanizado que puede incluir un dominio variable de cadena ligera donde las regiones CDR1, CDR2 y CDR3 y uno o más restos de estructura 37, 39, 48 y 49 del dominio variable son de la cadena ligera del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de la estructura de inmunoglobulina son de una o más cadenas ligeras humanas. De acuerdo con esto, el anticuerpo se puede unir al menos a un epítopo de HLA-DR en células HLA-DR+, y aumenta la muerte de las células. La muerte celular puede aumentar cuando no se necesitan para la muerte aditivos citotóxicos ni mecanismos efectores inmunológicos.
El problema que subyace en la presente invención se resuelve mediante la materia de las reivindicaciones independientes adjuntas. Las realizaciones preferidas se pueden tomar de las reivindicaciones dependientes anexas.
Más específicamente, el problema subyacente de la presente invención se resuelve en un primer aspecto mediante
un anticuerpo L243 humanizado o un fr+agmento de unión con antígeno del mismo, que se une al menos a un epítopo de HLA-DR en células HLA-DR y que comprende un dominio variable de cadena pesada y un dominio variable de cadena ligera, en donde las regiones CDR1 (NYGMN), CDR2 (WINTYTREPTYADDFKG) y CDR3 (DITAVVPTGFDY) y los restos de estructura 27, 38, 46, 68 y 91 de dicho dominio variable de cadena pesada, usando el sistema de numeración de Kabat, son de la cadena pesada de anticuerpo monoclonal mL243 de ratón, y el resto de los dominios de estructura de la cadena pesada de la inmunoglobulina son de una o más cadenas pesadas humanas, en donde las regiones CDR1 (RASENIYSNLA), CDR2 ( AASNLAD) y CDR3 (QHFWTTPWA) y los restos flanqueantes 37, 39, 48 y 49 de dicho dominio variable de cadena ligera usando el sistema de numeración de Kabat son de la cadena ligera mL243 del anticuerpo monoclonal de ratón y el resto de los dominios de estructura de la cadena ligera de inmunoglobulina de una o más cadenas ligeras humanas.
En una realización del primer aspecto, el anticuerpo L243 humanizado o el fragmento de unión con el antígeno del mismo comprende secuencias de la región constante de la IgG4 humana.
En una realización del primer aspecto, el anticuerpo L243 humanizado o fragmento de unión al antígeno del mismo comprende una mutación de punto Ser241 Pro.
Más específicamente, el problema que subyace en la presente invención se resuelve en un segundo aspecto por una composición farmacéutica que comprende un anticuerpo de acuerdo con el primer aspecto, incluyendo cualquier forma de realización del mismo.
En una realización del segundo aspecto, la composición comprende además una o más moléculas de unión adicionales que se unen específicamente a uno o más antígenos asociados a un tumor, donde la molécula de unión adicional se administra antes, con, o después del anticuerpo L243 humanizado o fragmento de unión con antígeno de acuerdo con el primer aspecto, incluyendo cualquier forma de realización del mismo.
Más específicamente, el problema que subyace en la presente invención se resuelve en un tercer aspecto mediante una composición que comprende el anticuerpo L243 humanizado o fragmento de unión con antígeno del mismo según el primer aspecto, que incluye cualquier realización del mismo, para uso en un tratamiento de una enfermedad asociada con la proliferación indeseada de células que expresan HLA-DR.
En una realización del tercer aspecto, dichas células son células linfoides o mieloides.
En una realización del tercer aspecto, dichas células son células de cáncer sólido.
En una realización del tercer aspecto, la enfermedad es una enfermedad autoinmunitaria.
En una realización del tercer aspecto, la enfermedad es una leucemia o un linfoma.
En una realización del tercer aspecto, la enfermedad es amiloidosis.
En una realización del tercer aspecto, la enfermedad es una enfermedad neurodegenerativa.
En una realización del tercer aspecto, la enfermedad se selecciona entre trastornos inmuno-desreguladores.
Más específicamente, el problema que subyace en la presente invención se resuelve en un cuarto aspecto mediante una composición farmacéutica que comprende el anticuerpo L243 humanizado de acuerdo con el primer aspecto, incluyendo cualquier forma de realización del mismo, conjugado con uno o más péptidos, lípidos, vehículos poliméricos, micelas, nanopartículas o combinaciones de los mismos; y uno o más efectores.
En una realización del cuarto aspecto, la composición es un inmunoconjugado.
En una realización del cuarto aspecto, el anticuerpo está conjugado con uno o más lípidos.
En una realización del cuarto aspecto, la composición comprende además una o más moléculas de unión adicionales que se unen específicamente a uno o más antígenos asociados a tumores.
En una realización del cuarto aspecto, el anticuerpo L243 humanizado tiene al menos una especificidad para HLA-DR, en donde la especificidad remanente es para un péptido que se une a una molécula de unión adicional que se une específicamente a uno o más antígenos asociados a tumores.
En una realización del cuarto aspecto, el efector comprende un agente terapéutico o un agente de diagnóstico. En una realización del cuarto aspecto, el efector comprende un fármaco, un profármaco, una toxina, una enzima, un radioisótopo, un inmunomodulador, una citocina, una hormona, una molécula de unión, un oligonucleótido, un ARN de interferencia, un agente fotodinámico o mezclas de los mismos.
En una realización del cuarto aspecto, el efector comprende FUdR, FUdR-dO o mezclas de los mismos.
En una realización del cuarto aspecto, la composición comprende además cationes seleccionados entre el Grupo II,
Grupo III, Grupo IV, Grupo V, cationes de metales de transición, lantánidos o actínidos, o mezclas de los mismos. En una realización del cuarto aspecto, la composición comprende además cationes seleccionados de Tc, Re, Bi, Cu, As, Ag, Au, At, Pb o mezclas de los mismos.
En una realización del cuarto aspecto, la composición comprende además NOTA, DOTA, DTPA, TETA, Tscg-Cys, Tsca-Cys o mezclas de los mismos.
En una realización del cuarto aspecto, el efector comprende un radionucleido.
En una realización del cuarto aspecto, el efector comprende una enzima.
En una realización del cuarto aspecto, el efector comprende un inmunomodulador.
En una realización del cuarto aspecto, el efector comprende un agente antiangiogénico.
En una realización del cuarto aspecto, el anticuerpo está conjugado con uno o más agentes terapéuticos, agentes de diagnóstico o mezclas de los mismos.
En una realización del tercer aspecto, el anticuerpo L243 humanizado se conjuga con uno o más péptidos, lípidos, vehículos poliméricos, micelas, nanopartículas o combinaciones de los mismos, y la composición comprende además uno o más efectores.
En una realización del tercer aspecto, la composición comprende uno o más agentes para terapia fotodinámica. En una realización del tercer aspecto, el agente para terapia fotodinámica es un fotosensibilizador.
En una realización del tercer aspecto, la composición comprende uno o más agentes de diagnóstico.
En una realización del tercer aspecto, el agente de diagnóstico comprende uno o más agentes potenciadores de la imagen MRI.
En una realización del tercer aspecto, la composición comprende uno o más agentes radioopacos o agentes de contraste para rayos X o tomografía computerizada (CT).
En una realización del tercer aspecto, la composición comprende además una composición adicional que comprende un agente terapéutico, un agente de diagnóstico o mezclas de los mismos.
En una realización del tercer aspecto, la composición se administra antes, durante, simultáneamente o después de la administración de la composición adicional.
Más específicamente, el problema que subyace en la presente invención se resuelve en un quinto aspecto mediante un kit que comprende la composición según el cuarto aspecto, donde el anticuerpo está conjugado con uno o más agentes terapéuticos, agentes de diagnóstico o mezclas de los mismos.
En una realización del tercer aspecto, la composición comprende un complejo de proteínas polivalentes "desnudas", que comprende tres sitios de unión en donde al menos un sitio de unión está compuesto de un anticuerpo L243 humanizado, y uno o más sitios de unión se unen a un antígeno asociado a un tumor.
En una realización del tercer aspecto, la enfermedad es un trastorno de desregulación neoplásico, autoinmunitario o inmunitario, un trastorno metabólico o un trastorno neurodegenerativo.
En una realización del tercer aspecto, la composición comprende un anticuerpo biespecífico o un fragmento de anticuerpo que comprende al menos un brazo que comprende un anticuerpo L243 humanizado o un fragmento del mismo y al menos otro brazo que se une específicamente a un objetivo conjugado dirigible en el que dicho conjugado dirigible comprende un resto hapteno y un agente terapéutico.
En una realización del tercer aspecto, la composición comprende un anticuerpo biespecífico o un fragmento de anticuerpo que comprende un anticuerpo L243 humanizado o un fragmento del mismo y un brazo que se une a un antígeno asociado a un tumor.
En una realización del tercer aspecto, dicha afección comprende un tumor maligno de células B o de células T. En una realización del tercer aspecto, dicho antígeno asociado a un tumor es CD20.
En una realización del tercer aspecto, dicha composición comprende adicionalmente un anticuerpo o un fragmento de anticuerpo que se une a un antígeno asociado a un tumor.
En una realización del tercer aspecto, dicha afección comprende un tumor maligno de células B.
En una realización del tercer aspecto, dicho anticuerpo o fragmento de anticuerpo que se une a un antígeno asociado a un tumor comprende un anticuerpo humanizado o un fragmento de anticuerpo.
En una realización del tercer aspecto, dicho antígeno asociado a un tumor es CD20.
En una realización del tercer aspecto, dicho brazo que se une a CD20 es un anticuerpo A20 humanizado (hA20) o un fragmento del mismo o rituximab.
En una realización del tercer aspecto, dicho anticuerpo o fragmento de unión con CD20 es un anticuerpo hA20 o un fragmento del mismo o rituximab.
En una realización del tercer aspecto, la afección es un trasplante de órganos.
En una realización del tercer aspecto, dicho brazo que se une a CD20 es rituximab y dicho anticuerpo L243 humanizado o fragmento del mismo es una IgG4.
En una realización del tercer aspecto, dicho brazo que se une a CD20 es rituximab y dicho anticuerpo L243 humanizado o fragmento del mismo es una IgG4.
En una realización del primer aspecto, dicho anticuerpo provoca o conduce a la muerte de dichas células de manera que no se necesitan aditivos citotóxicos ni mecanismos efectores inmunológicos para dicha muerte.
También se describe un anticuerpo L243 humanizado que puede incluir un dominio variable de cadena pesada y un dominio variable de cadena ligera, en donde las regiones CDR1, CDR2 y CDR3 y uno o más restos de estructura 27, 38, 46, 68 y 91 del dominio variable de la cadena pesada son de la cadena pesada del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de estructura de la cadena pesada de la inmunoglobulina son de una o más cadenas pesadas humanas. De acuerdo con esto, un anticuerpo L243 humanizado puede incluir un dominio variable de cadena pesada y un dominio variable de cadena ligera, en donde las regiones CDR1, CDR2 y CDR3 y uno o más restos de estructura 37, 39, 48 y 49 del dominio variable de cadena ligera son del anticuerpo monoclonal de ratón mL243 y el resto de los dominios de estructura de cadena ligera de inmunoglobulina son de una o más cadenas ligeras humanas. Además, el anticuerpo se puede unir al menos a un epítopo de HLA-DR en células HLA-DR+, y aumenta la muerte de las células. La muerte celular puede aumentar cuando no se necesitan para la muerte aditivos citotóxicos ni mecanismos efectores inmunológicos.
En un aspecto de la presente invención como se define en las reivindicaciones, cualquiera de los anticuerpos de la invención como se definen en las reivindicaciones puede usarse en una composición farmacéutica. De acuerdo con este aspecto, una composición farmacéutica que incluye uno o más anticuerpos según se definen en las reivindicaciones puede contener agentes terapéuticos adicionales como se describe a continuación.
También se describen moléculas de ácido nucleico que codifican una o más de las composiciones de anticuerpos, conjugados y proteínas de fusión que se han descrito, como se define en las reivindicaciones. También se pueden incluir vectores de expresión y células hospedadoras que contienen estos ácidos nucleicos.
También se describen métodos para fabricar anticuerpos tales como el uso de células hospedadoras cultivadas en un medio de crecimiento adecuado para generar los anticuerpos que pueden incluirse.
En una realización de la presente invención como se define en las reivindicaciones, uno o más de los anticuerpos de la invención descritos se pueden usar en una composición farmacéutica con fines terapéuticos y/o de diagnóstico. Por ejemplo, uno o más anticuerpos pueden administrarse en una composición terapéutica o farmacéutica a un sujeto en necesidad de dicho tratamiento (por ejemplo, un sujeto que tiene una enfermedad inmunológica tal como una enfermedad autoinmunitaria).
En una realización más particular de la presente invención como se ha definido en las reivindicaciones, el anticuerpo L243 humanizado tiene un dominio variable de cadena pesada que tiene la secuencia mostrada en la Figura 4 y/o un dominio variable de cadena ligera que tiene la secuencia que se muestra en la Figura 3.
En otra realización de la invención como se define en las reivindicaciones, una composición farmacéutica puede contener además una o más moléculas de unión adicionales que se unen específicamente a uno o más antígenos seleccionados entre el grupo que consiste en CD4, CDS, CDS, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD66 (a, b, c, d), CD74, CD80, CD126, CD138, CD154, B7, MUC1, MUC2, MUC3, MUC4, MUC16, 1a, HM1.24, tenascina, VEGF, EGFR, CEA, CSAp, ILGF, factor de crecimiento placentario, Her2/neu, anhidrasa carbónica IX, IL-6, SI00, MART-1, TRP-1, TRP-2, gplOO, amiloide y combinaciones de los mismos, donde la molécula de unión adicional se proporciona antes, con o después de cualquier composición farmacéutica descrita en este documento que contiene una composición de anticuerpo L243 humanizado y/o un vehículo de suministro para el anticuerpo.
En una realización de la invención como se define en las reivindicaciones, una composición farmacéutica para administrar a un sujeto en necesidad de tal tratamiento puede contener un anticuerpo L243 humanizado y uno o más péptidos, lípidos, vehículos poliméricos, micelas, nanopartículas o combinaciones de los mismos; y uno o más
efectores.
Uno o más de los anticuerpos y fragmentos de unión con el antígeno de los mismos de la invención, como se define en las reivindicaciones, se pueden usar para tratar una enfermedad que incluye, pero sin limitarse a ellas, linfomas no Hodgkin de células B, leucemias linfoides agudas y crónicas de células B, linfoma de Burkitt, linfoma de Hodgkin, leucemia de células pilosas, leucemias mieloides agudas y crónicas, linfomas y leucemias de células T, mieloma múltiple, macroglobulinemia de Waldenstrom, carcinomas, melanomas, sarcomas, gliomas y cánceres de piel. Los carcinomas se pueden seleccionar entre el grupo que consiste en carcinomas de la cavidad oral, tracto gastrointestinal, tracto pulmonar, mama, ovario, próstata, útero, vejiga urinaria, páncreas, hígado, vesícula biliar, piel y testículos. Además, el anticuerpo o fragmento de unión con el antígeno del mismo de la invención, como se define en las reivindicaciones, puede usarse para tratar una enfermedad autoinmunitaria, por ejemplo, púrpura trombocitopénica idiopática aguda, púrpura trombocitopénica idiopática crónica, dermatomiositis, corea de Sydenham, miastenia gravis, lupus eritematoso sistémico, nefritis lúpica, fiebre reumática, síndromes poliglandulares, penfigoide bulloso, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis post-estreptocócica, eritema nudoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, esclerosis múltiple, sarcoidosis, colitis ulcerosa, eritema multiforme, nefropatía por IgA, poliarteritis nodosa, espondilitis anquilosante, síndrome de Goodpasture, tromboangitis obliterante, síndrome de Sjogren, cirrosis biliar primaria, tiroiditis de Hashimoto, tirotoxicosis, esclerodermia, hepatitis activa crónica, polimiositis/dermatomiositis, policondritis, pénfigo vulgar, granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsal, arteritis/polimialgia de células gigantes, anemia perniciosa, glomerulonefritis rápidamente progresiva, psoriasis o alveolitis fibrosante. En una realización, se puede usar una composición farmacéutica de la presente invención como se define en las reivindicaciones para tratar un sujeto que tiene leucemia, tal como leucemia linfocítica crónica, leucemia linfocítica aguda, leucemia mieloide crónica o leucemia mieloide aguda.
En una realización, puede usarse una composición farmacéutica de la presente invención como se define en las reivindicaciones para tratar a un sujeto que tiene una enfermedad metabólica, tal como amiloidosis, o una enfermedad neurodegenerativa, tal como la enfermedad de Alzheimer. Además, una composición farmacéutica de la presente invención como se define en las reivindicaciones se puede usar para tratar un sujeto que tiene un trastorno desregulador inmunitario.
Otros objetos, características y ventajas de la presente invención se pondrán de manifiesto a partir de la descripción detallada que sigue. Sin embargo, debe entenderse que la descripción detallada y los ejemplos específicos, aunque indican realizaciones preferidas de la invención, se dan solamente a título de ilustración.
Breve descripción de los dibujos
Los dibujos que siguen forman parte de la presente memoria descriptiva y se incluyen para demostrar adicionalmente ciertas realizaciones de la presente invención. Las realizaciones pueden entenderse mejor por referencia a uno o más de estos dibujos en combinación con la descripción detallada de realizaciones específicas presentadas en este documento.
La Figura 1 (también SEQ ID NO: 1 y SEQ ID NO: 2) ilustra un ejemplo de codificación de ADN y secuencias de aminoácidos de VK del anticuerpo anti-HLA-DR de ratón L243. Las regiones de CDR putativas están subrayadas e indicadas. Los restos de nucleótidos se numeran secuencialmente. La numeración de Kabat de moléculas de Ig se usa para restos de aminoácidos. La numeración de los restos con una letra (en la parte superior) es el número de restos anteriores más la letra, por ejemplo, el número para T que sigue a N52 es 52A; los números para N, N y L después de 82 son 82A, 82B y 82C, respectivamente.
La Figura 2 (también SEQ ID NO: 3 y SEQ ID NO: 4) ilustra un ejemplo de codificación de ADN y secuencias de aminoácidos de VH del anticuerpo anti-HLA-DR de ratón L243. Las regiones putativas de CDR están subrayadas e indicadas. Los restos de nucleótidos se numeran secuencialmente. La numeración de Kabat de moléculas de Ig se usa para restos de aminoácidos como se describió anteriormente.
La Figura 3 (también SEQ ID NO: 5 y SEQ ID NO: 6) ilustra un ejemplo de ADN y secuencias de aminoácidos de L243 VR humanizado. Las secciones en negrita y subrayadas de las secuencias de aminoácidos indican las CDRs como se definen por el esquema de numeración de Kabat.
La Figura 4 (también SEQ ID NO: 7 y SEQ ID NO: 8) ilustra un ejemplo de ADN y secuencias de aminoácidos para L243 VH humanizado. Las secciones en negrita y subrayadas de las secuencias de aminoácidos indican las CDR definidas por el esquema de numeración de Kabat.
La Figura 5 (también SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 y SEQ ID NO: 12) ilustra una alineación de ejemplo de secuencia de aminoácidos de RF-TS3 y NEWM (estructura 4) humano, L243 murino, y la cadena hL243 VH. Los puntos indican los restos en L243 y su versión humanizada es idéntica a los restos correspondientes en RF-TS3 o NEWM. Los guiones representan huecos introducidos para ayudar a la alineación. Las cajas representan las regiones CDR. Los restos tanto N como C terminales (subrayados) de hL243 se fijan mediante el vector de estacionamiento utilizado. Por lo tanto, los restos terminales correspondientes de L243 no se comparan con los de la
secuencia de VH humana.
La Figura 6 (también SEQ ID NO: 13, SEQ ID NO: 14 y SEQ ID NO: 15) ilustra un ejemplo de alineación de secuencia de aminoácidos de las cadenas REI humana, L243 murina y hL243 VK. Los puntos indican los restos en L243 que son idénticos a los restos correspondientes en REI. Los guiones representan huecos introducidos para ayudar a la alineación. Las cajas representan las regiones CDR. Los restos tanto N como C terminales (subrayados) de hL243 se fijan mediante el vector de estacionamiento utilizado. Por tanto, los restos terminales correspondientes de L243 no se comparan con los de la secuencia humana. Se usa el esquema de numeración de Kabat.
La Figura 7 ilustra un ejemplo de especificidad de unión con el antígeno de hL243. Las células Raji, preincubadas con o sin una concentración saturada de mL234 (para bloquear los sitios del antígeno de superficie celular ("Ag")), se resuspendieron en PBS que contenía BSA al 1% y 10 μg/ml de hL243 purificado y se incubaron durante 1 h a 4 °C. Después del lavado, las células se resuspendieron en PBS que contenía 1% de BSA y IgG antihumana de cabra marcada con PE, anticuerpo específico de fragmento Fc. Después de una incubación adicional a 4 ºC durante 30 minutos, las células se contaron en un PCA Guava. (A) Muestra la unión específica de hL243 a las células de linfoma humano Raji (trazo rojo), que se bloqueó mediante la preincubación de las células con mL243 (trazo azul). (B) Es un testigo de unión negativa, realizado con anticuerpo anti-CEA (hMN-14) en lugar de hL243 bajo condiciones idénticas.
La Figura 8 ilustra un ejemplo de afinidades de unión a Ag que compara hL243 γ 4P y mL243 en un ensayo de unión competitiva a la superficie cel5ular. Se mezcló una cantidad constante (100.000 cpm, -10 uCi/ug) de mL234 (A) o hL243γ4P (B) marcado con 12 l con concentraciones variables (0,2-700 nM) de hL243γ4P sin marcar (A) o mL2343 (•). Las mezclas se añadieron a las células Raji y se incubaron a temperatura ambiente durante 2 h. Las células se lavaron para eliminar los anticuerpos no unidos y se contó la radiactividad asociada con las células. Se demostró que hL243γ4P y mL234 competían entre sí por la unión con la superficie celular del Ag. En ambos casos, hL243γ4P pareció unirse a las células Raji más intensamente que mL243.
La Figura 9 ilustra un ejemplo de afinidades de unión a Ag de hL243γ4P y mL243 determinado por unión de saturación de la superficie celular directa y análisis de la gráfica de Scachard. Se incubaron concentraciones variables de mL234 (») o hL243γ4P (A) marcados con 125I, con 2 x 105 células de linfoma humano Daudi a 4 °C durante 2 h, y la radioactividad no unida se eliminó de las suspensiones celulares por lavado. Se contó la radiactividad asociada a las células, se calculó la unión específica del anticuerpo marcado radiactivamente con el antígeno de la superficie celular y luego se aplicó el análisis de la gráfica de Scatchard para determinar el número máximo de sitios de unión por célula y la constante de afinidad aparente de unión con el antígeno: La unión máxima de mL234 o hL243γ4P a la superficie de la célula Daudi fue de 6 x 106 moléculas/célula. Las constantes de disociación determinadas para mL234 o hL243γ4P fueron 14 y 2,6 nM, respectivamente.
La Figura 10 ilustra un ejemplo de h243 que es eficaz para matar células diana en presencia de complemento de suero humano: las células Daudi se incubaron con hL243, hL243γ4P, hA20 (un control positivo) y hMN-14 (un control negativo) en presencia de complemento de suero humano. Se demostró que hL243γ4P no produce citotoxicidad inducida por el complemento.
La Figura 11 ilustra un ejemplo de liberación de LDH (A) y % de lisis celular (B) por ADCC, como se observó para hL243, hL243γ4P, hA20 (control positivo) y 1 hMN-14 (control negativo).
Las Figuras 12A-B ilustran un ejemplo de ensayos proliferativos in vitro en líneas de células Daudi y Raji al cabo de 2 días.
La Figura 13A-B ilustra un ejemplo de ensayos proliferativos in vitro en líneas de células Daudi y Raji al cabo de 3 días.
La Figura 14 ilustra un ejemplo de tiempos medios de supervivencia para ratones SCID portadores de tumores inyectados con hL243γ4P.
La Figura 15 ilustra un ejemplo de inducción comparativa de la apoptosis en células de linfoma de perro (medida como % de células con un contenido de ADN de fase sub GO/G1) causada por L243, hL243 (isotipo IgG4), hMN-14 (IgG MN-14 humanizada) y Ag8 (mAb derivado del mieloma murino). L243 y hL243 causaron apoptosis cuando se reticularon con anticuerpos anti-ratón de cabra (GAM) y anti-humano de cabra (GAH), respectivamente.
La Figura 16A-B ilustra un ejemplo de efecto anti-proliferativo de anticuerpos humanizados (hLL1, hLL2, Rituximab, hA20, hMN-14 y hL243 (isotipo IgG4), con y sin IgG antihumana de cabra (GAH)) en la línea celular de linfoma de células B humanas Namalwa, según lo determinado por un ensayo de captación de 3H-timidina.
La Figura 17 ilustra las características de unión de hL243γ4P relativa a la murina parental L243.
La Figura 18 ilustra ensayos de CDC en líneas celulares Raji, Ramos y Namalwa cuando se exponen a diversos anticuerpos descritos en el presente texto.
La Figura 19 ilustra ensayos de ADCC y la liberación de calceína AM cuando las células SU_DHL-6 se exponen a diversos anticuerpos descritos en este documento.
La Figura 20A y 20B ilustra los efectos antiproliferativos de hL243γ4P en varias líneas celulares descritas en el presente texto. A. Estudios de MTT y B ensayos de absorción de 3H-timidina. En la etiqueta del eje de B, hL243 se refiere a la forma γ4P.
Las Figuras 21A y 21B ilustran la inducción de la apoptosis; las células muertas están representadas por símbolos no rellenos y las células apoptóticas se ilustran con símbolos rellenos. A. Medida del ADN Sub G0 en células SU-DHL-6 y Namalwa y B. Anexina V/7-ADD a las 4 y a las 24 horas. Las células usadas tenían 97% de viabilidad antes del tratamiento.
La Figura 22 ilustra el potencial de membrana mitocondrial usando un ensayo JC-1 en varias líneas de células. La Figura 23A, 23B y 23C ilustra una caspasa-3 escindida (A), P-AKT (1 hora a 2 días) (B) y P-AKT (0 a 60 minutos) (C) estudios en función del tiempo en células Daudi.
La Figura 24 ilustra la terapia de ratones SCID portadores de Raji con L243 murino y L243γ4P.
Descripción detallada
En la sección que sigue se describen varios métodos para detallar diversas realizaciones de la invención, tal como se define en las reivindicaciones. Para un experto en la técnica será evidente que la práctica de las diversas realizaciones no requiere el empleo de todos o incluso de algunos de los detalles específicos descritos en el presente texto, sino más bien que las concentraciones, los tiempos y otros detalles específicos pueden modificarse mediante experimentación rutinaria. En algunos casos, métodos o componentes bien conocidos no han sido incluidos en la descripción para evitar un enmascaramiento innecesario de las diversas realizaciones.
La presente invención según se define en las reivindicaciones proporciona anticuerpos de ratón humanizados que se unen a HLA-DR. En una realización particular, pueden proporcionarse anticuerpos mL243 humanizados que se unen a HLA-DR pero que tienen una inmunogenicidad reducida en comparación con los correspondientes anticuerpos murinos. De acuerdo con esta realización, los anticuerpos pueden inhibir la proliferación de células (o inducir la muerte celular) que expresan moléculas de HLA-DR, tales como las células de linfoma. Alternativamente, los anticuerpos descritos en el presente texto pueden usarse para unirse a una molécula diana y aumentar la probabilidad de muerte celular. Se proporcionan composiciones farmacéuticas que contienen los anticuerpos y su uso en métodos para el tratamiento de enfermedades asociadas con la proliferación de células HLA-DR+.
El mL243 es un anticuerpo monoclonal anteriormente descrito por Lampson y Levy (J. Immunol. (1980) 125293). Las secuencias de aminoácidos de las regiones variables de la cadena ligera y la pesada del anticuerpo se muestran en las Figuras 1 y 2 (también SEQ ID. 1 y 2, respectivamente). El mL243 ha sido depositado en la American Type Culture Collection, Rockville, MD, bajo el número de registro ATCC HB55.
En la descripción que sigue, se pueden usar varios términos y se proporcionan las siguientes definiciones para facilitar la comprensión de la presente invención.
A menos que se especifique otra cosa, "uno" significa "uno o más".
Como se usa en el presente texto, "sujeto" o "sujetos" puede incluir, pero sin limitarse a ellos, mamíferos tales como los mamíferos humanos o los mamíferos como, por ejemplo, perros, gatos, hurones, conejos, cerdos, caballos o ganado.
La "citotoxicidad mediada por células dependiente de anticuerpos" o "ADCC" es una reacción mediada por células en la que células citotóxicas inespecíficas que expresan receptores Fc (células asesinas naturales, neutrófilos y macrófagos) reconocen el anticuerpo unido en las células diana y posteriormente causan la lisis de las células diana. Las células primarias para mediar la ADCC son las células asesinas naturales (expresan el FcDRIII solamente) y los monocitos (expresan FcDRI, FcDRII y FcDRIII).
La "citotoxicidad dependiente del complemento" o "CDC" se refiere a la lisis de una diana en presencia de complemento. La ruta de activación del complemento se inicia mediante la unión del primer componente del sistema del complemento (Clq) a una molécula (por ejemplo, un anticuerpo) complejada con un antígeno relacionado.
El "receptor Fc" o "FcR" se usa para describir un receptor que se une a la región Fc de un anticuerpo. Tanto CDC como ADCC requieren la porción Fc de un MAb y el efecto de ADCC puede aumentarse incrementando la afinidad de unión por FcyR (receptores IgG Fc) en células efectoras (Shinkawa, y col., J. Biol. Chem.278: 3466 - 3473, 2003; Shields y col., J. Biol. Chem.211: 26733 - 26740, 2002; Shields y col., J. Biol. Chem.276: 6591 - 6604, 2002; Davies y col., Biotechnol. Bioeng. 74: 288 - 294, 2001 y Umana et al., Nature Biotechnol. 176 - 180, 1999). Una "célula efectora" se refiere a cualquier tipo de célula que sea capaz de llevar a cabo una o varias funciones celulares efectoras. Es bien sabido que las células efectoras que tienen diferentes funciones inmunológicas especializadas se pueden distinguir entre sí sobre la base de su expresión diferencial de una amplia variedad de antígenos de la
superficie celular, tales como muchos de los antígenos descritos en el presente texto a los que los polipéptidos del dominio de unión pueden unirse específicamente. Las células efectoras incluyen, pero no sin limitarse a ellas, cualquier célula que sea capaz de mediar directamente una actividad que es un componente de la función del sistema inmunitario, incluidas las células que tienen dicha capacidad de forma natural o como resultado de ingeniería genética. Una célula efectora comprende un receptor de la superficie celular para una inmunoglobulina, tal como un receptor para una región constante de inmunoglobulina e incluyendo la clase de receptores denominados comúnmente "receptores Fc" (FcR). Las células que son capaces de mediar la ADCC son ejemplos de células efectoras. Otros ejemplos incluyen células asesinas naturales (NK), linfocitos T infiltrantes tumorales (TIL), linfocitos T citotóxicos (CTL) y células granulocíticas tales como células que comprenden mecanismos de respuesta alérgica. Las células efectoras también pueden afectar a las células de origen hematopoyético, incluyendo las células en diversos estadios de diferenciación dentro de los linajes mieloide y linfoide, y que pueden (pero no necesitan) expresar uno o más tipos de FcR de superficie celular funcional, como linfocitos T, linfocitos B, células NK, monocitos, macrófagos, células dendríticas, neutrófilos, basófilos, eosinófilos, mastocitos, plaquetas, eritrocitos y precursores, progenitores (por ejemplo, células troncales hematopoyéticas), quiescentes, formas activadas y maduras de tales células. Otras células efectoras pueden incluir células de origen no hematopoyético que son capaces de mediar funciones inmunitarias, por ejemplo células endoteliales, queratinocitos, fibroblastos, osteoclastos, células epiteliales y otras células. Las células efectoras inmunitarias también pueden incluir células que median eventos citotóxicos o citostáticos, o episodios endocíticos, fagocíticos o pinocíticos, o que provocan la inducción de la apoptosis, o que afectan la inmunidad microbiana o la neutralización de una infección microbiana, o células que median la hipersensibilidad alérgica, inflamatoria y/o reacciones autoinmunitarias.
Un anticuerpo que "inhibe el crecimiento" es el que inhibe el crecimiento de células enfermas in vitro y/o in vivo. Inhibiendo el crecimiento de las células enfermas, se reduce el porcentaje de células en la fase S. El porcentaje preferido de inhibición del crecimiento por un anticuerpo de la presente invención puede ser mayor que el 20%, preferiblemente mayor que el 50%, a una concentración de anticuerpo de aproximadamente 0,5 μg/mL - 20 μg/mL in vitro, y a una dosis en pacientes adultos de aproximadamente 0,5 mg/kg - 15 mg/kg.
Un "anticuerpo" como se usa en el presente texto se refiere a una molécula de inmunoglobulina de longitud completa (es decir, de origen natural o formada por procesos de recombinación de un fragmento génico de inmunoglobulina normal; por ejemplo, un anticuerpo IgG) o una porción inmunológicamente activa (es decir, unida específicamente) de una molécula de inmunoglobulina, como un fragmento de anticuerpo. El término "anticuerpo" también incluye anticuerpos "humanizados" e incluso anticuerpos completamente humanos que pueden producirse por presentación de fago, métodos de transfección de genes y cromosomas, así como por otros medios. Este término también incluye anticuerpos monoclonales, anticuerpos policlonales, anticuerpos multivalentes, anticuerpos multiespecíficos (por ejemplo, anticuerpos biespecíficos).
Una "respuesta inmunogénica" o "respuesta antigénica" es una respuesta que da como resultado la producción de anticuerpos dirigidos a un compuesto después de que las células apropiadas se han puesto en contacto con ellos. El compuesto que se usa para desencadenar una respuesta inmunogénica se denomina inmunógeno o antígeno. Los anticuerpos producidos en la respuesta inmunogénica se unen específicamente al inmunógeno usado para desencadenar la respuesta.
El compuesto que se usa para desencadenar una respuesta inmunogénica se denomina inmunógeno o antígeno. Un "epítope" o "determinante antigénico" es un área en la superficie de un inmunógeno que estimula una respuesta inmunológica específica dirigida al epítopo. En las proteínas, en particular en las proteínas desnaturalizadas, un epítopo se define típicamente y se representa por una secuencia de aminoácidos contigua. Sin embargo, en el caso de las proteínas no desnaturalizadas, los epítopos también incluyen estructuras, tales como sitios activos, que se forman mediante el plegamiento tridimensional de una proteína de manera tal que los aminoácidos de porciones separadas de la secuencia de aminoácidos de la proteína se ponen en estrecho contacto físico entre sí.
Las moléculas de anticuerpo de origen natural (tipo silvestre) son moléculas en forma de Y que consisten en cuatro cadenas polipeptídicas, dos cadenas pesadas idénticas y dos cadenas ligeras idénticas, que están unidas entre sí covalentemente mediante puentes disulfuro. Ambos tipos de cadenas polipeptídicas tienen regiones constantes, que no varían o varían mínimamente entre anticuerpos de la misma clase (es decir, IgA, IgM, etc.) y regiones variables. Las regiones variables son únicas para un anticuerpo en particular y comprenden un elemento de reconocimiento para un epítopo. Las regiones carboxi-terminales tanto de la cadena pesada como de la ligera se conservan en secuencia y se denominan regiones constantes (también conocidas como dominios C). Las regiones aminoterminales (también conocidas como dominios V) son de secuencia variable y son responsables de la especificidad del anticuerpo. El anticuerpo específicamente reconoce y se une a un antígeno principalmente a través de seis regiones cortas determinantes de la complementariedad (CDR) ubicadas en sus dominios V.
Cada cadena ligera de un anticuerpo está asociada con una cadena pesada, y las dos cadenas están unidas por un puente disulfuro formado entre restos de cisteína en la región carboxi-terminal de cada cadena, que es distal de la región amino terminal de cada cadena que constituye su porción del dominio de unión al antígeno. Las moléculas de anticuerpo se estabilizan adicionalmente mediante puentes disulfuro entre las dos cadenas pesadas en un área conocida como región bisagra, en localizaciones más cercanas al término carboxi de las cadenas pesadas que las localizaciones en las que se hacen los puentes disulfuro entre las cadenas pesada y ligera. La región de bisagra
también proporciona flexibilidad para las porciones de unión al antígeno de un anticuerpo.
La especificidad de unión al antígeno de un anticuerpo puede determinarse por sus regiones variables localizadas en las regiones amino terminales de las cadenas ligera y pesada. Las regiones variables de una cadena ligera y una cadena pesada asociada forman un "dominio de unión a antígeno" que reconoce un epítopo específico; un anticuerpo tiene así dos dominios de unión con el antígeno. Los dominios de unión con el antígeno en un anticuerpo de tipo silvestre se dirigen al mismo epítopo de una proteína inmunogénica, y un único anticuerpo de tipo silvestre es por tanto capaz de unir dos moléculas de la proteína inmunogénica al mismo tiempo. Por tanto, un anticuerpo de tipo silvestre es monoespecífico (es decir, dirigido a un único antígeno) y divalente (es decir, capaz de unirse a dos moléculas de antígeno).
Los “anticuerpos policlonales” se generan en una respuesta inmunogénica a una proteína que tiene muchos epítopos. Una composición (por ejemplo, suero) de anticuerpos policlonales incluye así una variedad de diferentes anticuerpos dirigidos a los mismos y a diferentes epítopos dentro de la proteína. Los métodos para producir anticuerpos policlonales son conocidos en la técnica (véase, por ejemplo, Cooper et al., Sección III del Capítulo 11 en: Short Protocols in Molecular Biology, 2ª edición, Ausubel y col., eds., John Wiley and Sons, Nueva York, 1992, páginas 11 - 37 a 11 - 41).
Los "anticuerpos antipeptídicos" (también conocidos como "anticuerpos monoespecíficos") se generan en una respuesta humoral a un polipéptido inmunógeno corto (típicamente, de 5 a 20 aminoácidos) que corresponde a unos cuantos (preferiblemente uno) epítopos aislados de la proteína de la que se deriva. Una diversidad de anticuerpos antipeptídicos incluye una variedad de anticuerpos diferentes dirigidos a una porción específica de la proteína, es decir, a una secuencia de aminoácidos que contiene al menos un epítopo, preferiblemente solo uno. Los métodos para producir anticuerpos antipeptídicos son conocidos en la técnica (véase, por ejemplo, Cooper et al., Sección III del Capítulo 11 en: Short Protocols in Molecular Biology, 2ª edición, Ausubel y col., eds., John Wiley and Sons, Nueva York, 1992, páginas 11 - 42 a 11 - 46).
Un "anticuerpo monoclonal" es un anticuerpo específico que reconoce un único epítopo específico de una proteína inmunogénica. En una pluralidad de un anticuerpo monoclonal, cada molécula de anticuerpo es idéntica a las otras en la pluralidad. Para aislar un anticuerpo monoclonal, se identifica primero una línea celular clonal que expresa, presenta y/o secreta un anticuerpo monoclonal particular; esta línea celular clonal puede usarse en un método para producir los anticuerpos de la presente invención. Los métodos para la preparación de líneas celulares clonales y de anticuerpos monoclonales expresados de este modo son conocidos en la técnica (véase, por ejemplo, Fuller et al., Sección II del Capítulo 11 en: Short Protocols in Molecular Biology, 2ª Ed., Ausubel et al., eds., John Wiley and Sons, Nueva York, 1992, páginas 11 - 22 a 11 - 11 - 36).
Un “anticuerpo desnudo" es una molécula de anticuerpo intacta que no contiene más modificaciones tales como la conjugación con una toxina, o con un quelato para unirse a un radionucleido. La porción Fc del anticuerpo desnudo puede proporcionar funciones efectoras, tales como la fijación del complemento y ADCC (citotoxicidad celular dependiente de anticuerpos), que pone en acción mecanismos que pueden dar como resultado la lisis celular. Véase, por ejemplo, Markrides, Therapeutic inhibition of the complement system, Pharmacol. Rev.50: 59 - 87, 1998. En una realización, la acción terapéutica de un anticuerpo puede requerir las funciones efectoras de la región Fc (véase, por ejemplo, Golay et al., Biologic response of B lymphoma cells to anti-CD20 monoclonal rituximab in vitro: CD55 y CD59 regulate complement mediated cell lysis, Blood 95: 3900 - 3908, 2000).
En otra realización, la porción Fc puede no ser necesaria o, en algunos casos, deseable para un tratamiento terapéutico de un sujeto. De acuerdo con esta realización, pueden invocarse otros mecanismos, tales como la apoptosis. Vaswani y Hamilton, Humanized antibodies as potential therapeutic drugs. Ann. Allergy Asthma Immunol.
81: 105 - 119, 1998.
Un "fragmento de anticuerpo" es una porción de un anticuerpo intacto tal como F(ab')a, F(ab)2, Fab', Fab, Fv, sFv y similares. Al margen de la estructura, un fragmento de anticuerpo se une con el mismo antígeno que es reconocido por el anticuerpo de longitud completa. Por ejemplo, un fragmento de anticuerpo monoclonal anti-CD20 se une con un epítopo de CD20. La expresión "fragmento de anticuerpo" incluye también cualquier proteína sintética o modificada genéticamente que actúa igual que un anticuerpo uniéndose a un antígeno específico para formar un complejo. Por ejemplo, los fragmentos de anticuerpos incluyen fragmentos aislados que consisten en las regiones variables, tales como los fragmentos "Fv" que consisten en las regiones variables de las cadenas pesada y ligera, moléculas de polipéptido de cadena simple recombinantes en las que las regiones variables ligera y pesada están conectadas por un péptido enlazador ("proteínas scFv"), y unidades de reconocimiento mínimas que consisten en los restos de aminoácidos que imitan la región hipervariable.
Los fragmentos de anticuerpos producidos por proteólisis limitada de anticuerpos de tipo silvestre se denominan fragmentos de anticuerpo proteolíticos. Estos incluyen, pero sin limitarse a ellos, los siguientes: los "fragmentos F(ab')2" se liberan de un anticuerpo por exposición limitada del anticuerpo a una enzima proteolítica, por ejemplo pepsina o ficina. Un fragmento F(ab')2 comprende dos "brazos", cada uno de los cuales comprende una región variable que se dirige a un antígeno común y se une específicamente al mismo. Las dos moléculas Fab' están unidas por enlaces disulfuro intercatenarios en las regiones bisagra de las cadenas pesadas; las moléculas de Fab'
pueden dirigirse hacia el mismo epítopo (bivalente) o epítopo diferente (biespecífico).
Los "fragmentos Fab1" contienen un único dominio anti-unión que incluye un Fab y una porción adicional de la cadena pesada a través de la región bisagra.
Los “fragmentos Fab’-SH" se producen típicamente a partir de fragmentos F(ab')2 que se mantienen unidos mediante enlaces disulfuro entre las cadenas H en un fragmento F(ab')2. El tratamiento con un agente reductor suave tal como, a título de ejemplo no limitante, beta-mercaptoetilamina, rompe el enlace o enlaces disulfuro y se liberan dos fragmentos Fab' a partir de un fragmento F(ab')2. Los fragmentos Fab'-SH son monovalentes y monoespecíficos.
Los "fragmentos Fab" (es decir, un fragmento de anticuerpo que contiene el dominio de unión con el antígeno y comprende una cadena ligera y parte de una cadena pesada puenteada por un enlace disulfuro) se producen por digestión de anticuerpos intactos con papaína. Un método conveniente es usar papaína inmovilizada en una resina para que la enzima pueda retirarse fácilmente y terminar la digestión. Los fragmentos Fab no tienen el enlace o los enlaces disulfuro entre las cadenas H presentes en un fragmento F(ab')2.
Los "anticuerpos monocatenarios" son un tipo de fragmento de anticuerpo. La expresión anticuerpo monocatenario se abrevia con frecuencia como "scFv" o "sFv". Estos fragmentos de anticuerpo se producen utilizando genética molecular y tecnología de ADN recombinante. Un anticuerpo monocatenario consiste en una cadena polipeptídica que comprende tanto un dominio VH como un dominio VL que interaccionan para formar un sitio de unión con el antígeno. Los dominios VH y VL están unidos generalmente por un péptido de 10 a 25 restos de aminoácidos. La expresión "anticuerpo monocatenario" incluye además, pero sin limitarse a ello, un Fv ligado a disulfuro (dsFv) en el que dos anticuerpos monocatenarios (cada uno de los cuales puede dirigirse a un epítopo diferente) unidos entre sí mediante un enlace disulfuro; un sFv biespecífico en el que dos scFvs discretos de especificidad diferente están conectados con un enlazador peptídico; un diacuerpo (un sFv dimerizado formado cuando el dominio VH de un primer sFv se ensambla con el dominio VL de un segundo sFv y el dominio VL del primer sFv se ensambla con el dominio VH del segundo sFv; las dos regiones de unión con el antígeno del diacuerpo pueden dirigirse hacia epítopos iguales o diferentes); y un triacuerpo (un sFv trimerizado, formado de manera similar a un diacuerpo, pero en el que se crean tres dominios de unión con el antígeno en un único complejo, los tres dominios de unión a antígeno pueden dirigirse hacia los mismos epítopos o a epítopos diferentes).
Los "péptidos de la región determinante de la complementariedad" o "péptidos CDR" son otra forma de fragmento de anticuerpo. Un péptido CDR (también conocido como "unidad mínima de reconocimiento") es un péptido que corresponde a una única región determinante de complementariedad (CDR), y puede prepararse construyendo genes que codifican la CDR de un anticuerpo de interés. Tales genes se preparan, por ejemplo, usando la reacción en cadena de la polimerasa para sintetizar la región variable del ARN de las células productoras de anticuerpos. Véase, por ejemplo, Larrick et al. Methods: A Companion to Methods in Enzymology 2: 106, 1991.
En "anticuerpos modificados con cisteína", se inserta o se sustituye un aminoácido cisteína en la superficie del anticuerpo mediante manipulación genética y se usa para conjugar el anticuerpo con otra molécula a través, por ejemplo, de un puente disulfuro. Se han descrito sustituciones o inserciones de cisteína para anticuerpos (véase la patente de EE. UU. nº 5.219.996). Los métodos para introducir restos Cys en la región constante de los anticuerpos IgG para uso en la conjugación de anticuerpos específica del sitio se describen en Stimmel et al. (J. Biol. Chem 275: 330445 - 30450, 2000).
Un "anticuerpo humanizado" es una proteína recombinante usada para reducir la cantidad de proteína no humana en la que las CDRs de un anticuerpo de una especie, por ejemplo, un anticuerpo de roedor, cadenas variables pesadas y ligeras del anticuerpo de roedor se intercambian por algunos dominios variables pesados y ligeros humanos, por ejemplo usando técnicas de ingeniería de proteínas. Los dominios constantes de la molécula de anticuerpo se derivan de los de un anticuerpo humano. Véase Gussow y Seemann, Humanization of monoclonal antibodies, Method Enzymol. 203: 99 - 121, 1991 y Vaswani y Hamilton, Ann. Allergy Asthma Immunol. 81: 105 -119, 1998.
Producción de un Fragmento de Anticuerpo.
Algunas realizaciones de la invención como se definen en las reivindicaciones pueden referirse a fragmentos de anticuerpos. Dichos fragmentos de anticuerpos se pueden obtener por digestión con pepsina o papaína de anticuerpos completos por métodos convencionales. Por ejemplo, pueden producirse fragmentos de anticuerpos por escisión enzimática de anticuerpos con pepsina para proporcionar un fragmento 5S denominado F(ab')2. Este fragmento puede escindirse adicionalmente usando un agente reductor de tiol y, opcionalmente, un grupo bloqueante para los grupos sulfhidrilo resultantes de la escisión de los enlaces disulfuro, para producir fragmentos monovalentes de Fab' 3.5S. Alternativamente, una escisión enzimática usando pepsina produce dos fragmentos Fab monovalentes y un fragmento Fc. Los ejemplos de métodos para producir fragmentos de anticuerpos se describen en la patente de EE. UU. nº 4.036.945; patente de EE. UU. nº 4.331.647; Nisonoff y otros, 1960, Arch. Biochem. Biophys., 89: 230; Porter, 1959, Biochem. J., 73: 119; Edelman et al., 1967, Methods in Enzymology, página 422 (Academic Press), y Coligan et al. (eds.), 1991, Current Protocols in Immunology, (John Wiley & Sons).
También se pueden usar otros métodos de escindir anticuerpos, tales como la separación de cadenas pesadas para formar fragmentos de cadenas monovalentes ligeras-pesadas, escisión adicional de fragmentos u otras técnicas enzimáticas, químicas o genéticas, siempre y cuando los fragmentos se unan al antígeno que es reconocido por el anticuerpo intacto. Por ejemplo, los fragmentos Fv comprenden una asociación de cadenas V H y V L. Esta asociación puede ser no covalente, como se describe en Inbar et al., 1972, Proc. Nat'l. Acad. Sci. EE. UU. 69: 2659. Alternativamente, las cadenas variables pueden estar unidas por un enlace disulfuro intermolecular o reticuladas por productos químicos tales como glutaraldehído. Véase Sandhu, 1992, Crit. Rev. Biotech., 12: 437.
Preferiblemente, los fragmentos Fv comprenden cadenas V H y V L conectadas por un enlazador peptídico. Estas proteínas de unión con el antígeno de cadena simple (sFv) se preparan construyendo un gen estructural que comprende secuencias de ADN que codifican los dominios VH y VL, conectados por una secuencia de unión de oligonucleótidos. El gen estructural se inserta en un vector de expresión que posteriormente se introduce en una célula hospedadora, tal como E. coli. Las células hospedadoras recombinantes sintetizan una única cadena polipeptídica con un péptido enlazador puenteando los dos dominios V. Los métodos para producir sFvs son bien conocidos en la técnica. Véase Whitlow et al., 1991, Methods: A Companion to Methods in Enzymology 2: 97; Bird et al., 1988, Science, 242: 423; patente de EE. UU. nº 4.946.778; Pack et al., 1993, Bio/Technology, 11: 1271, y Sandhu, 1992, Crit. Rev. Biotech., 12: 437.
Otra forma de fragmento de anticuerpo es un péptido que codifica una única región determinante de la complementariedad (CDR). Los péptidos CDR ("unidades mínimas de reconocimiento") pueden obtenerse construyendo genes que codifican la CDR de un anticuerpo de interés. Tales genes se preparan, por ejemplo, usando la reacción en cadena de la polimerasa para sintetizar la región variable del ARN de las células productoras de anticuerpos. Véase Larrick et al., 1991, Methods: A Companion to Methods in Enzymology 2: 106; Ritter et al. (eds.), 1995, Monoclonal Antibodies: Production, Engineering and Clinical Application, páginas 166 - 179 (Cambridge University Press); Birch et al., (eds.), 1995, Monoclonal Antibodies: Principles and Applications, páginas 137 - 185 (Wiley-Liss, Inc.).
En una realización, el anticuerpo humanizado puede unirse a un efector o molécula repórter. Por ejemplo, un macrociclo para la quelación de un átomo de metal pesado, o una toxina tal como ricina, se puede unir al anticuerpo humanizado mediante una estructura de enlace covalente. Alternativamente, el procedimiento de tecnología de ADN recombinante puede usarse para producir una molécula de anticuerpo humanizado en la que el fragmento Fc, el dominio Cu3 o Cn2 de una molécula de anticuerpo completa ha sido reemplazado por o se ha unido a él por unión peptídica a una proteína funcional no inmunoglobulina, tal como una enzima o molécula de toxina.
En otra realización de la presente invención, el anticuerpo humanizado puede incluir una molécula de anticuerpo completa, que tiene cadenas pesadas y ligeras de longitud completa; un fragmento del mismo, tal como un Fab, Fab', F(ab')2, o fragmento Fv; un fragmento de anticuerpo monocatenario, p. ej. un monómero o dímero de cadena sencilla Fv, cadena ligera o cadena pesada; proteínas de unión a antígeno monoespecíficas multivalentes que comprenden dos, tres, cuatro o más anticuerpos o fragmentos de los mismos unidos entre sí por una estructura de conexión; o un fragmento o análogo de cualquiera de estas o cualquier otra molécula con la misma especificidad que MAb mL243. En una realización particular, el anticuerpo puede incluir una molécula de anticuerpo completa, que tiene cadenas pesadas y ligeras de longitud completa.
Anticuerpos humanizados L243.
Anticuerpos quiméricos y humanizados.
Un anticuerpo quimérico es una proteína recombinante en la que las regiones variables de un anticuerpo humano han sido reemplazadas, por ejemplo, por las regiones variables de un anticuerpo anti-L243 de ratón, que incluye las regiones determinantes de la complementariedad (CDR) del anticuerpo de ratón. Los anticuerpos quiméricos muestran una inmunogenicidad disminuida y una estabilidad aumentada cuando se administran a un sujeto. Los métodos para construir anticuerpos quiméricos son bien conocidos en la técnica (por ejemplo, Leung et al., 1994, Hybridoma 13: 469).
Un anticuerpo monoclonal quimérico puede ser humanizado transfiriendo las CDRs de ratón de las cadenas variables pesada y ligera de la inmunoglobulina de ratón a los correspondientes dominios variables de un anticuerpo humano. Las regiones estructura de ratón (FR) en el anticuerpo monoclonal quimérico también se reemplazan con secuencias FR humanas. Para preservar la estabilidad y la especificidad del monoclonal humanizado, uno o más restos de FR humanas pueden reemplazarse por los restos contrapartida de ratón. Los anticuerpos monoclonales humanizados pueden usarse para el tratamiento terapéutico de sujetos. La afinidad por una diana de los anticuerpos humanizados también puede aumentarse mediante la modificación seleccionada de las secuencias de CDR (documento WO0029584A1). Las técnicas para la producción de anticuerpos monoclonales humanizados son bien conocidas en este campo. (Véanse, por ejemplo, Jones et al., 1986, Nature, 321: 522; Riechmann et al., Nature, 1988, 322: 323; Verhoeyen et al., 1988, Science, 239: 1534; Carter et al., 1992), Proc. Nat'l Acad. Sci. USA, 89: 4285; Sandhu, Crit. Rev. Biotech., 1992, 12: 437; Tempest et al., 1991, Biotechnology 9: 266; Singer et al., J. Immun., 1993, 150: 2844).
También se describen anticuerpos de primate no humano. Pueden encontrarse técnicas generales para generar anticuerpos terapéuticamente útiles en babuinos, por ejemplo, en Goldenberg et al., documento WO 91/11465 (1991), y en Losman et al., Int. J. Cancer 46: 310 (1990).
También se describe un anticuerpo monoclonal humano. Tales anticuerpos se obtienen a partir de ratones transgénicos que se han modificado por ingeniería genética para producir anticuerpos humanos específicos en respuesta a la sensibilización antigénica. En esta técnica, los elementos del locus de cadena pesada y ligera humana se introducen en cepas de ratones derivadas de líneas de células madre embrionarias que contienen interrupciones dirigidas de los loci de cadena pesada endógena y de cadena ligera. Los ratones transgénicos pueden sintetizar anticuerpos humanos específicos para antígenos humanos, y los ratones pueden usarse para producir hibridomas secretores de anticuerpos humanos. Los métodos para obtener anticuerpos humanos a partir de ratones transgénicos son descritos por Green et al., Nature Genet. 7: 13 (1994), Lonberg et al., Nature 368: 856 (1994), y Taylor et al., Int. Immun.6: 579 (1994).
También se describe que el anticuerpo humanizado puede incluir las secuencias de la región CDR de mL243 dentro de secuencias estructura de anticuerpo humano y con secuencias de la región constante de anticuerpo humano. Más en particular, los anticuerpos humanizados pueden incluir un dominio variable de cadena pesada (VH) que contiene los restos de VH de mL243 en todo CDR1 (31 a 35), CDR2 (50 a 65) y CDR3 (95 a 102). En otra realización, las CDRs del dominio variable de la cadena ligera (VL) corresponden a restos de mL243 VL en todo CDR1 (24 a 34), CDR2 (50 a 56) y CDR3 (89 a 97). En otra realización particular de la invención, otros restos murinos de L243 VH retenidos en el diseño humanizado están en una o más de las posiciones siguientes: F27, K38, K46, A68 y F91. Del mismo modo, los restos murinos de L243 en la VL retenidos en el diseño humanizado están en una o más de las siguientes posiciones: R37, K39, V48, F49 y G100.
Otros detalles para humanizar las secuencias de anticuerpos, reteniendo al mismo tiempo la especificidad antigénica del anticuerpo no-humano original, se describen, por ejemplo, en la solicitud de patente de EE. UU. nº 09/988.013 presentada el 16 de noviembre de 2001.
También se describe una cadena pesada de anticuerpo humanizado injertado con CDR, que tiene un dominio de región variable que comprende estructuras aceptoras derivadas de una cadena pesada humana del subgrupo I y las regiones de unión con el antígeno derivadas del donante mL243 donde la estructura comprende restos de donantes mL243 en una o más de las posiciones F27, K38, K46, A68 y F91. Véanse las Figuras 3 y 4 respectivamente.
También se describe una cadena ligera de anticuerpo humanizado injertado con CDR que puede tener un dominio de región variable que comprende estructuras aceptoras derivadas de una cadena ligera kappa humana de las regiones de unión con el antígeno donante del subgrupo I y mL243, en donde la estructura comprende mL243 restos donantes en una o más de las posiciones R37, K39, V48, F49 y G100.
En la molécula de anticuerpo humanizado injertado con CDR de realizaciones de la presente invención como se define en las reivindicaciones, las porciones derivadas de la inmunoglobulina no-L243 restantes (aceptores) puede derivarse de cualquier inmunoglobulina humana adecuada, con la condición de que el anticuerpo humanizado pueda plegarse de manera que conserve la capacidad de unirse específicamente a HLA-DR. Preferiblemente, el tipo de estructura (FR) humana utilizada es de clase/tipo igual/similar que el anticuerpo donante.
En una realización de la invención, las estructuras humanas pueden escogerse para maximizar la homología con una secuencia de anticuerpo donante particularmente en posiciones espacialmente cercanas o adyacentes a las CDRs. De acuerdo con esta realización, las estructuras (es decir, FR1-4) de L243 VH o VL humanizado pueden derivarse de una combinación de anticuerpos humanos. Los ejemplos de estructuras humanas que pueden usarse para construir anticuerpos injertados con CDR son LAY, POM, TUR, TEI, KOL, NEWM, REI, RF y EU; preferiblemente se utilizan RF-TS3 FR1 -3 y NEWM FR4 para la cadena pesada y se usa REI FR1-4 para la cadena ligera. El sistema de numeración de restos del dominio V usado en este documento se describe en Kabat et al, (1991), Sequences of Proteins of Immunological Interest, 5ª edición, United States Department of Health and Human Services. Véase la Figura 5 para una alineación comparativa de la secuencia de aminoácidos de las cadenas humanas RF-TS3 (FR 1-3 y NEWM FR4), mL243 y hL243 VH. Véase la Figura 6 para una alineación comparativa de la secuencia de aminoácidos de las cadenas humanas REI, mL243 y hL243 VL.
Los dominios variables de cadena ligera y pesada de la molécula de anticuerpo humanizado pueden fusionarse a dominios constantes de cadena ligera o pesada humana según lo apropiado (la expresión "dominios constantes de cadena pesada incluyen regiones bisagra a menos que se especifique otra cosa). Los dominios constantes humanos de la molécula de anticuerpo humanizado, cuando están presentes, pueden seleccionarse con respecto a la función del anticuerpo propuesta. En una realización, los dominios constantes humanos pueden seleccionarse basándose en la ausencia de funciones efectoras. Los dominios constantes de la cadena pesada fusionados a la región variable de la cadena pesada pueden ser los de la IgA humana (cadena a1 o a2), IgG (cadena 71, 72, j3 > o y4) o IgM (cadena u). Preferiblemente, se usa una cadena γ humana. Los dominios constantes de la cadena ligera que pueden fusionarse con la región variable de la cadena ligera incluyen cadenas lambda y kappa humanas.
En una realización concreta de la presente invención, se usa una cadena γ1. En otra realización particular de la
presente invención, se usa una cadena γ4. En algunos casos el uso de la cadena γ4 puede incrementar la tolerancia de un hL243 en sujetos (disminución de efectos secundarios y de reacciones de infusión, mayor tolerancia, etc.). En una realización, pueden usarse análogos de dominios constantes humanos. Estos incluyen, pero sin limitarse a ellos, los dominios constantes que contienen uno o más aminoácidos adicionales que el dominio humano correspondiente o aquellos dominios constantes en los que se han eliminado o alterado uno o más aminoácidos existentes del correspondiente dominio humano. Dichos dominios se pueden obtener, por ejemplo, mediante mutagénesis dirigida por oligonucleótidos.
Como se usa en el presente texto, el término "alterado", cuando se utiliza junto con la capacidad de un anticuerpo para fijar el complemento, indica una disminución en la capacidad del anticuerpo para fijar el complemento en comparación con el anticuerpo inalterado de partida. La alteración de un aminoácido apropiado altera la capacidad de un anticuerpo para fijar el complemento. Como se usa en el presente texto, el término "substancialmente" reduce la fijación del complemento y denota que la fijación del complemento humano es preferiblemente menor o igual al 30%, más preferiblemente menor que o igual al 20%, y lo más preferiblemente menor que o igual al 10% del nivel observado con el anticuerpo de tipo silvestre.
La capacidad de fijación del complemento alterada se puede producir mediante técnicas que son bien conocidas en este campo, por ejemplo eliminando restos, insertando un sitio de glucosilación en una posición de la molécula adecuada, o intercambiando regiones bisagra inferiores de anticuerpos de isotipos diferentes.
Preparación de genes que codifican anticuerpos HL243.
Cualquier técnica estándar de biología molecular conocida en la técnica puede usarse para preparar secuencias de ADN que codifiquen los anticuerpos de acuerdo con la presente invención. Por ejemplo, las secuencias de ADN se pueden sintetizar completamente o en parte usando técnicas de síntesis de oligonucleótidos. Las técnicas de mutagénesis dirigida al sitio y de reacción en cadena de la polimerasa (PCR) se pueden usar según sea apropiado. Los procesos adecuados incluyen el procedimiento de superposición de cadena de PCR y la mutagénesis por PCR como se describe, por ejemplo, en "PCR Technology Principles and Applications for DNA Amplification” (1989), Ed. H. A. Erlich, Stockholm Press, N. Y., Londres, y mutagénesis dirigida por oligonucleótidos (Kramer et al, Nucleic. Acid. Res.129441 (1984)).
Cualquier técnica estándar de biología molecular puede también usarse para preparar secuencias de ADN que codifican productos injertados con CDR. Por ejemplo, las secuencias de ADN se pueden sintetizar completamente o en parte usando técnicas de síntesis de oligonucleótidos. La mutagénesis dirigida al sitio y las técnicas de reacción en cadena de la polimerasa (PCR) se pueden usar según sea apropiado. Se puede usar la síntesis dirigida por oligonucleótidos (Jones et al. (1986) Nature 321522 - 525) y la mutagénesis dirigida por oligonucleótidos de una región de dominio variable preexistente (Verhoeyen et al. (1988) Science 231534 - 1536). También se puede usar el rellenado enzimático de oligonucleótidos ahuecados utilizando T4 ADN polimerasa (Queen et al (1989) Proc. Natl. Acad. Sci. USA 8610029 - 10033). Se puede usar cualquier sistema de célula hospedadora/vector de expresión adecuado para la expresión de las secuencias de ADN que codifican las cadenas pesadas y ligeras quiméricas o injertadas con CDR. Un "hospedador recombinante" puede ser cualquier célula procariota o eucariota que contenga un vector de clonación o vector de expresión. Este término incluye también las células procariotas o eucariotas, así como animales transgénicos, que han sido modificados genéticamente para contener el gen o los genes clonados en el cromosoma o genoma de la célula o células hospedadoras. Pueden usarse ventajosamente bacterias, p. ej. E. coli y otros sistemas microbianos en particular para la expresión de fragmentos de anticuerpos, por ejemplo fragmentos Fv, Fab y Fab' y fragmentos de anticuerpos monocatenarios, p. ej. Fvs de cadena simple. Hospedadores eucarióticos, p. ej. los sistemas de expresión de células de mamíferos, también pueden ser usados para obtener anticuerpos de acuerdo con la presente invención, particularmente para la producción de productos más grandes de anticuerpos quiméricos o injertados con CDR. Las células huésped de mamífero adecuadas incluyen células de mieloma, tales como células Sp2/0 y NSO, así como células de ovario de hámster chino (CHO), líneas de células de hibridoma, y otras células de mamífero útiles para expresar anticuerpos.
Un "vector de expresión" como se usa en el presente texto es una molécula de ADN que incluye los genes de interés que se expresan en una célula hospedadora. Típicamente, la expresión del gen se pone bajo el control de ciertos elementos reguladores, que incluyen promotores constitutivos o inducibles, elementos reguladores específicos de tejidos y potenciadores. Se dice que dicho gen está "operativamente vinculado a "los elementos reguladores”. En otros aspectos, la realización también incluye secuencias de ADN que codifican las cadenas pesada y ligera de los anticuerpos de la presente invención, vectores de clonación y de expresión que contienen estas secuencias de ADN, células hospedadoras transformadas con estas secuencias de ADN, y procesos para producir las cadenas pesadas o ligeras y moléculas de anticuerpo que comprenden expresar estas secuencias de ADN en una célula hospedadora transformada.
El ADN que codifica las secuencias de inmunoglobulina humana se puede obtener por cualquier medio conocido en la técnica. Por ejemplo, las secuencias de aminoácidos de las estructuras aceptores humanos preferidos, tales como -LAY, POM, KOL, REI, EU, TUR, TEI, RF y NEWM, están ampliamente disponibles. Del mismo modo, también están disponibles las secuencias de consenso para los subgrupos de la cadena ligera y pesada humana. El experto en la
materia es consciente de que múltiples secuencias de codones pueden codificar el mismo aminoácido y que, en diversas realizaciones, las secuencias de ácido nucleico descritas pueden estar sustituidas con una secuencia alternativa que codifica la misma secuencia de aminoácidos. El experto en la técnica también es consciente de que, dependiendo de la especie de origen para una línea celular utilizada para expresar una proteína de una secuencia de ácido nucleico, el uso del codón puede optimizarse para potenciar la expresión en la especie seleccionada. Tales Dichas frecuencias de codón preferidas de la especie son bien conocidas en la técnica.
En una realización, el anticuerpo de la presente invención como se define en las reivindicaciones puede ser un anticuerpo completo o, como se explicó anteriormente, un fragmento del mismo, un monómero o dímero o una proteína de unión con el antígeno monoespecífica multivalente. Por tanto, además de la presente invención, se puede proporcionar una proteína monoespecífica de unión con el antígeno multivalente, que comprende dos, tres, cuatro o más fragmentos de anticuerpo de la misma unidos entre sí por una estructura de conexión, la cual proteína no es una inmunoglobulina natural, teniendo cada uno de dichos anticuerpos o fragmentos una especificidad para el epítopo reconocido por el MAb L243 murino, estando dicha proteína de unión con el antígeno conjugada opcionalmente con una molécula efectora o repórter.
De acuerdo con estas realizaciones, cada anticuerpo o fragmento puede ser un anticuerpo humanizado o un fragmento del mismo, como se definió anteriormente, y una proteína de unión con el antígeno monoespecífica multivalente puede ser una proteína de unión con el antígeno monoespecífica multivalente humanizada. Sin embargo, se pueden contemplar proteínas de unión con el antígeno monoespecíficas multivalentes no humanizadas, por ejemplo murinas, y una realización puede extenderse a éstas cuando sea el caso.
En una realización particular, una proteína de unión a antígeno multivalente puede proporcionar dos, tres o cuatro anticuerpos o fragmentos de los mismos unidos entre sí por una estructura de conexión. En otra realización, un proceso para producir el anticuerpo humanizado puede incluir: i) producir en un vector de expresión una secuencia de ADN que codifica una cadena ligera o pesada de anticuerpo, que incluye un dominio variable en el que al menos una de las CDRs del dominio variable puede ser derivado del mAb mL243 y las partes derivadas de la inmunoglobulina remanentes de la cadena de anticuerpo se derivan de una inmunoglobulina humana; ii) producir en un vector de expresión una secuencia de ADN que codifica una cadena ligera o pesada de anticuerpo complementario que incluye un dominio variable, en donde al menos una de las CDR del dominio variable se deriva del MAb mL243 y las partes derivadas de inmunoglobulina remanentes de la cadena de anticuerpo pueden derivarse de una inmunoglobulina humana; iii) transfectar una célula hospedadora con las secuencias de ADN mencionadas anteriormente; y iv) cultivar la línea celular transfectada para producir la molécula de anticuerpo humanizado.
Producción de hL243 recombinante en una célula hospedadora.
Una línea de células hospedadoras utilizada para producir hL243 recombinante puede ser transfectada con dos vectores, conteniendo el primer vector la secuencia de ADN que codifica el polipéptido derivado de la cadena ligera, y conteniendo el segundo vector la secuencia de ADN que codifica el polipéptido derivado de la cadena pesada. Los vectores pueden ser idénticos, excepto en cuanto a las secuencias codificadoras y los marcadores seleccionables, para asegurar en lo posible que cada cadena polipeptídica se exprese por igual. La transfección se puede llevar a cabo mediante cualquier técnica conocida por los expertos en este campo. Véanse, por ejemplo, Maniatis et al. (1982) (Molecular Cloning, Cold Spring Harbor, Nueva York) y Primrose y Old (1980) (Principles of Gene Manipulation, Blackwell, Oxford). Una técnica particular para la transfección puede ser la electroporación. Otros ejemplos incluyen transfección mediada por fosfato de calcio, transfección mediada por lípidos catiónicos, y similares. En una realización alternativa, puede usarse un solo vector, incluyendo el vector las secuencias de ADN que codifican polipéptidos derivados tanto de cadenas ligeras como de cadenas pesadas, y un marcador seleccionable.
Métodos generales para la producción de proteínas de fusión recombinantes que contienen fragmentos de anticuerpos.
Se pueden obtener secuencias de ácido nucleico que codifican los fragmentos de anticuerpo que reconocen epítopos específicos mediante técnicas que son bien conocidas en este campo. Por ejemplo, los hibridomas que secregan anticuerpos de una especificidad deseada se pueden usar para obtener ADN que codifica anticuerpos que se puede preparar usando técnicas conocidas, por ejemplo, mediante PCR o mediante técnicas de clonación de ADNc tradicionales. Alternativamente, pueden construirse bibliotecas de expresión de Fab' o bibliotecas de presentación de fagos de anticuerpos, para detectar fragmentos de anticuerpos que tienen una especificidad deseada.
El ácido nucleico que codifica el fragmento de anticuerpo puede entonces ligarse, directamente o mediante una secuencia que codifica un espaciador peptídico, a ácido nucleico que codifica DDD o AD. Los métodos para producir secuencias de ácido nucleico que codifican estos tipos de proteínas de fusión son bien conocidos en la técnica y se describen adicionalmente en los ejemplos que siguen.
En otra realización, pueden añadirse restos de aminoácidos adicionales al extremo C-terminal de la subunidad modular compuesta de A/DDD o B/AD, donde el sitio de fusión exacto puede depender de si el DDD o el AD están
unidos al terminal N o al C (o en una posición interna). Los restos de aminoácidos adicionales pueden comprender una etiqueta peptídica, un péptido señal, una citocina, una enzima (por ejemplo, una enzima activadora profármaco), una hormona, una toxina, un fármaco peptídico, un péptido que interactúa con la membrana u otras proteínas funcionales.
Las proteínas o péptidos pueden sintetizarse, en todo o en parte, en solución o en un soporte sólido de acuerdo con técnicas convencionales. Se dispone comercialmente de diversos sintetizadores automáticos y pueden usarse de acuerdo con protocolos conocidos. Véanse, por ejemplo, Stewart y Young, (1984, Solid Phase Peptide Synthesis, 2ª edición, Pierce Chemical Co.); Tam et al., (1983, J. Am. Chem. Soc., 105: 6442); Merrifield, (1986, Science, 232: 341 - 347); y Barany y Merrifield (1979, The Peptides, Gross y Meienhofer, eds., Academic Press, Nueva York, pp. 1 -284). Las secuencias peptídicas cortas, por lo general de aproximadamente 6 a aproximadamente 35 a 50 aminoácidos, pueden sintetizarse fácilmente mediante tales métodos. Alternativamente, se puede emplear la tecnología de ADN recombinante en la que una secuencia de nucleótidos que codifica un péptido de interés se inserta en un vector de expresión, se transforma o se transfecta en una célula hospedadora apropiada, y se cultiva bajo condiciones adecuadas para la expresión.
Los métodos para producir proteínas recombinantes en una célula huésped deseada son bien conocidos en la técnica. Para facilitar la purificación, las estructuras atadas de forma estable pueden contener marcadores peptídicos adecuados, tales como la secuencia FLAG o la secuencia poli-HIS, para facilitar su purificación con una columna de afinidad relevante.
En una realización, los fragmentos Fv pueden incluir cadenas VH y VL conectadas mediante un conector peptídico. Estas proteínas de unión a antígeno de cadena simple (sFv) se preparan construyendo un gen estructural que comprende secuencias de ADN que codifican los dominios V H y V L, conectados por una secuencia de unión de oligonucleótidos. El gen estructural se inserta en un vector de expresión que se introduce posteriormente en una célula hospedadora, tal como E. coli. Las células hospedadoras recombinantes sintetizan una única cadena polipeptídica con un péptido enlazador puenteando los dos dominios V. Los métodos para producir sFvs son bien conocidos en la técnica. Véanse Whitlow et al., 1991, Methods: A Companion to Methods in Enzymology 2: 97; Bird et al., 1988, Science, 242: 423; patente de EE. UU. nº 4.946.778; Pack et al., 1993, Bio/Technology, 11: 1271, y Sandhu, 1992, Crit. Rev. Biotech., 12: 437.
Otra forma de fragmento de anticuerpo es un péptido que codifica una única región determinante de la complementariedad (CDR). Los péptidos CDR ("unidades mínimas de reconocimiento") pueden obtenerse construyendo genes que codifican la CDR de un anticuerpo de interés. Tales genes se preparan, por ejemplo, usando la reacción en cadena de la polimerasa para sintetizar la región variable del ARN de las células productoras de anticuerpos. Ver Larrick et al., 1991, Methods: A Companion to Methods in Enzymology 2: 106; Ritter et al. (eds.), 1995, Monoclonal Antibodies: Production, Engineering and Clinical Application, páginas 166 - 179 (Cambridge University Press); Birch et al., (Eds.), 1995, Monoclonal Antibodies Principles and Applications, páginas 137 - 185 (Wiley-Liss, Inc.).
Las células hospedadoras o líneas celulares adecuadas para la expresión de las subunidades constituyentes de las estructuras establemente atadas son conocidas por un experto en la técnica. El uso de una célula huésped humana permitiría que cualquier molécula expresada se modificara con patrones de glicosilación humana. Sin embargo, no hay ninguna indicación de que una célula hospedadora humana sea esencial o preferida para los métodos descritos. Anticuerpos biespecíficos y conjugados.
En ciertas realizaciones, los ligandos de L243 descritos en este documento pueden usarse en combinación con otra molécula unida al ligando. La unión puede ser covalente o no covalente. En algunas realizaciones, se puede unir un ligando L243 a un anticuerpo biespecífico, es decir, un anticuerpo que tiene dos sitios de unión diferentes, uno para el ligando L243 y otro para un antígeno diana relacionado con la enfermedad. Cualquier enfermedad o condición relacionada con la angiogénesis, cáncer, metástasis o motilidad celular puede ser diana, incluyendo, entre otros, el cáncer primario, cáncer metastásico, hiperplasia, artritis reumatoide, enfermedad intestinal inflamatoria, enfermedad de Crohn, colitis ulcerosa, sarcoidosis, asma, edema, hipertensión pulmonar, formación y desarrollo de tejido tumoral, psoriasis, retinopatía diabética, degeneración macular, rechazo de injerto corneal, glaucoma neovascular, angiogénesis miocárdica, neovascularización de la placa, reestenosis, formación de neointima después de un trauma vascular, telangiectasia, articulaciones hemofílicas, angiofibroma, fibrosis asociada a inflamación crónica, fibrosis pulmonar, trombosis venosa profunda y granulación de heridas. Los métodos para la construcción y uso de anticuerpos biespecíficos y multiespecíficos se describen, por ejemplo, en la publicación de la solicitud de patente de EE. UU. nº 20050002945, presentada el 11/2/2004.
Cuando el anticuerpo biespecífico se dirige en parte contra un antígeno asociado a un tumor, se prevé que cualquier tipo de tumor y cualquier tipo de antígeno tumoral puedan ser direccionados así. Los ejemplos de tipos de tumores que pueden ser dirigidos incluyen leucemia linfoblástica aguda, leucemia mielógena aguda, cáncer biliar, cáncer de mama, cáncer de cuello uterino, leucemia linfocítica crónica, leucemia mielógena crónica, cáncer colorrectal, cáncer de endometrio, cáncer esofágico, gástrico, de cabeza y cuello, linfoma de Hodgkin, cáncer de pulmón, tiroides medular, linfoma no Hodgkin, cáncer de ovario, cáncer de páncreas, glioma, melanoma, cáncer de hígado, cáncer
de próstata y cáncer de vejiga urinaria. Se prefieren los tumores que tienen expresión constitutiva de L243, o que pueden estimularse para producir L243.
Se puede usar una variedad de métodos recombinantes para producir anticuerpos biespecíficos y fragmentos de anticuerpo. Por ejemplo, se pueden producir anticuerpos biespecíficos y fragmentos de anticuerpo en la leche de ganado transgénico (véase, por ejemplo, Colman, A., Biochem. Soc. Symp., 63: 141 - 147, 1998; patente de EE. UU. nº 5.827; 690). Se preparan dos constructos de ADN que contienen, respectivamente, segmentos de ADN que codifican cadenas pesadas y ligeras de inmunoglobulina emparejadas. Los fragmentos se clonan en vectores de expresión que contienen una secuencia promotora que se expresa preferentemente en células epiteliales mamarias. Los ejemplos incluyen, pero sin limitarse a ellos, promotores de genes de caseína de conejo, vaca y oveja, el gen de la alfa-lactoglobulina de vaca, el gen de beta-lactoglobulina de oveja y el gen de proteína ácida de suero de ratón. Preferiblemente, el fragmento insertado está flanqueado en su lado 3' por secuencias genómicas cognadas procedentes de un gen mamario específico. Esto proporciona un sitio de poliadenilación y secuencias estabilizadoras del transcripto. Las casetes de expresión son coinyectadas en los pronúcleos de huevos de mamífero fertilizados, que luego se implantan en el útero de una hembra receptora y se les permite gestar. Después del parto, la progenie se somete a cribado en relación con la presencia de ambos transgenes mediante análisis Southern. Para que el anticuerpo esté presente, los genes tanto de la cadena pesada como de la ligera deben expresarse al mismo tiempo en la misma célula. La leche de las hembras transgénicas se analiza en cuanto a la presencia y funcionalidad del anticuerpo o fragmento de anticuerpo usando métodos inmunológicos estándar conocidos en la técnica. El anticuerpo puede purificarse de la leche usando métodos estándar conocidos en la técnica.
Pre-marcación (“Pre-targeting”).
Una estrategia para el uso de anticuerpos biespecíficos incluye metodologías de pre-marcación ( pre-targeting), en las que se administra a un sujeto una molécula efectora, tal como un ligando antiangiogénico o antitumoral, después de que se haya administrado un anticuerpo biespecífico. El anticuerpo biespecífico, que incluiría un sitio de unión para un ligando L243 y uno para el tejido enfermo, localiza el tejido enfermo e incrementa la especificidad de la localización del ligando efector L243 en el tejido enfermo (solicitud de patente de EE. UU. nº 20050002945). Como la molécula efectora puede eliminarse de la circulación mucho más rápidamente que el anticuerpo biespecífico, los tejidos normales pueden tener una exposición a la molécula efectora cuando se usa una estrategia de selección previa menor que cuando la molécula efectora está directamente relacionada con el anticuerpo dirigido a la enfermedad.
Se han desarrollado métodos de pre-targeting para aumentar las relaciones diana:fondo de los agentes de detección o terapéuticos. Se describen ejemplos de pre-targeting y planteamientos de biotina/avidina, por ejemplo, en Goodwin et al., patente de EE. UU. nº 4.863.713; Goodwin et al., J. Nucl. Med.29: 226, 1988; Hnatowich et al., J. Nucl. Med.
28: 1294,1987; Oehr et al., J. Nucl. Med.29: 728, 1988; Klibanov et al., J. Nucl. Med.29: 1951, 1988; Sinitsyn et al., J. Nucl. Med. 30:66, 1989; Kalofonos et al., J. Nucl. Med. 31: 1791, 1990; Schechter et al., Int. J. Cancer 48: 167, 1991; Paganelli et al., Cancer Res.51: 5960, 1991; Paganelli et al., Nucl. Med. Commun.12: 211, 1991; patente de EE. UU. nº 5.256.395; Stickney et al., Cancer Res.51: 6650, 1991; Yuan et al., Cancer Res.51: 3119, 1991; patente de EE. UU. nº 6.077.499; documento U.S. Ser. No. 09/597.580; documento U.S. Ser. No. 10/361.026; documento U.S. Ser. No. 09/337.756; documento U.S. Ser. No. 09/823.746; documento U.S. Ser. No. 10/116.116; documento U.S. Ser. No.09/382.186; documento U.S. Ser. No. 10/150.6541 publicada como patente de EE. UU. nº 7.011.812, documento US 2003/0232011, documento US 7.074.405, documento US 2002/0006379, documento US 2008/0193460, documento US 7.052.872, y documento US 2003/0198595, patente de EE. UU. nº 6.090.381; patente de EE. UU. nº 6.472.511; documento U.S. Ser. No. 10/114.315 publicada como US 2002/0176856, solicitud provisional de los Estados Unidos Nº 60/386.411; solicitud provisional de Estados Unidos No. 60/345.641; solicitud provisional de los Estados Unidos Nº 60/328.835; solicitud provisional de los Estados Unidos Nº 60/426.379 y la solicitud provisional de Estados Unidos Nº 60/342.103 publicada como documentos US 2004/0044076, US 2003/0148409, US 2003/0113333, US 2004/0166115 y US 2003/0162709; y documento U.S. Ser. No.09/823.746 y U.S. Ser. No.09/337.756 publicada como documento US 2002/0006379 y patente de EE. UU. nº 7.074.405.
En ciertas formas de realización, los anticuerpos biespecíficos y construcciones dirigibles pueden ser útiles en el tratamiento y/o la formación de imágenes de tejidos y órganos normales o enfermos, por ejemplo usando los métodos descritos en la patente de los EE. UU. Nos. 6.126.916; 6.077.499; 6.010.680; 5.776.095; 5.776.094; 5.776.093; 5.772.981; 5.753.206; 5.746.996; 5.697.902; 5.328.679; 5.128.119; 5.101.827; y 4.735.210. Se describen métodos adicionales en la solicitud de los EE.UU. No.09/337.756 presentada el 22 de junio de 1999 y en la solicitud de los EE.UU. Nº 09/823.746, presentada el 3 de abril de 2001, publicada como documentos US 7.074.405 y US 2002/0006379.
Usos terapéuticos y de diagnóstico de hL243.
En otra realización, la presente invención proporciona también composiciones terapéuticas y de diagnóstico que contienen los anticuerpos de las realizaciones de la invención. Tales composiciones pueden incluir un anticuerpo de acuerdo con la invención junto con un excipiente, diluyente o vehículo farmacéuticamente aceptables, por ejemplo para uso in vivo.
Un "agente terapéutico" es una molécula o un átomo que se administra separada, concurrente o secuencialmente con un resto de anticuerpo o conjugado a un resto de anticuerpo, es decir, anticuerpo o fragmento de anticuerpo, o un subfragmento, y es útil en el tratamiento de una enfermedad. Entre los ejemplos de agentes terapéuticos se incluyen anticuerpos, fragmentos de anticuerpos, fármacos, toxinas, enzimas, nucleasas, hormonas, agentes inmunomoduladores, oligonucleótidos, ARN de interferencia, agentes quelantes, compuestos de boro, agentes fotoactivos o colorantes y radioisótopos.
Un "agente de diagnóstico/detección" es una molécula o un átomo que se administra unido o conjugado con un resto de anticuerpo, es decir, anticuerpo o fragmento de anticuerpo o subfragmento, y es útil en el diagnóstico o la detección de una enfermedad localizando las células que contienen el antígeno. Los agentes de diagnóstico/detección útiles incluyen, pero no sin limitarse a ellos, radioisótopos, colorantes (tales como el complejo biotina-estreptavidina), agentes de contraste, compuestos o moléculas fluorescentes y agentes potenciadores (por ejemplo, iones paramagnéticos) para la formación de imágenes de resonancia magnética (IRM), y partículas o liposomas como ejemplos de agentes usados para la formación de imágenes por ultrasonidos. Los agentes potenciadores del ultrasonido se describen en las solicitudes de patente de los Estados Unidos US20040219203 A y US2005002020A1. Se prefieren los liposomas llenos de gas. Véanse Maresca, G. et al., Eur J. Radiol. Suppl 2 S171-178 (1998); Demos, Sm. et al. J. Drug Target 5507-518 (1998); y Unger, E. et al., Am. J. Cardiol.8158G-61G (1998). Alternativamente, se puede usar un anticuerpo biespecífico para dirigir el liposoma. En una de tales realizaciones, el liposoma es un liposoma lleno de gas con un péptido DTPA bivalente unido covalentemente a la superficie exterior de la membrana lipídica del liposoma. La solicitud de patente de los Estados Unidos US20040018557A1 describe tales liposomas.
La patente de EE. UU. nº 6.331.175 describe la técnica de MRI y la preparación de anticuerpos conjugados con un agente potenciador de MRI. En un método concreto, los agentes de diagnóstico/detección pueden seleccionarse entre el grupo que consiste en radioisótopos, agentes potenciadores para uso en formación de imágenes por resonancia magnética, agentes de ultrasonidos y compuestos fluorescentes. Para cargar un componente de anticuerpo con metales radiactivos o iones paramagnéticos, puede ser necesario hacerlo reaccionar con un reactivo que tiene una cola larga a la que están unidos múltiples grupos quelantes para unir los iones. Tal cola puede ser un polímero como la polilisina, un polisacárido u otra cadena derivatizada o derivatizable que tenga grupos colgantes a los que puedan unirse grupos quelantes tales como, por ejemplo, ácido etilendiaminotetraacético (EDTA), ácido dietilentriaminopentaacético (DTPA), porfirinas, poliaminas, éteres corona, bis-tiosemicarbazonas, polioximas y grupos similares conocidos por su utilidad para este fin. Los quelatos se pueden acoplar a los anticuerpos usando químicas estándar. El quelato puede estar ligado con el anticuerpo por un grupo que permite la formación de un enlace a la molécula con pérdida mínima de inmunorreactividad y agregación mínima y/o reticulación interna. Otros métodos y reactivos, más inusuales, para conjugar quelatos con anticuerpos se describen en la patente de EE. UU. nº 4.824.659 de Hawthorne, titulada "Antibody Conjugates", expedida el 25 de abril de 1989. En otra realización particular, las combinaciones útiles de metal-quelato pueden incluir 2-bencil-DTPA y sus análogos de monometilo y ciclohexilo, usados con isótopos de diagnóstico en el intervalo de energía general de 60 a 4.000 keV, tales como 125 131 I, I, 123I, 124I, 62Cu, MCu, 18F, inln, 67Ga, 68Ga, """Tc, 94mTc, HC, 13N, 15O, 76Br, 97Zr, para radioimágenes. Los mismos quelatos, cuando forman complejos con metales no radiactivos como el manganeso, el hierro y el gadolinio, pueden ser útiles para la MRI, cuando se usan junto con cualquier anticuerpo descrito en el presente texto. Los quelatos macrocíclicos tales como NOTA, DOT A y TETA se usan con una variedad de metales y radiometales, más en particular con radionucleidos de galio, itrio y cobre, respectivamente. Tales complejos de quelato de metal pueden ser estabilizados adaptando al metal de interés el tamaño del anillo. Otros quelatos de tipo anillo, tales como poliéteres macrocíclicos, que son de interés para nucleidos de unión estable, tales como 223Ra para RAIT, están comprendidos por las realizaciones de la presente memoria.
Los ejemplos de agentes terapéuticos incluyen, pero sin limitarse a ellos, anticuerpos, fragmentos de anticuerpo, medicamentos, incluidos agentes quimioterapéuticos, toxinas, enzimas, inhibidores de enzimas, nucleasas, hormonas, antagonistas hormonales, inmunomoduladores, citocinas, agentes quelantes, compuestos de boro, átomos de uranio, agentes fotoactivos y radionucleidos.
Los agentes de diagnóstico/detección útiles incluyen, pero sin limitarse a ellos, radioisótopos, colorantes (como con el complejo biotina-estreptavidina), materiales radiopacos (p. ej. yodo, bario, galio y compuestos de talio y similares), agentes de contraste, compuestos fluorescentes o moléculas y agentes potenciadores (p. ej. iones paramagnéticos) para imágenes de resonancia magnética (MRI). La patente de EE. UU. nº 6.331.175 describe la técnica de MRI y la preparación de anticuerpos conjugados con un agente potenciador de MRI. Preferiblemente, los agentes de diagnóstico/detección se seleccionan entre el grupo que consiste en radioisótopos para formación de imágenes nucleares, detección intraoperatoria y endoscópica; agentes potenciadores para uso en imágenes de resonancia magnética o en ultrasonografía; radiopacos y agentes de contraste para rayos X y tomografía computerizada; y compuestos fluorescentes para fluoroscopía, que incluyen fluoroscopía endoscópica.
Los agentes quimioterapéuticos, para los fines de esta descripción, incluyen todos los agentes quimioterapéuticos conocidos. Los agentes quimioterapéuticos conocidos incluyen, pero sin limitarse a ellos, taxanos, mostazas nitrogenadas, derivados de etilenimina, sulfonatos de alquilo, nitrosoureas, triazenos, análogos de ácido fólico, análogos de pirimidina, análogos de purina, oligonucleótidos antisentido, antagonistas o inhibidores de factores de transcripción, ARNs de interferencia, alcaloides, antibióticos, enzimas, complejos de coordinación de platino,
inhibidores de COX-2, agentes apoptóticos, urea sustituida, derivados de metilhidrazina, supresores de la corteza suprarrenal o antagonistas. En una realización más particular, los agentes quimioterapéuticos pueden incluir esteroides, progestinas, estrógenos, antiestrógenos o andrógenos. En otra realización particular, los agentes quimioterapéuticos pueden incluir actinomicina, azaribina, anastrozol, azacitidina, bleomicina, brostatina-1, busulfán, carmustina, celebrex, clorambucil, cisplatino, irinotecán (CPT-11), carboplatino, cladribina, ciclofosfamida, citarabina, dacarbazina , docetaxel, dacarbazina, dactinomicina, daunorrubicina, dexametasona, dietilestilbestrol, doxorrubicina, etinil estradiol, estramustina, etopósido, floxuridina, fludarabina, flutamida, fluorouracilo, fluoximesterona, gemcitabina, caproato de hidroxiprogesterona, hidroxiurea, idarrubicina, ifosfamida, L-asparaginasa, leucovorina, lomustina, mecloretamina, acetato de medroprogesterona, acetato de megestrol, melfalán, mercaptopurina, metotrexato, mitoxantrona, ritmitina, mitomicina, mitotano, oxaliplatino, butirato de fenilo, prednisona, procarbazina, paclitaxel, pentostatina, semustina, estreptozocina, SN-38, tamoxifeno, taxanos, taxol, propionato de testosterona, talidomida, tioguanina, tiotepa, tenipósido, topotecán, mostaza de uracilo, vinblastina, vinorelbina o vincristina. Algunos agentes quimioterapéuticos adecuados se describen en Remington's Pharmaceutical Sciences 19ª Ed. (Mack Publishing Co. 1995). Otros agentes quimioterapéuticos adecuados, tales como fármacos experimentales, son conocidos por los expertos en la técnica.
En una realización de la presente invención, una toxina puede incluir, pero sin limitarse a ellas, ricina, abrina, ribonucleasa, DNasa I, enterotoxina A estafilocócica, proteína antiviral de hierba carmín, gelonina, toxina diftérica, exotoxina de Pseudomonas o endotoxina de Pseudomonas.
En una realización de la presente invención, las enzimas también son agentes terapéuticos útiles y se pueden seleccionar del grupo que incluye, pero sin limitarse a ellos, malato deshidrogenasa, nucleasa estafilocócica, delta-V-esteroide isomerasa, alcohol deshidrogenasa de levadura, a-glicerofosfato deshidrogenasa, triosa fosfato isomerasa, peroxidasa de rábano picante, fosfatasa alcalina, asparaginasa, glucosa oxidasa, p-galactosidasa, ribonucleasa, ureasa, catalasa, glucosa-6-fosfato deshidrogenasa, glucoamilasa y acetilcolinesterasa.
Como se usa en el presente documento, el término "inmunomodulador" incluye citocinas, factores de crecimiento de células madre, linfotoxinas, tales como factor de necrosis tumoral (TNF) y factores hematopoyéticos, tales como interleucinas (por ejemplo, interleucina-1 (IL-1), IL-2 , IL-3, IL-6, IL-10, IL-12, IL-18 e IL-21), factores estimuladores de colonias (p. ej., factor estimulador de colonias de granulocitos (G-CSF) y factor estimulador de colonias de granulocitos macrófagos (GM-CSF)), interferones (por ejemplo, interferones-α, -β y -γ), factor de crecimiento de células madre denominado "factor S1" y eritropoyetina y trombopoyetina. Los ejemplos de restos de inmunomoduladores adecuados incluyen IL-2, IL-6, IL-10, IL-12, IL-18, IL-21, interferón-γ, TNF-α y similares. Alternativamente, los sujetos pueden recibir composiciones de la invención y una citoquina administrada por separado, que se puede administrar antes, simultáneamente o después de la administración de las composiciones descritas en el presente texto. Las realizaciones de la presente invención pueden incluir composiciones conjugadas con un inmunomodulador.
Una citocina, para los propósitos de esta descripción, incluye cualquier citocina incluyendo, pero sin limitarse a ellas, IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21, interferón-α, interferón-β e interferón-γ. También puede ser un factor estimulador de colonias, como GM-CSF, G-CSF, eritropoyetina, trombopoyetina y similares.
Además, un quelante puede incluir, pero sin limitarse a ellos, DTP A, DOTA, TETA o NOTA o un péptido adecuado, con el cual puede conjugarse una etiqueta detectable como una molécula fluorescente, o un agente citotóxico como un metal pesado o un radionucleido, Por ejemplo, puede obtenerse un inmunoconjugado terapéuticamente útil conjugando un agente fotoactivo o un colorante con un compuesto de anticuerpo. Se contempla aquí que las composiciones fluorescentes, tales como fluorocromo y otros cromógenos o colorantes, tales como porfirinas sensibles a la luz visible, se han usado para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto se ha denominado fotorradiación, fototerapia o terapia fotodinámica (Jori et al. (eds.), Photodynamic Therapy of Tumors and Other Diseases (Libreria Progetto, 1985), van den Bergh, Chem. Britain 22: 430, 1986). Además, se contempla que los anticuerpos monoclonales acoplados con colorantes fotoactivados para lograr la fototerapia se pueden usar con fines diagnósticos o terapéuticos en este documento. Mewe/a/., J. Immunol. 130: 1473, 1983; idem., Cancer Res. 45: 4380, 1985; Oseroff y col., Proc. Natl. Acad. Sci. USA 83: 8744, 1986; idem., Photochem. Photobiol.46: 83,1987; Hasan et al., Prog. Clin. Biol. Res.288: 471, 1989; Tatsuta et al., Lasers Surg. Med.9: 422, 1989; Pelegrin et al., Cancer 67: 2529, 1991. Sin embargo, estos estudios iniciales no incluyeron el uso de aplicaciones de terapia endoscópica, especialmente con el uso de fragmentos de anticuerpo o subfragmentos. Así pues, en el presente texto se contempla, en una realización, el uso terapéutico de inmunoconjugados que comprenden agentes fotoactivos o colorantes. Así, los presentes métodos terapéuticos pueden incluir el uso terapéutico de inmunoconjugados que comprenden agentes fotoactivos o colorantes. Se describen métodos endoscópicos de detección y terapia en las patentes de EE. UU. núms.4.932.412; 5.525.338; 5.716.595; 5.736.119; 5.922.302; 6.096.289; y 6.387.350.
En una realización de la presente invención se puede usar un nucleido. En una realización particular se contemplan radionucleidos que tienen propiedades diagnósticas o terapéuticas útiles, tales como indio-111 o itrio-90, respectivamente. Otros nucleidos útiles incluyen, pero sin limitarse a ellos, F-18, P-32, Sc-47, Cu-62, Cu-64, Cu-67, Ga-67, Ga-68, Y-86, Y-90 , Zr-89, To-99m, Pd-109, Ag-111, In-111, I-123, I-125, I-131, Sm-153, Gd-155, Gd-157,
Tb-161, Lu -177, Re-186, Re-188, Pt-197, Pb-212, Bi-212, Bi-213, Ra-223, Ac-225, As-72, As-77, At-211, Au-198 , A-199, Bi-212, Br-75, Br-76B, C-11, Co-55Co, Dy-166, Er-169, F-18, Fe-52, Fe-59, Ga-67, Ga -68, Gd -154-158, Ho-166, 1-120,1-121,1-124, In-110, In-111, M194, Lu-177, Mn-51, Mn-52, Mo-99 , N-13, O-15, P-32, P-33, Pb-211, Pb-212, Pd-109, Pm-149, Pr-142, Pr-143, Rb-82, Re-189, Rh-105, Sc-47, Se-75, Sr-83, Sr-89, Tb-161, Tc-94, Tc-99, Y-86, Y-90 o Zr-89. Por ejemplo, los radionucleidos de diagnóstico adecuados incluyen, pero sin limitarse a ellos, In-110, In-111, Lu-177, F-18, Fe-52, Cu-62, Cu-64, Cu-67, Ga-67, Ga- 68, Y-86, Zr-89, Tc-94m, Tc-94, Tc-99m, I-120, I-123, I-124, I-125, I-131, Gd-154-158, P- 32, C-11, N-13, 0-15, Re-186, Re-188, Mn-51, Mn-52m, Co-55, As-72, Br-75, Br-76, Rb-82m, Zr-89 y Sr-83. Un radionucleido de diagnóstico típico emite partículas y/o positrones que tienen entre 25 y 10.000 keV.
Adicionalmente, los radionucleidos terapéuticos adecuados incluyen, pero sin limitarse a ellos, In-111, Lu-177, Bi-212; Bi-213, At-211, Cu-62, Cu-64, Cu-67, Y-90,1-125,1-131, P-32, P-33, Sc-47, Ag-111, Ga- 67, Pr-142, Sm-153, Tb-161, Dy-166, Ho-166, Rep-186, Re-188, Re-189, Pb-212, Ra-223, Ac-225, Fe-59 , Se-75, As-77, Sr-89, Mo-99, Rh-105, Pd-109, Pr-143, Pm-149, Er-169, Ir-194, Au-198, Au-199, Ac -225 y Pb-211. Un catión terapéutico típico emite partículas y/o positrones que tienen entre 20 y 10.000 keV.
Las energías máximas de desintegración de nucleidos emisores de partículas beta útiles son preferiblemente de 20 a 5.000 keV, más preferiblemente de 100 a 4.000 keV, y lo más preferiblemente de 500 a 2.500 keV. También se prefieren los radionucleidos que se descomponen sustancialmente con partículas de emisión Auger. Por ejemplo, Co-58, Ga-67, Br-80m, Tc-99m, Rh-103m, Pt-109, In-111, Sb-119, I-125, Ho-161, Os-189m e Ir-192. Las energías de desintegración de nucleidos que emiten partículas Auger útiles son preferiblemente <1.000 keV, más preferiblemente <100 keV, y lo más preferiblemente <70 keV. También se prefieren los radionucleidos que se desintegran sustancialmente con la generación de partículas alfa. Tales radionucleidos incluyen, pero sin limitarse a ellos: Dy-152, At-211, Bi-212, Ra-223, Rn-219, Po-215, Bi-211, Arc-225, Fr-221, At-217, Bi-213 y Fm-255. Las energías de desintegración de los radionucleidos emisores de partículas alfa útiles son, preferiblemente, de 2.000 a 10.000 keV, más preferiblemente de 3.000 a 8.000 keV, y lo más preferiblemente de 4.000 a 7.000 keV.
Otros agentes terapéuticos útiles incluyen metales, como los que forman parte de una terapia fotodinámica, y nucleidos, como los que son valiosos en terapias basadas en procedimientos de captura de neutrones. Específicamente, zinc, aluminio, galio, lutecio y paladio son útiles para la terapia fotodinámica y B-10, Gd-157 y U-235 son útiles para la terapia de captura de neutrones.
En una realización, pueden usarse metales como agentes de diagnóstico, incluyendo los usados para técnicas de imagen de resonancia magnética. Estos metales incluyen, pero sin limitarse a ellos: gadolinio, manganeso, hierro, cromo, cobre, cobalto, níquel, disprosio, renio, europio, terbio, holmio y neodimio. Para cargar un componente de anticuerpo con metales radiactivos o iones paramagnéticos, puede ser necesario hacerlo reaccionar con un reactivo que tiene una cola larga a la que están unidos múltiples grupos quelantes para unir los iones. Por ejemplo, tal cola puede ser un polímero como una polilisina, polisacárido u otra cadena derivatizada o derivatizable que tenga grupos colgantes a los que se pueden unir grupos quelantes tales como, por ejemplo, ácido etilendiaminotetraacético (EDTA), ácido dietilentriaminopentaacético (DTPA), porfirinas, poliaminas, éteres corona, bis-tiosemicarbazonas, polioximas, y grupos similares que se sabe que son útiles para este propósito. Además, los quelatos se pueden acoplar a los antígenos peptídicos usando químicas estándar. El quelato se puede unir al anticuerpo por un grupo que permite la formación de un enlace con la molécula con una pérdida mínima de inmunorreactividad y una mínima agregación y/o reticulación interna. Otros métodos y reactivos para conjugar quelatos con anticuerpos se describen en la patente de EE. UU. nº 4.824.659 de Hawthorne, titulada "Antibody Conjugates", expedida el 25 de abril de 1989. En una realización particular, las combinaciones metal-quelato útiles pueden incluir, pero sin limitarse a ellas, 2-bencil-DTPA y sus análogos de monometilo y ciclohexilo, utilizados con isótopos de diagnóstico en el intervalo general de energía de 20 a 2.000 keV. Los mismos quelatos, cuando se complejan con metales no radioactivos tales como manganeso, hierro y gadolinio, son útiles para la MRI cuando se usan junto con los anticuerpos de las realizaciones descritas en este documento. Los quelatos macrocíclicos como NOT A, DOT A y TETA pueden usarse con una variedad de metales y radiometales, lo más particularmente con radionucleidos de galio, itrio y cobre, respectivamente. Tales complejos metal-quelato se pueden hacer muy estables adaptando el tamaño del anillo al metal de interés. Otros quelatos de tipo anillo tales como poliéteres macrocíclicos, que son de interés para nucleidos de unión estable, tales como 223Ra para RAIT, están comprendidos en las realizaciones de la presente invención.
En una realización de la invención, se pueden obtener inmunoconjugados terapéuticamente útiles mediante la conjugación de agentes fotoactivos o colorantes con un compuesto de anticuerpo. Los fluorescentes y otros cromógenos, o colorantes, como las porfirinas sensibles a la luz visible, se han usado para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto se ha denominado fotorradiación, fototerapia o terapia fotodinámica (Jori et al., eds., Therapy of Tumors and Other Diseases (Libreria Progetto 1985), van den Bergh, Claem, Britain 22: 430, 1986). Además, los anticuerpos monoclonales se han acoplado con colorantes fotoactivados para lograr la fototerapia. Mew et al., J. Immunol.130: 1473, 1983; idem., Cancer Res.45: 4380, 1985; Oseroff et al., Proc. Natl. Acad. Sci. USA 83: 8744, 1986; idem., Photochem. Photobiol 46: 83, 1987; Hasan y otros, Prog. Clin. Biol. Res.288: 471, 1989; Tatsuta et al., Lasers Surg. Med.9: 422, 1989; Pelegrin et al., Cancer 67: 2529, 1991. Sin embargo, estos estudios anteriores no incluyeron el uso de aplicaciones de terapia endoscópica, especialmente con el uso de fragmentos de anticuerpos o subfragmentos. Por tanto, en una realización de la presente invención, se contempla el uso terapéutico de inmunoconjugados que comprenden agentes fotoactivos o colorantes.
Los iones paramagnéticos adecuados para su uso en realizaciones de la presente invención incluyen, pero sin limitarse a ellos, cromo (III), manganeso (II), hierro (III), hierro (II), cobalto (II), níquel (II), cobre (II), neodimio (HI), samario (III), iterbio (III), gadolinio (III), vanadio (II), terbio (III), disprosio (III), holmio (III) y erbio (III), siendo especialmente preferido el gadolinio.
Los iones útiles en otros contextos, tales como la formación de imágenes por rayos X, incluyen, pero sin limitarse a ellos, lantano (III), oro (III), plomo (II) y especialmente bismuto (III). Las etiquetas fluorescentes incluyen rodamina, fluoresceína y renografina. La rodamina y la fluoresceína se unen con frecuencia a través de un intermediario de isotiocianato. Los materiales radiopacos y de contraste se usan para mejorar los rayos X y la tomografía computerizada, e incluyen compuestos de yodo, compuestos de bario, compuestos de galio, compuestos de talio, etc. Los compuestos específicos incluyen bario, diatrizoato, aceite etiodizado, citrato de galio, ácido iocármico, ácido iocetámico, yodamida, yodiparmde, ácido yodoxámico, iogulamida, iohexol, iopamidol, ácido iopanoico, ácido ioprocémico, ácido iosefámico, ácido iosérico, iosulamida, meglumina, ácido iosemético, iotasul, ácido iotétrico, ácido iotalámico, ácido iotróxico, ácido ioxáglico, ácido ioxotrizoico, ipodato, meglumina, metrizamida, metrizoato, propilodiona y cloruro de talio. Por tanto, en otra realización puede proporcionarse una composición terapéutica, farmacéutica o diagnóstica que comprende un anticuerpo descrito en el presente texto, en combinación con un excipiente, diluyente o vehículo farmacéuticamente aceptable.
Se proporciona un procedimiento para la preparación de una composición terapéutica, farmacéutica o diagnóstica que comprende mezclar un anticuerpo descrito en el presente texto junto con un excipiente, diluyente o vehículo farmacéuticamente aceptable.
Los anticuerpos y las composiciones pueden ser para administración en cualquier forma y cantidad apropiadas de acuerdo con la terapia en la que se emplean.
En una realización, la composición terapéutica, farmacéutica o diagnóstica puede tomar cualquier forma adecuada para la administración y preferiblemente está en una forma adecuada para administración parenteral, p. ej. por inyección o infusión, por ejemplo mediante inyección en bolo o infusión continua. Cuando el producto es para inyección de infusión, puede tomar la forma de una suspensión, solución o emulsión en un vehículo oleoso o acuoso y puede contener agentes de formulación tales como agentes de suspensión, conservantes, estabilizantes y/o dispersantes. Alternativamente, el anticuerpo o composición puede estar en forma seca, para su reconstitución con un líquido estéril apropiado antes de ser usado.
Se contempla en el presente texto que los usos terapéuticos y de diagnóstico pueden comprender la administración de una cantidad eficaz de un anticuerpo de acuerdo con las realizaciones descritas en este documento, a un sujeto humano. La dosis exacta a administrar variará de acuerdo con el uso del anticuerpo y con la edad, el sexo y el estado del paciente, pero típicamente puede variar de aproximadamente 0,1 mg a 1000 mg, por ejemplo de aproximadamente 1 mg a 500 mg. El anticuerpo puede ser administrado como una dosis única o de manera continua durante un período de tiempo. Las dosis pueden repetirse según se precise.
En un ejemplo, los anticuerpos y composiciones descritos en este documento pueden usarse para administración en cualquier forma y cantidad apropiadas de acuerdo con la terapia en la que se empleen. La dosis a la que se administra el anticuerpo depende de la naturaleza de la afección a tratar y de si el anticuerpo se usa profilácticamente o para tratar una afección existente. La dosis también se seleccionará según la edad y las condiciones del paciente. Una dosis terapéutica de los anticuerpos puede ser en consecuencia, por ejemplo, entre preferiblemente, 0,1 y 25 mg/kg de peso corporal por dosis terapéutica única y lo más preferiblemente entre 0,1 y 10 mg/kg de peso corporal para dosis terapéutica única.
En una realización, cualquier anticuerpo se puede formular de acuerdo con la práctica convencional para la administración por cualquier vía adecuada y generalmente puede estar en forma líquida (por ejemplo, una solución del anticuerpo en un tampón estéril fisiológicamente aceptable) para la administración, por ejemplo, por vía intravenosa, intraperitoneal, subcutánea o intramuscular.
Un "inmunoconjugado" contemplado en el presente texto es un anticuerpo, proteína de fusión o fragmento del mismo, conjugado con al menos un agente terapéutico y/o de diagnóstico/detección. El agente de diagnóstico/ detección puede incluir un radionucleido o no radionucleido, un agente de contraste (como por ejemplo, imágenes de resonancia magnética, tomografía computerizada o ultrasonido), y el radionucleido puede ser un isótopo emisor de radiaciones gamma, beta, alfa, electrones Auger, o positrones.
Como se usa en el presente texto, el término "proteína de fusión de anticuerpos" es una molécula de unión a antígeno producida por vía recombinante en la que están ligados dos o más de los mismos o diferentes segmentos de anticuerpo natural, anticuerpo monocatenario o fragmento de anticuerpo con la misma o distintas especificidades. La valencia de la proteína de fusión indica el número total de brazos o sitios de unión que tiene la proteína de fusión para un antígeno o epítopo; es decir, monovalente, bivalente, trivalente o multivalente. La multivalencia de la proteína de fusión del anticuerpo significa que puede aprovechar múltiples interacciones en la unión con un antígeno, aumentando así la avidez de la unión con el antígeno. La especificidad indica cuántos antígenos o epítopos diferentes puede unir una proteína de fusión de un anticuerpo; es decir, monoespecífico, biespecífico,
triespecífico, multiespecífico. Usando estas definiciones, un anticuerpo natural, p. ej. una IgG, es bivalente porque tiene dos brazos de unión pero es monoespecífico porque se une a un antígeno. Las proteínas de fusión multivalentes monoespecíficas tienen más de un sitio de unión para un epítopo, pero solo se unen con el mismo epítopo en el mismo antígeno, por ejemplo un diacuerpo con dos sitios de unión reactivos con el mismo antígeno. La proteína de fusión puede incluir una combinación multivalente o multiespecífica de diferentes componentes de anticuerpos o copias múltiples del mismo componente de anticuerpo. La proteína de fusión puede incluir adicionalmente un agente terapéutico. Los ejemplos de agentes terapéuticos adecuados para tales proteínas de fusión incluyen inmunomoduladores ("proteína de fusión anticuerpo-inmunomodulador") y toxinas ("proteína de fusión anticuerpo-toxina"). Una toxina preferida comprende una ribonucleasa (RNasa), preferiblemente una RNasa recombinante.
En otra realización, puede conseguirse un enlace selectivo usando un enlazador heterobifuncional tal como el éster de maleimida-hidroxisuccinimida. La reacción del éster con un anticuerpo o fragmento puede derivatizar grupos amina en el anticuerpo o fragmento, y después puede hacerse reaccionar el derivado, por ejemplo, con un fragmento Fab de anticuerpo que tiene grupos sulfhidrilo libres (o un fragmento más grande o anticuerpo intacto con grupos sulfhidrilo anexados al mismo, por ejemplo mediante el reactivo de Traut). Tal enlazador es menos probable que reticule grupos en el mismo anticuerpo y mejora la selectividad del enlace.
En una realización particular, los anticuerpos o fragmentos de la presente invención tal como se definen en las reivindicaciones se pueden ligar en sitios alejados de los sitios de unión con el antígeno. Esto se puede lograr, por ejemplo, mediante la unión a grupos sulfhidrilo intercatenarios escindidos, como se señaló anteriormente. Otro método implica hacer reaccionar un anticuerpo que tiene una porción de carbohidrato oxidada con otro anticuerpo que tiene al menos una función amina libre. Esto da como resultado un enlace inicial de base de Schiff (imina), que se estabiliza preferiblemente por reducción a una amina secundaria, por ejemplo, mediante reducción de borohidruro, para formar el producto final. Tales enlaces específicos del sitio se describen, para moléculas pequeñas, en la patente de EE. UU. nº 4.671.958, y para sumandos mayores en la patente de EE. UU. nº 4.699.784.
Los puentes disulfuro intercatenarios del fragmento F(ab')2 que tienen especificidad por la diana se pueden reducir con cisteína, evitando el enlace de cadena ligera-pesada, para formar fragmentos Fab'-SH. El grupo o grupos SH se pueden activar con un exceso de enlazador de bis-maleimida (1,1'-15 (metilendi-4,1-fenilen) bis-maleimida).
En una realización, los anticuerpos hL243 de la presente invención como se definen en las reivindicaciones, así como otras moléculas de unión con diferentes especificidades, pueden usarse en terapia de combinación. Por ejemplo, los anticuerpos multiespecíficos pueden incluir al menos un sitio de unión a un epítopo reconocido por el anticuerpo monoclonal murino mL243, o antígeno, y al menos un sitio de unión a otro epítopo reconocido por el anticuerpo monoclonal murino mL243, u otro antígeno. Además, los anticuerpos multivalentes (que incluyen múltiples sitios de unión con el mismo epítopo o antígeno), o los anticuerpos pueden ser tanto multivalentes como multiespecíficos.
En una realización particular, una molécula de unión puede ser una proteína de fusión. En otra realización particular, la proteína de fusión puede contener cuatro o más Fvs o Fab’s de anticuerpos L243 humanizados quiméricos humanos o murinos, o fragmentos, como se describe en el presente texto. En otra realización, una proteína de fusión de anticuerpo puede contener uno o más Fvs o Fab’s de los mAbs o fragmentos de un mAb L243 humanizado, quimérico, humano o murino, o fragmento, como se describe en el presente texto. De acuerdo con estas realizaciones, se pueden incluir uno o más Fvs o Fab’s de anticuerpos específicos para otro antígeno que es específico para un marcador celular distinto de un antígeno HLA. Por ejemplo, el antígeno no HLA puede incluir un marcador tumoral seleccionado de un antígeno de linaje de células B (por ejemplo, CD19, CD20 o CD22 para el tratamiento de neoplasias de células B). En otro ejemplo, el antígeno no HLA también se puede expresar en otras células que causan otros tipos de tumores malignos, tales como SI 00 en melanoma, etc. Además, el marcador celular puede ser un antígeno de linaje no de células B, tal como el seleccionado del grupo que consiste en HLA-DR, CD30, CDS3, CD52, CD66, MUC1 y TAC.
En una realización, un anticuerpo L243 de la presente invención como se define en las reivindicaciones puede combinarse con otros anticuerpos y usarse para tratar a un sujeto que tiene, o se sospecha que tiene, una enfermedad. De acuerdo con esta realización, un anticuerpo L243 o una composición del mismo puede combinarse con un anticuerpo monoclonal anticancerígeno tal como un anticuerpo monoclonal humanizado (por ejemplo, hA20 (Mab CD20)) y usarse para tratar el cáncer. En una realización más particular, un anticuerpo HLA-DR de L243 puede combinarse con un anticuerpo monoclonal anticancerígeno (p. ej. hA20) y usarse para tratar a un sujeto sospechoso de desarrollar una enfermedad. Se contempla aquí que puede usarse un anticuerpo hL243 como una composición de anticuerpo separada en combinación con una o más composiciones de anticuerpos separadas, así como también usarse como anticuerpo bifuncional, por ejemplo uno de hL243 y el otro de hA20. De acuerdo con esta realización, el anticuerpo hL243 puede ser el HLA-DR de hL243. En otra realización particular, la enfermedad puede incluir dirigir una enfermedad de malignidad de células B en un sujeto que tiene tal enfermedad. La malignidad de células B puede consistir en formas indolentes de linfomas de células B, formas agresivas de linfomas de células B, leucemias linfáticas crónicas, leucemias linfáticas agudas, macroglobulinemia de Waldenstrom y mieloma múltiple. También hay trastornos de células B no malignas y enfermedades relacionadas, tales como muchas enfermedades autoinmunitarias y desreguladoras del sistema inmune, que incluyen septicemia y choque
séptico entre las enfermedades desreguladoras del sistema inmunológico (véase también la solicitud provisional de los EE. UU. Nº 60/634.076 presentada el 8 de diciembre de 2004, por Goldenberg y Hansen, publicada como documento US 2006/0140936). En particular, las composiciones descritas en el presente texto son particularmente útiles para el tratamiento de diversas enfermedades autoinmunitarias, así como formas indolentes de linfomas de células B, formas agresivas de linfomas de células B, leucemias linfáticas crónicas, leucemias linfáticas agudas, mieloma múltiple y macroglobulinemia de Waldenstrom, así como otras neoplasias hematopoyéticas, como las leucemias mieloides agudas y crónicas y las leucemias y linfomas de células T. Por ejemplo, los componentes del anticuerpo hL243 y los inmunoconjugados se pueden usar preferiblemente para tratar formas tanto indolentes como agresivas de linfoma no Hodgkin y leucemias linfoides.
Los antígenos asociados a un tumor que pueden ser específicos incluyen, pero sin limitarse a ellos, A3, antígeno específico para el anticuerpo A33, antígeno BrE3, CD1, CD1a, CD3, CD5, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD45, CD74, CD79a, CD80, HLA-DR, NCA 95, NCA 90, HCG y sus subunidades, CEA (CEACAM-5), CEACAM-6, CSAp, EGFR, EGP-1, EGP-2, Ep-CAM, Ba 733, HER2/neu, factor inducible por hipoxia (HIF), antígeno KC4, antígeno KS-1, KS1-4, Le-Y, factor de inhibición de macrófagos (MIF), MAGE, MUC1, MUC2, MUC3, MUC4, antígeno PAM-4, PSA, PSMA, RS5, S100, TAG-72, p53, tenascina, IL-6, IL-8, factor de crecimiento de insulina-1 (IGF-1), antígeno Tn, antígenos de Thomson-Friedenreich, antígenos de necrosis tumoral, VEGF, antígeno 17-1A, un marcador de angiogénesis (p. ej., fibronectina ED-B), un marcador oncogénico, un producto oncogénico y otros antígenos asociados a tumores. Los informes recientes sobre antígenos asociados a tumores incluyen Mizukami et al., (2005, Nature Med.11: 992 - 97); Hatfield et al., (2005, Curr. Cancer Drug Targets 5: 229 - 48); Vallbohmer et al. (2005, J. Clin. Oncol.23: 3536-44) y Ren et al. (2005, Ann. Surg.242: 55-63).
Además, otra realización de la presente invención puede incluir anticuerpos biespecíficos o multiespecíficos para preparar inmunoconjugados y composiciones. De acuerdo con estas realizaciones, los anticuerpos L243 o fragmentos o proteínas de fusión de anticuerpos de los mismos, pueden unirse a un anticuerpo o fragmento de anticuerpo específico para una sustancia marcadora de cáncer, un epítopo en la superficie de un organismo patógeno infeccioso o una sustancia nociva en la sangre u otros fluidos corporales. Los anticuerpos biespecíficos y multiespecíficos pueden ser útiles para inducir el aclaramiento de una variedad de sustancias nocivas. Por ejemplo, un anticuerpo biespecífico puede tener una o más especificidades para una sustancia nociva, tal como un organismo patógeno, y una o más especificidades para HLA-DR, la cadena invariante de HLA de clase II (li). La cadena invariante de HLA de clase II (li) se describe en detalle en el documento de EE.UU. nº de serie 09/314.135, presentado el 19 de mayo de 1999, titulado "Therapeutic Using a Bispecific Antibody”.
En otra realización, los inmunoconjugados y las composiciones del presente invención como se definen en las reivindicaciones descritas en el presente texto pueden incluir también un anticuerpo multivalente L243. De acuerdo con esta realización, se puede construir una proteína multivalente de unión con la diana mediante la asociación de un primero y un segundo polipéptidos. El primer polipéptido puede incluir una primera molécula monocatenaria de Fv unida covalentemente a un primer dominio de tipo de la inmunoglobulina que preferiblemente es un dominio de región variable de cadena ligera de inmunoglobulina. El segundo polipéptido puede incluir una segunda molécula de Fv monocatenaria unida covalentemente a un segundo dominio del tipo de la inmunoglobulina que preferiblemente es un dominio de la región variable de la cadena pesada de inmunoglobulina. Cada una de las primera y segunda moléculas Fv monocatenarias forma un sitio de unión de la diana, y el primer y segundo dominios del tipo de la inmunoglobulina se asocian para formar un tercer sitio de unión de la diana.
En una realización alternativa, un anticuerpo monoclonal humanizado, quimérico o humano L243 puede ser usado para producir diacuerpos, triacuerpos y tetracuerpos específicos del antígeno. Por ejemplo, los diacuerpos, triacuerpos y tetracuerpos monoespecíficos pueden unirse selectivamente a antígenos dirigidos y a medida que aumenta el número de sitios de unión en la molécula, aumenta la afinidad por la célula diana y se observa un tiempo de permanencia más largo en la ubicación deseada. Para los diacuerpos se pueden utilizar las dos cadenas que comprenden el polipéptido VH del mAb L243 humanizado conectado con el polipéptido VK del mAb L243 humanizado, por un enlazador de residuo de cinco aminoácidos. Cada cadena forma la mitad del diacuerpo L243 humanizado. En el caso de triacuerpos, se utilizan las tres cadenas que comprenden el polipéptido VH del MAb L243 humanizado conectado al polipéptido VK del MAb L243 humanizado sin enlazador. Cada cadena forma un tercio del triacuerpo hL243.
En otra realización, los inmunoconjugados y las composiciones de la presente invención como se definen en las reivindicaciones pueden incluir también anticuerpos funcionales de cadena única biespecíficos (bscAb) (véase, por ejemplo, Mack et al., Proc. Natal. Acad. Sci. USA, 92: 7021 - 7025, 1995, incorporada al presente texto como referencia). Por ejemplo, el bscAb puede producirse juntando dos fragmentos Fv monocatenarios a través de un enlazador de glicina-serina usando métodos recombinantes. Los dominios V de cadena ligera (VL) y V de cadena pesada (VH) de dos anticuerpos de interés pueden aislarse usando métodos PCR estándar. Los ADNc de VL y VH obtenidos de cada hibridoma se pueden unir para formar un único fragmento monocatenario en una PCR de fusión en dos etapas. En un ejemplo, la primera etapa de la PCR introduce el enlazador (Gly4-Serl)3, y la segunda etapa junta los amplicones VL y VH. Cada molécula de cadena simple puede clonarse en un vector de expresión bacteriano. Después de la amplificación, una de las moléculas monocatenarias puede escindirse y subclonarse en el otro vector, que contiene la segunda molécula monocatenaria de interés. Después, el fragmento bscAb se puede subclonar en un vector de expresión eucariota. La expresión de proteína funcional puede obtenerse transfectando el
vector en células de ovario de hámster chino. Se preparan otras proteínas de fusión biespecíficas de una manera similar. Los anticuerpos monocatenarios biespecíficos y las proteínas de fusión biespecíficas se pueden usar para preparar los vehículos del fármaco.
Además, una realización puede incluir un diacuerpo en tándem tetravalente (denominado “ tandAb”) con doble especificidad (Cochlovius y col., Cancer Research (2000) 60: 4336 -4341). Un tandAb biespecífico es un dímero de dos polipéptidos idénticos, cada uno de los cuales contiene cuatro dominios variables de dos anticuerpos diferentes (VH1, VL1, VH2, VL2) enlazados en una orientación que facilita la formación de dos posibles sitios de unión para cada una de las dos diferentes especificidades en la autoasociación.
En otra realización, puede usarse un anticuerpo L243 multivalente conjugado para preparar el inmunoconjugado o la composición. Se pueden añadir residuos de aminoácidos adicionales al extremo N o C del primer o segundo polipéptido. Los residuos de aminoácidos adicionales pueden comprender una etiqueta peptídica, un péptido señal, una citocina, una enzima (por ejemplo, una enzima activadora pro-fármaco), una hormona, un oligonucleótido, un ARN de interferencia, una toxina peptídica como la exotoxina de pseudomonas, un fármaco peptídico, una proteína citotóxica u otras proteínas funcionales. Como se usa en el presente texto, una proteína funcional es una proteína que tiene una función biológica.
En otra realización más, el anticuerpo hL243, o fragmentos del mismo, puede usarse para preparar un complejo de proteína polivalente, una nueva proteína de fusión con anticuerpo que comprende tres o cuatro sitios de unión con el antígeno. De acuerdo con estas realizaciones, uno o más sitios de unión con el antígeno pueden estar compuestos por los dominios variables hL243, y uno o más de los sitios de unión con el antígeno restantes pueden incluir dominios variables de otros anticuerpos específicos del antígeno, según se desee. Tales complejos de proteína polivalente se describen en la Publicación PCT WO04094613A2 (Rossi et al., 2004). Cuando se combina con una cadena variable de anticuerpo específica del antígeno apropiada, puede usarse un complejo de proteína polivalente que comprende un dominio variable hL243 para tratar una diversidad de trastornos de desregulación neoplásica, infecciosa, metabólica, neurodegenerativa, autoinmunitaria o inmunitaria.
En una realización de la presente invención, fármacos, toxinas, compuestos radioactivos, enzimas, hormonas, proteínas citotóxicas, oligonucleótidos, ARN de interferencia (p. ej. moléculas de ARNi), quelatos, citocinas y otros agentes funcionales, pueden conjugarse con una proteína multivalente de unión con la diana. De acuerdo con estas realizaciones, pueden usarse las uniones covalentes a las cadenas laterales de los restos de aminoácidos de la proteína multivalente de unión con la diana, por ejemplo, grupos amina, carboxilo, fenilo, tiol o hidroxilo. Se pueden usar diversos enlazadores convencionales con este propósito, por ejemplo diisocianatos, diisotiocianatos, ésteres de bis (hidroxisuccinimida), carbodiimidas, ésteres de maleimida-hidroxisuccinimida, glutaraldehído y similares. La conjugación de agentes con la proteína multivalente no afecta preferiblemente de un modo significativo a la especificidad de unión de la proteína o su afinidad por su diana. Como se usa en el presente texto, un agente funcional es un agente que tiene una función biológica. Un agente funcional preferido es un agente citotóxico.
En otras realizaciones más, el suministro, dirigido por anticuerpos biespecíficos, de fármacos o polímeros de profármacos a dianas in vivo, puede combinarse con la administración de radionucleidos de anticuerpos biespecíficos, de manera que se consigue la quimioterapia de combinación y la radioinmunoterapia. Cada agente terapéutico puede conjugarse con un conjugado dirigible y administrarse simultáneamente, o el nucleido puede administrarse como parte de un primer conjugado dirigible y el fármaco administrado en un paso posterior como parte de un segundo conjugado dirigible. Los conjugados y fármacos dirigibles adecuados son conocidos en la técnica.
En otra realización, los agentes citotóxicos pueden conjugarse con un vehículo polimérico, y el vehículo polimérico puede conjugarse posteriormente con la proteína multivalente de unión con una diana. Para este método, véanse Ryser et al, Proc. Natl. Acad. Sci. USA, 75: 3867 - 3870, 1978, patente de EE. UU. nº 4.699.784 y patente de EE. UU. nº 4.046.722. La conjugación preferiblemente no afecta significativamente a la especificidad de unión o afinidad de la proteína multivalente de unión.
Uso de anticuerpos quiméricos y humanos humanizados, para el tratamiento y el diagnóstico.
Los anticuerpos monoclonales humanizados de la presente invención como se definen en las reivindicaciones son adecuados para su uso en los métodos terapéuticos y métodos de diagnóstico que utilizan inmunoconjugados y composiciones como se describe en el presente texto. En consecuencia, los inmunoconjugados o composiciones pueden incluir anticuerpos o anticuerpos humanizados, quiméricos y humanos desnudos, que pueden conjugarse con un vehículo, un agente terapéutico o un agente de diagnóstico. Los inmunoconjugados pueden administrarse como terapia multimodal. Por ejemplo, se pueden administrar agentes terapéuticos o de diagnóstico adicionales antes, simultáneamente o después de la administración del inmunoconjugado o composición. La eficacia de los inmunoconjugados o composiciones puede ser potenciada suplementando los inmunoconjugados o composiciones L243 humanizados, quiméricos y humanos con una o más moléculas de unión (es decir, mAbs contra antígenos específicos, tales como CD4, CDS, CD8, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUC1, MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrosis, PAM-4, KS-1, Le (y), MAGE, la, IL-2, IL-6, tenascina, HM1.24,
VEGF, EGFR, EGP-1, EGP-2, receptor de folato, gonadotropina coriónica humana, antígeno-p específico del colon (CSAp), factor de crecimiento similar a la insulina (ILGF), factor de crecimiento placentario (P1GF), fosfatasa ácida prostática, PSA, PSMA, T101, TAG, TAG-72, Her2/neu, anhidrasa carbónica IX, IL-6, SI00, alfa-fetoproteína, A3, CA125, antígeno carcinoembrionario (CEA), antígenos no específicos de reacción cruzada tales como CD66 (a, b, c, d), MART-1, TRP-1, TRP-2, gplOO, amiloide, con anticuerpos hL243, o inmunoconjugados de los mismos, o anticuerpos contra estos antígenos citados). Los antígenos asociados a las células B preferidos incluyen los equivalentes a los antígenos humanos CD19, CD20, CD21, CD22, CD23, CD46, CD52, CD74, CD80 y CDS. Los antígenos de células T preferidos incluyen aquellos equivalentes a los antígenos humanos CD4, CDS y CD25 (el receptor de IL-2).
Alternativamente, la molécula sustituta para un antígeno HLA-DR puede ser usada en el tratamiento de trastornos tanto de células B como de células T. En una realización particular, los antígenos de células B pueden ser equivalentes a los antígenos humanos CD19, CD22, CD21, CD23, CD74, CD80 y HLA-DR. En otra realización particular, pueden usarse antígenos de células T equivalentes a los antígenos humanos CD4, CDS y CD25. Alternativamente, pueden usarse antígenos CD46 y CD59 en la superficie de las células cancerosas que bloquean la lisis dependiente del complemento (CDC). En una realización, se pueden usar antígenos asociados a un melanoma maligno, tales como el equivalente a MART-1, TRP-1, TRP-2 y gpI00. Además, en una realización particular, los antígenos asociados a un mieloma múltiple son los equivalentes a MUC1, CD38 y CD74.
En un ejemplo, la molécula de unión suplementaria puede estar desnuda o conjugada con un vehículo, un agente terapéutico o un agente de diagnóstico, incluidos lípidos, polímeros, fármacos, toxinas, inmunomoduladores, hormonas, enzimas, oligonucleótidos, ARNs de interferencia y radionucleidos terapéuticos, etc. De acuerdo con esta realización, la molécula de unión suplementaria puede administrarse concurrentemente, secuencialmente, o de acuerdo con un régimen de dosificación prescrito, con los inmunoconjugados o composiciones de L243 humanizado, quimérico y humano.
Además, se contempla en este documento la administración de un inmunoconjugado o composición para usos diagnósticos y terapéuticos en linfomas de células B, linfomas de células T y otras enfermedades o trastornos. Un inmunoconjugado, como se describe en este documento, puede ser una molécula que incluye una molécula de unión conjugada con un vehículo. De acuerdo con esta realización, el inmunoconjugado puede usarse para formar una composición que incluye además un agente terapéutico o de diagnóstico, que puede incluir un péptido que puede llevar el agente de diagnóstico o terapéutico. Un inmunoconjugado conserva la inmunorreactividad de la molécula de unión (es decir, el resto de anticuerpo tiene aproximadamente la misma capacidad o una capacidad ligeramente reducida de unirse al antígeno cognado después de la conjugación como antes de la conjugación). Los inmunoconjugados pueden incluir moléculas de unión conjugadas con cualquier segunda molécula adecuada (por ejemplo, lípidos, proteínas, carbohidratos, que pueden formar estructuras más ordenadas, o las propias estructuras más ordenadas, tales como liposomas, micelas y/o nanopartículas). Para facilitar el suministro de ciertos efectores, puede ser deseable conjugar el anticuerpo hL243 con una o más moléculas que son capaces de formar estructuras más ordenadas (por ejemplo, lípidos anfifílicos). Las moléculas anfifílicas también pueden ser deseables para facilitar el suministro de efectores que demuestran solubilidad limitada en solución acuosa.
En otra realización, se puede usar una amplia variedad de reactivos de diagnóstico y terapéuticos para formar los inmunoconjugados y las composiciones como se describe en este documento. Los agentes terapéuticos incluyen, por ejemplo, fármacos quimioterapéuticos tales como alcaloides de la vinca, antraciclinas, epidofilotoxinas, taxanos, antimetabolitos, agentes de alquilación, antibióticos, inhibidores de Cox-2, agentes antimitóticos, antiangiogénicos y apoptóticos, particularmente doxorrubicina, metotrexato, taxol, CPT-11, camptotecanos, y otros de estas y otras clases de agentes anticancerosos, y similares. Otros fármacos quimioterapéuticos útiles para el cáncer para la preparación de inmunoconjugados y proteínas de fusión de anticuerpos incluyen las mostazas nitrogenadas, sulfonatos de alquilo, nitrosoureas, triazenos, análogos de ácido fólico, inhibidores de COX-2, análogos de pirimidina, análogos de purina, complejos de coordinación de platino, hormonas y similares. Los agentes quimioterapéuticos adecuados se describen en Remington's Pharmaceutical Sciences, 19ª ed. (Mack Publishing Co.
1995), y en The Pharmacological Basis of Therapeutics, 7ª ed. (MacMillan Publishing Co. 1985) de Goodman y Oilman, así como ediciones revisadas de estas publicaciones. Se pueden usar otros agentes quimioterapéuticos adecuados, tales como fármacos experimentales, y se conocen en la técnica.
Adicionalmente, en otra realización, un quelante tal como DTPA, DOTA, TETA o NOTA se puede conjugar con uno o más componentes de las composiciones como se describe en el presente texto. Alternativamente, un péptido adecuado que incluye un marcador detectable (por ejemplo, una molécula fluorescente) o un agente citotóxico (por ejemplo, un metal pesado o un radionucleido), puede estar asociado covalentemente, no covalentemente, o de otro modo, con más componentes de las composiciones como se describe en el presente texto. Por ejemplo, se puede obtener un inmunoconjugado terapéuticamente útil incorporando un agente o colorante fotoactivo en la composición como se describe en este documento. Las composiciones fluorescentes, tales como el fluorocromo y otros cromógenos o colorantes, tales como las porfirinas sensibles a la luz visible, se han usado para detectar y tratar lesiones dirigiendo la luz adecuada a la lesión. En terapia, esto se ha denominado fotorradiación, fototerapia o terapia fotodinámica (Jori et al. (Eds.), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985), van den Bergh, Chem. Britain 22: 430 (1986)). Además, los anticuerpos monoclonales han sido acoplados con colorantes fotoactivados para lograr la fototerapia. Mew y col., J. Immunol. 130: 1473 (1983);
idem., Cancer Res. 45: 4380 (1985); Oseroff et al., Proc. Natl. Acad. Sci. 83: 8744 (1986); idem., Photochem. Photobiol.46: 83 (1987); Hasan y otros, Prog. Clin. Biol. Res.288: 471 (1989); Tatsuta et al., Lasers Surg. Med.9: 422 (1989); Pelegrin et al., Cancer 67: 2529 (1991). También se contemplan aplicaciones endoscópicas. Los métodos endoscópicos de detección y terapia se describen en las patentes de EE. UU. números 4.932.412; 5.525.338; 5.716.595; 5.736.119; 5.922.302; 6.096.289; y 6.387.350.
En una realización, se contempla que el uso terapéutico de composiciones de inmunoconjugados hL243 que comprenden agentes fotoactivos o colorantes, y los métodos diagnóstico/terapéuticos descritos, pueden incluir el uso diagnóstico o terapéutico de composiciones de inmunoconjugado de hL423 que comprenden agentes fotoactivos o colorantes. El inmunoconjugado puede contener también agentes de ultrasonidos de los tipos discutidos anteriormente. También se contempla el uso de agentes radiactivos y no radiactivos como agentes de diagnóstico en las composiciones de inmunoconjugado L423 humanizado, quimérico y humano, como se describe en el presente texto. Un agente de diagnóstico no radiactivo adecuado es un agente de contraste adecuado para formación de imágenes de resonancia magnética, tomografía computerizada o ultrasonidos. Los agentes de formación de imágenes magnéticas incluyen, por ejemplo, metales no radioactivos tales como manganeso, hierro y gadolinio, complejados con combinaciones de metal-quelato que incluyen 2-bencil-DTPA y sus análogos de monometilo y ciclohexilo, cuando se usan junto con los anticuerpos descritos en el presente texto (véase el documento U.S. Serial nº 09/921.290 presentado el 10 de octubre de 2001, publicado como documento US 2002/0041847.
En otra realización, una composición de inmunoconjugado L423 humano, quimérico y humanizado puede incluir un radioisótopo o un emisor de positrones útil para la formación de imágenes de diagnóstico. Los radioisótopos adecuados pueden incluir los que están en el margen de energía de 60 a 4.000 keV. Los radioisótopos adecuados pueden incluir 18-F, 52-Fe, 62-Cu, 64-Cu, 67-Cu, 67-Ga, 68-Ga, 86-Y, 89-Zr, 94-Tc, 94m-Tc, 99m-Tc, 111-In, 123-I,124-I,125-I, 131-I, y similares (véase, por ejemplo, la solicitud de patente de EE. UU. titulada "Labeling Targeting Agents with Gallium-68), inventores G. L. Griffiths y W. J. McBride (solicitud provisional de Estados Unidos No.
60/342.104 publicada como US 2003/0176784, que describe emisores de positrones, tales como 18-F, 68-Ga, 94m-Tc y similares para fines de obtención de imágenes).
En otra realización de la presente invención, una toxina, tal como la exotoxina de Pseudomonas, puede estar presente en los anticuerpos L243 humanizados, quiméricos y humanos, o inmunoconjugados o composiciones de los mismos como se describe en el presente texto. Por ejemplo, la toxina puede complejarse o formar la porción de agente terapéutico de una proteína de fusión con anticuerpo, de un anticuerpo hL243 descrito en este documento. Otras toxinas incluyen ricina, abrina, ribonucleasa (RNasa), ADNasa I, enterotoxina A estafilocócica, proteína antiviral de hierba carmín, gelonina, toxina diftérica, exotoxina de Pseudomonas y endotoxina de Pseudomonas (véase, por ejemplo, Pastan et al., Cell 47: 641 (1986), y Goldenberg, CA - A Cancer Journal for Clinicians 44: 43 (1994). Toxinas adicionales adecuadas para su uso en la presente memoria son conocidas por los expertos en la técnica y se describen en la patente de EE. UU. nº 6.077.499).
Alternativamente, también puede estar presente un inmunomodulador, tal como una citocina, en las composiciones de inmunoconjugado hL423 administradas de la invención, como se define en las reivindicaciones. Por ejemplo, un inmunomodulador se puede conjugar con, o formar la porción de agente terapéutico de una proteína de fusión de anticuerpo o ser administrado como parte de las composiciones de inmunoconjugado de L423 humana, quimérica y humanizada como se describe en este documento. Las citocinas adecuadas incluyen, pero sin limitarse a ellas, interferones e interleucinas, como se describe a continuación.
En una realización, un anticuerpo L243 humanizado de la invención como se define en las reivindicaciones puede usarse como parte de la premarcación ( pretargeting), una alternativa no inmunogénica altamente selectiva para aplicaciones de diagnóstico y terapéuticas, en las que se emplea un anticuerpo biespecífico que reconoce conjuntamente un antígeno tumoral y uno o más haptenos en una molécula transportadora, donde la molécula transportadora puede incluir una molécula efectora. Los anticuerpos biespecíficos (bsAb) tienen la ventaja de que pueden ser diseñados como proteína humanizada relativamente no inmunogénica. La afinidad de unión de un bsAb puede depender de la afinidad de unión del agente de direccionamiento primario. Usando un péptido divalente, se puede lograr un aumento de la afinidad, que puede mejorar en gran medida la unión del péptido con el sitio diana en comparación con un péptido monovalente. Véase, por ejemplo, la patente de EE. UU. nº 5.256.395. En una realización, la premarcación con un hL243 bsAb puede incluir un brazo del bsAb derivado de las regiones variables de un anticuerpo hL243 como se describe en el presente texto, y el segundo brazo del anticuerpo que reconoce un resto que contiene un agente de diagnóstico o terapéutico (por ejemplo, un transportador con un agente de diagnóstico o terapéutico juntos como una "construcción dirigible"). Construcciones dirigibles adecuadas y métodos de uso se describen en la solicitud de patente de EE. UU. 20050002945. La construcción dirigible puede ser, por ejemplo, (i) DOTA-Phe-Lys (HSG)-D-Tyr-Lys (HSG)-NH 2; (ii) DOTA-Phe-Lys(HSG)-Tyr-Lys- (HSG) -NH 2; o (iii) Ac-Lys (HSG) D-Tyr-Lys (HSG) - Lys (Tscg-Cys)-NH2, aunque el experto en la materia apreciará que pueden usarse otras construcciones dirigibles. En otros sistemas, la construcción dirigible comprende un resto hapténico que es reconocido por el segundo brazo del anticuerpo y un agente terapéutico o de diagnóstico. Por ejemplo, un agente terapéutico puede ser un agente quimioterapéutico o una toxina, tal como los descritos anteriormente.
Una realización particular incluye un sistema de premarcación descrito por Janevik-Ivanovska et al., que usa un
anticuerpo dirigido contra un derivado de histamina, histamina-succinil-glicilo (HSG), como sistema de reconocimiento en el que se podrían preparar una variedad de sustancias efectoras. Los anticuerpos L243 humanizados de la presente invención se pueden usar en tal sistema. Este sistema de premarcación representa una ventaja significativa sobre otros sistemas de premarcación ya que se puede usar con una variedad de diferentes agentes de formación de imágenes o terapéuticos. En un ejemplo, este sistema puede basarse en el uso de un anticuerpo dirigido contra DTP A o HSG y el desarrollo de péptidos que contienen el resto de DTPA o HSG. Los péptidos que contienen DTPA y/o que contienen HSG pueden sintetizarse y, cuando el péptido contiene DTPA, dicho péptido puede marcarse con nucleidos quelados, tales como In, Y o Lu, que pueden ser útiles en terapia o diagnóstico. Se han generado anticuerpos contra el resto DTPA-In. En otras realizaciones, el sistema incluye p ‘’’éptid 1o7s7 de haptenos y/o quelantes tales como DTPA, y que pueden ser adecuados para el radiomarcaje con 90Y, In, y Lu, así como 99mTc.
Preparación de inmunoconjugados.
Los inmunoconjugados descritos en el presente texto se pueden preparar por métodos conocidos para unir anticuerpos con lípidos, carbohidratos, proteínas u otros átomos y moléculas. Por ejemplo, las moléculas de unión descritas en el presente texto pueden conjugarse con uno o más de los vehículos descritos en la presente memoria (por ejemplo, lípidos, polímeros, liposomas, micelas o nanopartículas) para formar un inmunoconjugado, y el inmunoconjugado puede incorporar un agente terapéutico o de diagnóstico, bien sea covalentemente, no covalentemente, o de alguna otra forma. Además, cualquiera de las moléculas de unión descritas en este documento puede conjugarse con uno o más agentes terapéuticos o de diagnóstico descritos en la presente memoria, o vehículos adicionales. Generalmente, un agente terapéutico o de diagnóstico se puede unir a cada molécula de unión, pero más de un agente terapéutico o agente de diagnóstico se puede unir a la misma molécula de unión. En una realización, las proteínas de fusión de anticuerpos contempladas en el presente texto pueden incluir dos o más anticuerpos o fragmentos de las mismas y cada uno de los anticuerpos que incluyen esta proteína de fusión puede conjugarse con uno o más de los vehículos descritos en la presente memoria. Adicionalmente, uno o más de los anticuerpos de la proteína de fusión de anticuerpo pueden tener uno o más agentes terapéuticos o de diagnóstico unidos. Además, no es necesario que el agente terapéutico sea el mismo, sino que pueden ser agentes terapéuticos diferentes. Por ejemplo, las composiciones descritas en este documento pueden incluir un fármaco y un radioisótopo.
En un ejemplo, una IgG puede marcarse radiactivamente con 131I y conjugarse con un lípido, de modo que el conjugado IgG-lípido pueda formar un liposoma. De acuerdo con este ejemplo, el liposoma puede incorporar uno o más agentes terapéuticos o de diagnóstico, (p. ej. un fármaco tal como FUdR-dO). Alternativamente, además del vehículo, la IgG puede conjugarse con 131-I (por ejemplo, en un resto de tirosina) y un fármaco (por ejemplo, en el grupo épsilon amino de un resto de lisina), y el vehículo puede incorporar un agente terapéutico o agente de diagnóstico adicionales. Los agentes terapéuticos y de diagnóstico pueden estar asociados covalentemente con la molécula de unión, (por ejemplo, conjugados con grupos disulfuro reducidos, cadenas laterales de carbohidrato, o cualquier otro grupo reactivo de la molécula puente.
En otra realización, se puede unir un vehículo, un agente terapéutico o un agente de diagnóstico en la región bisagra de un componente de anticuerpo reducido a través de la formación de un enlace disulfuro. Como alternativa, los péptidos se pueden unir a un componente de anticuerpo usando un agente de entrecruzamiento heterobifuncional, tal como N-succinil 3-(2-piridilditio) propionato (SPDP). Yu et al., Int. J. Cancer 56: 244 (1994). Las técnicas generales para tal conjugación son bien conocidas en la técnica (véanse, por ejemplo, Wong, Chemistry of Protein Conjugation and Cross-linking (CRC Press 1991); Upeslacis et al., "Modification of Antibodies by Chemical Methods", en Monoclonal Antibodies Principles and Applications, Birch et al. (eds), páginas 187D230 (Wiley-Liss, Inc. 1995); Price, "Production and Characterization of Synthetic Peptide-Derived Antibodies” en Monoclonal Antibodies: Production, Engineering and Clinical Application, Ritter et al. (eds.), páginas 60D84 (Cambridge University Press 1995)). Alternativamente, el vehículo, agente terapéutico o agente de diagnóstico se puede conjugar a través de un resto de hidrato de carbono en la región Fc de un anticuerpo. El grupo carbohidrato puede usarse para aumentar la carga del mismo péptido que está unido a un grupo tiol, o el resto de hidrato de carbono puede usarse para unirse a un péptido diferente.
El método para conjugar péptidos con componentes de anticuerpo a través de un resto de carbohidrato de anticuerpo es bien conocido por los expertos en la técnica (véanse, por ejemplo, Shih et al., Int. J. Cancer 41: 832 (1988); Shih et al., Int. J. Cancer 46: 1101 (1990); y Shih et al., patente de EE. UU. nº 5.057.313). Se puede usar una química similar para conjugar uno o más anticuerpos hL243, o sus componentes, con uno o más vehículos, agentes terapéuticos o agentes de diagnóstico. En una realización, un método general implica hacer reaccionar un componente de anticuerpo que tiene una porción de carbohidrato oxidada con un polímero vehículo que tiene al menos una función amina libre y que está cargado con diversos péptidos. Esta reacción da como resultado un enlace de base de Schiff inicial (imina), que se puede estabilizar por reducción a una amina secundaria para formar el conjugado final.
En una realización, la región Fc puede estar ausente, por ejemplo, si la molécula de unión con hL423 es un fragmento de anticuerpo. Alternativamente, se puede introducir un resto de carbohidrato en la región variable de la cadena ligera de un anticuerpo de longitud completa o fragmento de anticuerpo (véanse, por ejemplo, Leung et al., J.
Immunol., 154: 5919 (1995); Hansen et al., patente de EE. UU. nº 5.443.953 (1995), Leung et al., patente de EE. UU. nº 6.254.868). De acuerdo con estas realizaciones, el resto de carbohidrato modificado por ingeniería genética puede usarse para unir un vehículo portador, o un agente terapéutico o de diagnóstico.
Vehículos (lípidos, liposomas, micelas, polímeros y nanopartículas).
Puede usarse cualquier método para la formación de liposomas y micelas, y son conocidos en la técnica (véanse, p. ej., Wrobel et al., Biochimica et Biophysica Acta, 1235: 296 (1995); Lundberg et al., J. Pharm. Pharmacol., 51: 1099 -1105 (1999); Lundberg et al., Int. J. Pharm., 205: 101 - 108 (2000); Lundberg, J. Pharm. Sci., 83: 72 - 75 (1994); Xu et al., Molec. Cancer Then, 1: 337 - 346 (2002); Torchilin y otros, Proc. Nat'l. Acad. Sci. USA, 100: 6039 - 6044 (2003); documento U. S.5.565.215; documento U. S.6.379.698; y documento U. S.2003/0082154). Se han descrito nanopartículas o nanocápsulas formadas a partir de polímeros, sílice o metales, que se consideran en la presente memoria para el suministro de fármacos o la formación de imágenes (véanse, p. ej., West et al., Applications of Nanotechnology to Biotechnology, 11: 215 - 217 (2000), documento US 5.620.708, documento US 5.702.727 y documento US 6.530.944).
Inmunoliposomas.
Se han descrito algunos métodos para conjugar anticuerpos o moléculas de unión con liposomas para formar un vehículo dirigido para agentes terapéuticos o de diagnóstico (véanse, p. ej., Bendas, Biodrugs, 15: 215 - 224 (2001); Xu et al., Molec. Cancer Ther., 1: 337 - 346 (2002); Torchilin et al., Proc. Natl. Acad. Sci., 100: 6039 - 6044 (2003); Bally, et al., J. Liposome Res., 8: 299 - 335 (1998); Lundberg, Int. J. Pharm., 109: 73 - 81 (1994); Lundberg, J. Pharm. Pharmacol., 49: 16 - 21 (1997); Lundberg, Anti - Cancer Drug Design, 13: 453 - 461 (1998)). Véanse también el documento U.S. 6.306.393; documento U.S. nº de serie 10/350.096; documento U.S. nº de serie 09/590.284, y documento U.S. nº de serie 60/138.284, presentado el 9 de junio de 1999 y publicado como US 2002/0133930 y US 7.074.403.
Excipientes farmacéuticamente aceptables.
En una realización, los inmunoconjugados o composiciones pueden incluir uno o más excipientes adecuados farmacéuticamente, uno o más ingredientes adicionales o una combinación de los mismos.
En otra realización, el inmunoconjugado o composiciones de la presente invención como se define en las reivindicaciones se pueden formular de acuerdo con métodos conocidos para preparar composiciones útiles farmacéuticamente, en las que el inmunoconjugado o las composiciones se combinan en una mezcla con un excipiente farmacéuticamente adecuado. La solución salina tamponada con fosfato estéril es un ejemplo de excipiente farmacéuticamente adecuado. Otros excipientes adecuados son bien conocidos por los expertos en la técnica (véanse, por ejemplo, Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 5ª ed. (Lea y Febiger 1990), y Gennaro (ed), Remington's Pharmaceutical Sciences, 18ª edición (Mack Publishing Company 1990), y ediciones revisadas de las mismas.
En otra realización, el inmunoconjugado o composiciones de la presente invención tal como se definen en las reivindicaciones pueden formularse para administración intravenosa mediante, por ejemplo, inyección en bolo o infusión continua.
Las formulaciones para inyección pueden presentarse, por ejemplo, en forma de dosificación unitaria, por ejemplo en ampollas o en recipientes de multidosis, con un conservante añadido. Las composiciones pueden adoptar formas tales como suspensiones, soluciones o emulsiones en vehículos aceitosos o acuosos, y pueden contener agentes de formulación tales como agentes de suspensión, estabilizantes y/o dispersantes. Alternativamente, el ingrediente activo puede estar en forma de polvo para su constitución con un vehículo adecuado, por ejemplo, agua estéril libre de pirógenos, antes de su uso. Se pueden emplear métodos farmacéuticos adicionales para controlar la duración de la acción del conjugado terapéutico, de diagnóstico o anticuerpo desnudo. Por ejemplo, los preparados de liberación controlada pueden obtenerse mediante el uso de polímeros para complejar o adsorber el inmunoconjugado o el anticuerpo desnudo. En un ejemplo, los polímeros biocompatibles incluyen matrices de poli (etileno-co-acetato de vinilo) y matrices de un copolímero de polianhídrido de un dímero de ácido esteárico y ácido sebácico. Sherwood et al., Bio/Technology 10: 1446 (1992). Algunas de las velocidades de liberación de un inmunoconjugado o anticuerpo de dicha matriz dependen del peso molecular del inmunoconjugado o anticuerpo, la cantidad de inmunoconjugado, el anticuerpo dentro de la matriz y el tamaño de las partículas dispersas. Saltzman y otros, Biophys. J. 55: 163 (1989); Sherwood et al., supra. Otras formas de dosificación sólidas se describen en Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 5ª edición (Lea & Febiger 1990), y Gennaro (ed), Remington's Pharmaceutical Sciences, 18ª edición (Mack Publishing Company 1990), y ediciones revisadas de los mismos. En una realización, el inmunoconjugado o composiciones pueden ser también administradas a un mamífero por vía subcutánea o incluso por otras rutas parenterales. Además, la administración puede ser por infusión continua o mediante bolos únicos o múltiples. En un ejemplo, la dosificación de un inmunoconjugado, proteína de fusión o anticuerpo desnudo administrado para seres humanos variará dependiendo de factores tales como la edad, el peso, la altura, el sexo, el estado general y el historial médico previo del paciente, etc. En una realización particular, se puede administrar al receptor una dosis de inmunoconjugado o composición que incluye el inmunoconjugado que
está en el intervalo de aproximadamente 1 mg/kg a mg/kg como una única infusión intravenosa, aunque también se puede administrar una dosificación inferior o superior según las circunstancias. Esta dosificación puede repetirse según sea necesario, por ejemplo, una vez por semana durante 4 a 10 semanas, preferiblemente una vez por semana durante 8 semanas, y más preferiblemente, una vez por semana durante 4 semanas. También se puede administrar con menos frecuencia, como cada dos semanas durante varios meses. La dosificación puede administrarse a través de varias rutas parenterales, con el ajuste apropiado de la dosis y el programa.
En una realización, para fines terapéuticos, el inmunoconjugado, o la composición que incluye el inmunoconjugado, se administra a un mamífero en una cantidad terapéuticamente eficaz. Un sujeto adecuado para los métodos terapéuticos y de diagnóstico descritos en la presente memoria puede ser un ser humano, aunque también se contempla un sujeto animal no humano.
En un ejemplo, se dice que un preparado de anticuerpo se administra en una "cantidad terapéuticamente efectiva" si la cantidad administrada es fisiológicamente significativa. Un agente es fisiológicamente significativo si su presencia da como resultado un cambio detectable en la fisiología de un mamífero receptor. En particular, un preparado de anticuerpo es fisiológicamente significativo si su presencia atrae una respuesta antitumoral o mitiga los signos y síntomas de un estado patológico autoinmunitario. Un efecto fisiológicamente significativo también podría ser la inducción de una respuesta inmunitaria humoral y/o celular en el mamífero receptor.
Métodos de tratamiento usando composiciones que incluyen anticuerpos L243 humanizados, quiméricos y humanos. En una realización, las enfermedades inmunológicas que pueden tratarse con los anticuerpos de la presente invención pueden incluir, por ejemplo, enfermedades articulares tales como espondilitis anquilosante, artritis reumatoide juvenil, artritis reumatoide; enfermedades neurológicas tales como esclerosis múltiple y miastenia gravis; enfermedades pancreáticas tales como diabetes, especialmente diabetes de inicio juvenil; enfermedades del tracto gastrointestinal tales como hepatitis activa crónica, enfermedad celíaca, colitis ulcerosa, enfermedad de Crohn, anemia perniciosa; enfermedades de la piel tales como psoriasis o esclerodermia; enfermedades alérgicas tales como asma y en condiciones relacionadas con trasplantes, tales como la enfermedad de injerto contra huésped y rechazo de aloinjerto.
En otra realización de la presente invención, se proporcionan composiciones y métodos que pueden incluir los anticuerpos descritos aquí, o inmunoconjugados de los mismos, para tratar una enfermedad o trastorno autoinmunitario. La inmunoterapia de trastornos autoinmunes que usan anticuerpos que se dirigen a las células B se describe en la publicación de solicitud PCT nº WO 00/74718. Entre los ejemplos de enfermedades autoinmunitarias se incluyen la púrpura trombocitopénica idiopática aguda, púrpura trombocitopénica idiopática crónica, dermatomiositis, corea de Sydenham, miastenia gravis, lupus eritematoso sistémico, nefritis lúpica, fiebre reumática, síndromes poliglandulares, penfigoide bulloso, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis postestreptocócica, eritema nodoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, esclerosis múltiple, sarcoidosis, colitis ulcerosa, eritema multiforme, nefropatía por IgA, poliarteritis nodosa, espondilitis anquilosante, síndrome de Goodpasture, tromboangitis obliterante, síndrome de Sjogren, cirrosis biliar primaria , tiroiditis de Hashimoto, tirotoxicosis, esclerodermia, hepatitis activa crónica, polimiositis/dermatomiositis, policondritis, pénfigo vulgar, granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsal, arteritis/polimialgia de células gigantes, anemia perniciosa, glomerulonefritis rápidamente progresiva, psoriasis y alveolitis fibrosante.
En otra realización de la presente invención, las composiciones y su uso se proporcionan para tratar un trastorno seleccionado entre el grupo que consiste en carcinoma, sarcoma, glioma, linfoma, leucemia o cáncer de piel. El carcinoma se puede seleccionar del grupo que consiste en cáncer de piel, esófago, gástrico, colon, rectal, páncreas, pulmón, pecho, ovario, vejiga urinaria, endometrio, cervical, testicular, renal, suprarrenal o cáncer de hígado. La enfermedad relacionada con células B puede ser una forma indolente de linfoma de células B, una forma agresiva de linfoma de células B, linfoma no Hodgkin, leucemia linfocítica crónica, leucemia linfocítica aguda, macroglobulinemia de Waldenstrom o mieloma múltiple. Además, la enfermedad relacionada con células B puede ser una enfermedad de tipo humano o veterinario. Por otra parte, una enfermedad relacionada con células T puede incluir una leucemia o linfoma de células T humano o de otro mamıfero, psoriasis cutánea, artritis psoriásica o micosis fungoide. En un ejemplo, la enfermedad metabólica puede ser una amiloidosis. En un ejemplo, la enfermedad neurodegenerativa puede ser la enfermedad de Alzheimer.
También, se contempla aquí en una realización de la invención el uso de los anticuerpos, entre los que se incluyen inmunoconjugados, como una composición para el tratamiento de cualquiera de las siguientes enfermedades o trastornos, donde la enfermedad o el trastorno se selecciona del grupo que consiste en una enfermedad de desregulación inmunitaria, una enfermedad autoinmunitaria, rechazo de injerto de órgano, enfermedad de injerto contra huésped, enfermedad metabólica (por ejemplo, amiloidosis) y enfermedad neurodegenerativa (p. ej., enfermedad de Alzheimer). La enfermedad o trastorno maligno se selecciona entre el grupo que consiste en un tumor sólido, un tumor hematopoyético (linfoma, leucemia, mieloma y similares). El tumor sólido se selecciona entre el grupo que consiste en melanoma, carcinoma y sarcoma, y el carcinoma se selecciona entre el grupo que consiste en carcinoma renal, carcinoma de mama, carcinoma de pulmón, carcinoma gastrointestinal y carcinoma urogenital. La malignidad de células B se selecciona entre el grupo que consiste en formas indolentes de linfomas de células B,
formas agresivas de linfomas de células B, leucemias linfáticas crónicas, leucemias linfáticas agudas, macroglobulinemia de Waldenstrom y mieloma múltiple. También hay trastornos de células B no malignas y enfermedades relacionadas, tales como muchas enfermedades autoinmunitarias y desreguladoras del sistema inmunitario, incluida la septicemia y el choque séptico entre las enfermedades desreguladoras inmunitarias (una lista de enfermedades inmunorreguladoras puede encontrarse de manera más extensa en la solicitud provisional de EE. UU. nº 60/634.076 presentada el 8 de diciembre de 2004, por Goldenberg y Hansen, publicada como US 2006/ 0140936). En particular, las composiciones descritas en el presente texto son particularmente útiles para el tratamiento de diversas enfermedades autoinmunitarias, así como formas indolentes de linfomas de células B, formas agresivas de linfomas de células B, leucemias linfáticas crónicas, leucemias linfáticas agudas, mieloma múltiple y macroglobulinemia de Waldenstrom, así como otras metástasis hematopoyéticas, como las leucemias mieloides agudas y crónicas y las leucemias y linfomas de células T. Por ejemplo, los componentes y los inmunoconjugados de anticuerpo hL243 se pueden utilizar preferiblemente para tratar tanto formas indolentes y agresivas de linfoma no Hodgkin como de leucemias linfoides.
En otra realización, los anticuerpos L243 humanizados, quiméricos y humanos de la presente invención pueden usarse para tratar las enfermedades y trastornos antes mencionados, según corresponda, en todos los mamíferos, incluyendo los seres humanos, y mamíferos domésticos, que incluyen, pero sin limitarse a ellos, perros, gatos, caballos y ganado.
En una realización particular de la invención como se define en las reivindicaciones, el método para tratar un tumor maligno de células B puede incluir administrar a un sujeto con un tumor maligno relacionado con células B una composición terapéutica que incluye un vehículo farmacéuticamente aceptable, un agente terapéutico y un inmunoconjugado que incluye un anticuerpo L243, o un componente del mismo (p. ej., un anticuerpo humanizado, quimérico o humano L243 o un fragmento del mismo o proteína de fusión de anticuerpo del mismo), en el que la malignidad de células B es un linfoma o leucemia. Más específicamente, la malignidad de células B es formas indolentes de linfomas de células B, formas agresivas de linfomas de células B, mieloma múltiple, leucemias linfáticas crónicas o leucemias linfáticas agudas. En una realización más particular, un inmunoconjugado o composición que incluye el inmunoconjugado se puede administrar por vía intravenosa o intramuscular a una dosis de aproximadamente 20 - 2000 mg que incluye además administrar el inmunoconjugado o la composición antes, simultáneamente o después de la administración de al menos un agente terapéutico o agente de diagnóstico adicional usado para detectar o tratar la malignidad de células B. Por ejemplo, un agente adicional puede incluir un inmunoconjugado adicional como se describe en el presente texto, que incluye un agente terapéutico o de diagnóstico. De acuerdo con estas realizaciones, un agente terapéutico puede incluir un anticuerpo desnudo, un inmunomodulador, una hormona, un agente citotóxico, una enzima y/o un anticuerpo conjugado con al menos un inmunomodulador, marcador radioactivo, hormona, enzima, oligonucleótido, ARN de interferencia o agente citotóxico, o una combinación de los mismos. En un ejemplo particular, un inmunomodulador puede ser una citocina y el agente citotóxico puede ser un fármaco o una toxina. En una realización más particular, un anticuerpo que puede administrarse en combinación como un anticuerpo desnudo o como un inmunoconjugado suplementario reacciona preferiblemente con CD4, CDS, CDS, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CD138, CD154, B7, MUC1, MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrosis, PAM-4, KS-1, 90 Le (y), MAGE, la, IL-2, IL-6, tenascina, HM1.24, VEGF, EGFR, EGP-1, EGP-2, receptor de folato, gonadotropina coriónica humana, CEA, antígeno-p específico del colon (CSAp), factor de crecimiento similar a la insulina (ILGF), factor de crecimiento placentario (P1GF), fosfatasa ácida prostática, PSA, PSMA, T101, TAG, TAG-72, Her2/neu, anhidrasa carbónica IX, IL-6, SI00, alfa fetoproteína, A3, CA125, antígeno carcinoembrionario (CEA), antígenos de reacción cruzada no específicos tales como CD66 (a, b, c, d), MART-1, TRP-1, TRP-2, amiloide, o gp100.
También se contempla en el presente texto que un tratamiento de un tumor maligno puede incluir administrar a un sujeto con un tumor maligno distinto del linfoma o la leucemia, una composición terapéutica que puede incluir: (1) un anticuerpo hL243, o un inmunoconjugado del mismo, y un vehículo; (2) un efector; y (3) un excipiente aceptable farmacéuticamente. La composición puede ser administrada por vía intravenosa o intramuscular a una dosis de 20 -2000 mg. Además, la composición se puede administrar antes, simultáneamente o después de la administración de al menos un agente terapéutico o un agente de diagnóstico adicional. Los agentes terapéuticos, como se describió anteriormente y a lo largo de la memoria descriptiva, pueden incluir un inmunomodulador, una hormona, un agente citotóxico o una molécula de unión (ya sea desnuda o conjugada con al menos un inmunomodulador, marcador radioactivo, enzima, hormona, agente citotóxico, oligonucleótido antisentido, ARN de interferencia, o una combinación de los mismos, donde el inmunomodulador es preferiblemente una citocina y el agente citotóxico es preferiblemente un fármaco o toxina). Un agente terapéutico o agente de diagnóstico puede incluir las composiciones o inmunoconjugados como se describe en este documento. En una configuración en particular, un anticuerpo puede administrarse en combinación con la composición terapéutica y/o diagnóstica para tratar un tumor maligno que no es un tumor de células B, sino que es probable que reaccione con un marcador distinto al reconocido por el anticuerpo hL243, que se expresa mediante las células que comprenden el tumor maligno que se trata, y el anticuerpo debe formularse en un vehículo farmacéuticamente aceptable. Los ejemplos de anticuerpos que pueden administrarse para antígenos asociados a melanoma maligno son los anticuerpos reactivos con MART-1, TRP-1, TRP-2 y gp100. Además, los anticuerpos preferidos contra antígenos asociados a mieloma múltiple incluyen los reactivos con MUC1, CD74 y CD38. Las composiciones para el tratamiento pueden contener el
anticuerpo WL243, o inmunoconjugados del mismo, solos o en combinación con otros anticuerpos, tales como otros anticuerpos humanizados, quiméricos o humanos.
En una realización, las composiciones pueden incluir un inmunomodulador como efector. Como se usa en el presente documento, el término "inmunomodulador" incluye citocinas, factores de crecimiento de células madre, linfotoxinas, tales como factor de necrosis tumoral (TNF) y factores hematopoyéticos, tales como interleucinas (por ejemplo, interleucina-1 (IL-1), IL-2 , IL-3, IL-6, IL-10, IL-12, IL-18 e IL-21), factores estimuladores de colonias (p. ej., factor estimulador de colonias de granulocitos (G-CSF) y factor estimulador de colonias de granulocitos y macrófagos (GMDCSF)), interferones (por ejemplo, interferones -α, -β y -γ), el factor de crecimiento de células madre denominado "factor SI", eritropoyetina, trombopoyetina o una combinación de los mismos. Los ejemplos de restos inmunomoduladores adecuados incluyen IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL-21, y una combinación de los mismos, e interferón-α, -β y -γ, TNF-α y β, y similares. En una realización, el inmunomodulador puede estar presente en la composición o, alternativamente, el inmunomodulador se puede administrar antes, simultáneamente o después de la administración de las composiciones terapéuticas y/o diagnósticas. En una realización particular, el anticuerpo hL243 se puede conjugar también con el inmunomodulador. El inmunomodulador también se puede conjugar con un anticuerpo híbrido que consiste en uno o más anticuerpos que se unen a diferentes antígenos.
En un ejemplo, las terapias multimodales contempladas en la presente invención pueden incluir inmunoterapia con inmunoconjugados tales como el anticuerpo hL243 suplementado con la administración de moléculas de unión adicionales (por ejemplo, anti-CD22, anti-CD19, anti-CD21, anti-CD20, anti-CD80, anti-CD23, anti-CD46 o HLA-DR, preferiblemente los anticuerpos del dímero HLA-DR maduro en forma de anticuerpos desnudos, proteínas de fusión o como inmunoconjugados). Además, una micela, un liposoma o una nanopartícula, como se describe en este documento, pueden incluir moléculas de unión además de los anticuerpos hL243. Por ejemplo, los anticuerpos pueden ser anticuerpos policlonales, monoclonales, quiméricos, humanos o humanizados que reconocen al menos un epítopo en los determinantes antigénicos mencionados anteriormente. Además, se conocen en la técnica los anticuerpos anti-CD19 y anti-CD22 (véanse, por ejemplo, Ghetie et al., Cancer Res.48: 2610 (1988); Helanan et al., Cancer Immunol. Immunother., 32: 364 (1991); Longo, Curr. Opin. Oncol. 8: 353 (1996) y las patentes de Estados Unidos nº 5.798.554 y nº 6.187.287).
En una realización concreta, otra forma de terapia multimodal puede ser la terapia en la que los sujetos reciben inmunoconjugados hL243 junto con quimioterapia estándar contra el cáncer. Por ejemplo, "CVB" (1,5 g/m2 de ciclofosfamida, 200 - 400 mg/m2 de etopósido, y 150 - 200 mg/m2 de carmustina) es un régimen utilizado para tratar el linfoma no Hodgkin. Patti et al., Eur. J. Haematol. 51: 18 (1993). Otros regímenes quimioterapéuticos de combinación adecuados son bien conocidos por los expertos en la técnica (véanse, p. ej., Freedman et al., "Non-Hodgkin’s Lymphomas", en Cancer Medicine, Volumen 2, 3ª Edición, Holland et al. (eds.), páginas 2028 - 2068 (Lea y Febiger 1993)). Como ilustración, los regímenes quimioterapéuticos de primera generación para el tratamiento del linfoma no Hodgkin (LNH) de grado intermedio incluyen C-MOPP (ciclofosfamida, vincristina, procarbazina y prednisona) y CHOP (ciclofosfamida, doxorrubicina, vincristina y prednisona). En una realización particular de la presente invención, el régimen quimioterapéutico de segunda generación puede ser m-BACOD (metotrexato, bleomicina, doxorrubicina, ciclofosfamida, vincristina, dexametasona y leucovorina), mientras que un régimen de tercera generación adecuado es MACOP-B (metotrexato, doxorrubicina, ciclofosfamida, vincristina, prednisona, bleomicina y leucovorina). La terapias adicionales pueden incluir fenil butirato y briostatina-1. En una terapia multimodal preferida, tanto los fármacos quimioterapéuticos como las citocinas se pueden administrar conjuntamente con un anticuerpo, inmunoconjugado o proteína de fusión. Las citocinas, los fármacos quimioterapéuticos y el anticuerpo o inmunoconjugado pueden administrarse en cualquier orden, o simultáneamente.
En una realización particular, el NHL puede tratarse con 4 infusiones semanales del inmunoconjugado hL243 (p. ej., una composición terapéutica) a una dosis de 25 - 700 mg/m2 a la semana durante 4 semanas consecutivas o cada dos semanas (iv durante 2 - 8 horas), repetida según sea necesario en los siguientes meses/años, más preferiblemente en una dosis de 100 - 400 mg/m2 a la semana durante 4 semanas consecutivas o cada dos semanas (iv durante 2 - 8 horas), repetida según sea necesario en los siguientes meses/años. Además, el LNH puede tratarse con 4 infusiones semestrales como las anteriores, pero combinadas con epratuzumab (anticuerpo humanizado anti-CD22) los mismos días, a una dosis de 360 mg/m2, administrada como una infusión iv durante 1 hora, bien sea antes, durante o después de la infusión de inmunoconjugado de anticuerpo hL243. Alternativamente, el HL se puede tratar con 4 infusiones semanales del inmunoconjugado de anticuerpo hL243 como se ha indicado anteriormente, combinado con una o más inyecciones de mAb CD22 radiomarcadas con un isótopo terapéutico tal como itrio-90 (a dosis de 90-Y entre 5 y 35 mCi/m2 como una o más inyecciones durante un período de semanas o meses. En un ejemplo, cuando se usa en pacientes con respuestas más bajas a los anticuerpos CD20, WL243 se puede combinar con anticuerpos CD20 tales como rituximab o hA20. De acuerdo con este ejemplo, esta última combinación se puede administrar de forma secuencial o simultánea, durante el mismo día o semana, y en dosis variables, como 375 mg/m2 una vez a la semana mediante infusión iv para rituximab o hA20 y 250 mg/m2 para hL243 también administrada una vez a la semana por infusión iv. En todos los casos mencionados anteriormente, las dosis pueden fraccionarse, administrarse como infusiones continuas o por vías parenterales conocidas en la técnica. También pueden administrarse por otras vías, tales como la vía subcutánea.
Además, en una realización de la invención como se define en las reivindicaciones, una composición terapéutica puede contener una mezcla de moléculas híbridas de inmunoconjugados hL243 dirigidas a diferentes epítopos no
bloqueantes reconocidos por el anticuerpo hL243. De acuerdo con esta realización, las composiciones terapéuticas pueden incluir una mezcla de inmunoconjugados hL243 que se unen al menos a dos epítopos reconocidos por el anticuerpo hL243. Además, los inmunoconjugados descritos en el presente texto pueden contener una mezcla de anticuerpos hL243 con secuencias CDR variables.
En una realización de la presente invención, los anticuerpos hL243, o sus inmunoconjugados, pueden usarse para tratar linfoma de células B y leucemia, y otras enfermedades o trastornos de células B, así como otros tumores malignos en los que células malignas afectadas o asociadas son reactivas con epítopos reconocidos por el anticuerpo hL243. Por ejemplo, los anticuerpos hL243, o inmunoconjugados de los mismos, se pueden usar para tratar la enfermedad de desregulación inmunitaria y enfermedades autoinmunes relacionadas que incluyen, pero sin limitarse a ellas, enfermedades autoinmunitarias de Clase III, tales como trombocitopenias inmunomediadas, tales como púrpura trombocitopénica idiopática aguda y púrpura trombocitopénica idiopática crónica, dermatomiositis, síndrome de Sjogren, esclerosis múltiple, corea de Sydenham, miastenia gravis, lupus eritematoso sistémico, nefritis lúpica, fiebre reumática, síndromes poliglandulares, penfigoide bulloso, diabetes mellitus, púrpura de Henoch-Schonlein, nefritis posestreptocócica, eritema nudoso, arteritis de Takayasu, enfermedad de Addison, artritis reumatoide, sarcoidosis, colitis ulcerosa, eritema multiforme, nefropatía por IgA, poliarteritis nodosa, espondilitis anquilosante, síndrome de Goodpasture, tromboangitis obliterante, cirrosis biliar primaria, tiroiditis de Hashimoto, tirotoxicosis, esclerodermia; hepatitis crónica activa; polimiositis/dermatomiositis, policondritis, pénfigo vulgar; granulomatosis de Wegener, nefropatía membranosa, esclerosis lateral amiotrófica, tabes dorsal, arteritis/ polimialgia de células gigantes, anemia perniciosa, glomerulonefritis rápidamente progresiva y alveolitis fibrosante.
En una realización más particular, los anticuerpos hL243, o inmunoconjugados o fragmentos de los mismos o proteínas de fusión con anticuerpos de los mismos, pueden ser administrados a un sujeto con una o más de estas enfermedades autoinmunitarias. Los anticuerpos hL243 descritos en el presente texto son particularmente útiles en el método de tratamiento de trastornos autoinmunitarios, descrito en la solicitud de patente pendiente de los EE. UU. nº de serie 09/590.284 presentada el 9 de junio de 2000, titulada "Immunotherapy of Autoimmune Disorders using Antibodies that Target B-Cells". En una realización particular, los anticuerpos hL243 se pueden administrar por vía intravenosa o intramuscular a una dosis de 20 - 2000 mg. Además, los anticuerpos hL243 pueden administrarse antes, durante o después de la administración de al menos un agente terapéutico o un agente de diagnóstico. En una realización más concreta, el agente terapéutico, como se describe en la presente memoria, puede incluir un anticuerpo, un inmunomodulador, una hormona, una enzima, un agente citotóxico, un anticuerpo conjugado con al menos un inmunomodulador, marcador radioactivo, hormona, enzima o agente citotóxico, oligonucleótido antisentido, un ARN de interferencia, o una combinación de los mismos, donde el inmunomodulador es una citocina y dicho agente citotóxico es un fármaco o una toxina. Por ejemplo, el agente terapéutico puede incluir un inmunoconjugado como se describe en este documento. En una realización particular, los anticuerpos que pueden administrarse en combinación como un anticuerpo desnudo o como un inmunoconjugado suplementario incluyen anticuerpos que reaccionan, p. ej., con mAbs contra antígenos específicos, tales como CD4, CDS, CDS, CD14, CD15, CD19, CD21, CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, GD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUC1, MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrosis, PAM-4, KS-1, Le(y), MAGE, la, IL-2, IL-6, tenascina, HM1.24, VEGF, EGFR, 1): publicado como US 7.074.403.
EGP-1, EGP-2 , receptor de folato, gonadotropina coriónica humana, antígeno-p específico del colon (CSAp), factor de crecimiento similar a la insulina (ILGF), factor de crecimiento placentario (P1GF), fosfatasa ácida prostática, PSA, PSMA, T101, TAG, TAG-72, Her2/neu, anhidrasa carbónica IX, IL-6, S100, alfafetoproteína, A3, CA125, antígeno carcinoembrionario (CEA), antígenos de reacción cruzada no específicos, como CD66 (a, b, c, d), MART-1, TRP -1, TRP-2, amiloide y gplOO, formulados en un vehículo farmacéuticamente aceptable.
Como se usa en el presente texto, una "composición farmacéutica" se refiere a una composición que incluye un fármaco en el que el vehículo es un vehículo farmacéuticamente aceptable, mientras que una "composición veterinaria" es una en la que el vehículo es un vehículo veterinariamente aceptable. El término "vehículo farmacéuticamente aceptable" o "vehículo veterinariamente aceptable" puede incluir cualquier medio o material que no sea biológicamente, o de cualquier otra forma, no deseable, es decir, el vehículo puede administrarse a un organismo junto con una composición o compuesto de la presente invención sin causar ningún efecto biológico indeseable o interactuando de manera nociva con el complejo o cualquiera de sus componentes, o el organismo. Se proporcionan ejemplos de reactivos farmacéuticamente aceptables en The United States Pharmacopeia, The National Formulary, United States Pharmacopeial Convention, Inc., Rockville, MD 1990, y en Pharmaceutical Dosage Forms & Drug Delivery Systems, 7ª edición, Ansel et al., editores, Lippincott Williams y Wilkins; 1999.
Se puede incluir un fármaco (es decir, un constructo o complejo dirigible) en la composición farmacéutica en una cantidad suficiente para producir el efecto deseado sobre el paciente. Las composiciones farmacéuticas de la presente invención pueden comprender además otros componentes químicos, tales como diluyentes y excipientes. Un "diluyente" es un compuesto químico diluido en un disolvente, preferiblemente un disolvente acuoso, que facilita la disolución del fármaco en el disolvente, y también puede servir para estabilizar la forma biológicamente activa del fármaco o uno o más de sus componentes. Las sales disueltas en soluciones tamponadas se utilizan como diluyentes en la técnica. Por ejemplo, los diluyentes preferidos son soluciones tamponadas que contienen una o más sales diferentes. Una solución tamponada preferida es la solución salina tamponada con fosfato (en particular junto con composiciones destinadas a la administración farmacéutica), por cuanto imita las condiciones salinas de la
sangre humana. Como las sales tampón pueden controlar el pH de una solución a bajas concentraciones, un diluyente tamponado raramente modifica la actividad biológica de un péptido biológicamente activo.
En una realización de la presente invención, las composiciones farmacéuticas facilitan la administración de anticuerpos humanizados a un organismo, preferiblemente un animal, preferiblemente un mamífero. Los mamíferos particulares incluyen animales bovinos, caninos, equinos, felinos, ovinos y porcinos, y primates no humanos. Los humanos son particularmente preferidos. Las múltiples técnicas de administración o suministro de un compuesto que existen en la técnica incluyen, pero sin limitarse a ellas, aerosol oral, rectal (p. ej., un enema o supositorio; p. ej., para administración nasal o pulmonar), parenteral (p. ej., i. v., i. m., s. c.) y administración tópica. Preferiblemente, se pueden suministrar cantidades suficientes de la composición o compuesto para lograr el efecto deseado. La cantidad particular de composición o compuesto a administrar dependerá de muchos factores, incluido el efecto a conseguir, el tipo de organismo al cual se suministra la composición, la vía de suministro, el régimen de dosificación y la edad, la salud y el sexo del organismo. Como tal, la dosificación particular de una composición o compuesto de realización descrita en este documento en una formulación dada, se deja a la discreción del profesional con una experiencia ordinaria (por ejemplo, a la discreción del proveedor de atención médica).
Los expertos en la técnica apreciarán que cuando las composiciones farmacéuticas de la presente invención se administran como agentes para conseguir un resultado biológico deseado particular, que puede incluir un efecto o efectos terapéuticos o protectores (incluyendo la vacunación), puede ser necesario combinar la composición o los compuestos descritos en este documento con un vehículo farmacéutico adecuado. La elección del vehículo farmacéutico y la preparación de la composición o compuesto como agente terapéutico o protector dependerán del uso y modo de administración pretendidos. Las formulaciones y los métodos de administración de agentes terapéuticos adecuados incluyen, entre otros, los de administración oral, pulmonar, nasal, bucal, ocular, dérmica, rectal o vaginal.
Dependiendo del modo de suministro empleado, la entidad funcional dependiente del contexto puede suministrarse en una variedad de formas farmacéuticamente aceptables. Por ejemplo, la entidad funcional dependiente del contexto puede administrarse en forma de sólido, solución, emulsión, dispersión, micela, liposoma y similares, incorporada en una píldora, cápsula, tableta, supositorio, areosol, gotículas o pulverización. Las píldoras, tabletas, supositorios, areosoles, polvos, gotículas y pulverizaciones pueden tener estructuras complejas de múltiples capas y tener una gran variedad de tamaños. Los aerosoles, polvos, gotículas y pulverizaciones pueden variar desde tamaños pequeños (aproximadamente 1 micra) hasta grandes (aproximadamente 200 micras).
Las composiciones farmacéuticas de la invención como se definen en las reivindicaciones pueden usarse en forma de un sólido, un polvo liofilizado, una solución, una emulsión, una dispersión, una micela, un liposoma y similares, en donde la composición resultante contiene uno o más de los constructos o complejos dirigibles de realizaciones de la presente invención, como ingrediente activo, en mezcla con un vehículo o excipiente orgánico o inorgánico adecuado para aplicaciones enteral o parenteral. El ingrediente activo se puede componer, por ejemplo, con los vehículos farmacéuticamente aceptables no tóxicos habituales para tabletas, gránulos, cápsulas, supositorios, soluciones, emulsiones, suspensiones y cualquier otra forma adecuada para su uso. Los vehículos que pueden usarse incluyen glucosa, lactosa, manosa, goma arábiga, gelatina, manitol, pasta de almidón, trisilicato de magnesio, talco, almidón de maíz, queratina, sílice coloidal, almidón de patata, urea, triglicéridos de longitud de cadena media, dextranos y otros vehículos adecuados para ser usados en la fabricación de preparados, en forma sólida, semisólida o líquida. Además, se pueden usar agentes auxiliares, estabilizantes, espesantes y colorantes y perfumes. Los ejemplos de agente seco estabilizante incluyen triulosa, preferiblemente en concentraciones de 0,1% o mayores (véase, por ejemplo, la patente de EE. UU. nº 5.314.695).
Aunque las necesidades individuales pueden variar, la determinación de intervalos óptimos para cantidades efectivas de composiciones farmacéuticas está dentro de la experiencia en la técnica. Las dosis humanas se pueden extrapolar de estudios en animales (Katocs et al., capítulo 27 en: Remington's Pharmaceutical Sciences, 18ª edición, Gennaro, ed., Mack Publishing Co., Easton, PA, 1990). Generalmente, la dosificación requerida para proporcionar una cantidad efectiva de una composición farmacéutica que puede ser ajustada por un experto en la técnica variará dependiendo de la edad, la salud, el estado físico, el peso, el tipo y el alcance de la enfermedad o trastorno del receptor, la frecuencia del tratamiento, la naturaleza de la terapia concurrente (si la hay) y la naturaleza y el alcance de los efectos deseados. Véanse, por ejemplo, Nies et al., capítulo 3 en: The Pharmacological Basis of Therapeutics, de Goodman & Oilmah, 9ª edición, Hardman et al., eds., McGraw-Hill, Nueva York, N. Y., 1996).
La dosificación de las composiciones terapéuticas depende de la gravedad y la capacidad de respuesta del estado patológico a tratar, durando el transcurso del tratamiento de varios días a varios meses, o hasta que se realiza una cura o se logra una disminución del estado patológico. Los programas óptimos de dosificación pueden calcularse a partir de mediciones de la acumulación de fármacos en el cuerpo del paciente. El término "paciente" pretende abarcar animales (por ejemplo, gatos, perros y caballos), así como seres humanos. Las personas con una experiencia ordinaria pueden determinar fácilmente las dosis óptimas, las metodologías de dosificación y las tasas de repetición. Las dosificaciones óptimas pueden variar dependiendo de la potencia relativa de los agentes terapéuticos individuales, y generalmente se pueden estimar basándose en EC que se ha encontrado efectivo en modelos animales in vitro e in vivo.
El intervalo de dosis (la cantidad de constructo dirigible o complejo administrado) es amplio, ya que en general la eficacia de un efecto terapéutico para diferentes mamíferos varía ampliamente con dosis que son típicamente 20, 30 o incluso 40 veces más pequeñas (por unidad de peso corporal) en el hombre que en la rata. En general, la dosis es de 0,01 μg a 100 mg por kg de peso corporal, preferiblemente de 0,01 μg a 10 mg/kg de peso corporal, de 0,01 μg a 50 μg/kg de peso corporal, de 0,01 μg a 100 mg/kg de peso corporal, de 0.01 μg a 10 mg/kg de peso corporal, de 0,01 μg a 1 mg/kg de peso corporal, de 0,01 μg a 100 μg/kg de peso corporal, de 0,01 μg a 10 μg/kg de peso corporal, de 0,01 μg a 1 μg/kg, de peso corporal, de 0,01 μg a 10 μg/kg de peso corporal, de 0,01 μg a 1 μg/kg de peso corporal, de 0,01 μg a 0,1 μg/kg de peso corporal, e intervalos basados en los límites de los márgenes de concentración anteriores. Así, por ejemplo, la descripción anterior de dosificaciones abarca dosis dentro del margen de 10 mg a 100 mg por kg de peso corporal, 1,0 mg a 100 mg/kg de peso corporal, 0,1 mg a 100 mg/kg de peso corporal, etc.
En una realización, las dosis pueden administrarse una o más veces al día, semanalmente, mensualmente o anualmente, o incluso una vez cada 2 a 5 o más años. Los expertos en la técnica pueden estimar las tasas de repetición para la dosificación en función de los tiempos de permanencia medidos y las concentraciones de la construcción dirigible o complejo en fluidos o tejidos corporales. Después de un tratamiento con éxito, puede ser deseable que el paciente se someta a terapia de mantenimiento para prevenir la recurrencia del estado patológico, donde el agente terapéutico se administra en dosis de mantenimiento que están en el intervalo de 0,01 ug a 100 mg por kg de peso corporal, una o más veces al día, hasta una vez cada 5 años.
En una realización, se puede calcular una dosis particular de acuerdo con el peso corporal aproximado o el área superficial del paciente. Otros factores en la determinación de la dosificación apropiada pueden incluir la enfermedad o afección a tratar o prevenir, la gravedad de la enfermedad, la vía de administración, y la edad, el sexo y la condición médica del paciente. Los expertos en la técnica realizan rutinariamente refinamientos adicionales de los cálculos necesarios para determinar la dosificación apropiada para el tratamiento, especialmente a la luz de la información de dosificación y los ensayos descritos en este documento. La dosificación puede determinarse también mediante el uso de ensayos conocidos para determinar dosificaciones usadas junto con datos de dosis-respuesta apropiados.
En una realización, la dosificación de un paciente individual puede ajustarse a medida que se monitoriza el progreso de la enfermedad. Se pueden medir los niveles en sangre del constructo o complejo dirigible en un paciente para ver si la dosificación necesita ser ajustada para obtener los resultados deseados.
En una realización, se puede usar la farmacogenómica para determinar qué constructos y/o complejos dirigibles, y sus dosificaciones, son los más probablemente efectivos para un individuo dado (Schmitz et al., Clinica ChimicaActa 308: 43 - 53, 2001; Steimer et al, Clinica ChimicaActa 308: 33 - 41, 2001).
La administración de los anticuerpos humanizados de la presente invención como se define en las reivindicaciones puede ser parenteral, incluyendo intravenosa, intraarterial, intraperitoneal, intramuscular, subcutánea, intrapleural, intratecal, intracavitaria, mediante perfusión a través de un catéter o mediante inyección intralesional directa. De acuerdo con esta administración, los anticuerpos pueden administrarse una o más veces al día, una o más veces a la semana, una o más veces al mes y una o más veces al año.
Las realizaciones descritas ilustrativamente en el presente texto se pueden practicar adecuadamente en ausencia de cualquier elemento o elementos, limitación o limitaciones, no específicamente descritos en este documento. Así, por ejemplo, los términos "que comprende", "que incluye”, "que contiene", etc. deben leerse de manera amplia y sin limitaciones. Además, los términos y expresiones empleados en este documento se han usado como términos de descripción y no de limitación, y en el uso de tales términos y expresiones no existe la intención de excluir ningún equivalente de las características mostradas y descritas, o partes de las mismas, pero se reconoce que son posibles diversas modificaciones dentro del alcance de la presente invención reivindicada. Así pues, debe entenderse que aunque la presente invención ha sido descrita específicamente mediante realizaciones preferidas y características opcionales, los expertos en la técnica pueden recurrir a la modificación y a las variaciones aquí descritas, y que tales modificaciones y variaciones se consideran dentro del alcance de esta invención, como se define en las reivindicaciones.
Las realizaciones de la presente invención se han descrito de forma amplia y genérica en este documento. Cada una de las especies más estrechas y agrupamientos subgenéricos que caen dentro de la divulgación genérica también pueden formar parte de la invención. Esto incluye la descripción genérica en el presente texto, con una condición o limitación negativa que elimina cualquier materia sujeto del género, al margen de si el material eliminado se menciona específicamente aquí.
Además, cuando las características o aspectos se describen en términos de grupos de Markush, los expertos en la técnica reconocerán que las realizaciones también se describen de ese modo en términos de cualquier miembro individual o subgrupo de miembros del grupo Markush.
Las realizaciones se ilustran con más detalle mediante los siguientes ejemplos y protocolos detallados. Sin embargo, los ejemplos están destinados meramente a ilustrar realizaciones y no debe considerarse que limiten el alcance de
la presente invención según se define en las reivindicaciones.
Ejemplos.
Ejemplo 1. Construcción de un anticuerpo L243 humanizado.
Clonación molecular de los genes L243Vk y VH.
En un método ejemplar, el clon de células de hibridoma que produce el mAb mL243 se cultivó en medio HSFM (Life Technologies, Inc.) suplementado con 10% de FBS (Hyclone). Los genes que codifican VK (VK1BACK/CK3) y VH (VH1BACK/VH1FOR) de mL243 se clonaron mediante RT-PCR y las secuencias se determinaron mediante secuenciación de ADN. Múltiples clones independientes fueron secuenciados para eliminar posibles errores resultantes de la reacción de PCR.
Diseño de secuencia de genes hL243 V.
En un ejemplo, buscando las secuencias de VK y VH humanas en la base de datos de Kabat se encontró que las FRs de mL243 VK y VH exhiben el mayor grado de homología de secuencia con REI VK humano y RF-TS3 VH, respectivamente. Una excepción es el FR4 de mL243VH, que mostró la homología de secuencia más alta con la de NEWM VH. Por tanto, en un ejemplo se usaron secuencias estructura REI humanas como armazón para injertar las CDRs de mL243VK (Figura 5), y se usó una combinación de secuencias de estructura RF-TS3 y NEWM para hL243Vn (Figura 6). De hecho, hL243 VH tiene las mismas estructuras de VH humanos que otro Ab humanizado, hRS7 (Govindan y col., Breast Cancer Res. Treat.84, 173 - 182, 2004). Hay una serie de cambios de aminoácidos en cada cadena fuera de las regiones CDR en comparación con las estructuras iniciales de anticuerpos humanos. Varios restos de aminoácidos en FR murinas que flanquean las CDRs putativas se mantuvieron en el hL243 Fv remodelado en las directrices establecidas previamente (Qu et al., Clin Cancer Res. (1999) 53095s – 3100s). Estos restos son R37, K39, V48, F49 y G100 de mL243Vk y F27, K38, K46, A68 y F91 de mL243VH (Figuras 3 y 4, respectivamente). Véase también la SEQ. ID. 3 y 4 respectivamente para la secuencia de hL243 VL y hL243VH, respectivamente.
Construcción de secuencias hL243 V.
Una estrategia modificada como se describe en Leung et al. (Mol. Immunol. (1995) 321413 - 1427) fue usada para construir los genes VK y VH diseñados para hL243 usando una combinación de síntesis de oligonucleótidos largos y PCR como se ilustra en la Figura 4. Para la construcción del dominio hL243 VH, dos oligonucleótidos largos, hL243VHA (175-mero) y hL243VHB (168-mero), se sintetizaron en un sintetizador de ADN automático (Applied Biosystem). hL243VHA representa nt 23 a 197 del dominio HL243VH.
5'-GGTCTGAGTT GAAGAAGCCT GGGGCCTCAG TGAAGGTTTC CTGCAAGGCT TCTGGATTTA CCTTCACAAA CTATGGAATG AACTGGGTGA AGCAGGCCCC TGGACAAGGG CTTAAGTGGA TGGGCTGGAT AAACACCTAC ACTAGAGAGC CAACATATGC TGATGACTTC AAGGG-3' (SEQ ID NO: 16) hL243VHB representa la cadena menos del dominio hL243VH complementaria a los nt 176 - 343.
Las secuencias 3'-terminales (22 restos de nt) de hL243VHA y B son complementarias entre sí, como se subraya en las secuencias anteriores. En un ejemplo, bajo condiciones de PCR definidas, los extremos 3' de hL243VHA y B se reasocian para formar un ADN bicatenario corto flanqueado por el resto de los oligonucleótidos largos. Cada extremo reasociado sirve como cebador para la replicación del ADN monocatenario en una reacción de PCR, dando como resultado un ADN bicatenario compuesto por los nt de 23 a 343 de hL243VH. Este ADN se amplificó adicionalmente en presencia de un par de cebadores de oligonucleótidos cortos, hRS7VHBACK y hL243VHFOR, para formar el hL243VH de longitud completa. A causa de la identidad de secuencia entre hRS7VH y hL243VH en la región, se utilizó aquí hRS7VHBACK, diseñado previamente y utilizado para el Ab hRS7.
hRS7VHBACK 5'-GTGGTGCTGC AGCAATCTGG GTCTGAGTTG AAGAAGCC-3' (SEQ ID NO: 18) hL243VHFOR 5'-TGAGGAGACG GTGACCAGGG ACCCTTGGCC CCAGTAGT-3' (SEQ ID NO: 19)
En este ejemplo, fue amplificada una cantidad mínima de hL243VHA y B (determinada empíricamente) en presencia de 10 µl de Tampón para PCR 1Ox (KC1500 mM, tampón Tris.HCL 100 mM, pH 8,3,15 mM de MgCl 2).2 umol de hRS7VHBACK y hL243VHFOR, y 2,5 unidades de ADN polimerasa Taq (Perkin Elmer Cetus, Norwalk, CT). Esta mezcla de reacción fue sometida a 3 ciclos de reacción de PCR consistentes en desnaturalización a 94 °C durante 1 minuto, hibridación a 45 °C durante 1 minuto y polimerización a 72 °C durante 1,5 minutos, seguido de 27 ciclos de
reacción de PCR que consisten en desnaturalización a 94 °C durante 1 minuto, reasociación a 55 °C durante 1 minuto y polimerización a 72 °C durante 1 minuto. El producto de doble cadena amplificado por PCR para hL243VH se purificó en gel, se digirió por restricción con PstI y BstEII y se clonó en los sitios PstI/BstEII complementarios del vector de estadificación de cadena pesada, VHpBS4.
En un ejemplo, para construir el ADN de longitud completa de la secuencia VK humanizada, se sintetizaron hL243 VKA (155-mero) y hL243VKB (155-mero) como se describió anteriormente. hL243VKA y B se amplificaron mediante dos oligonucleótidos cortos hlmmu31 VKBACK y hlmmu31 VKFOR como se describió anteriormente. h1mmuS 1 VKB ACK y h1mmuS1 VKFOR se diseñaron y usaron previamente para un Ab anti-AFP humanizado (Qu et al., Clin Cancer Res. (1999) 53095 - 3100).
hL243VKA representa nt 21 a nt 175 del dominio hL243VD.
hL243VKB representa la cadena negativa del dominio hL243VK complementaria a nt 154 a 312.
hImmu31VKBACK 5'-GACATTCAGC TGACCCAGTC TCCATCATCT CTGAGCGC-3' (SEC ID Nº: 22) hImmu31VKFOR 5'-CCGGCAGATC TGCAGCTTGG TCCCTCCACC G-3' (SEQ ID NO: 23).
Los productos de PCR purificados en gel para hL243VK en este ejemplo fueron digeridos por restricción con PvuII y Bg1HI y se clonaron en los sitios complementarios PvuI/BcII del vector de estadificación de cadena ligera, VKpBR2. El vector de expresión final hL243pdHL2 se construyó subclonando secuencialmente los fragmentos Xba1-BamHI y XhoI/NotI de hL243Vic y VH, respectivamente, en pdHL2 como se describió anteriormente.
Construcción de los vectores de expresión para anticuerpos hL243.
En un ejemplo, se construyó un vector de expresión final hL243pdHL2 subclonando secuencialmente los fragmentos Xbal-BamHI y XhoI/NotI de hL243Vx y VH, respectivamente, en pdHL2 como se describió previamente (Losman et al., Cancer, 80: 2660 (1997)). El vector de expresión pdHL2, como describen Gilles et al. (J. Immunol. Methods 125: 191 (1989), contiene la secuencia genómica de la cadena y1 humana, por tanto, hL243 es un isotipo IgG1/K.
En un método ejemplar, para construir el vector de expresión para hL243 de otro isotipo, como IgG4/K, la secuencia genómica de la cadena γ1 humana se reemplazó por la de la cadena γ4, que se obtuvo por amplificación por PCR. La plantilla utilizada fue el ADN genómico extraído de la célula ATCC CRL-11397 y el par de cebadores fue P-SacII (5'-CCGCGGTCACATGGCACCA CCTCTCTTGCAGCTTCCACCA AGGGCCC-3') (SEC ID Nº: 24) y P-EagI (5'-CCGGCCGTCG CACTCAT TTA CCCAGAGACA GGG-3') (SEC ID Nº: 25). El producto de PCR amplificado se clonó en el vector de secuenciación TOPO -TA (Invitrogen) y la secuencia se confirmó mediante secuenciación de ADN. Una mutación puntual, Ser241Pro (basándose en la numeración de Kabat) se introdujo en la región bisagra de la secuencia γ4 para evitar la formación de semi-moléculas cuando se expresa el Ab IgG4 en cultivos de células de mamíferos (Schuurman y col., Mol. Immunol.38: 1 (2001)). La secuencia de la región bisagra γ4 humana entre los sitios de restricción PstI y StuI (56 pb) fue reemplazada con un fragmento de ADN sintético con la sustitución del codón TCA para Ser241 por CCG para Pro. La secuencia genómica γ1 humana en hL243pdHL2 se sustituyó con la secuencia y4 mutada, dando como resultado el vector de expresión final, designado como hL243γ4PpdHL2, para el isotipo IgG4 hL243.
Transfección y expresión de anticuerpos hL243.
En un ejemplo de método, aproximadamente 30 μg del vector de expresión para hL243 o hL243γ4P se linealizaron por digestión con Sail y se transfectaron en células Sp2/0-Agl4 mediante electroporación (450 V y 25 uF). Las células transfectadas se cultivaron en placas de 96 pocillos durante 2 días y luego se seleccionaron por su resistencia a los fármacos mediante la adición de MTX en el medio a una concentración final de 0,025 pM. Las colonias resistentes al MTX emergieron en los pozos 2-3 semanas. Los sobrenadantes de las colonias que sobrevivieron a la selección se cribaron en relación con la detección de la secreción de Ab humano por ensayo
ELISA. Brevemente, se añadieron 100 ul de sobrenadantes en los pocillos de una placa de microtítulo recubierta previamente con GAH-IgG, Ab específico del fragmento F(ab')2 y se incubaron durante 1 h a temperatura ambiente. Las proteínas no unidas se eliminaron lavando tres veces con tampón de lavado (PBS que contiene 0,05% de polisorbato 20). Se añadió GAH-IgG conjugado con HRP, Ab específico del fragmento Fc a los pocillos. Después de una incubación de 1 h, la placa se lavó. El Ab conjugado con HRP unido se reveló por lectura de A490 nm después de la adición de una solución de sustrato que contenía 4 mM de OPD y 0,04% de H 2O 2. Los clones de células positivas se expandieron y hL243 y hL243γ4P se purificaron del sobrenadante de cultivo celular mediante cromatografía de afinidad en una columna de Proteína A.
La especificidad de unión con Ag de hL243.
En un ejemplo, la actividad de unión a Ag y la especificidad de HL243 se demostraron mediante un ensayo de unión con la superficie celular. Las células Raji se incubaron en PBS/BSA (1%) que contenían una concentración saturada de hL243 purificado (20 μg/ml) durante 1 hora a 4 °C. Después del lavado, se detectó hL243 unida a la superficie celular incubando las células Raji en el tampón que contiene un segundo anticuerpo conjugado con PE (IgG antihumano de cabra, fragmento Fc específico) y contando en un sistema PCA de Guave (Guava Technologies, Inc., Hayword, CA). Como se muestra en la Figura 7, hL243 se unió a un antígeno en células Raji reconocido por mL243 porque la unión se bloquea específicamente por la preincubación de las células con mL243, lo que indica que la especificidad de unión a Ag de mL243 se conserva en la versión humanizada.
La actividad de unión con Ag de hL243γ4P.
En un método ejemplar, se llevó a cabo un ensayo de unión a células de competición para evaluar la inmunoreactividad de hL243γ4P e5n relación con el mL243 precursor. Se incubó una cantidad constante de L243 o hL243γ4P murino marcado con 12 I (100.000 cpm - 10 uCi/ug) con células de linfoma humano (Raji, Daudi o Ramos) en presencia de concentraciones variables (0,2 - 700 nM) de hL243γ4P purificado o L243 murino a 4 °C durante 1 -2 h. Los Abs no unidos se eliminaron por lavado de las células en PBS. La radioactividad asociada con las células se determinó después del lavado. Como se muestra en la Figura 8, los mAbs murinos L243 y hL243γ4P compitieron entre sí por la unión al antígeno de superficie celular, lo que indica que reconocen el mismo determinante antigénico. hL243γ4P mostró una avidez de unión aparente ~2 veces más intensa que mL243 porque compitió mejor que mL243 (ECso de ~7 frente a ~16.SnM).
La constante de afinidad de unión con antígeno de hL243γ4P se determinó mediante el ensayo de unión de superficie celular directa de los anticuerpos radiomarcados y el análisis de la gráfica de Scatchard. Para medir la unión específica al antígeno de la superficie celular, se prepararon dos conjuntos de células y se usaron en el ensayo de unión para estimar la unión no específica y total de las radioactividades, respectivamente. Las células para la unión no específica se preincubaron con una cantidad en exceso de Ab no marcado para bloquear todos los sitios de antígeno de superficie antes de añadir el anticuerpo radiomarcado, mientras que las de unión total se preincubaron en PBS. Después de la preincubación, se añadieron cantidades variables de 125I-hL243γ4P o 125I-mL243 y se incubaron con 2 x 105 células de linfoma humano (Raji, Daudi o Ramos) a 4 °C durante 2 h y los anticuerpos no unidos se eliminaron mediante lavado. Se hizo recuento de la radiactividad asociada a la célula. La unión de la superficie celular específica del anticuerpo radiomarcado a una concentración dada de anticuerpo radiomarcado se calculó como: los recuentos de unión total se restan de los recuentos de unión no específica. Entonces se realizó el análisis de la gráfica de Scatchard para determinar el número máximo de sitios de unión hL243γ4P y mL243 por célula y las constantes de disociación aparente de la unión de equilibrio. Como se muestra en la Figura 9, la unión máxima de hL243γ4P y mL243 a células Daudi era virtualmente la misma, 6 x 105 moléculas /célula, lo que indica que se unen al mismo Ag. Se calculó que los valores constantes de disociación aparente para hL243γ4P y mL243 eran 2,6 y 14 nM, respectivamente. Se obtuvieron resultados similares con las células Raji y Ramos (datos no mostrados).
Ejemplo 2. Estudios funcionales de hL243γ4P.
En un método ejemplar se llevaron a cabo estudios basados en células in vitro para determinar si hL243γ4P había retenido su efecto antiproliferativo y si las células efectoras y las funciones de unión al complemento se habían anulado. En este ejemplo, el estudio descrito a continuación indica que el efecto antiproliferativo se ha mantenido, mientras que las funciones de unión de células efectoras y complemento se han anulado.
Ensayo de las células efectoras.
El objetivo de reemplazar la región Fc de hL243 con una región Fc de isotipo de IgG4 era anular las funciones de células efectoras a través del receptor Fey y la unión al complemento. Se realizaron ensayos de CDC y ADCC para evaluar estas funciones mediante hL243y4P.
CDC.
Las células Daudi se incubaron con diluciones en serie de los anticuerpos hL243, hL243γ4P, hA20 (como otro control positivo) y hMN14 (control negativo) en presencia de complemento humano durante 2 h. Esto fue seguido por la adición de resazurina para evaluar la viabilidad celular. Se incluyeron controles de lisis no tratados y máximos. Las
lecturas de fluorescencia se obtuvieron 5 horas después de la adición de resazurina. El nivel de fluorescencia obtenido se correlaciona directamente con la cantidad de células viables. El porcentaje de células viables se calculó mediante la fórmula (lisis máxima de prueba)/(control no tratado - lisis máxima) x 100. Los resultados indican que hL243γ4P no produce ningún efecto citotóxico mediado por el complemento en las células en comparación con hL243 (EC50 = 2,6 nM) y hA20 (CE50 = 0,66 nM). Véase la Figura 10.
ADCC.
Las células Daudi se incubaron con hA20, hL243, hL243γ4P y hMN-14 a 5 μg/ml. Las células efectoras se añadieron a una relación de 50:1. Al cabo de 4 horas, se ensayó la lisis celular mediante la liberación de LDH (Figura 11A) y lisis celular (Figura 1 IB).
En estos resultados, en los que se muestran los efectos del anticuerpo solo sobre las células efectoras, puede observarse que el KL243 indujo una lisis significativa de células efectoras, mientras que hL243γ4P no lo hizo. Cuando las cifras de lisis específicas se corrigen para el efecto sobre las células efectoras, hL243γ4P muestra una lisis mucho más reducida de las células diana en comparación con hL243 (12% frente a 48%).
Ensayos de proliferación in vitro.
Se realizaron ensayos colorimétricos múltiples utilizando tanto la biorreducción MTS (para la determinación del número de células viables) como BrdU (para la cuantificación de la proliferación celular basándose en la medida de la incorporación de BrdU durante la síntesis de ADN). Las células Daudi y Raji se incubaron con diluciones seriadas de hL243γ4P durante 2 y 3 días. Se usaron mL243 y hMN-14 como controles positivos y negativos, respectivamente. Después de la incubación, se realizaron los ensayos BrdU y MTS. Los resultados de los ensayos MTS se muestran a continuación. Los ensayos BrdU dieron resultados similares.
En un método ejemplar, se realizaron ensayos colorimétricos múltiples utilizando tanto la biorreducción MTS (para la determinación del número de células viables) como BrdU (para la cuantificación de la proliferación celular basándose en la medida de la incorporación de BrdU durante la síntesis de ADN). Las células Daudi y Raji se incubaron con diluciones seriadas de hL243γ4P durante 2 y 3 días. Se usaron L243 y hMN14 murinas como controles positivo y negativo, respectivamente. Después de la incubación, se realizaron los ensayos BrdU y MTS. Los resultados de los ensayos MTS se muestran en las Figuras 12 y 13. Los ensayos Brdu dieron resultados similares (no mostrados). Estos resultados indican que hL243γ4P inhibe la proliferación de las líneas celulares Raji y Daudi. Sin embargo, en experimentos similares en la línea celular EBV negativa Ramos, la inhibición de la proliferación solo se observó en presencia de un anti-Fc (Fab) 2 de reticulación.
Ejemplo 3: Comparación de la eficacia in vivo de hL243γ4P y mL243 (IgG2a) en un modelo de xenoinjerto de linfoma no Hodgkin humano.
En un método ejemplar, se realizó un estudio terapéutico para comparar la eficacia in vivo de los isotipos de anticuerpo monoclonal L243-IgG4 humanizado y L243-IgG2a murino, en un modelo de xenoinjerto de linfoma no Hodgkin humano (Raji). Estudios previos in vitro han demostrado que reemplazar la región Fc de L243-IgG1 con un isotipo IgG4 anula las funciones de las células efectoras del anticuerpo (ADCC y CDC), conservando al tiempo los efectos antiproliferativos. Estudios previos que usan anticuerpos anti-HLA-DR completamente humanos diseñados como un isotipo IgG4 han mostrado también minimizar los efectos secundarios debido a las funciones efectoras mediadas por la porción Fc, mientras proporcionan una excelente actividad tumoricida in vitro, e in vivo en modelos de xenoinjerto de linfoma no Hodgkins y modelos animales (monos cynomologus) sin efectos hematológicos de larga duración. Véase Nagy et al., Nature Medicine, 8: 801 (2002). Así pues, este estudio tuvo como objetivo determinar si hL243-IgG4 podría mantener una eficacia antitumoral significativa en un modelo de xenoinjerto. En ausencia de suficiente cantidad de hL243-IgG1, se usó IgG2a mL243 (la IgG2a murina es el equivalente de la IgG1 humana en la fijación del complemento, y efectúa ADCC).
Ratones SCID fueron inyectados con 2,5 millones de células Raji. La terapia con hL243-IgG4 o mL243-IgG2a se inició 1 día después de la administración de la célula tumoral. Ambos grupos de ratones inyectados con solución salina o con el anticuerpo de control no específico, hMN-14, tuvieron un tiempo de supervivencia medio (MST) de 17 días. Todos los grupos de ratones tratados con L243 tanto humanizado como murino tuvieron una vida útil significativamente mejorada en comparación con los ratones a los que se inyectó solución salina o hMN-14 (PO.0001). El tratamiento con varias dosis de hL243 IgG4 dio como resultado una relación dosis-respuesta, teniendo mejores tiempos de supervivencia los ratones que recibieron dosis más altas. En el grupo de animales tratados con varias dosis de IgG2a mL243, la tasa de curación estaba en el intervalo de 80 a 100%. Véase la Figura 14.
Este estudio mostró la retención concurrente de la eficacia antitumoral y la eliminación de la actividad de unión con el complemento de la construcción IgG4 de L243. Aunque este estudio se llevó a cabo en ratones, se pueden lograr beneficios terapéuticos significativos usando los constructos mencionados anteriormente en todos los mamíferos que padecen enfermedades autoinmunitarias, linfomas o leucemias. En particular, los constructos mencionados anteriormente pueden ser usados de manera efectiva en (i) animales domésticos, especialmente gatos, perros y caballos, para tratar enfermedades autoinmunitarias y linfomas/leucemias; y (ii) seres humanos, para el tratamiento de enfermedades autoinmunitarias, linfomas y leucemias, así como enfermedades inmunitarias desreguladoras,
metabólicas y neurodegenerativas, que implican la expresión de HLA-DR.
Ejemplo 4: Comparación in vitro de hL243 con L243 y MAbs anti- células B en el tratamiento de linfomas humanos y caninos.
Se ensayó una muestra de 0,5 mg de hL243 (isotipo IgG4) en relación con la reactividad con líneas de células de linfoma y un aspirado de linfoma de células B de perro en comparación con el L243 murino, así como en comparación con otros MAbs anti-células B. También se hicieron dos estudios funcionales. Se determinó la capacidad del hL243 para inducir la apoptosis en el aspirado de linfoma de perro y se probó la actividad antiproliferativa del hL243 frente a Namalwa, una línea de células de linfoma humano que se ha informado que es resistente al rituximab.
La unión de MAbs humanizados o quiméricos en los linfomas de células B humanas se midió mediante citometría de flujo usando un clasificador de células activado por fluorescencia (FACS) en el que los siguientes MAbs - hMN-14, hLL1, hLL2, hA20, Rituxan y hL243 se tiñeron con IgG Fc antihumano de cabra (GAH) FITC. Las líneas celulares elegidas fueron Namalwa (una línea de células de linfoma de células B humano resistentes a rituximab), SU-DHL-6 (linfoma no Hodgkin de células B humanas), WSU-FSCCL (una línea de células de linfoma de células B humanas de grado bajo EBV-negativas), células Raji, Daudi y Ramos. Como se muestra en la Tabla 2, hL243 se une a todas las líneas celulares mencionadas anteriormente. En particular, hL243 unido a las células de Namalwa que no responden a CD20, muestran una mayor unión que otros MAbs humanizados. Véase la Tabla 1. Además, hL243 demostró actividad antiproliferativa en la línea celular de linfoma de células B humanas resistentes a rituximab, Namalwa, medida mediante un ensayo de absorción de 3H-timidina. El otro anticuerpo CD20, A20 humanizado (hA20), desarrollado por Immunomedics, Inc., mostró resultados similares a rituximab, un anti-CD20 quimérico conocido como Rituxan®. Véase Stein et al. (2004) Clin. Cancer Res.10: 2868 - 2878.
Como se muestra en la Figura 16A-B, el hL243 produjo un 28% de inhibición de la proliferación cuando se administra solo; esto aumentó al 51% cuando se administró hL243 en combinación con un segundo anticuerpo IgG antihumano. Cuando se usó en combinación con rituximab, la actividad se incrementó a un nivel mayor que el de cualquiera de los MAb solos. Véase la Figura 16-B.
Los estudios demostraron también que hL243 tiene una mayor afinidad de unión a las células de linfoma de perro que otros MAbs humanizados. Véase la Tabla 3. Además, KL243 fue capaz de inducir la apoptosis en células de linfoma de perro cuando se reticula con un segundo anticuerpo IgG antihumano, medido como el porcentaje de células con un contenido de ADN en fase sub GO/G1. Véase la Figura 15.
Ejemplo 5: Combinaciones de anticuerpo hL243 y sus efectos.
Métodos.
Anticuerpos.
En un método ejemplar, el clon de célula de hibridoma que produce el anticuerpo monoclonal anti-HLA-DR, L243, se obtuvo de la ATCC (ATCC número HB-55). Las células se cultivaron en medio HSFM (Life Technologies, Inc.) suplementado con 10% de SFB (Hyclone). Los genes que codifican los genes VK y VH de L243 se clonaron mediante RT-PCR. El L243 humanizado (isotipo IgG1/ κ), hL243γ1, se generó de manera similar, como se describió previamente (Leung et al., Hybridoma 13: 469 (1994); Leung et al., Mol. Immunol., 32: 1413 (1995); Stein et al., Blood 104: 3705 (2004); Govindan y col., Breast Cancer Res. Treat.84: 173 (2004)).
El isotipo IgG4/κ de hL243, hL243γ4p, se puede construir reemplazando la secuencia codificadora de la región constante de la cadena pesada por la cadena γ1 humana con la de la cadena γ4. Una mutación de punto Ser241Pro (basada en la numeración Kabat) fue introducida en la región bisagra de la secuencia γ4 para evitar la formación de semimoléculas cuando el anticuerpo se expresa y produce en cultivos de células de mamífero (Schuurman y col., Mol Immunol.: 1 (2001)). Otros MAbs usados en los estudios fueron rituximab, adquirido, por ejemplo, de IDEC Pharmaceuticals Corp. (San Diego, CA), y hMN-14, o labetuzumab (antígeno anti-carcinoembrionario humanizado IgG1), proporcionado por Immunomedics, Inc. La construcción y caracterización de hMN-14, utilizado aquí como control de isotipo negativo, se han descrito anteriormente.
Células.
Se usaron líneas celulares ejemplares en varios estudios. Por ejemplo, las líneas de linfoma de Burkitt, Daudi, Raji y Ramos, se adquirieron de la American Type Culture Collection (Manassas, VA). Las líneas de células de linfoma no Burkitt se obtuvieron de la forma siguiente. RL y SU-DHL-6, que contienen la translocación cromosómica t (14; 18), se obtuvieron del Dr. John Gribben (Dana-Farber Cancer Institute, Boston, MA) y el Dr. Alan Epstein (Universidad del Southern California, Los Angeles, CA), respectivamente. Las líneas celulares SU-DHL-4, SU-DHL-10 y Karpas422 fueron proporcionadas por el Dr. Myron Czuczman (Roswell Park Cancer Institute, Buffalo, NY), y las líneas celulares WSU-FCCL y DoHH2 se obtuvieron del Dr. Mitchell Smith (Fox Chase Cancer Center, Filadelfia, PA). Las células se cultivaron como cultivos en suspensión en DMEM (Life Technologies, Gaithersburg, MD), complementado con suero bovino fetal al 10%, penicilina (100 U/ml), estreptomicina (100 μg/ml) y L-glutamina (2
mM) (medios completos).
La especificidad de unión al antígeno de los MAbs hL243.
La actividad de unión al antígeno y la especificidad de hL243γ1 se demostraron mediante un ensayo de unión a la superficie celular. Las células Raji se incubaron en PBS/BSA (1%) que contenía una concentración de saturación de hL243 purificado (20 μg/ml) durante 1 h a 4 ºC. Después del lavado, se detectó hL243γ1 unido a la superficie celular incubando las células Raji en el tampón que contiene un segundo anticuerpo conjugado con PE (IgG antihumana de cabra, fragmento Fc específico) y recontando, por ejemplo, en un sistema PCA Guave (Guava Technologies, Inc., Hayword, CA).
Se llevó a cabo un ensayo de unión celular de competición para evaluar la reactividad de hL243γ4P en relación con el mL243 original. Se incubó una cantidad constante de L243 o hL243γ4P murino marcado con 125I (100.000 cpm, ~10 μCi /μg) con células de linfoma humano (Raji, Daudi o Ramos) en presencia de concentraciones variables (0,2 -700 nM) de hL243γ4P purificado o L243 murino a 4 °C durante 1 - 2 h. Los MAbs no unidos se eliminaron lavando las células en PBS. La radioactividad asociada con las células se determinó después del lavado.
En un ejemplo, se determinó la constante de afinidad de unión al antígeno de hL243γ4P mediante el ensayo directo de unión a la superficie celular de los anticuerpos radiomarcados y el análisis de la gráfica de Scatchard. Para medir la unión al antígeno de la superficie celular, se prepararon dos conjuntos de células y se usaron en el ensayo de unión para estimar la unión no específica y la total de las radioactividades, respectivamente. Las células para la unión no específica se preincubaron con una cantidad en exceso de MAb no marcado para bloquear todos los sitios del antígeno de superficie antes de añadir el anticuerpo radiomarcado, mientras que las de la unión total se preincubaron en PBS. Después de la preincubación se añadieron cantidades variables de 125I-hL243γ4P o 125I-mL243 y se incubaron con 2 x 105 células de linfoma humano (Raji, Daudi o Ramos) a 4 °C durante 2 h, y los anticuerpos no unidos se eliminaron mediante lavado. Se contó la radiactividad asociada a la célula. La unión de la superficie celular específica del anticuerpo radiomarcado a una concentración dada de anticuerpo radiomarcado se calculó como: los recuentos de unión total restan los recuentos de unión no específica.
Ensayos de citometría de flujo.
Inmunofenotipificación: Se realizaron ensayos de inmunofluorescencia indirecta con el panel de líneas de células descrito anteriormente, usando IgG antihumana de cabra-FITC (Tago, Inc., Burlingame, CA) esencialmente como se describió anteriormente, y se analizaron mediante citometría de flujo usando un FACSCaliber (Becton Dickinson, San Jose, CA).
Ejemplo Análisis de apoptosis: El análisis de citometría de flujo del ADN celular se realizó después de la tinción con yoduro de propidio. Las células se pusieron en placas de 24 pocillos (5 x 105 células/pocillo) y posteriormente se trataron con MAbs (5 μg/ml). Se prepararon tres pocillos con cada MAb en el que se van a estudiar los efectos de la reticulación con anticuerpos anti-ratón de cabra o anti-humanos de cabra. Después de una incubación de 20 minutos con los MAbs primarios (37 ºC, 5% de CO2, se añadió segundo anticuerpo Fcγ-específico anti-IgG de ratón de cabra F(ab') 2 (Jackson Laboratories, West Grove, PA) a un pocillo de cada MAb primario para ajustar la concentración del segundo anticuerpo a 20 μg/ml. Del mismo modo se añadió F(ab') 2 anti-IgG humana Fcγ-específica de cabra (Jackson Laboratories) al segundo pocillo de cada MAb primario, y el volumen del tercer conjunto se ecualizó mediante la adición de medio. Después de una incubación de 48 h (37ºC, 5% de CO 2), las células se transfirieron a tubos de ensayo, se lavaron con PBS y después se resuspendieron en solución hipotónica de yoduro de propidio (50 mg/ml de yoduro de propidio en citrato de sodio al 0,1%, Triton X-100 al 0,1%). Las muestras se analizaron mediante citometría de flujo usando un FACSCaliber. El porcentaje de células apoptóticas se definió como el porcentaje de células con tinción de ADN antes del pico G1/G0 (hipodiploide).
Construcción y caracterización de hL243.
En un método ejemplar, se generaron dos MAbs anti-DR humanizados. Se diseñó hL243γ1 para tener regiones constantes IgG1/κ humanas y se construyó hL243γ4p reemplazando la secuencia codificadora de la región constante de la cadena pesada de la cadena γ1 humana con la de la cadena γ4 humana. Se introdujo una mutación puntual, Ser241Pro, en la región bisagra de la secuencia γ4 para reducir la formación de semimoléculas cuando se expresa el anticuerpo y se produce en cultivos de células de mamífero (Schuurman y col., Mol Immunol. 38: 1 (2001)). La capacidad de los dos anticuerpos L243 humanizados, γ1 y γ4P, para unirse a las células Raji se muestra en las Figuras 7, 8 y 17. En la Figura 7, la unión de hL243γ1 a las células Raji se bloquea específicamente mediante la preincubación de las células con L243 murino parental (mL243), indicando que la especificidad de unión al antígeno de mL243 se conserva en la versión humanizada.
En un ejemplo, se evaluó la reactividad de hL243γ4P con respecto a mL243 parental y se llevó a cabo un ensayo de competición de unión con las células. Se incubó una cantidad constante de mL243 o hL243γ4P marcado con 125I con células de linfoma humano (Raji, Daudi o Ramos) en presencia de concentraciones variables de hL243γ4P o mL243 purificados. Como se muestra en la Figura 8, los MAbs mL243 y hL243γ4P compitieron entre sí por la unión al antígeno de superficie celular, indicando el reconocimiento de un determinante antigénico común. hL243γ4P tenía una aparente avidez de unión aproximadamente 2 veces más fuerte que mL243 (EC 50 de ~ 7 frente a ~16,5 nM). El
número máximo de sitios de unión hL243γ4P y mL243 por célula y las constantes de disociación aparente de la unión de equilibrio se determinaron por análisis de la gráfica de Scatchard. Como se muestra en la Figura 17, la unión máxima de hL243γ4P y mL243 a células Daudi fue virtualmente la idéntica, aproximadamente 6 x 105 moléculas/célula, consistente con la unión de un antígeno común. Los valores constantes de disociación aparente para hL243γ4P y mL243 se calcularon para ser 2,6 nM y 14 nM, respectivamente. Se obtuvieron resultados similares con células Raji y Ramos (datos no mostrados).
Expresión de antígeno de células de linfoma cultivadas.
En un método ejemplar, se realizó un análisis de citometría de flujo usando tinción inmunofluorescente indirecta para mostrar que hL243γ4P se une a un panel de linfomas de células B humanas cultivadas. Se muestra una comparación con otros antígenos de superficie. Como se ve en la Tabla 4, el MAb hL243γ4P se une a todas las líneas celulares ensayadas. Se observó una expresión más fuerte en Daudi y Raji, pero el nivel de tinción de fluorescencia es fuerte en todas las líneas celulares. La unión se comparó con la de los MAbs humanizados frente a otros antígenos de células B (CD74, CD22, CD20), el MAb anti-CD20 quimérico murino-humano rituximab y un MAb anti-CEA humanizado (control negativo). La tinción con hL243γ4P es marcadamente mayor que la de CD22 y CD74 en las siete líneas de células. La tinción con CD20 fue más variable, como se muestra por la reactividad con los MAbs humanizados (hA20) y quiméricos (rituximab). Las líneas de Burkitt, Daudi, Raji y Ramos, expresan niveles intermedios de CD20, mientras que variaron las líneas de linfoma de células B grandes foliculares y difusas evaluadas. En comparación con la expresión de HLA-DR medida por la unión de hL243γ4P, SU-DHL-6 tiene una expresión de CD20 más alta, Namalwa y WSU-FSCCL expresión más baja de CD20, y RL expresión aproximadamente igual de ambos antígenos.
Ensayos de células efectoras.
En un ejemplo, la región Fc de hL43 se reemplazó con una región Fc de isotipo de IgG4 para anular las funciones de células efectoras a través del receptor de Fc y la unión al complemento. Se realizaron ensayos de CDC y ADCC para evaluar estas funciones.
En otro método ejemplar, las células CDC Daudi se incubaron con diluciones en serie de los anticuerpos hL243γ1, hL243γ4P, hA20 (como otro control positivo) y hMN14 (anti-CEA, control negativo) en presencia de complemento humano durante 2 h. Esto fue seguido por la adición de resazurina para evaluar la viabilidad celular. Se incluyeron controles de lisis no tratados y máximos. Se obtuvieron lecturas de fluorescencia 5 h después de la adición de resazurina. El nivel de fluorescencia obtenido se correlaciona directamente con el número de células viables. Estos resultados indican que hL243γ4P no produce un efecto citotóxico mediado por el complemento sobre las células en comparación con hL243γ1 (EC50 = 2,6 nM) y hA20 (EC50 = 0,66 nM) donde se observó CMC (Figuras 10 y 18). La inducción de ADCC se midió también en Raji, Daudi y SU-DHL-6 mediante la liberación de calceína AM. La actividad de hL243γ4P se comparó con la de L243 murino y rituximab, como control positivo. Como se esperaba, el rituximab y el L243 murino indujeron significativamente más lisis celular que los controles negativos (sin MAb y MN-14 murino y humanizado) y hL243γ4P no lo hizo (Figura 19).
Efectos antiproliferativos in vitro.
En un ejemplo, el efecto de hL243 sobre la proliferación celular fue evaluado usando el ensayo de absorción de 3H-timidina en Raji, FSCCL y Namalwa (Figura 20B y Tabla 5). El efecto de hL243γ4P se comparó con el de rituximab y con rituximab combinado con hL243γ4P, en presencia o ausencia de un anticuerpo anti Fc de entrecruzamiento. En FSCCL, que anteriormente se había demostrado que era relativamente insensible al rituximab, hL243γ4P produjo una inhibición de la proliferación significativamente mayor que el rituximab. En Ramos, la actividad de hL243 y rituximab fueron similares, y la combinación fue más efectiva que cualquiera de ellos por sí solo. La combinación puede tener un efecto sinérgico. Se requiere la reticulación con un anticuerpo Fc antihumano para que se observe una actividad antiproliferativa significativa en Ramos. En Namalwa, como con FSCCL, hL243γ4P dio una inhibición de la proliferación significativamente mayor que rituximab, y la combinación de rituximab y hL243γ4P produjo una inhibición de la proliferación significativamente mayor que cualquier MAb solo.
Evaluación de la inducción de apoptosis.
En un método ejemplar, el mecanismo de ensayos de muerte celular inducida por hL243γ4P fue evaluado midiendo varios marcadores de apoptosis. Estos incluyeron la inducción de la fragmentación del ADN, la tinción con anexina V/7-AAD, la medida de la caspasa-3 activada, la pérdida del potencial de membrana mitocondrial y la activación de la vía de supervivencia AKT.
En otro ejemplo, la fragmentación del ADN se evaluó mediante citometría de flujo en SU-DHL-6 y Namalwa. Las células se cultivaron con los MAbs durante 48 h con o sin un segundo MAb para la reticulación, seguido de tinción de ADN con yoduro de propidio. Las células se analizaron mediante citometría de flujo, y la fluorescencia positiva debajo de la región G1 representa la fragmentación del ADN y es una medida de la apoptosis. La actividad de hL243 γ4P se comparó con la de MAbs humanizados contra otros antígenos de células B, que incluyen anti-CD74 (hLL1), anti CD22 (hLL2, epratuzumab), anti-CD20 (hA20), así como el MAb quimérico murino-humano rituximab. Los
controles no incluyeron ningún primer MAb y el control negativo MAb anti-CEA humanizado, hMN-14. El hL243 γ4P indujo la apoptosis en ambas líneas celulares, a niveles similares o mayores que los otros MAbs anti-células B (Figuras 21A y 21B).
En una realización particular, se usó un kit (por ejemplo, el kit Guava Nexin™) para discriminar entre células muertas apoptóticas y no apoptóticas en células Daudi. En este ejemplo, el kit utiliza anexina-V-PE para detectar fosfatidilserina (PS) en la membrana externa de las células apoptóticas y un colorante impermeable a la célula 7-AAD como indicador de la integridad estructural de la membrana. El 7-AAD se excluye de las células vivas, sanas y de las células apoptóticas tempranas, pero se infiltra en las células muertas y apoptóticas de la última etapa. Como se muestra en la Figura 21B, los resultados de este estudio indicaron que hL243γ4P indujo apoptosis similar a mL243 después de un tratamiento de 4 h y 24 h. En cambio, el MAb anti-CD20 no indujo apoptosis mensurable en Daudi. Por tanto, el hiper-entrecruzamiento por un agente secundario, tal como anti-IgG humana o proteína A, puede usarse para la inducción de apoptosis por MAbs anti-CD20 en muchas líneas celulares incluyendo Daudi.
En otro ejemplo, los efectos de L243 humanizado y murino sobre el potencial mitocondrial fueron estudiados en diferentes células, a saber, SU-DHL-6, Daudi, Raji, WSU-FSCCL, RL y Namalwa. Los resultados se representan en la Figura 22, indicando que se observaron cambios apoptóticos en el potencial de membrana mitocondrial con MAbs L243 tanto murinos como humanizados. La reticulación con un segundo anticuerpo puede no ser necesaria, pero puede aumentar el efecto en 2 de las 6 líneas celulares evaluadas, FSCCL y Namalwa. La pérdida de potencial de membrana mitocondrial inducida por hL243γ4P fue mayor que la del MAb anti-CD20 (hA20), sin un agente de reticulación. Con la reticulación, los niveles de hA20 se incrementan a los de hL243γ4P en 3 de las 6 líneas celulares (RL, SU-DHL-6 y Daudi).
En un ejemplo, la inducción de caspasa-3 activada por L243 humanizado y murino se analizó mediante citometría de flujo en un panel de líneas celulares de linfoma. El resultado resumido en la Tabla 6 representa que tanto el L243 murino como el humanizado inducen la activación de la caspasa-3, a niveles similares, en ausencia de reticulación con el segundo anticuerpo. La inducción de la caspasa-3 activada, con los MAb L243 es en todas las líneas celulares mayor que en la de hA20. Con un segundo anticuerpo estos niveles se incrementan y el efecto de hA20 es similar al de hL243γ4P, excepto en Namalwa y FSCCL, dos líneas celulares que rutinariamente se observa que son relativamente insensibles a MAbs anti-CD20. La caspasa-3 escindida también se ensayó en Daudi durante un ciclo de tiempo de 2 días (Figura 23A). La actividad continúa aumentando durante aproximadamente 2 días de incubación de L243γ4P. No se realizaron valores del tiempo menores de 1 h.
En un ejemplo, se evaluó la intervención de AKT en el mecanismo de acción de L243 en 6 líneas celulares mediante citometría de flujo. Las células se incubaron con diversos MAbs durante 2 días, luego se ensayaron en relación con fosfo-AKT. Los resultados listados en la Tabla 7 muestran que L243 activa AKT en todas las líneas celulares. Los niveles de fosfo-AKT en células tratadas con anti-CD20, hA20, así como células tratadas con anti-CD74 y anti-CD22 (no mostradas) son similares a las células no tratadas en todas las líneas celulares. Para determinar el curso temporal de la activación de P-AKT, se incubaron células Daudi con MAbs durante diversos tiempos, se eliminaron los MAbs (por centrifugación) en momentos desde 0 min hasta aproximadamente 2 días (Figura 23B, Figura 23C). Estos resultados representan que la activación de AKT por L243 puede ocurrir más rápidamente de lo que puede medirse con este ensayo, porque incluso en el instante 0 los niveles de P-AKT son iguales al instante 2 días.
Eficacia terapéutica in vivo de hL243 en un modelo de xenoinjerto de linfoma no Hodgkin (Raji).
En un método ejemplar, se llevó a cabo un estudio terapéutico para comparar la eficacia in vivo de los anticuerpos monoclonales hL243γ4P y mL243 (isotipo IgG2a) en un modelo de xenoinjerto de linfoma no Hodgkin humano (Raji). El objetivo de este estudio era determinar si hL243γ4P puede mantener una eficacia antitumoral significativa en un modelo de xenoinjerto. Se inyectaron ratones SCID con 2,5 x 106 células Raji. La terapia con hL243γ4P o mL243 se inició un día después de la administración de la célula tumoral. Los resultados se muestran en la Figura 24. Ambos grupos de ratones a los que se inyectó solución salina o con anticuerpo de control no específico, hMN14, tuvieron un tiempo medio de supervivencia (MST) de 17 días. Todos los grupos de ratones tratados con L243 tanto humanizado como murino tuvieron una vida útil significativamente mejorada en comparación con los ratones a los que se inyectó solución salina o hMN14 (P < 0,0001). El tratamiento con varias dosis de hL243γ4P dio como resultado una relación dosis-respuesta, teniendo mejores tiempos de supervivencia los ratones que recibían dosis más altas. En el grupo de animales tratados con varias dosis de mL243 IgG2a, la tasa de curación estaba en el intervalo de 80 - 100%. Tabla 1. Comparación de la unión de Mabs humanos y murinos en Namalwa.
Tabla 2: Fenotipificación líneas de células (unión de MAbs humanizados o quiméridos en líneas de células B mediante ensayo FACS)
5 Tabla 3. Fenotipificación de aspirado de linfoma de perro.
Tabla 4. Unión de Mabs humanizados o quiméricos en líneas de células B. Se llevó a cabo un ensayo de citometría de flujo indirecta usando tinción de 2º anticuerpo específica de FITC-GAH Fc.
Tabla 5. Resumen de la actividad antiproliferativa de Mabs on y sin entrecruzamiento (% de inhibición de la absorción de 3H-timidina)
Tabla 6. Ensayo de Caspasa-3 escindida
Todas la COMPOSICIONES y/o MÉTODOS y/o APARATOS descritos y reivindicados aquí pueden hacerse y ejecutarse sin una experimentación excesiva a la luz de la presente descripción.
Lista de secuencias
<110> Goldenberg, David M.
Hansen, Hans J.
Qu, Zhengxing Hsing
Chang, Chein-Hsing
<120> Anticuerpos L243 humanizados
<130> 78258-33058
<140> pendiente
<141> 2006-03-02
<160> 25
<170> PatentIn version 3.3
<210> 1
<211> 324
<212> ADN
<213> anticuerpo anti-HLA-DR de ratón
<220>
<221> CDS
<222> (1)..(321)
<400> 1
<210> 2
<211> 107
<212> PRT
<213> anticuerpo anti-HLA-DR de ratón <400> 2
<210> 3
<211> 363
<212> ADN
<213> Anticuerpo anti-HLA-DR de ratón L243 <220>
<221> CDS
<222> (1)..(360)
<400> 3
<210> 4
<211> 120
<212> PRT
<213> Anticuerpo anti-HLA-DR de ratón L243 <400> 4
<210> 5
<211> 324
<212> ADN
<213> anticuerpo de ratón humanizado <220>
<221> CDS
<222> (1)..(324)
<400> 5
<210> 6
<211> 108
<212> PRT
<213> anticuerpo de ratón humanizado <400> 6
<210> 7
<211> 363
<212> ADN
<213> anticuerpo de ratón humanizado <220>
<221> CDS
<222> (1)..(363)
<400> 7
<210> 8
<211> 121
<212> PRT
<213> anticuerpo de ratón humanizado <400> 8
<210> 9
<211> 108
<212> PRT
<213> homo sapiens
<400> 9
<210> 10
<211> 121
<212> PRT
<213> Murinae gen. sp.
<400> 10
<210> 11
<211> 121
<212> PRT
<213> anticuerpo humanizado <400> 11
<210> 13
<211> 107
<212> PRT <213> homo sapiens <400> 13
<210> 14
<211> 108
<212> PRT
<213> mouse
<400> 14
<210> 15
<211> 108
<212> PRT
<213> ratón humanizado <400> 15
<210> 16
<211> 175
<212> ADN
<213> ratón humanizado
<400> 16
<210> 17
<211> 168
<212> ADN
<213> ratón humanizado
<400> 17
<210> 18
<211> 38
<212> ADN
<213> ratón humanizado
<400> 18
gtggtgctgc agcaatctgg gtctgagttg aagaagcc 38 <210> 19
<211> 38
<212> ADN
<213> ratón humanizado
<400> 19
tgaggagacg gtgaccaggg acccttggcc ccagtagt 38 <210> 20
<211> 155
<212> ADN
<213> ratón humanizado
<400> 20
<210> 21
<211> 159
<212> ADN
<213> ratón humanizado
<400> 21
<210> 22
<211> 38
<212> ADN
<213> ratón humanizado
<400> 22
gacattcagc tgacccagtc tccatcatct ctgagcgc 38
<210> 23
<211> 31
<212> ADN
<213> ratón humanizado
<400> 23
ccggcagatc tgcagcttgg tccctccacc g 31
<210> 24
<211> 47
<212> ADN
<213> ratón
<400> 24
ccgcggtcac atggcaccac ctctcttgca gcttccacca agggccc 47 <210> 25
<211> 33
<212> ADN
<213> ratón
<400> 25
ccggccgtcg cactcattta cccagagaca ggg 33