Processing

Please wait...

Settings

Settings

Goto Application

1. BRPI0607486 - anticorpo humanizado l243 contra hla-dr presente nas células hladr+,composição farmacêutica, kit e uso dos referidos anticorpos.

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ PT ]
Relatório Descritivo da Patente de Invenção para "ANTICORPOS HUMANIZADOS L234"
Referência Cruzada para Pedidos de Patente Relacionados
Este pedido de patente reivindica o benefício sob 35 U.S. C. [se- ção]119(e) do pedido de patente U.S. n 9 de série 60/657.695 depositado em 3 de março de 2005. O pedido de patente acima mencionado é aqui incorporado por referência em sua totalidade para todas as finalidades.
Campo
A presente invenção refere-se a anticorpos humanizados dire-cionados a um epitopo reconhecido por anticorpo monoclonal de camundongo L243. Em uma concretização, a presente invenção refere-se a composições e a métodos para a preparação e o uso de tais anticorpos. Em particular, a presente invenção provê um anticorpo monoclonal humanizado, hl_243, que é específico para o antígeno de leucócito humano (HLA) codificado na

i
região D do grupo de gene de HLA do principal complexo de histocompatibi-lidade (MHC), de outro modo conhecido com HLA-DR. O anticorpo inibe a proliferação de célula de HLA-DR+ e induz expressão e liberação de moléculas de TNF.
Antecedentes
Em seres humanos, o principal complexo de histocompatibilida-de (MHC) é o grupo de gene de antígeno de leucócito humano (HLA) no cromossoma 6, que é dividido em regiões chamadas D, B, C e A. A região D contém genes para as proteínas de Classe II, que estão envolvidos em cooperação e interação entre células do sistema imune. A região D era implica-da em muitas doenças incluindo a maioria de doenças auto-imunes.
( ,Um anticorpo, L243 (aqui em seguida mL243) é um anticorpo de anti-HLA-DR de lgG2a de camundongo. Este anticorpo pode ser de uso potencial no tratamento de doenças tais como doenças auto-imunes por dire-cionamento da região D do gene de HLA de camundongo. mL243 demonstra supressão potente de função imune in vitro e é monomórfico para a totalidade de HLA-DR. No entanto, problemas existem com a administração de anticorpos de camundongo a pacientes humanos, tal como a indução de uma resposta de anticorpo de anticamundongo humano (HAMA). Uma necessidade existe para anticorpos com a especificidade antigênica de ml_243, que podem ser administrados a indivíduos humanos.
Sumário
Uma concretização da presente invenção provê uma molécula de anticorpo humanizada recombinante tendo especificidade para o epitopo reconhecido pelo anticorpo monoclonal de camundongo ml_243. Este epitopo pode ser determinante antigênico dependente da cadeia de DR-alfa. De acordo com esta concretização, o anticorpo pode ser um anticorpo enxerta-do com CDR humanizado.
Por exemplo, em uma concretização, a molécula de anticorpo humanizada tendo especificidade para o epitopo reconhecido pelo anticorpo monoclonal de camundongo ml_243 tem um sítio de ligação de antígeno em que pelo menos uma das regiões de determinação complementaridde (C-DRs) do domínio variável é derivado do anticorpo monoclonal de camundongo ml_243 (MAb L243) e as partes derivadas de imunoglobulina humana ou um seu análogo. Em uma concretização particular da presente invenção, todas as três CDRs de cadeia pesada e leve de um anticorpo humanizado são derivadas de mAb ml_243. Em uma outra concretização da presente in-venção, a molécula de anticorpo humanizada pode ser conjugada a um efe-tor ou uma molécula repórter.
Em um exemplo, a presente invenção provê um anticorpo L243 humanizado tendo um domínio variável de cadeia pesada onde as regiões de CDR1 , CDR2, e CDR3 e um ou mais resíduos de 27, 38, 46, 68 e 91 do domínio variável são oriundas da cadeia pesada de anticorpo monoclonal de camundongo ml_243 e o restante dos domínios de estrutura de imunoglobulina são oriundos de uma ou mais de cadeias pesadas humanas. De acordo com este exemplo, o anticorpo pode se ligar a pelo menos um epitopo de HLA-DR sobre células de HLA-DR+, e aumenta a morte das células. Em uma concretização particular, morte de célula pode ser aumentada onde nem a-dendos citotóxicos nem mecanismos efetores imunológicos são necessários para a morte.

Em uma outra concretização da presente invenção, anticorpo L242 humanizado pode incluir domínio variável de cadeia leve onde regiões de CDR1 , CDR2, e CDR3 e um ou mais resíduos de estrutura de 27, 38, 46, 68 e 91 do domínio variável de cadeia pesada são oriundos do da cadeia pesada de anticorpo monoclonal de camundongo ml_243 e o restante dos domínios de estrutura de cadeia pesada de imunoglobulina são oriundos de uma ou mais cadeias pesadas humanas. De acordo com esta concretização, um anticorpo humanizado L243 pode incluir um domínio variável de cadeia pesada e um domínio variável de cadeia leve onde as regiões de CDR1 , CDR2, e CDR3 e um ou mais resíduos de estrutura 37, 39, 48 e 49 do domínio variável de cadeia leve são oriundos da cadeia leve de anticorpo monoclonal de camundongo ml_243 e o restante dos domínios de estrutura de cadeia leve de imunoglobulina são oriundos de uma ou mais de cadeias leves. Além disso, o anticorpo pode ser ligar a pelo menos um epitopo de HLA- DR sobre células de HLA-DR+, e aumenta morte das células. Em uma concretização particular, morte de célula pode ser aumentada onde nem adendos citotóxicos nem mecanismos efetores imunológicos são necessários para a morte.
Em uma concretização da presente invenção, qualquer um dos anticorpos como descritos supra podem ser usados em uma composição farmacêutica. De acordo com esta concretização, uma composição farmacêutica incluindo um ou mais anticorpos descritos aqui podem ulteriormente conter agentes terapêuticos como descritos abaixo.
Além disso, uma concretização na presente invenção provê mo-léculas de ácido nucléico que codifica uma ou mais das composições de anticorpo descritas, conjugados e proteínas de fusão como descritos infra. Ve-tores de expressão e células hospedeiras esses ácidos nucléicos podem também ser incluídos.
De acordo com estas concretizações, métodos para a produção dos anticorpos tal como o uso de células hospedeiras cultivadas em um meio de crescimento adequado para a geração dos anticorpos pode ser incluído.

Em uma concretização da presente invenção, um ou mais dos anticorpos descritos da invenção podem ser usados em uma composição farmacêutica para as finalidades de diagnóstico e/ou terapêutico. Por exemplo, um ou mais anticorpos podem ser administrados em uma composição terapêutica ou farmacêutica a um indivíduo que necessita de tal tratamento (por exemplo, um indivíduo tendo uma doença imune tal como uma doença auto-imune).
Em uma concretização mais particular da presente invenção, o anticorpo ml_243 humanizado tem um domínio variável de cadeia pesada tendo a sequência mostrada na figura 4 e/ou um domínio variável de cadeia leve tendo a sequência mostrada na figura 3.
Em uma concretização, a composição farmacêutica pode ulteriormente conter uma ou mais moléculas de ligação adicionais que especificamente se ligam a um ou mais antígenos selecionados do grupo que con-siste em CD4, CDS, CDS, CD14, CD15, CD19, CD20, CD21 , CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD66 (a,b,c,d), CD74, CD80, CD126, CD138, CD154, B7, MUC1 , MUC2, MUC3, MUC4, MUC16, 1 a, HM1.24, tenascina, VEGF, EGFR, CEA, CSAp, ILGF, fator de crescimento placental, Her2/neu, anidrase carbónica IX, IL-6, SIOO, MART-1 , TRP-1 , TRP-2, gplOO, amilóide e suas combinações, onde a molécula de ligação adicional é dada antes, com, ou depois de qualquer composição farmacêutica descrita aqui contendo uma composição de anticorpo humanizado L243 e/ou um veículo de fornecimento para o anticorpo.
Em uma concretização, uma composição farmacêutica para a administração a um indivíduo que necessita de tal tratamento pode conter um anticorpo L243 humanizado e um ou mais peptídeos, lipídios, veículos poliméricos, micelas, nanopartículas ou suas combinações; e um ou mais efetores.
Um ou mais dos métodos descritos da presente invenção podem ser usados para tratar um doença incluindo mas não limitada a linfomas de não Hodgkin de célula B, leucemias linfóides aguda e crónica de célula B, linfoma de Burkitt, linfoma de Hodgkin, leucemia de célula pilosa, leucemias mileóides aguda e crónica, linfomas de célula T e leucemias, mileoma múltiplos, macroglobulinemia de WaldenstronYs, carcinomas, melanomas, sarcomas, gliomas, e cânceres de pele. Os carcinomas podem ser seleciona-dos do grupo que consiste em carcinomas da cavidade oral, do trato gastro-intestinal, do trato pulmonar, de mama, de ovário, de próstata, uterino, de bexiga urinária, de pâncreas, de fígado, de vesícula biliar, de pele, e testes. Além disso, um ou mais métodos podem ser usados para tratar doenças au-to-imunes, por exemplo, púrpura trombocitopênica idiopática aguda, púrpura trombocitopênica idiopática crónica, dermatose, coréia de Sydenham, mias-tenia grave, lúpus eritematoso sistémico, nefrite de lúpus, febre reumática, síndromes poliglandular, bulbo penfigóide, diabetes mellitus, púrpura de He-noch-Schonlein, nefrite pós-estreptocócica, eritema nodoso, arterite de Ta-kayasu, doença de Addison, artrite reumatóide, esclerose múltipla, sarcoido-se, colite ulcerativa, eritema multiforme, nefropatia de IgA, poliarterite nodo-sa, espondilite anquisolante, síndrome de Goodpasture, tromboangite oblite-rante, síndrome de Sjorgren, cirrose biliar primária, tiroidite de Hashimoto, tirotoxicose, escleroderma, hepatite ativa crónica, polimiosi-te/dermatomiosite, policondrite, pênfigo vulgar, granulomatose de Wegener, nefropatia membranosa, esclerose lateral amiotrópica, tabes dorsais, polimi-algia/arterite de célula gigante, anemia perniciosa, glomerulonefrite rapidamente progressiva, psoríase, ou alveolite fibrosante.
Em uma concretização, uma composição farmacêutica da presente invenção pode ser usada para tratar um indivíduo tendo leucemia tal como leucemia linfocítica aguda, leucemia linfocítica aguda crónica, leuce-mia milóidè crónica ou leucemia milóide aguda.
Em uma concretização, uma composição farmacêutica da presente invenção pode ser usada para tratar um indivíduo tendo doença metabólica, tal como amiloidose, ou um doença neurodegenerativa, tal como doença de Alzheimer. Além disso, uma composição farmacêutica da presente invenção pode ser usada para tratar um indivíduo tendo uma distúrbio des-reguladora imune.
Outros objetos, características e vantagens da presente inven- ção se tornarão evidentes a partir da seguinte descrição detalhada. Seria entendido, no entanto, que a descrição detalhada e os exemplos específicos, enquanto indicando concretizações preferidas da invenção, são dadas apenas a título de ilustração, uma vez que mudanças e modificações dentro do espírito e do escopo da presente invenção se tornarão evidentes por aqueles versados na técnica a partir desta descrição detalhada-Breve Descrição dos Desenhos
Os seguintes desenhos fazem parte do presente relatório e estão incluídos para ulteriormente demonstrar certas concretizações da pre-sente invenção. As concretizações podem ser melhor entendidas por referência a um ou mais destes desenhos em combinação com a descrição detalhada de concretizações específicas apresentadas aqui.
A figura 1 (também SEQ ID NO: 1 e SEQ ID NO: 2) ilustra uma codificação de DNA exemplar e sequências de aminoácidos de VK do anti-corpo de anti-HLA-DR de camundongo L243. As regiões de CDR putativas são sublinhadas e são indicadas. Resíduos de nucleotídeos são numerados sequencialmente. Numeração de molécula de Ig de Kabat é usado parar resíduos de aminoácidos. A numeração para os resíduos com uma letra (no topo) é o número de resíduos precedentes mais a letra, por exemplo, o nú-mero para T após N52 é 52A; o números para N, N e L após 82 são 82A, 82B e 82C, respectivamente.
A figura 2 (também SEQ ID NO: 3 e SEQ ID NO: 4) ilustra uma codificação de DNA exemplar e sequências de aminoácidos de VH do anticorpo de anti-HLA-DR de camundongo L243. As regiões de CDR putativas são sublinhadas e são indicadas. Resíduos de nucleotídeos são numerados sequencialmente. Numeração de molécula de Ig de Kabat é usada para resíduos de aminoácidos como descrito acima.
A figura 3 (também SEQ ID NO: 5 e SEQ ID NO: 6) ilustra um DNA exemplar e sequências de aminoácidos de L243 VR humanizado. As seções sublinhadas e negritadas das sequências de aminoácidos indicam as CDRs como definidas pelo esquema de numeração de Kabat.
A figura 4 (também SEQ ID NO: 7 e SEQ ID NO: 8) ilustra um DNA exemplar e sequências de aminoácidos para L243 VH humanizado. As seções sublinhadas e negritadas das sequências de aminoácidos indicam as CDRs como definidas pelo esquema de numeração de Kabat.
A figura 5 (também SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 e SEQ ID NO: 12) ilustra um alinhamento de sequência de aminoácido exemplar de RF-TS3 e NEWM humano (estrutura 4), cadeia de VH de L243 e hl_243 de camundongo. Pingos indicam os resíduos em L243 e sua versão humanizada é idêntica aos resíduos correspondentes em RF-TS3 ou NEWM. Tracejados representam lacunas introduzidas para auxiliar o ali-nhamento. Caixas representam as regiões de CDR. Tanto resíduos de N-quanto C-terminais (sublinhados) de hl_243 são fixados pelo vetor representante usado. Portanto, os resíduos terminais correspondentes de L243 não são comparados com aquela da sequência de VH humana.
A figura 6 (também SEQ ID NO: 13, SEQ ID NO: 14 e SEQ ID NO: 15) ilustra um alinhamento de sequência de aminoácido exemplar de cadeias de VK hl_243, Le243 de camundongo e REI de ser humano. Pontos indicam os resíduos em L243 que são idênticos aos resíduos correspondentes em REI. Tracejados representam lacunas introduzidas para auxiliar o alinhamento. Caixas representam as regiões de CDR. Tanto resíduos N-quanto C-terminais (sublinhados) de hl_243 são fixados pelo vetor representante usado. Portanto, os resíduos terminais correspondentes de L243 não são comparados com aquela da sequência humana. Esquema de numeração de Kabat é usado.
A figura 7 ilustra uma especificidade de ligação de antígeno e-xemplar de hl_243. Células Raji, pré-incubadas com uma concentração saturada de ml_234 (para bloqueamento de sítios de antígeno de superfície de célula ("Ag")) ou sem, foram ressuspensas em PBS contendo 1% de BSA e 10 g/ml de hl_243 purificado e foram incubadas por 1 h a 4°C. Depois da lavagem, as células foram ressuspensas em PBS contendo 1% de BSA e IgG de anti-humana de cabra marcada com PE, anticorpo específico de fragmento de Fc. Depois de outra incubação a 4°C por 30 min, as células foram contadas em PCA de Guava. (A) mostra ligação específica de hl_243 a células de linfoma humana de Raji (traço vermelho), que foi bloqueada por pré-incubação das células com ml_243 (traço azul). (B) é um controle de ligação negativo com anticorpo de anti-CEA (hMN-14) em lugar de hl_243 sob condições idênticas.
A figura 8 ilustra afinidades de ligação de Ag exemplares em comparação com hl_243y4P e ml_243 em um ensaio de ligação de superfície de célula competitivo. Uma quantidade constante (100.000 cpm, -10 uCi/ug) de ml_234 marcado com 125-l (A) ou hL243y4P (B) foi misturado com concentrações variáveis (0,2-700 nM) de hl_243y4P não marcado(A) ou ml_2343 (·). As misturas foram adicionadas a células de Raji e foram incubadas a temperatura ambiente por 2 h. As células foram lavadas para remover anticorpos não ligados e a radioatividade associada às células foi contada. ΙιΙ_243γ4Ρ e ml_234 mostram competir entre si para a ligação a Ag de superfície de célula. Em ambos os casos hl_243y4P pareciam se ligar a células de Raji mais fortemente do que ml_243.
A figura 9 ilustra afinidades de ligação de Ag exemplares de hL243y4P e ml_243 determinadas por ligação de saturação de superfície de célula direta e análise de diagrama de Scachard. Concentrações variáveis de hL243y4P ou ml_234 marcado com 25l (») ou (A) foram incubadas com 2x105 células de linfoma humanas de Daudi a 4°C por 2 h, e radioatividade não ligada foi removida de suspensões de célula por lavagem. A radioatividade associada a célula foi contada, ligação específica de anticorpo radio-marcado à antígeno de superfície de célula calculado, e análise de diagrama de Scatchard foi então aplicada para determinar o número máxima de sítios de ligação por célula e constante de afinidade de ligação de antígeno aparente: A ligação máxima de ml_234 ou hL243y4P a superfície de célula de Daudi era 6x106 moléculas/célula; As constantes de dissociação determinadas para ml_234 ou hL243y4P eram de 14 e 2,6 nM, respectivamente.
A figura 10 ilustra um h243 exemplar que é eficaz na morte de células alvo na presença de complemento de soro humano: células de Daudi foram incubadas com hl_ 243, hL243y4P, hA20 (um controle positivo), e hMN-14 (um controle negativo) na presença de complemento de soro numa- no. ηΙ_243γ4Ρ foi mostrado não produzir qualquer citotoxicidade induzida por complemento.
A figura 11 ilustra uma liberação de LDH exemplar (A) e % de lise de célula (B) por ADCC como observado para hl_243, hL243y4P, hA20 (controle positivo) e 1 hMN-14 (controle negativo).
As figuras 12A-B ilustram ensaios proliferativos in vitro exemplares sobre linhas de células de Daudi e Raji no fim de 2 dias.
As figuras 13A-B ilustram ensaios proliferativos in vitro exemplares sobre linhas de células de Daudi e Raji no fim de 3 dias.
A figura 14 ilustra tempos de sobrevivência média exemplares para camundongos SCI D portadores de tumor injetados com hl_243y4P.
A figura 15 ilustra uma indução comparativa exemplar de apo-potse em células de linfoma de cachorro (medida como % de células com um conteúdo de DNA de fase sub GO/G1 ) causado por L243, hl_243 (isótipo de lgG4), hMN-14 (IgG de MN-14 humanizada), e Ag8 (mAb derivado de mieloma de camundongo). L243 e hl_243 causaram apoptose quando reticulados com anticorpos anticamundongo de cabra (GAM) de anti-humano de cabra (GAH) e, respectivamente.
A figura 16A-B ilustra efeitos antiproliferativos exemplares de anticorpos humanizados (hl_L1 , hl_L2, Rituximab, hA20, hMN-14 e hl_243 (isótipo de lgG4), com e sem IgG de anti-humano de cabra (GAH)) sobre linha de célula de linfoma de célula B de ser humano de Namalwa como determinado por ensaio de captação de 3H-timidina.
A figura 17 ilustra características de ligação de hl_243y4P em relação ao L243 de camundongo parental.
As figuras 18A e 18B ilustram ensaios de CDC em linhas de células de Raji, de Ramos e de Namalwa quando expostas a vários anticorpos descritos aqui.
A figura 19 ilustra ensaios de ADCC e liberação de calceína AM quanto células de SUJDHL-6 são expostas a vários anticorpos descritos a-qui.
As figuras 20A e 20B ilustram efeitos antiproliferativos de hl_243y4P sobre várias linhas de células descritas aqui. A. estudos de MTT e B. ensaios de captação de 3H-timidina, No eixo rótulo de B. hl_243 refere-se à forma γ4Ρ.
As figuras 21 A e 21 B ilustram indução de células mortas por a-poptose que são representadas por células claras e apoptóticas são ilustradas em sólido. A. mediçãode DNA de Sub GO em células de SU-DHL-6 e de Namalwa e B. Anexina V/7-ADD a 4 e 24 horas. Células usadas tinham 97% de viabilidade antes do tratamento.
A figura 22 ilustra potencial de membrana mitochondrial usando-se um ensaio de JC-I em várias linhas de células.
As figuras 23A e 23B ilustram uma caspase-3 clivada (A) e P-AKT (B) estudos de curso de tempo em células de Daudi.
A figura 24 ilustra terapia de camundongos SCID que portam Raji com L243 e Ι_243γ4Ρ de camundongos.
Descrição Detalhada
Na seguinte seção, vários métodos são descritos para detalhar várias concretizações da invenção. Será óbvio por aquele versado na técnica que a prática das várias concretizações não exigem o emprego de todos ou mesmo alguns dos detalhes específicos delineados aqui, mas, sim, con-centrações, tempos e outros detalhes específicos podem ser modificados através de experimentação rotineira. Em alguns casos, métodos ou componentes bem-conhecidos não eram incluídos na descrição a fim de prevenir mascaramento desnecessário das várias concretizações.
Em uma concretização da presente invenção anticorpos de ca-mundongo humanizados são providos que se ligam a HLA-DR. Em uma concretização particular, anticorpo ml_243 humanizados podem ser providos que se ligam a HLA-DR mas que reduziam imunogenicidade em comparação com os anticorpos de camundongo correspondentes. De acordo com esta concretização, os anticorpos podem inibir proliferação de células (ou induzem morte de célula) que expressam moléculas de HLA-DR, tais como células de linfoma. Alternativamente, anticorpos descritos aqui podem ser usados para se ligar a uma molécula alvo e aumentam a probabilidade de morte de célula. São providos composições farmacêuticas contendo os anticorpos e métodos de tratamento de doenças associadas a proliferação de células de HLA-DR+.
ml_243 é um anticorpo monoclonal anteriormente descrito por Lampson & Levy (J. Immunol. (1980) 125 293). As sequências de aminoácidos das regiões variáveis de cadeia leve e pesada são mostradas nas figuras 1 e 2 (também SEQ. ID. 1 e 2 respectivamente). ml_243 foi depositado na American Type Culture Collection, Rockville, MD, sob número de acesso ATCC HB55.
Na descrição que se segue, numerosos termos podem ser usaos e as seguintes definições são providos para facilitar o entendimento da presente invenção.
A não ser que de outra maneira especificado, "um", "uma", "uns" ou "umas" significa "um ou mais".
Como usado aqui a especificação, "indivíduo" ou "indivíduos" pode incluir mas não é limitados a mamíferos tais como seres humanos ou mamíferos, por exemplo, cachorros, gatos, furões, coelhos, porcos, cavalos ou gado bovino.
"Citotoxicidade mediada por célula dependente de anticorpo" ou "ADCC" é uma reação mediada por célula em que células citotóxicas não específicas que expressam receptores de Fc (células assassinas naturais, neutrófilos e macrófagos) reconhecem anticorpo ligado sobre células alvo e subsequentemente causam lise das células alvo. As células primárias para a mediação de ADCC são as células assassinas naturais (expressam o Fc-DRIII apenas) e monócitos (expressam FcDRI, FcDRIl e FcDRIII).
"Citotoxicidade dependente de complemento" ou "CDC" refere-se à lise de um alvo na presença de complemento. A trajetoria de ativação de complemento é inicada pela ligação do primeiro componente do sistema de complemento (Clq) a uma molécula (por exemplo, um anticorpo) comple-xada com um antígeno cognato.
O "receptor de Fc" ou "FcR" é usado para descrever um receptor que se liga à região de um anticorpo. Tanto CDC quanto ADCC exigem a porção de Fc de um MAb e o efeito de ADCC pode ser aumentado por aumento da afinidade de ligação para FcyR (receptores de Fc de IgG) sobre células efetoras (Shinkawa, e outros, J. Biol. Chem. 278: 3466-3473, 2003; Shields e outros, J. Biol Chem. 211 : 26733-26740, 2002; Shields e outros, J. Biol. Chem. 276: 6591 -6604, 2002; Davies e outros, Biotechnol. Bioeng. IA: 288-294,2001 ; e Umana e outros, Nature Biotechnol. 176-180, 1999).
Uma "célula efetora" refere-se a qualquer tipo de célula que é capaz de realizar função(ões) de célula efetora. É bem-conhecido que células efetoras tendo funções imunes especializadas diferentes podem ser dis-tinguidas entre si com base em sua expressão diferencial de uma ampla variedade de antígenos de superfície de célula, tais como muitos dos antíge-nos descritos aqui aos quais polipeptídeos de domínio de ligação podem especificamente se ligar. Células efetoras incluem mas não são limitadas a qualquer célula que é capaz de diretamente mediar uma atividade que é um componente de função de sistema imune, incluindo células tendo tal capacidade natural ou como um resultado de engenheiramento genético. Uma célula efetora compreende um receptor de superfície de célula para uma imu-noglobulina, tal como um receptor para uma região constante de imunoglo-bulina e incluindo a classe de receptores comumente chamados de "recepto-res de Fc" (FcR). Células que são capazes de mediar ADCC são exemplos de células efetoras. Outros exemplos incluem células assassinas naturais (NK), linfócitos T de infliltração de tumor (TIL), linfócitos T citotóxicos (CTL) e células granulocíticos tais como células que compreendem mecanismos de resposta alérgica. Células efetoras podem também afetar células de origens hematopoiéticas incluindo células a vários estágios de diferenciação dentro de linhagens mielóides e linfóides e que podem (mas não necessitam) expressar um ou mais tipos de superfície de célula funcional FcR, tais como linfócitos T, linfócitos B, células de NK, monócitos, macrófagos, células den-dríticas, neutrófilos, basófilos, eosinófilos, mastócitos, plaquetas, eritrócitos e precursores, progenitores (por exemplo, células tronco hematopoiéticas), formas quiescentes, ativadas e maduras de tais células. Outras células efetoras podem incluir células de origem não hematopoiética que são capazes de mediar funções imunes, por exemplo, células endoteliais, ceratinócitos, fibroblastos, osteoclatos, células epiteliais e outras células. Células efetoras imunes podem também incluir células que mediam eventos citotóxicos e ci-toestáticos, ou eventos endocíticos, eventos fagocíticos ou pinocitóticos, ou aquela indução de efeito de apoptose, ou aquele efeito de imunidade microbiana ou neutralização de infecção microbiana, ou células que mediam rea-ções alérgicas, inflamatórias, hipersensibilidades e/ou auto-imunes.
Um anticorpo que "inibe crescimento" é um que inibe o crescimento de células doentes in vitro e/ou in vivo. Por inibição de crescimento de células doentes, a percentagem de células em fase S é reduzida. Percentagem preferida de inibição de crescimento por um anticorpo da presente invenção pode ser maior do que 20%, de preferência maior do que 50% a uma concentração de anticorpo de cerca de 0,5 g/mL - 20 μg/mL in vitro, e a uma dose em pacientes adultos de cerca de 0,5 mg/kg - 15 mg/kg.
Um "anticorpo" como usado aqui refere-se a uma molécula de imunoglobulina de comprimento total (isto é, de ocorrência natural ou formada por processos recombinatoriais de fragmento de gene de imunoglobulina normal) (por exemplo, um anticorpo de IgG) ou uma porção imunologicamente ativa (isto é, ligação específica) de uma molécula de imunoglobulina, como um fragmento de anticorpo. O termo "anticorpo" também inclui anticorpos "humanizados" e ainda anticorpos totalmente humanos que podem ser produzidos por métodos de transfecção de cromossoma e gene, exibição de fago, bem como por outros meios. Este termo também inclui anticorpos mo-noclonais, anticorpos policlonais, anticorpos multivalentes, anticorpos multi-específicos (por exemplo, anticorpos biespecíficos).
Uma "resposta imunogênica" ou "resposta antigênica" é uma que resulta na produção de anticorpos dirigida a um composto depois que as células apropriadas foram postas em contato com os mesmos. O composto que é usado para eliciar uma resposta imunogênica refere-se a um imunó-geno ou antígeno. Os anticorpos produzidos na resposta imunogênica especificamente se ligam a imunógeno usado para eliciar a resposta.
O composto que é usado para eliciar uma resposta imunogênica é chamado de um antígeno ou um imunógeno. Um "epitopo" ou "determinante antigênico" é uma área sobre a superfície de um imunógeno que estimula uma resposta imune específica dirigida ao epitopo. Em proteínas, proteína particularmente desnaturadas, um epitopo é tipicamente definido e represen-tado por uma sequência de aminoácidos contígua. No entanto, no caso de proteína "nondenamred", epitopos também incluem estruturas, tais como sítios ativos, que são formados pelo dobramento tridimensional de uma proteína de modo que tais aminoácidos oriundos de porções separadas da sequência de aminoácidos da proteína são postos em contato físico próximos entre si.
Moléculas de anticorpo (de tipo selvagem) de ocorrência natural são moléculas de forma Y que consiste em quatro cadeias de polipeptídeo, duas cadeias pesadas idênticas e duas cadeias leves idênticas, que são co-valentemente ligadas entre si por ligações de dissulfeto. Ambos os tipos de cadeias de polipeptídeo têm regiões constantes, que não variam ou variam minimamente entre anticorpos da mesma classe (isto é, IgA, IgM, etc), e regiões variáveis. As regiões variáveis são únicas para um anticorpo particular e compreendem um elemento de reconhecimento para um epitopo. As regiões carbóxi-terminais de tanto cadeias leves quanto pesadas são con-servadas em sequência e são chamadas as regiões constantes (também conhecidas como domínios C). As regiões amino-terminais (também conhecidas como domínios V) são variáveis em sequência e são responsáveis pela especificidade de anticorpo. O anticorpo especificamente reconhece e se liga a um antígeno principalmente através de seis regiões de determinação de complementaridade curtas (CDRs) localizadas em seus domínios V.
Cada cadeia leve de um anticorpo está associada a uma cadeia pesada, e as duas cadeias estão ligadas por uma ponte de dissulfeto formada entre resíduos de cisteína na região carbóxi-terminal de cada cadeia, que é distai a partir da região amino terminal de cada cadeia que constitui sua porção do domínio de ligação de antígeno. Moléculas de anticorpo são ulteriormente estabilizadas por pontes de dissulfeto entre as duas cadeias pesadas em uma área conhecida como a região principal, nas localizações mais próximas do terminal carbóxi das cadeias pesadas do que as localizações onde as pontes de dissulfeto entre as cadeias leves e pesadas são produzidas. A região principal também provê flexibilidade para as porções de ligação de antígeno de um anticorpo.
A especificidade de ligação de antígeno de um anticorpo pode ser determinada por suas regiões variáveis localizadas nas regiões amino terminais das cadeias leves e pesadas. As regiões variáveis de uma cadeia leve e cadeia pesada associada formam um "domínio de antígeno" que reconhece um epitopo específico; um anticorpo assim tem dois domínios de ligação de antígeno. Os domínios de ligação de antígeno em um anticorpo de tipo selvagem referem-se ao mesmo epitopo de uma proteína imunogêni-ca, e um anticorpo de tipo selvagem simples é assim capaz de ligar duas moléculas da proteína imunogênica ao mesmo tempo. Assim, um anticorpo de tipo selvagem é monoespecífico (isto é, dirigido a um único antígeno) e divalente (isto é, capaz de ligar duas moléculas de antígeno).
"Anticorpos policlonais" são gerados em uma resposta imunogênica a uma proteína tendo muitos epitopos. Uma composição (por exemplo, soro) de anticorpos policlonais assim inclui uma variedade de anticorpos diferentes que referem-se ao mesmo e a diferentes epitopos dentro da proteí-na. Métodos para a produção de anticorpos policlonais são conhecidos na técnica (ver por exemplo, Cooper e outros, Seção III do capítulo 11 in: Short Protocols in Molecular Biology, 2nd Ed., Ausubel e outros, eds., John Wiley e Sons, New York, 1992, págs. 11 -37 a 11 -41 ).
"Anticorpos antipeptídeos" (também conhecidos como "anticor-pos não específicos") são gerados em uma resposta humoral a um polipep-tídeo imunogênico curto (tipicamente, de 5 a 20 aminoácidos) que corresponde a poucos epitopos isolados (de preferência um) a partir do qual ele é derivado. Uma pluralidade de anticorpos de antipeptídeo inclui uma variedade de anticorpos diferentes dirigidos a uma porção específica da proteína, isto é, a uma sequência de aminoácidos que contém pelo menos um, de preferência apenas um, epitopo. Métodos para a produção de anticorpos de antipeptídeo são conhecidos na técnica (ver por exemplo, Cooper e outros, Section lli de capítulo 11 in: Short Protocols in Molecular Biology, 2nd Ed., Ausubel e outros, eds., John Wiley e Sons, New York, 1992, págs. 11 -42 a 11-46).
Um "anticorpo monoclonal" é um anticorpo específico que reco-nhece um epitopo específico simples de uma proteína imunogênica. Em uma pluralidade de um anticorpo monoclonal, cada molécula de anticorpo é idêntica às outras na pluralidade. A fim de isolar um anticorpo monoclonal, uma linha de célula clonal que expressa, exibe e/ou secreta um anticorpo monoclonal particular é primeiramente identificada; esta linha de célula clonal po-de ser usada em um método de produção dos anticorpos da presente invenção. Métodos para a preparação de linhas de células clonais e de anticorpos monoclonais expressos desse modo são conhecidos na técnica (ver por e-xemplo, Fuller e outros, Section II de capítulo 11 in: Short Protocols in Molecular Biology, 2nd Ed., Ausubel e outros, eds., John Wiley e Sons, New York, 1992, págs. 1 1 -22 a 11 -11 -36).
Um "anticorpo nu" é uma molécula de anticorpo intacta que contém nenhuma outra modificação tal como conjugação com a toxina, ou com um quelato para a ligação a um radionuclídeo. A porção de Fc do anticorpo nu pode prover funções efetoras, tais como fixação de complemento e ADCC (citotoxicidade de célula dependente de anticorpo), que ajusta mecanismos em ação que pode resultar em lise de célula. Ver por exemplo, Mar-krides, Therapeutic inhibition of the complement system, Pharmacol. Rev. 50:59-87, 1998. Em uma concretização, a ação terapêutica de um anticorpo pode exigir que as funções efetoras da região de Fc (ver por exemplo, Golay e outros, Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 e CD59 regulate complement-mediated cell lysis, Blood 95: 3900-3908, 2000).
Em uma outra concretização, a porção de Fc pode não ser necessária ou em alguns casos desejadas para um tratamento terapêutico de um indivíduo. De acordo com esta concretização, outros mecanismos, tais como apóptose, pode ser evocada. Vaswani e Hamilton, Humanized antibo-dies as potential therapeutic drugs. Ann. Allergy Asthma Immunol. 81 : 105- 119,1998.
Um "fragmento de anticorpo" é uma porção de um anticorpo intacto tais como F(ab')a, F(ab)2, Fab', Fab, Fv, sFv e similares. Independentemente da estrutura, um fragmento de anticorpo liga com o mesmo antíge- no que é reconhecido pelo o anticorpo de comprimento total. Por exemplo, um fragmento de anticorpo monoclonal de anti-CD20 liga com um epitopo de CD20. O termo "fragmento de anticorpo" também inclui qualquer proteína genética ou sinteticamente engenheirada que age como um anticorpo por ligação a um antígeno específico para formar um complexo. Por exemplo, fragmentos de anticorpo incluem fragmentos isolados que consiste nas regiões variáveis, tais como os fragmentos de "Fv" que consistem nas regiões variáveis das cadeias leves e pesadas, moléculas de polipeptídeo de cadeia simples recombinantes em que regiões variáveis leves e pesadas estão ligadas por um ligante de peptídeo ("proteínas de scFv "), e unidades de reco-nhecimento mínimas que consistem nos resíduos de aminoácido que imitam a região hipervariável.
Fragmento de anticorpos produzidos por proteólise limitada de anticorpos de tipo selvagem são chamados de fragmentos de anticorpo pro-teolítico. Estes incluem, mas não são limitados aos seguintes: "fragmentos de F(ab')2" são liberados de um anticorpo por exposição limitada do anticorpo a uma enzima proteolítica, por exemplo, pepsina ou ficina. Um fragmento de F(ab')2 compreende dois "braços," cada um dos quais compreende uma região variável que refere-se a e especificamente liga a um antígeno. As duas moléculas de Fab' são unidadas pelas ligações de intercadeia nas regi-ões nuas das cadeias pesadas; as moléculas de Fab' podem referir-se aos mesmo epitopos (bivalentes) ou epitopos diferentes (biespecíficos).
"Fragmentos de Fab1" contêm um domínio de antilígação simples incluindo um Fab e uma porção adicional da cadeia pesada através da região nua.
"Fragmentos de Fab'-SH" são tipicamente produzidos a partir de fragmentos de F(ab')2, que são mantidos juntos por ligação(ões) de dissulfe-to entre as cadeias H em um fragmento de F(ab')2. O tratamento com um agente de redução moderado tal como, a título de exemplo não limitante, beta-mercaptoetilamina, rompe a(s) ligação(ões) de dissulfeto, e dois fragmentos de Fab' são liberados de um fragmento de F(ab')2. Fragmentos de Fab'-SH são monovalentes e monoespecíficos.
"Fragmentos de Fab" (isto é, um fragmento de anticorpo que contém o domínio de ligação de antígeno e compreende uma cadeia leve e parte de uma cadeia pesada ligada por ponte por uma ligação de dissulfeto) são produzidos por digestão de papaína de anticorpos intactos. Um método conveniente é usar papaína imobilizada sobre uma resina de modo que a enzima possa ser facilmente removida e a digestão terminada. Fragmentos de Fab não têm a(s) ligação(ões) de dissulfeto entre as cadeias H presentes em um fragmento de F(ab')2.
"Anticorpos de cadeia simples" são um tipo de fragmento de anticorpo. O termo anticorpo de cadeia simples é frequentemente abreviado como "scFv" ou "sFv". Estes fragmentos de anticorpo são produzidos usan-do-se genética molecular e tecnologia de DNA recombinante. Um anticorpo de cadeia simples consiste em uma cadeia de polipeptídeo que compreende tanto domínios de VH quanto de VL que interagem para formar um sítio de ligação de antígeno. Os domínios de VH e VL são usualmente ligados por um peptídeo de 10 a 25 resíduos de aminoácidos.
O termo "anticorpo de cadeia simples" ulteriormente inclui mas não é limitado a um Fv ligado a dissulfeto (dsFv) em que dois anticorpos de cadeia simples (cada um dos quais pode referir-se a um epitopo diferente) ligados entre si por uma ligação de dissulfeto; um sFv biespecífico em que dois scFvs discretos de especificidade diferentes estão ligados com um li-gante de peptídeo; um diacorpo (um sFv dimerizado formado quando o domínio de VH de um primeiro sFv se reúne com o domínio de VL de um segundo sFv e o domínio de VL do primeiro sFv se reúne com o domínio de VH do segundo sFv; as duas regiões de ligação de antígeno do diacorpo podem referir-se aos mesmos epitopos ou epitopos diferentes); e um triacor-po (um sFv trimerizado, formado de um modo similar a um diacorpo, mas em que três domínios de ligação de antígeno são criados em um complexo sim- pies; os três domínios de ligação de antígeno podem referir-se aos mesmo epitopos ou epitopos diferentes).
"Peptídeos de região de determinação de complementaridade" ou "peptídeos de CDR" são uma outra forma de um fragmento de anticorpo. Um peptídeo de CDR (também conhecido como "unidade de reconhecimento mínima") é um peptídeo que corresponde a uma região de determinação de complementaridade simples (CDR), e pode ser preparado por construção de genes que codificam a CDR de um anticorpo de interesse. Tais genes são preparados, por exemplo, por uso de reação de cadeia de polimerase para sintetizar a região variável do RNA de células produtoras de anticorpo. Ver por exemplo, Larrick e outros, Methods: A Companion to Methods in Enzymology 2:106, 1991.
Em "anticorpos modificados por cisteína", um aminoácido de cis-teína é inserido ou substituído sobre a superfície de anticorpo por manipula-ção genética e usado para conjugar o anticorpo a uma outra molécula através da, por exemplo, uma ponto de dissulfeto. Inserções ou substituições de cisteína para anticorpos foram descritas (ver a patente U.S. n9 5.219.996). Métodos para a introdução de resíduos de Cys para dentro da região constante dos anticorpos de IgG para o uso na conjugação específica de sítio de anticorpos são descritos por Stimmel e outros (J. Biol. Chem 275:330445-30450, 2000).
Um "anticorpo humanizado" é uma proteína recombinante usada para reduzir a quantidade de proteína não humana em que as CDRs oriundas de um anticorpo oriundo de uma espécie; por exemplo, um anticorpo de roedor, cadeias variáveis pesadas e leves do anticorpo de roedor são trocadas para alguns domínios variáveis leves e pesados humanos, por exemplo, uso de técnica de engenheiramento de proteína. Os domínios constantes da molécula de anticorpo são derivados daqueles de um anticorpo humano. Ver Gussow e Seemann, Humanization of monoclonal antibodies, Method Enzy-mol. 203:99-121 , 1991 e Vaswani e Hamilton, Ann. Allergy Asthma Immunol. 81 :105-119, 1998.
Produção de Fragmentos de Anticorpo Algumas concretizações dos métodos e/ou composições reivindicados podem referir-se a fragmentos de anticorpo. Tais fragmentos de anticorpo podem ser obtidos por digestão de pepsina ou papaína de anticorpos inteiros por métodos convencionais. Por exemplo, fragmentos de anticorpo podem ser produzidos por clivagem enzimática de anticorpos com pepsina para prover um fragmento de 5S significava F(ab')2. Este fragmento pode ser ulteriormente clivado usando-se um agente de redução de tiol e, opcionalmente, um grupo de bloqueamento para os grupos de sulfidrila que resultam de clivagem de ligações de dissulfeto, para produzir fragmentos mono-valentes de 3.5S Fab'. Alternativametne, uma clivagem enzimática usandp-se pepsina produz dois fragmentos de Fab monovalentes e um fragmento de Fc. Métodos exemplares para a produção de fragmentos de anticorpo são descritos na patente U.S. ne 4.036.945; na patente U.S. nQ 4.331 .647; Niso-noff e outros, 1960, Arch. Biochem. Biophys., 89:230; Porter, 1959, Biochem. J., 73:1 19; Edelman e outros, 1967, Methods in Enzymology, pág. 422 (Aca-demic Press), e Coligan e outros (eds.), 1991 , Current Protocols in Immuno-logy, (John Wiley & Sons).
Outros métodos de clivagem de anticorpos, tais como separação de cadeias pesadas para formar fragmentos de cadeia leve-pesada monova-lentes, clivagem ulterior de fragmentos ou outras técnicas enzimáticas, químicas e genéticas também podem ser usadas, contanto que os fragmentos se liguem ao antígeno que é reconhecido pelo anticorpo intacto. Por exemplo, fragmentos de Fv compreendem uma associação de cadeias de VH e VL. Esta associação pode ser não covalente, como descrito em Inbar e outros, 1972, Proc. Nafl. Acad. Sei. USA, 69:2659. Alternativamente, as cadeias variáveis podem ser ligadas por uma ligação de dissulfeto intermolecular ou reticuladas por produtos químicos tal como glutaralde ido. Ver Sandhu, 1992, Crit. Rev. Biotech., 12:437.
De preferência, os fragmentos de Fv compreendem cadeias de VH e VL ligados por um ligante de peptídeo. Essas proteínas de ligação de antígeno de cadeia simples (sFv) são preparadas por construção de um gene estrutural compreendendo sequências de DNA que codificam os domí- nios de VH e VL, ligados por uma seq iência ligante de nucleotídeos. O gene estrutural é inserido em um vetor de expressão que é subsequentemente introduzido para dentro de uma célula hospedeira, tal como E. coli. As células hospedeiras recombinantes sintetizam uma cadeia de polipeptídeo sim-pies com uma ligação de peptídeo de ligante dos dois domínios V. Métodos para a produção de sFvs são bem-conhecidos na técnica. Ver Whitlow e outros, 1991 , Methods: A Companion to Methods in Enzymology 2:97; Bird e outros, 1988, Science, 242:423; a patente U.S. n9 4,946,778; Pack e outros, 1993, BioATechnology, 11 :1271 , e Sandhu, 1992, Crit. Rev. Biotech., 12:437.
Uma outra forma de um fragmento de anticorpo é um peptídeo que codifica uma região de determinação de complementaridade simples (CDR). Peptídeos de CDR ("unidades de reconhecimento mínimas") podem ser observados por construção de genes que codificam a CDR de um anticorpo de interesse. Tais genes são preparados, por exemplo, por uso de reação de cadeia de polimerase para sintetizar a região variável de RNA de células produtoras de anticorpo. Ver Larrick e outros, 1991 , Methods: A Companion to Methods in Enzymology 2:106; Ritter e outros (eds.), 1995, Monoclonal Antibodies:Production, Engineering e Clinicai Application, págs. 166-179 (Cambridge University Press); Birch e outros, (eds.), 1995, Mono-clonal Antibodies: Principies e Applications, págs. 137-185 (Wiley-Liss, Inc.)

Em uma concretização, o anticorpo humanizado pode ser ligado a uma molécula repórter ou efetora. Por exemplo, um macrociclo para que-lação de átomo de metal pesado, ou uma toxina tal como ricina, pode ser ligada ao anticorpo humanizado por uma estrutura de ligação por ponte co-valente. Alternativamente, o procedimento de tecnologia de DNA recombi-nante pode ser usada para produzir uma molécula de anticorpo humanizada em que o fragmento de Fc, domínio de Cu3 ou Cn2 de uma molécula de anticorpo completa foi substituído por ou ligado à mesma por ligação de peptídeo de uma proteína de não imunoglobulina funcional tal como uma molécu-la de toxina ou enzima.
Em uma outra concretização da presente invenção, o anticorpo humanizado pode incluir uma molécula de anticorpo completa, tendo cadeias leves e pesadas de comprimento total; um seu fragmento, tal como um fragmento de Fab, Fab', F(ab')2, ou Fv; um fragmento de anticorpo de cadeia simples, por exemplo, uma Fv de cadeia simples, um monômero ou dímero de cadeia leve ou pesada; proteínas de ligação de antígeno não específicas multivalentes compreendendo dois, quatro ou mais anticorpos ou seus fragmentos ligados entre si por uma estrutura de ligação; ou um fragmento ou análogo de qualquer um destes ou qualquer outra molécula com a mesma especificidade como MAb ml_243. Em uma concretização particular, o anticorpo pode incluir uma molécula de anticorpo completa, tendo cadeias leves e pesadas de comprimento total.
Anticorpos L243 Humanizados
Anticorpos Quiméricos e Humanizados
Um anticorpo quimérico é uma proteína recombinante em que as regiões variáveis de um anticorpo humano foram substituídos pelas regiões variáveis de, por exemplo, um anticorpo de camundongo anti-L243, incluindo as regiões de determinação de complementaridade (CDRs) do anticorpo de camundongo. Anticorpos quiméricos exibem imunogenicidade diminuída e estabilidade aumentada quando administrados a um indivíduo. Métodos para a construção de anticorpos quiméricos são bem-conhecidos na técnica (por exemplo, Leung e outros, 1994, Hybridoma 13:469).
Um anticorpo monoclonal quimérico pode ser humanizado por transferência das CDRs de camundongo das cadeias variáveis leves e pesadas da imunoglobulina de camundongo nos domínios variáveis correspondentes de um anticorpo humano. As regiões de estrutura de camundongo (FR) no anticorpo monoclonal quimérico são também substituídas com sequências de FR. Para preservar a estabilidade e especificidade de antígeno do monoclonal humanizado, um ou mais resíduos de FR humanos podem ser substituídos pelos resíduos correspondentes de camundongo. Anticorpos monoclonais humanizados podem ser usados para o tratamento terapêutico de indivíduos. A afinidade de anticorpos humanizados para um alvo pode ser aumentada por modificação selecionada das sequências de CDR (WO 0029584A1 ). Técnicas para a produção de anticorpos monoclonais humani- zados são bem-conhecidos na técnica. (Ver por exemplo, Jones e outros, 1986, Nature, 321 :522; Riechmann e outros, Nature, 1988, 332:323; Verhoe- yen e outros, 1988, Science, 239:1534; Cárter e outros, 1992, Proc. Nafl Acad. Sei. USA, 89:4285; Sandhu, Crit. Rev. Biotech., 1992, 12:437; Tem- pest e outros, 1991 , Biotechnology 9:266; Singer e outros, J. Immun., 1993, 150:2844.).
Outras concretizações podem referir-se a anticorpos de primata não humanos. Técnicas gerais para criar anticorpos terapeuticamente úteis em balbuínos podem ser encontrados, por exemplo, em Goldenberg e ou-tros, WO 91/11465 (1991 ), e em Losman e outros, Int. J. Câncer 46: 310 (1990).
Em outra concretização, um anticorpo pode ser um anticorpo monoclonal humano. Tais anticorpos são obtidos a partir de camundongos transgênicos que foram engenheirados para produzir anticorpos de humanos específicos em reposta a desafilamento antigênico. Nesta técnica, elementos do local de cadeia leve e pesada humana são introduzidos para dentro de cepas de camundongos derivadas de linhas de células tronco embriônicas que contêm rompimentos direcionados dos locais de cadeia leve e de cadeia pesada endógena. Os camundongos transgênicos podem sintetizar anticor-pos humanos específicos para antígenos humanos, e os camundongos podem ser usados para produzir hibridomas de secreção de anticorpo humanos. Métodos para a obtenção de anticorpos humanos a partir de camundongos transgênicos são descritos por Green e outros, Nature Genet. 7:13 (1994), Lonberg e outros, Nature 368:856 (1994), e Taylor e outros, Int. Im-mun. 6:579 (1994).
Em uma concretização, o anticorpo humanizado pode incluir sequências de região de CDR de ml_243 dentro das sequências de estrutura de anticorpo humanas e com sequências de região de constante de anticorpo humanas. Mais particularmente, os anticorpos humanizados podem inclur um domínio variável de cadeia pesada (VH) contendo os resíduos de ml_243 VH em todas as CDRI (de 31 a 35), CDR2 (de 50 a 65) e CDR3 (de 95 a 102). Em uma outra concretização, as CDRs do domínio variável de cadeia leve (VL) correspondem a resíduos de ml_243 VL em todas as CDRI (de 24 a 34) CDR2 (de 50 a 56) e CDR3 (de 89 a 97). Em uma outra concretização particular da invenção, outros resíduos de L243 VH de camundongo retidos no projeto humanizado são em um ou mais das seguintes posições; R37, K39, V48, F49, e G100.
Outros detalhes para sequências de anticorpos de humanização, enquanto retendo a especificidade antigênica do anticorpo não humano original, são descritos, por exemplo, no pedido de patente U.S. nQ 09/988.013 depositado em 16 de novembo de 2001 , cujo texto total é incorporado aqui por referência.
Em uma concretização, a presente invenção ulteriormente provê uma cadeia pesada de anticorpo humanizada enxertada com CDR tendo um domínio de região variável compreendendo estruturas aceitantes derivadas de uma cadeia pesada humana de subgrupo I e as regiões de ligação de antígeno derivadas do doador de ml_243 onde a estrutura compreende resíduos doadores de mL243 a uma ou mais das posições F27, K38, K46, A68 e F91. Ver Figuras 3 e 4 respectivamente.
Em uma concretização da presente invenção uma cadeia leve de anticorpo humanizada enxertada com CDR pode ser provida tendo um domínio de região variável compreendendo estruturas aceitantes derivadas de uma cadeia de leve kappa humana de subgrupo I e regiões de ligação de antígeno de doador de ml_243 onde a estrutura compreende resíduos de doador de ml_243 a uma ou mais de posições R37, K39, V48, F49, e G100.
Na molécula de anticorpo humanizada enxertada com CDR de concretizações da presente invenção, as porções derivadas de imunoglobu-lina de não L243 restantes (aceitante) podem ser derivadas de qualquer i-munoglobulina humana adequada, com a condição de que o anticorpo humanizado possa dobrar tal que ele retém a capacidade de especificamente ligar HLA-DR. De preferência o tipo de estrutura humana (FR) usado é do mesmo/classe similar/tipo como o anticorpo de doador.
Em uma concretização da invenção, as estruturas humanas podem ser escolhidas para maximizar homologia com uma sequência de anti- 5

corpos de doador particularmente nas posições espacialmente próximas ou adjacentes às CDRs. De acordo com esta concretização, as estruturas (isto é, FR1 -4) do VL ou VH de L243 humanizados podem ser derivados de uma combinação de anticorpos humanos. Exemplos de estruturas humanas que podem ser usadas para construir anticorpos enxertados com CDR são LAY, POM, TUR, TEI, KOL, NEWM, REI, RF e EU; de preferência RF-TS3 FRI-3 e NEWM FR4 humanos são usados para a cadeia pesada e REI FR1 -4 é usado para cadeia leve. O sistema de numeração de resíduo de domínio V usado aqui é descrito em Kabat e outros, (1991 ), Sequences of Proteins of Im-munological Interest, 5th Edition, United States Department of Health e Hu-man Services. Ver a figura 5 para um alinhamento de sequência de aminoácidos comparativa de cadeia hl_243 VH, ml_243 e RF-TS3 humana (FR 1-3 e NEWM FR4). Ver a figura 6 para um alinhamento de sequência de aminoácidos comparativa cadeia de VL hl_243, mL243 e REI humana.
Os domínios variáveis de cadeia pesada e leve da molécula de anticorpo humanizada podem ser fundidos a domínios constantes de cadeia leva ou pesada humana quando apropriado- (o termo "domínios constantes de cadeia pesada incluem regiões de flexibilidade a não ser que de outra maneira especificada). Os domínios constantes humanos da molécula de anticorpo humanizada, onde presente, podem ser selecionados em relação à função proposta do anticorpo, em uma concretização, os domínios constantes humanos podem ser selecionados com base na carência de funções efe-toras. Os domínios constantes de cadeia pesada fundidos à região variável de cadeia pesada podem ser aqueles de IgA humana (cadeia de a1 ou a2), IgG humana (cadeia de 71 , 72, j3>, ou y4 chain) ou IgM humana (cadeia de u). De preferência cadeia y humana é usada. Os domínios de cadeia leve que podem ser fundidos à região de de variável de cadeia leve incluem cadeias lambda e kappa humanas.
Em uma concretização particular da presente invenção, uma cadeia y1 é usada. Em ainda uma outra concretização particular da presente invenção uma cadeia de γ4 é usada. O uso da cadeia de γ4 pode alguns casos aumentar a tolerância de um hl_243 em indivíduos (efeitos colaterais di- minuídos e reações de infusão, tolerância maior, etc.).
Em uma concretização, análogos de domínios constantes podem ser usados. Estes incluem mas não são limitados àqueles domínios constantes contendo um ou mais aminoácidos adicionais do que o domínio humano correspondente ou aqueles domínios constantes em que um ou mais aminoácidos existentes do domínio humano correspondente foi deleta-do ou alterado. Tais domínios podem ser obtidos, por exemplo, por mutagê-nese direcionada por oligonucleotídeo.
Como usado aqui, o termo "alterado" quando usado em combi-nação com a capacidade de um anticorpo para fixar complemento indica uma diminuição na capacidade de anticorpo de fixar complemento em comparação com o anticorpo não alterado de partida. Alteração de um aminoácido apropriado altera a capacidade de um anticorpo de fixar complemento. Como usado aqui a frase "substancialmente" reduz fixação de complemento significa que fixação de complemento humano é de preferência menos do que ou igual a 30% mais de preferência menos do que ou igual a 20%, e mais de preferência menos do que ou igual a 10% do nível visto com anticorpo de tipo selvagem.
Capacidade de fixação de complemento alterada pode ser pro-duzida por técnicas que são bem-conhecidas na técnica, por exemplo, resíduos de deleção, inserção de um sítio de glicosilação a uma posição adequada na molécula, ou troca de regiões de flexibilidade menores de anticorpos de isótipos diferentes.
Preparação de genes que codificam anticorpos HL243
Qualquer técnica padrão de biologia molecular conhecida na técnica pode ser usada para preparar seqúências de DNA que codificam os anticorpos de acordo com a presente invenção. Por exemplo, sequências de DNA podem ser sintetizadas totalmente ou em parte usando-se técnicas de síntese de oligonucleotídeo. Técnicas de reação de cadeia de polimerase (PCR) e mutagênese de sítio-dirigida podem ser usadas quando apropriadas. Tais processos incluem o procedimento de sobreposição de PCR e mutagênese de PCR como descrito em, por exemplo, "PCR Technology Princi- pies e Applications for DNA Amplification" (1989), Ed. H. A. Erlich, Stockholm Press, N. Y., London, e oligonucleotide directed mutagenesis (Kramer e outros, Nucleic. Acid. Res. 12 9441 (1984)).
Quaisquer técnicas padrão de biologia molecular podem também ser usadas para preparar sequências de DNA que codificam produtos enxertados com CDR. Por exemplo, sequências de DNA podem ser sintetizadas totalmente ou em parte usando-se técnicas de síntese de oligonucleotídeo. Técnicas de reação de cadeia de polimerase (PCR) e mutagênese de sítio-dirigida podem ser usadas quando apropriadas. Síntese de oligonucleotídeo-dirigida (Jones e outros (1986) Nature 321 522-525) e mutagênese de oligo-nucleotídeo-dirigida de uma região de domínio variável preexistente (Verho-eyen e outros (1988) Science 23 1534-1536) podem ser usadas. Preenchimento enzimático de oligonucleotídeos de lacuna usando-se polimerase de DNA de T4 (Queen e outros (1989) Proc. Natl. Acad. Sei. USA 86 10029-10033) pode também ser usado. Qualquer sistema de vetor de expressão/célula hospedeira adequado pode ser usado para a expressão das sequências de DNA que codificam as cadeias leves e pesadas enxertadas com CDR ou quiméricas. Um "hospedeiro recombinante" pode ser qualquer célula procariótica ou eucariótica que contém ou um vetor de clonagem ou vetor de expressão. Este termo também inclui aquelas células procarióticas ou eucarióticas, bem como animais transgênicos, que foram geneticamente en-genheirados para conter o(s) gene(s) clonado(s) no cromossoma ou genoma da(s) célula(s) hospedeira(s). Bactérias, por exemplo, E. coli, e outros sistemas microbianos podem ser usados vantajosamente em particular para ex-pressão de fragmentos de anticorpo, por exemplo, fragmentos de Fv, Fab e Fab' e fragmentos de anticorpo de cadeia simples, por exemplo, Fvs de cadeia simples. Hospedeiros eucarióticos, por exemplo, sistemas de expressão de célula de mamífero, podem ser usados para se obter anticorpos de acordo com a presente invenção, particularmente para a produção de produtos de anticorpo enxertados com CDR ou quiméricos maiores. Células hospedeiras de mamífero adequadas incluem células de mieloma, tais como Sp2/0 e NOS, bem como células de ovários de hamster chinês (CHO), linhas de cé- lulas de hibridoma e outras células de mamífero úteis para a expressão de anticorpos.
Um "vetor de expressão" como usado aqui é uma molécula de DNA incluindo os genes de interesse que são expressos em uma célula hospedeira. Tipicamente, expressão de gene é colocado sob o controle de certos elementos reguladores, incluindo promotores constitutivos e induzí-veis, aumentadores e elementos reguladores específicos de tecido. Tal gene é dito ser "operavelmente ligado aos" elementos reguladores. Em outros aspectos, uma concretização também inclui sequências de DNA que codificam cadeias leves e pesadas dos anticorpos da presente invenção, clonagem e vetores de expressão contendo essas sequências de DNA, células hospedeiras transformadas com estas sequências de DNA e processos para a produção de cadeias leves ou pesadas e moléculas de anticorpo compreendendo expressão destas sequências de DNA em uma célula hospedeira transformada.
DNA que codifica sequências de imunoglobulinas humanas pode ser obtido por meio conhecido na técnica. Por exemplo, sequências de aminoácidos de estruturas de aceitantes humanos preferidos tais como -LAY, POM, KOL, REI, EU, TUR, TEI, RF e NEWM, são amplamente disponíveis. Similarmente, as sequências de consenso para subgrupos de cadeia leve e pesada também disponíveis. O técnico versado está ciente que múltiplas seqúências de códons podem codificar o mesmo aminoácido e que em várias concretizações, as sequências de ácidos nucléicos descritas podem ser substituídas com uma seqúência alternativa que codifica a mesma seqúên-cia de aminoácidos. O técnico versado está também ciente que, dependendo da espécie de origem para uma linha de célula usada para expressar uma proteína a partir de uma seqúência de ácidos nucléicos, o uso de códon pode ser otimizado para aumentar expressão na espécie selecionada. Tais fre-qúências de códons de espécie preferidas são bem-conhecidas na técnica.
Em uma concretização, o anticorpo descrito aqui pode ser um anticorpo completo, ou como explicado acima, um seu fragmento, um mo-nômero ou dímero ou uma proteína de ligação de antígeno monoespecífico multivalente. Assim, promover a um aspecto da presente invenção, uma proteína de ligação de antígeno monoespecífico multivalente pode ser provida compreendendo dois, três, quatro ou mais seus fragmentos de anticorpo ligados entre si por uma estrutura de ligação, proteína essa que não é uma imunoglobulina natural, cada um dos ditos anticorpos ou fragmentos tendo uma especificidade para o epitopo reconhecido por MAb L243 de camundongo, a dita proteína de ligação de antígeno sendo opcionalmente conjugada com uma molécula repórter ou efetora.
De acordo com estas concretizações, cada anticorpo ou frag-mento pode ser um anticorpo humanizado ou um seu fragmento, como definido acima, e uma proteína de ligação de antígeno monoespecífica multivalente pode ser uma proteína de ligação de antígeno monoespecífica multivalente humanizada. Não humanizada, por exemplo, proteína de ligação de antígeno monoespecífica multivalente, de camundongo, no entanto, pode ser contemplada e uma concretização pode prolongar a esta onde aplicável.
Em uma concretização particular, uma proteína de ligação de antígeno multivalente pode prover dois, três, ou quatro anticorpos ou seus fragmentos ligados entre si por uma estrutura de ligação. Em uma outra concretização, um processo para a produção do anticorpo humanizado pode incluir: i) produção em um vetor de expressão de uma sequência de DNA que codifica uma cadeia leve ou pesada de anticorpo incluindo um domínio variável em que pelo menos uma das CDRs do domínio variável pode derivada do ml_243 MAb e as partes derivadas de não imunoglobulina restantes da cadeia de anticorpo são derivadas de uma imunoglobulina humana; ii) produção em uma vetor de expressão de uma sequência de DNA que codifica um cadeia leve ou pesada de anticorpo complementar incluindo um domínio variável, em que pelo menos uma das CDRs do domínio variável é derivado do MAb ml_243 e as partes derivadas de não imunoglobulina restantes da cadeia de anticorpo pode ser derivada de uma imunoglobulina hu-mana; iii) transfecção de uma célula hospedeira com as sequências de DNA acima mencionadas; e iv) cultivo da linha de célula transfectada para produzir a molécula de anticorpo humanizada.

Produção de hL243 recombinante em uma célula hospedeira
Em uma concretização, uma linha de célula para produzir hl_243 recombinante pode ser transfectada com dois vetores, o primeiro vetor contendo a sequência de DNA que codifica o polipeptídeo derivado de cadeia de luz, e o segundo vetor contendo a sequência de DNA que codifica o polipeptídeo derivado de cadeia pesada. De preferência, os vetores são idênticos exceto no tocante as sequências de codificação e marcadores selecio-náveis, de modo a assegurar tanto quanto possível que cada cadeia de polipeptídeo é igualmente expressa. Transfecção pode ser conduzida por qual-quer técnica conhecida por aqueles versados na técnica. Ver, por exemplo, Maniatis e outros (1982) (Molecular Cloning, Cold Spring Harbor, New York) e Primrose e Old (1980) (Principies of Gene Manipulation, Blackwell, Oxford). Uma técnica particular para a transfecção pode ser eletropo ração. Outros exemplos incuem trnafecção mediada por fosfato de cálcio, transfecção mediada por lipídio catiônico, e similares. Em uma concretização alternativa, um vetor simples pode ser usado, o vetor incluindo as sequências de DNA que codifica tanto polipeptídeos derivados de cadeia leve quanto de cadeia pesada, e um marcador selecionável.
Métodos gerais para a produção de proteínas de fusão recombinantes con-tendo fragmentos de anticorpo
Sequências de ácidos nucléicos que codificam fragmentos de anticorpo que reconhecem epitopos específicos podem ser obtidas por técnicas que são bem-conhecidas na técnica. Por exemplo, hibridomas que se-cretam anticorpos de uma especificidade desejada podem ser usados para se obter DNA de codificação de anticorpo que pode ser preparado usando-se técnicas conhecidas, por exemplo, por PCR ou por técnicas de clonagem de cDNA tradicionais. Alternativamente, bibliotecas de expressão de Fab' ou bibliotecas de exibição de fago de anticorpo podem ser construídas para triar quanto a fragmentos de anticorpo tendo uma especifificidade desejada.
O ácido nucléico que codifica um fragmento de anticorpo pode então ser ligado, diretamente ou através de uma sequência que codifica um espaçador de peptídeo, a ácido nucléico que codifica ou o DDD ou o AD.

Métodos de produção de sequências de ácidos nucléicos que codificam estes tipos de proteínas de fusão são bem-conhecidos e são ulteriormente discutidos nos seguintes exemplos.
Em uma outra concretização, resíduos de aminoácidos adicio-nais podem ser adicionados ou à N- ou C-terminal da subunidade modular constituída de A/DDD ou B/AD, onde o sítio de fusão exata pode depender de se o DD ou o AD estão ligados ao N- ou C-terminal (ou em uma posição terminal). Os resíduos de aminoácidos adicionais podem compreender uma etiqueta de peptídeo, um peptídeo de sinal, um citocina, uma enzima (por exemplo, uma enzima de ativação de pró-fármaco), um hormônio, uma toxina, um fármaco de peptídeo, um peptídeo de interação de membrana, ou outras proteínas funcionais.
Proteínas e peptídeos podem ser sintetizados, no total ou em parte, em solução ou sobre um suporte sólido de acordo com as técnicas convencionais. Vários sintetizadores automáticos estão comercialmente disponíveis e podem ser usados de acordo com os protocolos conhecidos. Ver, por exemplo, Stewart e Young, (1984, Solid Phase Peptide Synthesis, 2. ed., Pierce Chemical Co.); Tarn e outros, (1983, J. Am. Chem. Soe, 105:6442); Merrifield, (1986, Science, 232: 341- 347); e Barany and Merrifield (1979, The Peptides, Gross e Meienhofer, eds., Academic Press, New York, pp. 1 -284). Sequências de peptídeos curtas, usualmente de cerca de 6 até cerca de 35 a 50 aminoácidos, podem ser prontamente sintetizadas por tais métodos. Alternativamente, tecnologia de DNA recombinante pode ser empregada em que uma sequência de nucleotídeos que codifica um peptídeo de inte-resse é inserida dentro de um vetor de expressão, é transformada ou é transfectada em uma célula hospedeira apropriada, e é cultivada sob condições adequadas para a expressão.
Métodos para a produção de proteínas recombinantes em uma célula hospedeira desejada são bem-conhecidos na técnica. Para facilitar purificação, as estruturas estavelmente amarradas podem conter etiquetas de peptídeo adequadas, tal como a sequência de FLAG ou a sequência de poli-HIS, para facilitar sua purificação com uma coluna de afinidade relevan- te.
Em uma concretização, os fragmentos de Fv podem incluir cadeias de VH e VL ligadas por um ligante de peptídeo. Estas proteínas de ligação de antígeno de cadeia simples (sFv) são preparadas por construção de um gene estrutural compreendendo sequências de DNA que codificam os domínios de VH ou VL, ligadas por uma sequência ligantea de oligonucleotí-deos. O gene estrutural é inserido em um vetor de expressão que é subsequentemente introduzido em uma célula hospedeira, tal como E. coli. As células hospedeiras recombinantes sintetizam uma cadeia de polipeptídeo com uma ligação por ponte de peptídeo de ligante dos dois domínios V. Métodos para a produção de sFvs são bem-conhecidos na técnica. Ver Whitlow e outros, 1991 , Methods: A Companion to Methods in Enzymology 2:97; Bird e outros, 1988, Science, 242:423; a patente U.S. nQ 4.946.778; Pack e outros, 1993, Bio/Technology, 11 :1271 , e Sandhu, 1992, Crit. Rev. Biotech., 12:437.
Uma outra forma de um fragmento de anticorpo é um peptídeo que codifica uma região de determinação de complementaridade simples (CDR). Peptídeos de CDR ("unidades de reconhecimento mínimas") podem ser obtidos por construção de genes que codificam a CDR de um anticorpo de interesse. Tais genes são preparados, por exemplo, por uso da reação de cadeia de polimerase para sintetizar a região variável de RNA de células produtoras de anticorpo. Ver Larrick e outros, 1991 , Methods: A Companion to Methods in Enzymology 2:106; Ritter e outros (eds.), 1995, Monoclonal Antibodies: Production, Engineering e Clinicai Application, págs. 166-179 (Cambridge University Press); Birch e outros, (eds.), 1995, Monoclonal Anti-bodies Principies e Applications, págs. 137-185 (Wiley-Liss, Inc.)
Células hospedeiras ou linhas de células adequadas para a expressão das subunidades constituintes das estruturas estavelmente amarradas de são conhecidas por aquele versado na técnica. O uso de uma célula hospedeira humana permitiria quaisquer moléculas expressas a serem modi-ficadas com padrões de glicosilação humana. No entanto, não há indicação que uma célula hospedeira humana é essencial ou preferida para os métodos descritos.

Conjugados e anticorpos biespecíficos
Em certas concretizações, os ligantes de L243 descritos aqui podem ser usados em combinação com uma outra molécula ligada ao ligan-te. Ligação pode ser ou covalente ou não covalente. Em algumas concreti-zações, um ligante de L243 pode ser ligado a um anticorpo biespecífico, isto é, um anticorpo que tem dois sítios de ligação diferentes, um para o ligante de L243 e um outro para um antígeno alvo relacionado com a doença. Qualquer doença ou condição com relação a angiogênese, câncer, metástase, ou motilidade celular pode ser direcionada, incluindo mas não limitada a, câncer primário, câncer metástico, hiperplasia, artrite reumatóide, doença de intestino inflamatório, doença de Crohn, colite ulcerativa, sarcoidose, asma, edema, hipertensão pulmonar, formação e desenvolvimento de tecido de tumor, psoríase, retinopatia diabética, degeneração macular, rejeição de enxerto corneal, glaucoma neovascular, angiogênese miocardial, neovascularização de placa, restenose, formação neoíntima depois de trauma vascular, telangi-ectasia, juntas hemofílicas, angiofibroma, fibrose associada a inflamação crónica, fibrose de pulmão, trombose de veia profunda e granulação de ferimento. Métodos para a construção e uso de anticorpos multiespecíficos e biespecíficos são descritos, por exemplo, na publicação de pedido de paten-te ne 20050002945, depositada 2/11/2004, cujo texto total é incorporado aqui por referência.
Onde o anticorpo biespecífico é direcionado em parte contra um antígeno associado a tumor, é antecipado que qualquer tipo de tumor e qualquer tipo de antígeno de tumor pode ser assim direcionado. Tipos e-xemplares de tumores que podem ser direcionados incluem leucemia linfo-blástica aguda, leucemia mielógena aguda, câncer biliar, câncer cervical, leucemia linfocítica crónica, leucemia mielógena crónica, câncer colorretal, câncer endometrial, câncer esofâgeco, gástrico, cabeça e pescoço, linfoma de Hodgkin, câncer de pulmão, tiróide medular, linfoma de não Hodgkin, câncer ovariano, câncer pancreático, glioma, melanoma, câncer de fígado, câncer de próstata, e câncer de vesícula urinária. Preferidos são tumores que têm expressão constitutiva de L243, ou que podem ser estimulados para produzir L243.
Uma variedade de métodos recombinante podem ser usados para produzir anticorpos biespecíficos e fragmentos de anticorpo. Por exemplo, anticorpos biespecíficos e fragmentos de anticorpo podem ser produzi-dos no leite de animais de criação transgênicos. (Ver por exemplo, Colman, A., Biochem. Soe. Symp., 63: 141 -147, 1998; a patente U.S. ne 5.827.690, cada um incorporado aqui por referência). Dois construtos de DNA são preparados que contêm, respectivamente, segmentos de DNA que codificam cadeias leves e pesadas de imunoglobulina emparelhadas. Os fragmentos são clonados em vetores de expressão que contêm uma sequência de promotor que é de preferência expressa em células epiteliais de mamífero. E-xemplos incluem, mas não são limitados a, promotores oriundos genes de caseína de coelho, de vaca e carneiro, o gene de alfa-lactoglobulina de vaca, gene de beta-lactoglobulina de carneiro, e o gene de proteína de ácido de soro de camundongo. De preferência, o fragmento inserido é flanqueado em seu lado 3' por sequências genômicas cognatas de gene específico de mamífero. Isto provê um sítio de poliadenilação e sequências de estabilização de transcrito. Os pacotes de expressão são co-injetados para dentro dos pró-núcleos de ovos de mamífero, fertilizados, que são então implantados para dentro do útero de um receptor fêmea e é permitido que se desenvolva. Depois do nascimento, a progénie é triada quanto a presença de ambos os transgêneses por análise de Southern. A fim de o anticorpo estar presente, tanto genes de cadeia leve quanto pesada devem ser expressos concorrentemente na mesma célula. Leite oriundo de fêmeas transgênicas é analisado quanto a presença e funcionalidade do anticorpo ou fragmento de anticorpo usando-se métodos imunológicos padrão conhecidos na técnica. O anticorpo pode ser purificado do leite usando-se métodos padrão conhecidos na técnica.
Pré-Direcionamento
Uma estratégia para o uso de anticorpo biespecíficos inclui me-tologias de pré-direcionamento, em que uma molécula efetora, tal como um ligante de antitumor ou anti-angiogênico, é administrada a um indivíduo de- pois que um anticorpo biespecífico foi administrado. O anticorpo biespecífi-co, que incluiria um sítio de ligação para um ligante de L243 e um para o tecido doente, localiza no tecido doente e diminui a especificidade de localização do ligante de L243 efetor no tecido doente (pedido de patente U.S. nõ 20050002945). Uma vez que a molécula efetora pode ser clariada a partir da circulação muito mais rápida do que o anticorpo biespecífico, tecidos normais podem ter uma exposição diminuída à molécula efetora quando uma estratégia de pré-direcionamento é usada do que quando a molécula efetora é diretamente ligada ao anticorpo de direcionamento doente.
Métodos de pré-direcionamento foram desenvolvidos para aumentar as razões de alvo:base de agentes de detecção ou terapêuticos. E-xemplos de pré-direcionamento e abordagens de biotinaa/avidina são descritos, por exemplo, em Goodwin e outros, a patente U.S. n9 4.863.713; Good-win e outros, J. Nucl. Med. 29:226, 1988; Hnatowich e outros, J. Nucl. Med. 28:1294, 1987; Oehr e outros, J. Nucl. Med. 29:728, 1988; Klibanov e outros, J. Nucl. Med. 29:1951 , 1988; Sinitsyn e outros, J. Nucl. Med. 30:66, 1989; Kalofonos e outros, J. Nucl. Med. 31 :1791 , 1990; Schechter e outros, Int. J. Câncer 48:167, 1991 ; Paganelli e outros, Câncer Res. 51 :5960, 1991 ; Paga-nelli e outros, Nucl. Med. Commun. 12:211 , 1991 ; a patente U.S. n9 5.256.395; Stickney e outros, Câncer Res. 51 :6650, 1991 ; Yuan e outros, Câncer Res. 51 :3119, 1991 ; a patente U.S. n9 6.077.499; a patente U.S. ne de série 09/597.580; a patente U.S. ne de série 10/361.026; a patente U.S. n9 de série 09/337.756; a patente U.S. n9 de série 09/823.746; a patente U.S. n9 de série 10/116.116; a patente U.S. n9 de série 09/382.186; a paten-te U.S. n9 de série 10/150.654; a patente U.S. n9 6,090.381 ; a patente U.S. n9 6,472.511 ; a patente U.S. ns de série 10/114.315; o pedido de patente de patente provisório U.S. N9 60/386.411 ; o pedido de patente provisório U.S. N9 60/345.641 ; o pedido de patente provisório U.S. N9 60/3328.835; o pedido de patente provisório U.S. N9 60/426.379; a patente U.S. n9 de série 09/823.746; a patente U.S. n9 de série 09/337.756; e o pedido de patente provisório U.S. N9 60/342.103, cuja totalidade são incorporados aqui por referência.

Em certas concetizações, anticorpos biespecíficos e construtos direcionáveis podem ser de uso no tratamento e/ou imagem de tecido e órgãos normais ou doentes, por exemplo, usando-se os métodos descritos nas patentes U.S. n25 6.126.916; 6.077.499; 6.010.680; 5.776.095; 5.776.094; 5.776.093; 5.772.981 ; 5.753.206; 5.746.996; 5.697.902; 5.328.679; 5.128.119; 5.101.827; e 4.735.210, cada um incorporada aqui por referência. Métodos adicionais são descritos na pedido U.S. nQ de série. 09/337.756 arquivado 22 de Jun. de 1999 e no pedido U.S. n9 de série. 09/823.746, depositado em 3 de abril de 2001.
Usos terapêuticos e diagnósticos de hl_243
Em uma outra concretização, a presente invenção também provê composições terapêuticas e diagnosticas contendo os anticorpos de concretizações da invenção. Tais composições podem incluir um anticorpo de acordo com a invenção juntamente com um excipiente, diluente ou veículo farmaceuticamente aceitável, por exemplo, para uso in vivo.
Um "agente terapêutico" é um molécula ou um átomo que é administrado separada, concorrente ou sequencialmente com uma porção de anticorpo ou conjugado a uma porção de anticorpo, isto é, anticorpo ou fragmento de anticorpo, ou um subfragmento, e é útil no tratamento de uma doença. Exemplos de agentes terapêuticos incluem anticorpos, fragmentos de anticorpo, fármacos, toxinas, enzimas, nucleases, hormônios, imunomo-duladores, oligonucleotídeos, RNA de interferência, queladores, compostos de boro, agentes fotoativos ou corantes e radioisótopos.
Um "agente de diagnóstico/detecção" é uma molécula ou átomo que é administrado ligado a ou conjugado a uma porção de anticorpo, isto é, anticorpo ou fragmento ou subfragmento de anticorpo, e é útil no diagnóstico ou detecção de uma doença por localização das células contendo o antíge-no. Agentes de diagnóstico/detecção úteis incluem, mas não são limitados a, radioisótopos, corantes (tal como o complexo de biotina-esreptavidina), a-gentes de contraste, compostos fluorescentes ou molécula ou agentes de aumento (por exemplo, íons paramagnéticos) para imagem de ressonânica magnética (MRI), e partículas e lipossomas como exemplos de agentes usa- dos para imagem de ultrassom. Agentes de aumento de ultrassom são descritos nos pedidos de patentes U.S. US20040219203 A1 e US20050014207 A1 , e, são assim, incorporados em sua totalidade por referência. Preferidos são lipossomas enchidos com gás. Ver Maresca, G. e outros, Eur J. Radiol. Suppl 2 S171 -178 (1998); Demos, Sm. E outros J. Drug Target 5 507-518 (1998); e Unger, E. e outros, Am J. Cardiol. 81 58G-61 G (1998). Alternativamente, um anticorpo biespecífico pode ser usado para direcionar o lipos-soma. Em uma tal concretização, o lipossoma é um lipossoma enchido com gás com um DTPA-peptídeo bivalente covalentemente ligado à superfície externa da membrana de lipídio de lipossoma. Pedido de patente U.S. n9 US20040018557A1 descreve tais lipossomas, e é incorporado em sua totalidade por referência.
A patente U.S. nQ 6.331.175 descreve técnica de MRI e a preparação de anticorpo conjugados a um agente de aumento de MRI e é incorpo-rada em sua totalidade por referência. Em um método particular, agentes de diagnóstico/detecção podem ser selecionados do grupo que consistem em radioisótopos, agentes de aumento para o uso em imagem de ressonância magnética, agentes de ultrassom, e compostos fluorescentes. A fim de carregar um componente de anticorpo com metais radioativos e íons paramag-néticos, pode ser necesário reagir ele com um reagente tendo uma cauda longa à qual estão ligados uma multiplicidade de grupos de quelação para a ligação dos íons. Tal causa pode ser um polímero tal como uma polilisina, polissacarídeo, ou outa cadeia derivatizável ou derivatizada tendo grupos pedantes aos quais podem ser grupos de quelação ligados tais como, por exemplo, ácido etilenodiaminatetracético (EDTA), ácido dietilenotriaminapen-taacético (DTPA), porfirinas, poliaminas, éteres de coroa, bis-tiossemicarbozonas, polioximas, e grupos similares conhecidos como sendo úteis para esta finalidade. Quelatos podem ser acoplados aos anticorpos usando-se químicas padrão. O quelato pode ser ligado ao anticorpo pro um grupo que permite a formação de uma ligação à molécula com perda mínima de imunorreatividade e agregação mínima e/ou reticulação interna. Outros, métodos e reagentes, mais extraordinários para a conjugação de quelatos a anticorpos são descritos na patente U.S. n9 4.824.659 por Hawthorne, entitu- lado "Antibody Conjugates", expedida em 25 de abril de 1989, cuja descrição é incorporada aqui em sua totalidade por referência. Em uma outra concretização particular, combinações de quelatos podem incluir 2-benzil-DTPA e seus análogos de monometila e cicloexila, usadas com isótopos de diagnóstico na faixa de energia geral de 60 a 4.000 keV, tais como 251 , 1311 , 12>1 , 124l, 62Cu, MCu, 8F, inln, 67Ga; 68Ga, Tc, 94mTc, HC, 3N, 150, 76Br, 97Zr, para radioimagem. Os mesmos quelatos, quando complexados com metais não radioativos, tais como manganês, ferro e gadolínio podem ser úteis para MRI, quando usados juntamente com quaisquer anticorpos descritos aqui. Quelatos macricíclicos tais como NOTA, DOT A e TETA são de uso com uma variedade de metais e radiometais, mais particularmente com radionu-clídeos de gálio, ítrio e cobre, respectivamente. Tais complexos de metal-quelato podem ser estabilizados por adaptação do tamanho do anel para o metal de interesse. Outros quelatos de tipo anel tais como poliéteres macro-cíclico, que são de interesse para nuclídeos estavelmente ligados, tal como 223Ra para RAIT, estão incluídos por concretizações aqui.
Exemplos de agentes terapêuticos incluem mas não são limitados a anticorpos, fragmentos de anticorpo, fármacos, incluindo agentes qui-mioterapêuticos, toxinas, enzimas, inibidores de enzima, nucleases, hormô-nios, antagonistas de hormônio, imunomoduladores, citocinas, queladores, compostos de boro, átomos de urânio, agentes fotoativos e radionuclídeos.
Agentes diagnósticos/detecção úteis incluem, mas não são limitados a, radioisótipos, corantes (tal como o complexo de biotina-estreptavidina), materiais radiopacos (por exemplo, composições de iodo, bário, gálio e tálio e similares), agentes de contrate, compostos fluorescentes ou moléculas e agentes de aumento (por exemplo, íons paramagnéticos) para imagem de ressonância magnética (MRI). A patente U.S. ne 6.331.175 descreve a técnica de MR e a preparação de anticorpos conjugadas a um agente de aumento de MRI e é incorporada em sua totalidade por referência. De preferência, os agentes de diagnóstico/detecção são selecionados do grupo que consiste em radioisótipos para imagem nuclear, detecção intrao- perativa e endoscópica; agentes de aumento para o uso em imagem de ressonância magnética ou em ultrassonografia; agentes de contraste e radiopa-cos para os raios X e tomografia computadorizada; e compostos fluorescentes para fluoroscopia, incluindo fluoroscopia endoscópica.
Agentes quimioterapêuticos, para a finalidade desta descrição, incluem agentes quimioterapêuticos conhecidos. Agentes quimioterapêuticos conhecidos incluem mas não são limitados aos taxanos mostardas de nitrogénio, derivados de etilenimina, sulfonatos de alquila, nitrosouréias, triaze-nos, análogos de ácido fólico, análogos de pirimidina, análogos de purina, oligonucleotídeos de anti-sentido, antagonistas ou inibidores de fatores de transcrição, RNAs de interferência, alcalóides, antibióticas, enzimas, complexos de coordenação de platina, inibidores de COX-2, agentes apoptóti-cos, uréia substituída, derivados de hidrazina de metila, supressores adre-nocorticais, ou antagonistas. Em uma concertização mais particular, os a-gentes quimioterapêuticos podem incluir esteróides, progestinas, estrogê-nios, antiestrogênios, ou androgênios. Em uma outras concretização particular, os agentes de quimioterapia podem incluir actinomicina, azaribina, anas-trozol, azacitidina, bleomicina, brioestatina-1 , bussulfano, carmustina, Cele-brex, clorambucila, cisplatina, irinoecano (CPT-II), carboplatina, cladribina, ciclofosfamida, citarabina, dacarbazina, docetaxel, dacarbazina, dactinomici-na, daunorrubicina, dexametasona, dietilstilbestrol, doxorrubicina, etinil es-tradiol, estramustina, etoposídeo, floxurridina, fludarrabina, fiutamida, fluo-rouracila, fluoximesterona, gencitabina, caproato de hidroxiprogesterona, hidroxiuréia, idarrubicina, ifosfamida, L-asparaginase, leucovorina, lomustina, mecloretamina, medroprogesterona acetato, acetato de megestrol, melfala-no, mercaptopurina, metotrexato, mitoxantrona, mitramicina, mitomicina, mi-totano, oxaliplatina, butirato de fenila, prednisona, procarbazina, paclitaxel, pentostatina, estreptozocina de semustina, SN-38, tamoxifeno, taxanos, ta-xol, propionato de testosterona, talidomida, tioguanina, tiotepa, teniposídeo, topotecano, mostrada de uracila, vinblastína, vinorelbina ou vincristina.
Alguns agentes quimioterapêuticos adequados são descritos em Remington's Pharmaceutical Sciences 19th Ed. (Mack Publishing Co. 1995).

Outros agentes quimioterapêuticos adequados, tais como fármacos experimentais, são conhecidos por aquele versado na técnica.
Em uma concretização da presente invenção, uma toxina pode incluir mas não são limitadas a ricina, abrina, ribonuclease, DNase I, entero-toxinas-A Staphilococcal, proteína antiviral de caruru-de-cacho, gelonina, toxina da diftéria, exotoxina de Pseudomonas, ou exotoxina de Pseudomo-nas.
Em uma concretização preferida da presente invenção, enzimas são também agentes terapêuticos úteis e podem ser selecionados do grupo que inclui mas não limitados a desidrogenase de malato, nuclease Staphilococcal, isomerase de delta-V-esteróide, desidrogenase de álcool de levedura, desidrogenase de alfa-glicerofosfato, isomeroase de fosfato de triose, peroxidase de rábano silvestre, fosfatase alcalina, asparaginase, glicose oxi-dase, p-galactosidase, ribonuclease, uréias, catalase, desidrogenase de gli-cose-6-fosfato, glicoamilase e acetilcolinasterase.
Como usado aqui, o termo "imunomodulador" inclui citocinas, fatores de crescimento de célula tronco, linfotoxinas, tal como fator de necrose de tumor (TNF), e fatores hematopiéticos, tais como interleucinas (por exemplo, interleucina-1 (IL-1), IL-2, IL-3, IL-6, IL-10, IL-12, IL-18 e IL-21), fatores de estimulação de colónia (por exemplo, fatores de estimulação de colónia de granulócito (G-CSF) e fatores de estimulação de colónia de ma-crófago de granulócito (GM-CSF)), interferons (por exemplo, interferons-alfa, -beta e -gama), o fator de crescimento de célula tronco designado "fator de S1 ", e eritropoietina trombopoíetina. Exemplos de porções imunomodulado-ras incluem IL-2, IL-6, IL-10, IL-12, IL-18, IL-21 , interferon-gama, TNF-alfa, e similares. Alternativamente, indivíduos podem receber de composições da invenção e uma citocina administrada separadamente, quando pode ser administrada antes, concorrentemente, ou depois da administração de composições descritas aqui. Concretizações da presente invenção descritas aqui. Concretizações da presente invenção podem incluir composições conjugadas a um imunomodulador. Uma citocina, para as finalidades desta descrição, incluem quaisquer citocinas incluindo mas não limitadas a IL-1 , IL-2, IL- 3, IL-6, IL-10, IL-12, IL-18, IL-21 , interferon-alfa, interferon-beta, e interferon-gama. Pode também ser um fator de estimulação de colónia, tais como GM-CSF, G-CSF, eritropoietina, trombopoietina, e similares.
Adicionalmente, um quelador pode incluir mas não é limitado a DTPA, DOTA, TETA ou NOTA ou um peptídeo adequado, ao qual um rótulo detectável, tal como molécula fluorescente ou agente citotóxico, tal como um metal pesado ou radionuclídeo, pode ser conjugado. Por exemplo, um imu-noconjugado terapeuticamente útil pode ser obtido por conjugação de um agente fotoativo ou corante a um compósito de anticorpo. É contemplado aqui que composições fluorescentes, tais como fluorocromo e outros cromo-gênios, ou corantes, tais como forfirinas sensíveis a luz visível, foram usadas para detectar e tratar lesões por direção da luz adequada à lesão. Na terapi-a, isto foi chamado de fotorradiação, fototerapia, ou terapia fotodinâmica (Jo-ri e outros (eds.), Photodynamic Therapy of Tumors e Other Diseases (Libre-ria Progetto, 1985); van den Bergh, Chem. Britain 22:430, 1986). Além do mais, é contemplado que anticorpos rnonoclonais acoplados com corantes fotoativados para alcançar fototerapia pode ser usada para finalidades de diagnóstico e terapêuticas aqui. Mewe/a/., J. Immunol. 130: 1473, 1983; i-dem., Câncer Res. 45: 4380, 1985; Oseroff e outros, Proc. Natl. Acad. Sd. USA 83: 8744, 1986; idem., Photochem. Photobiol. 46: 83,1987; Hasan e outros, Prog. Clin. Biol. Res. 288: 471 , 1989; Tatsuta e outros, Lasers Surg. Med. 9: AH, 1989; Pelegrin e outros, Câncer 67: 2529,1991. No entando, estes estudos mais recentes não incluíam o uso de aplicações de terapia en-docópica, especialmente com o uso de fragmentos ou subfragmentos de anticorpo. Assim, contemplado aqui em uma concretização é o uso terapêutico de imunoconjugados compreendendo agentes fotoativos ou corantes. Assim, os presentes métodos terapêuticos podem incluir o uso terapêutico de imunoconjugados compreendendo agentes fotoativos ou corantes. Métodos endoscópicos de detecção e terapia são descritos nas patentes U.S. n— 4.932.412; 5.525.338; 5.716.595; 5.736.119; 5.922.302; 6.096.289; e 6.387.350, que são incorporadas aqui por referência em sua totalidade.
Em uma concretização da presente invenção, um nuclídeo pode ser usado. Em uma concretização particular radionuclídeos que têm propriedades de diagnóstico ou terapêutico, tal como índio-111 ou ítrio-90, respectivamente são contempladdos aqui. Outros nuclídeos úteis incluem, mas não são limitados a, F-18, P-32, Sc-47, Cu-62, Cu-64, Cu-67, Ga-67, Ga-68, Y-86, Y-90, Zr-89, Tc-99m, Pd-109, Ag-111 , ln-111 , 1-123, 1 -125, 1 -131 , Sm-153, Gd-155, Gd-157, Tb-161 , Lu-177, Re-186, Re-188, Pt-197, Pb-212, Bi-212, Bi-213, Ra-223, Ac-225, As-72, As-77, At-211 , Au-198, Au-199, Bi-212, Br-75, Br-76B, C-1 1 , Co-55Co, Dy-166, Er-169, F- 18, Fe-52, Fe-59, Ga-67, Ga-68, Gd -154-158, Ho-166, 1 -120,1 -121 ,1 -124, ln-110, ln-111 , M194, Lu-177, Mn-51 , Mn-52, Mo-99, N-13, O-15, P-32, P-33, Pb-211 , Pb-212, Pd-109, Pm-149, Pr- 42, Pr-143, Rb-82, Re-189, Rh-105, Se-47, Se-75, Sr-83, Sr-89, Tb-161 , Tc-94, Tc-99, Y-86, Y-90 ou Zr-89. Por exemplo, diagnóstico radionúclideos adequados incluem mas não são limitados a ln-110, ln-111 , Lu-177, F-18, Fe-52, Cu-62, Cu-64, Cu-67, Ga-67, Ga-68, Y- 86, Zr-89, Tc-94m, Tc-94, Tc-99m, 1-120, 1-123, 1-124, 1-125, 1-131 , Gd-154-158, P-32, C-1 1 , N-13, 0-15, Re-186, Re-188, Mn-51 , Mn-52m, Co-55, As-72, Br-75, Br-76, Rb-82m, Zr-89 e Sr-83. Um radionuclídeo de diagnóstico típico emite partículas e/ou pósitrons tendo entre 25-10.000 keV.
Adicionalmente, radionuclídeos terapêuticos adequados incluem, mas não são limitados a ln-11 1 , Lu-177, Bi-212, Bi-213, At-211 , Cu-62, Cu-64, Cu-67, Y-90, 1 -125, 1 -131 , P-32, P-33, Sc-47, Ag-HI, Ga-67, Pr-142, Sm-153, Tb-161 , Dy-166, Ho-166, Re-186, Re-188, Re-189, Pb- 212, Ra-223, Ac-225, Fe-59, Se-75, As-77, Sr-89, Mo-99, Rh-105, Pd-109, Pr-143, Pm-149, Er-169, lr-194, Au-198, Au-199, Ac-225 e Pb-211. Um cátion terapêuti-co típico emite partículas e/ou pósitrons tendo entre 20-10.000 keV.
Energias de declínio máximo de nuclídeos de emissão de partículas beta são de preferência de 20- 5,000 keV, mais de preferência de 100-4,000 keV, e com mais preferência de 500-2.500 keV. Também preferridos são radionuclídeos que substancialmente declinam com partículas de emis-são de Auger. Por exemplo, Co-58, Ga-67, Br-80m, Tc-99m, Rh-103m, Pt-109, In-HI, Sb-119, 1 -125, Ho-161 , Os-189m e lr-192. Energias de declínio de nuclídeos de emissão de partículas de Auger são de preferência <1.000 keV, mais de preferência <100 keV, e mais de preferência < 70 keV. Também preferidos são radionúclideos que substancialmente declinavam com a geração de alfa-partículas. Tais radionúclideos incluem, mas não são limitados a: Dy- 152, At-211 , Bi-212, Ra-223, Rn-219, Po- 215, Bi-211 , Ac-225, Fr-221 , At-217, Bi-213 e Fm-255. Energias de declínio de radionúclideos de emissão de partículas alfa úteis são de preferência de 2.000-10.000 keV, mais de preferência de 3.000-8.000 keV, e com mais preferência de 4.000-7.000 keV.
Outros agentes terapêuticos úteis incluem metais, tais como a-queles como parte de uma terapia fotodinâmica e nuclídeos, tais como aque-les valiosos nas terapias com base nos procedimentos de captura de neu-tron. Especificamente, zinco, alumínio, gálio, lutécio e paládio são úteis para a terapia fotodinâmica e B-10, Gd-157 e U-235 são para terapia de captura de neutron.
Em uma concretização, metais podem ser usados como agentes de diagnóstico, incluindo aqueles para técnicas de imagem de ressonância magnética. Estes metais incluem, mas não são limitados a: Gadolínio, manganês, ferro, cromo, cobre, cobalto, níquel, disprósio, rênio, erópio, térbio, holmío e neodímio. A fim de carregar um componente de anticorpo com metais radioativos ou íons paramagnéticos, pode ser necessário reagi-lo com um reagentes tendo uma cauda longa à qual são ligados uma multiplicidade de grupos de quelação para a ligação dos íons. Por exemplo tal cauda pode ser um polímero tal como uma polilisina, polissacarídeo, ou outra cadeia de-rivatizável ou derivada tendo grupos pendantes aos quais podem ser grupos de quelação ligados tais como, por exemplo, ácido etilenódiaminatetraacéti-co (EDTA), ácido dietilenotriaminapentaacético (DTPA), porfirinas, poliami-nas, éteres de coroa, bis-tiosemicarbazonas, polioximas, e similares grupos conhecidos como sendo úteis para esta finalidade. Além disso, quelatos podem ser acoplados aos antígenos de peptídeo usando-se químicas padrão. O quelato pode ser ligado ao anticorpo por um grupo que permite a forma-ção de uma ligação à molécula com perda mínima de imunorreatividade e agregação mínima e/ou reticulação interna. Outros, métodos e reagentes para a conjugação de quelatos a anticorpos são descritos na patente U.S. n9 4.824.659 por Hawthorne, entitulado "Antibody Conjugates," depositada em 25 de abril de 1989, cuja descrição é incorporada aqui em sua totalidade por referência. Em uma concretização particular, combinações de metal-quelato úteis podem incluir mas não são limitados a 2-benzil-DTPA e seus análogos de monometila e cicloexila, usados com isótopos de diagnóstico na faixa de energia geral de 20 a 2.000 keV. Os alguns quelatos, quando complexados com metais não reativos, tais como manganês, ferro e gadolínio, são úteis para MRI, quando usados ao longo com os anticorpo de concretizações descritas aqui. Quelatos macrocíclicos tais como NOA, DOA, e TETA podem ser de uso com uma variedade de metais e radiometais, mais particularmente com radionúclideos de gálio, ítrio e cobre, respectivamente. Tais complexos de metal-quelato podem ser produzidos muito estáveis por adaptação do tamanho do anel ao metal de interesse. Outros quelatos de tipo anel tais como poliéteres macrocíclicos, que são de interesse para nuclídeos de liga-ção estável, tal como 223Ra para RAIT estão incluídos por concretizações aqui.
Em uma concretização da invenção, imunoconjugados terapeuti-camente úteis podem ser obtidos por conjugação de agentes fotoativos ou corantes a um compósito de anticorpo. Fluorescente e outros cromógenoss, ou corantes, tais como porfirinas sensíveis a luz visível, foram usados para detectar ou tratar lesões por direção da luz adequada para a lesão. Em terapia, foi chamado de fotorradiação, fototerapia, ou terapia fotodinâmica (Jori e outros, eds., Photodynamic Therapy of Tumors e Other Diseases (Libreria Progetto 1985); van den Bergh, Chem, Britain 22: 430,1986). Além do mais, anticorpos monoclonais foram acoplados com corantes fotoativados para alcançar fototerapia. Mew e outros, J. Immunol. 130: 1473, 1983; idem., Câncer Res. 45: 4380, 1985; Oseroff e outros, Proc. Natl Acad. ScL USA 83: 8744, 1986; idem., Photochem. Photohiol 46:S3, 1987; Hasan e outros, Prog, Clin. Biol. Res. 288: 471 , 1989; Tatsuta e outros, Lasers Surg. Med. 9: 422, 1989; Pelegrin e outros, Câncer 61 : 2529, 1991. No entanto, estudos mais precoces não incluíam o uso de aplicações de terapia endoscópica, especialmente com o uso de fragmentos ou subfragmentos de anticorpo.

Assim, em uma concretização da presente invenção contempla uso terapêutico de imunoconjugados compreendendo agentes fotoativos ou corantes.
íons paramagnéticos adequados para o uso nas concretizações da presente invenção incluem mas não são limitados a cromo (III), manga-nês (II), ferro (III), ferro (II), cobalto (II), níquel(ll), cobre (II), neodímio (Hl), samário (III), itérbio (III), gadolínio (III), vanádio (II), terbío (III), disprósio (III), holmío (III) e erbío (III), com gadolínio sendo particularmente preferido.
íons úteis em outros contextos, tal como imagem de raios X, incluem mas não são limitados a Tolanthanum (III), ouro (III), chumbo (II), e especialmente bismuto (III). Rótulos fluorescentes incluem rodamina, fluo-resceína e renografina. Rodamina e fluoresceína são frequentemente ligadas através de um intermediário de isotiocianato. Materiais de contraste e radiopacos usados para aumentar imagens de raios X e tomografia computadorizada, e incluem compostos de iodo, compostos de bário, compostos de gálio, compostos de tálio, etc. Compostos específicos incluem bário, diatri-zoato, óleo etiodizado, citrato de gálio, ácido iocármico, ácido iocetâmico, iodamida, iodiparmde, ácido iodoxâmico, iogulamida, ioexol, iopamidol, ácido iopanóico, ácido iprocêmico, ácido iosefâmico, ácido iosérico, iosulamida meglumina, ácido iosemético, iotasul, ácido iotétrico, ácido iotalâmico, ácido iotróxico, ácido ioxáglico, ácido ioxotrizóico, ipodata, meglumina, metrizami-da, metrizoato, propiliodona, e cloreto de talo. Assim, em uma outra concretização, uma composição terapêutica, farmacêutica ou de diagnóstico compreendendo um anticorpo descrito aqui, em combinação com um excipiente, diluente ou veículo farmaceuticamente aceitável pode ser provido.
Em uma outra concretização da presente invenção, um processo para a preparação de uma composição terapêutica, farmacêutica ou de diagnóstico compreendendo a misturação de um anticorpo descrito aqui juntamente com um excipiente, diluente ou veículo farmaceuticamente aceitável pode ser provido.
Os anticorpos e composições podem ser para a administração em qualquer quantidade e forma apropriada de acordo com a terapia em que eles são empregados.

Em uma concretização, uma composição terapêutica, farmacêutica ou de diagnóstico pode tomar qualquer forma adequada para a administração, e, de preferência em uma forma adequada para a administração pa-renteral, por exemplo, por injeção ou infusão, por exemplo, por injeção bolus ou infusão contínua. Onde o produto é para injeção de infusão, pode tomar a forma de uma suspensão, solução ou emulsão em um veículo aquoso ou oleoso e pode conter agentes formuladores tais como agentes de suspensão, conservante, estabilização e/ou dispersão. Alternativamente, o anticorpo ou a composição pode estar em forma seca, para reconstituição antes do uso com líquido estéril apropriado.
É contemplado aqui que usos terapêuticos e diagnósticos podem compreender a administração de uma quantidade eficaz de um anticorpo de acordo com as concretizações descritas aqui a um indivíduo humano. A dose exata a ser administrada variará de acordo com o uso do anticorpo e da idade, do sexo e da condição do paciente mas pode tipicamente ser variada de cerca de 0,1 mg a 1000 mg, por exemplo de cerca de 1 mg a 500 mg. O anticorpo pode ser administrado como uma dose única ou de modo contínuo durante um período de tempo. Doses podem ser repetidas quando apropriadas.
Em um exemplo, os anticorpos e composições descritos aqui podem ser usados para a administração em qualquer quantidade e forma apropriada de acordo com a terapia em que eles são empregados. A dose em que o anticorpo é administrado depende da natureza da condição a ser tratada e se o anticorpo esta sendo uso profilaticamente ou para tratar uma condição existente. A dose também será selecionada de acordo com a idade e condições do paciente. Uma dose terapêutica dos anticorpos correspondentemente pode ser, por exemplo, entre de preferência 0,1-25 mg/kg de peso de corpo por uma dose terapêutica única e mais de preferência entre 0,1 -10 mg/kg de peso de corpo para dose terapêutica única.
Em uma concretização, qualquer anticorpo descrito aqui pode ser formulado de acordo com a prática convencional para a administração por qualquer rota adequada e pode em geral estar em uma forma Ilíquida (por exemplo, uma solução do anticorpo em um tampão fisiologicamente aceitável estéril) para a administração por, por exemplo, uma rota intravenosa, intraperitoneal, subcutânea ou intramuscular.
Um "imunoconjugado" contemplado aqui é um anticorpo, proteí-na de fusão ou seu fragmento conjugado a pelo menos um agente terapêuticos e/ou diagnóstico/detecção. O agente de diagnóstico/detecção pode incluir um radionuclídeo ou não radionuclídeo, um agente de contraste (tal como para imagem de ressonância magnética, tomografia computadorizada ou ultrassom), e o radionuclídeo pode ser um isótopo de emissão gama, be-ta, alfa, de elétron de Auger, ou posítron.
Como usado aqui, o termo "proteína de fusão de anticorpo" é uma molécula de ligação de antígeno recombinantemente produzida em que dois ou mais do anticorpo natural igual ou diferente, anticorpo de cadeia simples ou segmentos de fragmento de anticorpo com especificidades iguais ou diferentes estão ligadas. Valência da proteína de fusão indica o número total de braços ou sítios de ligação que a proteína de fusão tem um antígeno ou epitopo; isto é, monovalente, bivalente, trivalente ou multivalente. A multi-valência da proteína de fusão de anticorpo significa que ela tira vantagem de múltiplas interações na ligação a um antígeno, assim aumentando a avidez da ligação ao antígeno. Especificidade indica quantos antígeno ou epitopos diferentes uma proteína de fusão de anticorpo é capaz de se ligar; isto é, monoespecífica, biespecífica, triespecífica, multiespecífica. Usando-se essas definições, um anticorpo natural, por exemplo, um IgG, é bivalente uma vez que ele tem dois braços de ligação mas é monoespecífico uma vez que ele se liga a um antígeno. Proteínas de fusão multivalente, monoespecífica têm mais do que um sítio de ligação para um epitopo mas apenas ligam o mesmo epitopo no mesmo antígeno, por exemplo, um diacorpo com dois sítios de ligação reativos com o mesmo antígeno. A proteína de fusão pode incluir uma combinação multivalente ou multiespecífica de múltiplas cópias ou componentes de anticorpo diferentes do mesmo componente de anticorpo. A proteína de fusão pode adicionalmente incluir um agente terapêutico. Exemplos de agentes terapêuticos adequados para tais proteínas de fusão inclu- em imunomoduladores ("proteína de fusão de imunomodulador de anticorpo") e toxinas ("proteína de fusão de toxina de anticorpo"). Uma toxina preferida compreende ribonuclease (RNase), de preferência uma RNase recom- binante.
Em uma outra concretização, ligação seletiva pode ser alcançada por uso de um ligante heterobifuncional tais como éster de hidroxissucci- nimida de maleimida. Reação do éster com um anticorpo ou fragmento pode derivatizar grupos amina no anticorpo ou fragmento, e o derivado pode então ser reagido com, por exemplo, um fragmento de Fab de anticorpo tendo gru-pos sulfidrila livres (ou, um fragmento maior ou anticorpo intacto com grupos sulfidrila anexos ao mesmo por, por exemplo, Reagente de Traut). Tal ligante é menos provável de reticular grupos no mesmo anticorpo e aperfeiçoa a seletividade da ligação.
Em uma concretização particular, anticorpos ou fragmentos des-critos aqui podem ser ligados a sítios distantes dos sítios de ligação de antí-geno. Isto pode ser realizado, por, por exemplo, ligação a grupos de sulfidrila de intercadeia clivados, como observado acima. Um outro método envolve a reação de um anticorpo tendo uma porção de carboidrato oxidada com um outro anticorpo que tem pelo menos uma função amina livre. Isto resulta em uma ligação de base de Schiff inicial (imina), que é de preferência estabilizada por redução a uma amina secundária, por exemplo, por redução de bo-roidreto, para formar o produto final. Tais ligações específicas de sítio são descritas, para moléculas pequenas, na patente U.S. n- 4.671.958, e para adendos maiores na patente U.S. ηδ 4.699.784.
As pontes de dissulfeto de intercadeia de um fragmento de

F(ab')2 tendo especificidade de alvo podem ser reduzidas com cisteína, evitando ligação de cadeia pesada-leve, para formar fragmentos de Fab'-SH. O(s) grupo(s) pode(m) ser ativado(s) com um excesso de ligação de bis-maleimida (1 ,1 '-15(metilenodi-4,1 -fenileno)bis-maleimida).
Em uma concretização, anticorpos hL243 descritos aqui, bem como outras moléculas de ligação com especificidades diferentes podem ser usadas em terapia de combinação. Por exemplo, os anticorpos multiespecí- ficos podem incluir pelo menos um sítio de ligação a um epitopo reconhecido pelo anticorpo monoclonal de camundongo ml_243, ou antígeno, e pelo menos um sítio de ligação a um outro epitopo reconhecido pelo anticorpo monoclonal de camundongo ml_243, ou um outro antígeno. Além disso, anticor-pos multivalentes (incluindo múltiplos sítios de ligação ao mesmo epitopo ou antígeno), ou os anticorpos podem ser tanto multivalentes quanto multiespe-cíficos.
Em uma concretização particular, uma molécula de ligação pode ser uma proteína de fusão. Em uma concretização mais particular, a proteína de fusão pode conter quatro ou mais Fvs ou Fab's de anticorpos L243 de camundongo, humanos, quiméricos, humanizados ou fragmento como descrito aqui. Em uma outra concretização, uma proteína de fusão de anticorpo pode conter um ou mais Fvs ou Fab's dos mAbs ou fragmentos de um L243 Mab humanizado, quimérico ou de camundongo ou fragmento como descrito aqui. De acordo com estas concretizações, um ou mais Fvs ou Fab's oriundos de anticorpos específicos para um outro antígeno que é específico para um marcador de célula outro que não um antígeno HLA pode ser incluído. Por exemplo, o antígeno de não HLA pode incluir um marcador de tumor selecionado de um antígeno de linhagem de célula B (por exemplo, CD19, CD20 ou CD22 para o tratamento de malignidades de célula B). Em um outro exemplo, o antígeno de não HLA pode também ser expresso em outras células que causem outros tipos de malignidades, tal como SI 00 em mela-noma, etc. Além disso, o marcador de célula pode ser um antígeno de linhagem de não célula B, tal como selecionado do grupo que consiste em HLA-DR, CD30, CDS3, CD52, CD66, MUC1 e TAC.
Em uma concretização, um anticorpo L243 descrito aqui pode ser combinado com outros anticorpos e usados para tratar um indivídiuo tendo ou suspeito de desenvolver uma doença. De acordo com esta concretização uma anticorpo L243 ou sua composição pode ser combinada com um anticorpo monoclonal anticâncer tal como um anticorpo monoclonal humanizado (por exemplo hA20 (CD20 Mab)) e usado para tratar câncer. Em uma concretização mais preferida, um anticorpo HLA-DR de L243 pode ser combinado com um anticorpo monoclonal de anticâncer (por exemplo, hA20) e usado para tratar um indivíduo tendo suspeitado de de desenvolver uma doença. É contemplado aqui que um anticorpo hl_243 pode ser usado como uma composição de anticorpo separada em combinação com uma ou mais outras composições de anticorpo separadas, bem como, usadas como um anticorpo bifuncional, por exemplo, um de hl_243 e um outro de hA20. De acordo com esta concretização, o anticorpo hl_243 pode ser o HLA-DR de hl_343. Em uma outra concretização particular, a doença pode incluir targen-tin uma doença de malignidade de célula B em um indivíduo tendo tal doen-ça. A malignidade de célula B pode consistir em formas indolentes de linfomas de célula B, formas agressivas de linfomas de célula B, leucemias linfáticas crónica, leucemias linfáticas aguda, macroglobulinemia de Waldens-trom, e mieloma múltiplo. Há também distúrbios de célula B não malignos e doenças relacionadas, tais como muitas doenças auto-imunes e desregula-doras imunes, incluindo septicemia e choque sético entre doenças desregu-ladoras imunes (ver também o pedido de patente provisório U.S. nQ 60/634.076 depositado em 8 de dezembro de 2004, por Goldenberg e Hansen, e incorporado aqui em sua totalidade). Em particular, as composições descritas aqui são particularmente úteis para o tratamento de várias doenças auto-imunes, bem como formas indolentes de linfomas de célula B, formas agressivas de linfomas de célula B, leucemias linfáticas crónica, leucemias linfáticas aguda, macroglobulinemia de Waldenstrom, e mieloma múltiplo, bem como outras malignidades hematopoiéticas, tais como leucemias mie-lóides crónica e aguda e linfomas e leucemias de célula T. Por exemplo, os imunoconjugados e componentes de anticorpo hl_243 podem ser usados de preferência para tratar tanto formas indolentes quanto agressivas de leucemias linfóides e linfomas de não Hodgkin.
Antígenos associados a tumor que podem ser direcionados incluem, mas não são limitados a, A3, antígeno específico para anticorpo A33, antígeno de BrE3, CD1 , CD1a, CD3, CD5, CD15, CD19, CD20, CD21 , CD22, CD23, CD25, CD30, CD45, CD74, CD79a, CD80, HLA-DR5 NCA 95, NCA90, HCG e suas subunidades, CEA (CEACAM-5), CEACAM-6, CSAp, EGFR, EGP-1 , EGP-2, Ep-CAM, Ba 733, HER2/neu, fator induzível de hipoxia (HIF), antígeno KC4, antígeno de KS-1 , KS 1 -4, Le-Y, fator de inibição de macrófago (MIF), MAGE, MUC1 , MUC2, MUC3, MUC4, antígeno de PAM-4, PSA, PSMA, RS5, S100, TAG-72, p53, tenascin, IL-6, IL-8, fator de cresci-mento de insulina-1 (IGF-1), antígeno de Tn, antígenos de Thomson-Friedenreich, antígenos de necrose de tumor, VEGF, antígeno de 17-1 A, um marcador de angiogênese (por exemplo, fibronectina de ED-B), um marcador de oncogene, um produto de oncogene, e outros antígenos associados a tumor. Relatórios recentes sobre antígenos associados a tumor incluem Mi-zukami e outros, (2005, Nature Med. 11 :992-97); Hatfield e outros, (2005, Curr. Câncer Drug Targets 5:229-48); Vallbohmer e outros (2005, J. CHn. Oncol. 23:3536-44) e Ren e outros (2005, Ann. Surg. 242:55-63), cada um incorporado aqui por referência.
Além disso, uma outra concretização da presente invenção pode incluir anticorpos biespecíficos ou multiespecíficos para a preparação de i-munoconjugados ou composições. De acordo com estas concretizações, anticorpo L243 ou fragmentos ou suas proteínas de fusão de anticorpo podem ser ligados a um anticorpo ou fragmento de anticorpo específico para uma substância marcadora de câncer, um epitopo na superfície de um orga-nismo de doença infecciosa, ou uma substância nociva no sangue ou outros fuidos de corpo. Os anticorpos biespecíficos e multiespecíficos podem ser úteis para a indução de depuração de uma variedade de substâncias nocivas. Por exemplo, um anticorpo biespecífico pode ter uma ou mais especificidades para uma substância nociva, tal como um organismo patogênico, e uma ou mais especificidades para HLA-DR a cadeia não variante de classe II de HLA (li). A cadeia não variante de classe II de HLA (li) é descrita em detalhes na patente U.S. nQ de série 09/314.135, depositada em 19 de maio de 1999, entitulada "Therapeutic Using a Bispecific Antibody," que é incorporada em sua totalidade por referência.
Em uma outra concretização, os imunoconjugados e composições descritos aqui podem também incluir um anticorpo multivalente L243. De acordo com esta concretização, uma proteína de ligação de alvo multiva- lente pode ser construída por associação de uma primeiro e um segundo polipeptídeo. O primeiro polipeptídeo pode incluir uma primeira molécula de Fv de cadeia simples covalentemente ligada a um primeiro domínio de tipo imunoglobulina que de preferência é um domínio de região variável de ca-deia leve de imunoglobulina. O segundo polipeptídeo pode incluir uma segunda molécula de Fv de cadeia simples covalentemente ligada a um segundo domínio de tipo imunoglobulina que é de preferência um domínio de região variável de cadeia pesada de imunoglobulina. Cada uma da primeira e segunda das moléculas de Fv de cadeia simples forma um sítio de ligação de alvo, e os primeiro e segundo domínios de tipo imunoglobulina se associam para formar um terceiro sítio de ligação alvo.
Em uma concretização alternativa, um anticorpo monoclonal L243 humanizado, quimérico ou humano pode ser usado para produzir dia-corpos, triacorpo e tetracorpos específicos de antígeno. Por exemplo, os di-acorpos, triacorpo e tetracorpos monoespecíficos podem ser ligar seletiva-mente a antígenos direcionados e como o número de sítios de ligação na molécula aumenta, a afinidade para célula alvo aumenta e um tempo de residência mais longo é observado na localização desejada. Para diacorpos, as duas cadeias compreendendo o polipeptídeo de VH do L243 mAb huma-nizado ligado ao polipeptídeo de VK do L243 mAb humanizado por um ligante de resíduo de cinco aminoácidos pode ser utilizado. Cada cadeia forma uma metade de diacorpo L243 humanizado. No caso de triacorpos, as três cadeias compreendendo polipeptídeo de VH do L243 MAb humanizado ligado ao polipeptídeo de VK do L243 MAb humanizado por nenhum ligante é utilizado. Cada cadeia forma uma terceira do triacorpo de hl_243.
Em uma outra concretização, os imunoconjugados e composições descritos aqui podem também incluir anticorpo de cadeia simples bies-pecíficos funcionais (bscAb) (Ver por exemplo, Mack e outros, Proc. Natl. Acad. Sd. USA, 92:7021 -7025, 1995, incorporado aqui por referência). Por exemplo, bscAb pode ser produzido por união de dois fragmentos de Fc de cadeia simples através de um ligante de glicina-serina usando-se métodos recombinantes. Os domínios de cadeia leve de V (VL) e de cadeia pesada de V (VH) de dois anticorpos de interesse podem ser isolados usando-se métodos de PCR padrão. Os cDNAs de VL e de VH obtidos a partir de cada hibridoma podem ser unidos para formar um fragmento de cadeia simples em um PCR de fusão de duas etapas. Em um exemplo, a primeira etapa de PCR introduz o ligante de (Gly4- Serl)3, e a segunda etapa une os amplicons de VL e VH. Cada molécula de cadeia simples pode ser clonada em um vetor de expressão bacteriano. Após a ampliação, uma das moléculas de cadeia simples pode ser extirpada e subclonada no outro vetor, contendo a segunda molécula de cadeia simples de interesse. Então o fragmento de bscAb pode ser subclonado em um vetor de expressão eucariótico. Expressão de proteína funcional pode ser obtida por tranfecção do vetor em células de ovário de hamster chinês. Outras proteínas de fusão biespecíficas são preparadas de modo similar. Anticorpos de cadeia simples biespecíficos e proteínas de fusão biespecíficas podem ser usados para se preparar os veí-culos de fármaco.
Além disso, uma concretização independentemente pode incluir um diacorpo tandem tetravalente (chamado tandab) com especificidade dupla (Cochlovius e outros, Câncer Research (2000) 60: 4336-4341 ). Um tandab biespecífico é um dímero de dois polipeptídeos idênticos, cada um con-tendo quatro domínios variáveis de dois anticorpos diferentes (VH1 , VL1 , VH2, VL2) ligados em uma orientação para facilitar a formação de dois sítios ligação potenciais para cada uma das duas especificidades diferentes na auto-associação.
Em uma outra concretização, um anticorpo L243 multivalente conjugado pode ser usado para preparar o imunoconjugado ou a composição. Resíduos de aminoácidos adicionais podem ser adicionados ou ao N-ou N-terminal do primeiro ou o segundo polipeptídeo. Os resíduos de aminoácidos adicionais podem compreender uma etiqueta de peptídeo, um peptí-deo de sinal, uma citocina, uma enzima (por exemplo, uma enzima de ativa-ção de pró-fármaco), um hormônio, um oligonucleotídeo, um RNA de interferência, uma toxina de peptídeo, tais como exotoxina de pseudomonas, um fármaco de peptídeo, uma proteína citotóxica ou outras proteínas funcionais.

Como usado aqui, a proteína funcional é uma proteína que tem uma função biológica.
Em ainda uma outra concretização, o anticorpo hl_243, ou seu fragmento, pode ser usado para preparar um complexo de proteína poliva-lente, uma nova proteína de fusão compreendendo três ou quatro sítios de ligação de antígeno. De acordo com estas concretizações, um ou mais dos sítios de ligação de antígeno podem ser constituídos dos domínios variáveis de hl_243, e um ou mais dos sítios de ligação de antígeno restantes podem incluir domínios variáveis de outros anticorpos específicos de anticorpo quando desejados. Tais complexos de proteína polivalentes como descritos na publicação de PCT WO 04094613A2 (Rossi e outros, 2004). Quando combinados com uma cadeia variável de anticorpo específico de antígeno apropriado,1 um complexo de proteína polivalente compreendendo um domínio variável de hl_243 podem ser usados para tratar uma variedade de dis-túrbios neoplásticos, infecciosos, metabólicos, neurodegenerativas, auto-imunes ou de desregulação imune.
Em uma concretização da presente invenção, fármacos, toxinas, compostos radioativos, enzimas, ormônios, proteínas citotóxicas, oligonu-cleotídeos, RNAs de interferência (por exemplo, moléculas de RNAi), quela-tos, citocinas e outros agentes funcionais podem ser conjugados a uma proteína de ligação alvo multivalente. De acordo com estas concretizações, ligações covalentes às cadeias laterais dos resíduos de aminoácidos da proteína de ligação alvo multivalente podem ser usadas, por exemplo, grupos amina, carboxila, fenila, tiol ou hidroxila. Vários ligantes convencionais po-dem ser usados para esta finalidade, por exemplo, diisocianatos, diisotiocia-natos, ésteres de bis(hidroxissuccinimida), carbodiimidas, ésteres de malei-mida-hidroxissuccinimida, glutaraldeído e similares. Conjugação de agentes à proteína multivalente de preferência não significativamente afeta a especificidade de ligação da proteína ou afinidade a seu alvo. Como usado aqui, um agente funcional é um agente que tem uma função biológica. Um agente funcional preferido é um agente citotóxico.
Em ainda outas concretizações, fornecimento anticorpo-dirigido biespecífico de terapêuticos ou polímeros de pró-fármacos a alvos in vivo podem ser combinados com fornecimento de anticorpo biespecífico de ra-dionuclídeos, tal que a quimioterapia de combinação e radioimunoterapia seja alcançado. Cada agente terapêutico pode ser conjugado a um conjuga-do direcionado e administrado simultaneamente, ou o nuclídeo pode ser dado como parte de um primeiro conjugado direcionável e o fármaco dado em uma última etapa como parte de um segundo conjugado direcionável. Conjugados e fármacos direcionáveis adequados são conhecidos na técnica.
Em uma concretização, agentes citotóxicos podem ser conjuga-dos a um veículo de polímero, e o veículo de polímero pode ser subsequentemente conjugado à proteína de ligação alvo multivalente. Para este método, ver Ryser e outros, Proc. Natl. Acad. Sd. USA, 75:3867-3870.1978, a patente U.S. n9 4.699.784 e a patente U.S. n9 4.046.722, que são incorporados aqui por referência. Conjugação de preferência não significativamente afeta a especificidade ou afinidade de ligação da proteína de ligação multivalente.
Uso de anticorpos humanizados, quimérico e humanos para o tratamento e diagnóstico
Anticorpos monoclonais humanizados, quiméricos ou humanos descritos aqui, são adequados para o uso nos métodos terapêuticos e métodos de diagnósticos que utilizam imunoconjugados e composições como descritos aqui. Correspondentemente, os imunoconjugados ou composições podem incluir anticorpo humanizados, quiméricos e humanos nus ou anticorpo, que podem ser conjugados a um veículo, um agente terapêutico ou um agente de diagnóstico. Os imunoconjugados podem ser administrados como terapia multimodal. Por exemplo, agentes de diagnósticos ou terapêuticos adicionais podem ser administrados antes, simultaneamente ou depois da administração do imunoconjugado ou composição. A eficácia dos imunoconjugados ou composições pode ser aumentada por suplementação de composições ou imunoconjugados de L243 humanizados, quiméricos ou humanos com uma ou mais outras moléculas de ligação (isto é, mAbs a an-tígenos específicos, tais como CD4, CDS, CD8, CD14, CD15, CD19, CD21 , CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUC1 , MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrose, PAM-4, KS-1 , Le(y), MAGE, la, IL-2, IL-6, tenascin, HM1.24, VEGF, EGFR, EGP-1 , EGP-2, re-ceptor de folato, gonodotropina coriônica humana, antígeno-p específico de cólon (CSAp), fator de crescimento de tipo insulina (ILGF), fator de crescimento placental(PIGF), fosfatase de ácido prostático, PSA, PSMA, T101 , TAG, TAG-72, Her2/neu, anidrase carbónica IX, IL-6, S100, alfa- fetoproteí-na, A3, CA125, antígeno carcinoembriônico (CEA), antígenos de reação cru-zada não específicos tais como CD66 (a,b,c,d)( MART-1 , TRP-1 TRP-2, gp100, amilóide, com anticorpo hL243, ou seus imunoconjugados, ou anticorpos a estes antígenos relatados). Antígenos associados a célula B preferidos incluem aqueles equivalente a antígenos de CD19, CD20, CD21 , CD22, CD23, CD46, CD52, CD74, CD80, e CDS humanos. Antígenos de célula T preferidos incluem aqueles equivalentes a antígenos de CD4, CDS e CD25 humanos (o receptor de IL-2).
Alternativamente, molécula substituta para um antígeno de HLA-DR pode ser usada no tratamento de ambos aos distúrbios de célula B quanto de célula T. Em uma concretização particular, antígenos de célula B po-dem ser equivalente a antígenos de CD19, CD22, CD21 , CD23, CD74, CD80, e HLA-DR humanos. Em uma outra concretização particular, antígenos de célula T a antígenos de CD4, CDS e CD25 humanos podem ser usados. Alternativamente antígenos de CD46 e CD59 na superfície de células de câncer que bloqueiam lise dependente de complemento (CDC) podem ser usados. Em uma concretização, melanoma maligno associado a antígenos tais como equivalente a MART-1 , TRP-1 , TRP-2 e gplOO podem ser usados. Além disso, em uma concretização particular, antígenos associados a mieloma múltipo são aqueles equivalente a MUC1 , CD38, e CD74.
Em um exemplo, a molécula de ligação suplementar pode ser nua ou conjugada com um veículo, um agente terapêutico, ou um agente de diagnóstico, incluindo lipídios, polímeros, fármacos, toxinas, imunomodula-dores, radionuclídeos, etc. De acordo com esta concretização, a molécula de 5

ligação sumplementar pode ser administrada concorrentemente, sequencialmente, ou de acordo com o regime de administração dosada prescrito, com as composições ou imunoconjugados de L243 humanizados, quiméricos e humanos.
Além disso, a administração de uma composição ou imunocon-jugado para os usos terapêuticos e diagnósticos em linfomas de célula B, linfomas de célula T, e outras doenças ou distúrbios é contemplada aqui. Um imunoconjugado, como descrito aqui, pode ser uma molécula incluindo uma molécula de ligação conjugada a um veículo. De acordo com esta concreti-zação, o imunoconjugado pode ser usado para formar uma composição que ulteriormente inclui um agente terapêutico ou de diagnóstico, que pode incluir um peptídeo que pode portar um agente de diagnóstico ou terapêutico. Um imunoconjugado retém a imunorreatividade da molécula de ligação (isto é, a porção de anticorpo tem cerca da mesma capacidade ou levemente reduzida de ligar o antígeno cognato depois da conjugação como antes da conjugação). Imunoconjugados podem incluir moléculas de ligação conjugadas a qualquer segunda molécula adequada (por exemplo, lipídios, proteínas, car-boidratos, que podem formar estruturas ordenadas superiores, ou as próprias estrutras ordenadas superiores, tais como lipossomas, micelas e/ou nanopartículas). Para facilitar o fornecimento de certos efetores, pode ser desejável conjugar o anticorpo hl_243 a uma ou mais moléculas que são capazes de formar estrutras ordenadas superiores (por exemplo, lipídios alifáti-cos). Moléculas anfifílicas podem também ser desejáveis para facilitar o fornecimento de efetores que demonstram solubilidade limitada em solução aquosa.
Em uma outra concretização, uma ampla variedade de reagentes de diagnósticos e terapêuticos podem ser usados para formar os imunoconjugados e composições como descritos aqui. Agentes terapêuticos incluem, por exemplo, fármacos quimiterapêuticos tais como vinca alcalóides, antraciclinas, epidofilotoxinas, taxanos, antimetabólitos, agentes de alquila-ção, antibióticos, inibidores de Cox-2, antimitóticos, agentes antiangiogêni-cos e apoptóticos, particularmente doxorrubicina, metotrexato, taxol, CPT-11 campotecanos, e outros oriundas destas e outras classes de agentes anti-câncer e similares. Outros fármacos quimioterapêuticos de câncer úteis para a preparação de imunoconjugados e proteína de fusão de anticorpo incluem mostadrdas de nitrogénio, sulfonatos de alquila, nitrosouréias, triazenos, a- nálogos de ácido fólico, inibidores de COX-2, análogos de pirimidina, análogos de purina, complexos de coordenação de platina, hormônio, e similares. Agentes quimioterapêuticos são descritos em Remington's Pharmaceutical Sciences, 19th Ed. (Mack Publishing Co. 1995), e in Goodman e Oilman's The pharmacological Basis of Therapeutics, 7th Ed. (MacMillan Publishing Co. 1985), bem como edições revisadas destas publicações. Outros agentes quimioterapêuticos adequados, tais como fármacos experimentais, podem ser usados e são conhecidos na técnica.
Adicionalmente, em uma outra concretização, um quelador tal como DTPA, DOTA, TETA, ou NOTA pode ser conjugado a um ou mais componentes das composições como descritas aqui. Alternativamente, um peptídeo adequado incluindo um rótulo detectável (por exemplo, molécula fluorescente), ou um agente citotoxico (por exemplo, um metal pesado ou radionuclídeo), pode ser covalentemente, não covalentemente, ou de outra maneira associado a mais componentes das composições como descrito aqui. Por exemplo, um imunconjugado terapeuticamente útil pode ser obtido por incorporação de um corante ou agente fotoativo nas composições como descritas aqui. Composições fluorescentes, tais como fluorocromo e outros cromógenos, ou corantes, tais como porfirinas sensíveis a luz visível, foram usadas para detectar e tratar lesões por direção da luz adequada para a le-são. Na terapia, isto foi chamado fotorradiação, fototerapia, ou terapia foto-dinâmica (Jori e outros (eds.), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh, Chem. Britain 22:430 (1986)). Além do mais, anticorpos monoclonais foram acoplados com corantes fotoativados para alcançar fototerapia. Mew e outros, J. Immunol. 130:1473 (1983); idem., Câncer Res. 45:4380 (1985); Oseroff e outros, Proc. Natl. Acad. Sei. USA 83:8744 (1986); idem., Photochem. Pho-tobiol. 46:83 (1987); Hasan e outros, Prog. Clin. Biol. Res. 288:471 (1989);

Tatsuta e outros, Lasers Surg. Med. 9:422 (1989); Pelegrin e outros, Câncer 67:2529 (1991 ). Aplicações endoscópicas são também contempladas. Métodos endoscópicos de detecção e terapia são descritos nas patentes U.S. n— 4.932.412; 5.525.338; 5.716.595; 5.736.119; 5.922.302; 6.096.289; e 6.387.350, que são incorporados aqui por referência em sua totalidade.
Em uma concretização, é contemplado aqui que o uso terapêutico de composições de imunoconjugado de hL243 compreendendo corantes ou agentes fotoativos, e os pesentes métodos de dianóstico/terapêuticos podem incluir o uso terapêutico ou de diagnóstico de composições de imu-noconjugado de hL243 compreendendo corantes ou agentes fotoativos. O imunoconjugado pode também conter agentes ultrassom dos tipos discutidos acima. Também contemplados é o uso de agentes radiativos e não radioati-vos como agentes de diagnóstico nas composições de imunoconjugado de L423 humanizadas, quiméricas e humanas como descritas aqui. Um agentes de diagnóstico não radioativo adequado é um agente de contraste para a imagem de ressonância magnética, tomografia computadorizada ou ultrassom. Agentes de imagem magnética incluem, por exemplo, metais não ra-dioativos, tais como manganês, ferro e gadolínio, combinações de metal-quelato que incluem 2-benzil-DTPA e seus análogos de monometila e ciclo-exila, quando usadas ao longo com os anticorpos descritos aqui (ver a patente U.S. ne de série 09/921.290 depositada em 10 de outubro de 2001 , que é incorporada em sua totalidade por referência).
Em uma outra concretização, uma composição de imunoconjugado de L423 humanizada, quimérica e humana pode incluir um radioisótopo ou um emissor de posítron útil para imagem de diagnóstico. Radioisótpos podem incluir aqueles na faixa de energia de 60 a 4.000 keV. Radioisótopos podem incluir 18-F, 52-Fe, 62-Cu, 64-Cu, 67-Cu, 67-Ga, 68-Ga, 86-Y, 89-Zr, 94-Tc, 94m-Tc, 99m-Tc, H l-ln, 123-1 , 124-1 , 125-1 , 131-1 , e similares. (Ver, por exemplo, o pedido de patente U.S. "Labeling Targeting Agents with Gal-lium-68"- Inventors G.L.Griffiths e WJ. McBride (Pedido de patente provisório NQ 60/342.104), que descrevem emissores de posítron, tais como 18-F, 68-Ga, 94m-Tc, e similares, para as finalidades de imagem e que é incorporado em sua totalidade por referência).
Em uma outra concretização da presente invenção, uma toxina, tal como extoxina de Pseudomonas, pode estar presente nos imunoconjuga-dos ou anticorpos L243 humanizados, quimérico e humanos ou suas com-posições, como descrito aqui. Por exemplo, a toxina pode ser complexada para ou formar a porção de agente terapêutico de uma proteína de fusão de anticorpo de um anticorpo hl_243 descrito aqui. Outras toxinas incluem ricina, abrina, ribonuclease (RNase), Dnase, enterotoxina-A Stahilococcal, proteína antival de caruru-de-cacho, gelonina, toxina de difterina, exotoxina de Pseu-dominas, e endotoxina de Pseudomonas. (Ver por exemplo, Pastan e outros, Celi 47:641 (1986), e Goldenberg, CA - A Câncer Journal for Clinicians 44:43 (1994). Toxinas adicionais adequadas para o uso aqui são conhecidas por aqueles versados na técnica e são descritas na patente U.S. ne 6.077.499, que é incorporada aqui em sua totalidade por referência).
Alternativamente, um imunomodulador, tal como uma citocina pode também estar presente nas composições de imunoconjugado de hl_243 administradas como descritas aqui. Por exemplo, um imunomodulador pode ser conjugado a, ou formar uma porção de agente terapêutico de uma proteína de fusão de anticorpo ou ser administrada como parte das composições de imunoconjugado de L423 humanizadas, quiméricas e humanas como descritas aqui. Citocinas adequadas incluem, mas não são limitadas a, inter-ferons e interleucinas, como descritos aqui.
Em uma concretização, um anticorpo L243 humanizado pode ser usado como parte de pré-direcionamento de uma alternativa não imunogêni-ca, altamente seletiva para aplicações de diagnóstico e terapêuticas, em que um anticorpo biespecífico é empregado que co-reconhece um antígeno de tumor e um ou mais haptenos em uma molécula de veículo, onde a molécula de veículo pode incluir uma molécula efetora. Anticorpos biespecíficos (bsAb) têm a vantagem de ser capaz de serem engenheirados como uma proteína humanizada relativamente não imunogênica. A afinidade de ligação de um bsAb pode depender da afinidade de ligação do agente de direciona-mento primário. Por uso de um peptídeo divalente, um aumento de afinidade pode ser alcançado, que pode grandemente aperfeiçoar a ligação do peptí- deo ao sítio alvo em comparação com um peptídeo monovalente. Ver, por exemplo, a patente U.S. ne 5.256.395, cujo conteúdo é incorporado aqui em sua totalidade.
Em uma concretização, pré-direcionamento com um hl_243 bsAb pode incluir um braço do bsAbd derivado das regiões variáveis de um anticorpo hL243 como aqui descrito, e o segundo branço do anticorpo que reconhece uma porção que contém um agente terapêutico ou de diagnóstico (por exemplo, um veículo com um agente terapêutico ou de diagnóstico juntos como um "construto direcionável"). Métodos e construtos direcionáveis adequados de uso são descritos na patente U.S. n- 20050002945, cujo conteúdo é incorporado aqui por referência em sua totalidade. O construto direcionável pode ser, por exemplo, (i) DOTA-Phe-Lys(HSG)-D- Tyr-Lys(HSG)-NH2; (ii) DOTA-Phe-Lys(HSG)-Tyr-Lys- (HSG)-NH2; ou (iii) Ac- Lys(HSG)D-Tyr-Lys(HSG)-Lys(TsCg-Cys)-NH2) embora o técnico versado apreciará que outros construtos direcionáveis possam ser usados. Em outros sistemas, o construto direcionável compreende uma porção haptênica que é reconhecida pelo segundo braço do anticorpo e um agente terapêutico ou de diagnóstico. Por exemplo, um agente terapêutico pode ser um agente quimioterapêutico ou uma toxina, tais como aqueles descritos acima.
Uma concretização particular inclui um sistema de pré-direcionamento descrito por Janevik- Ivanovska e outros que usa um anticorpo dirigido contra um derivado de histamina, histamina-succinil-glicila (HSG), como um sistema de reconhecimento sobre o qual uma variedade de substâncias efetoras poderiam ser preparadas. Anticorpos L243 humanizados da presente invenção podem ser usados em tal sistema. Este sistema de pré-direcionamento representa uma vantagem significativa sobre outros sistemas de pré-direcionamento pelo fato de que ele pode ser usado com uma variedade de agentes terapêuticos ou imagem diferentes. Em um e-xemplo, este sistema pode ser baseado no uso de anticorpo dirigido contra DTPA ou HSG e o desenvolvimento de peptídeos contendo os resíduos de DTPA ou HSG. Peptídeos contendo HSG e/ou contendo DTAP podem ser sintetizados, e onde o peptídeo contém DTPA, o peptídeo pode ser marcado com nuclídeos quelados, tal como In, Y ou Lu, que podem ser úteis na terapia ou diagnóstico. Anticorpos foram gerados contra a porção de DTPA-ln. Em outras concretizações, o sistema inclui peptídeos e haptenos e/ou que- ladores tal como DTPA, e que pode ser adequado para radiomarcação com 90l "Ίη, e 1 7Lu bem como 99mTc.
Preparação de Imunoconjugados
Os imunoconjugados descritos aqui podem ser preparados por métodos conhecidos dos anticorpos de ligação com lipídios, carboidratos, proteína ou outros átomos e moléculas. Por exemplo, as moléculas de ligação descritas aqui podem ser conjugadas com um ou mais veículos descritos aqui (por exemplo, lipídios, polímeros, lipossomas, micelas, ou nanopar-tículas) para formar um imunoconjugado, e o imunoconjugado pode incorporar um agente terapêutico ou de diagnóstico ou covalentemente, não cova-lentemente ou de outra maneira. Além disso, qualquer uma das moléculas de ligação descritas aqui pode ser conjugada com um ou mais agentes terapêuticos ou de diagnóstico aqui, ou veículos adicionais. Em geral, um agente terapêutico ou de diagnóstico pode ser ligado a cada molécula de ligação mas do que um agente terapêutico ou de diagnóstico pode ser ligado à mesma molécula de ligação. Em uma concretização, as proteínas de fusão de anticorpo contempladas aqui podem incluir dois ou mais anticorpos ou seus fragmentos e cada um dos anticorpos que incluem esta proteína de fusão pode ser conjugada com um ou mais veículos descritos aqui. Adicionalmente, um ou mais dos anticorpos da proteína de fusão de anticorpo po-de ter um ou mais agentes de diagnóstico ou terapêuticos ligados. Além disso, a terapêutica não necessita ser a mesma mas pode ser agentes terapêuticos diferentes. Por exemplo, as composições descritas descritas aqui podem incluir um fármaco ou um radioisótopo.
Em um exemplo, uma IgG pode ser radiomarcada com 131-1 e conjugada a um lipídio, tal que o conjugado de IgG-lipídio pode formar um lipossoma. De acordo com este exemplo, o lipossoma pode incorporar um ou mais agentes terapêuticos ou de diagnósticos (por exemplo, um fármaco tal como FudR-dO). Alternativamente, além do veículo, a IgG pode ser conjugada a 131 -1 (por exemplo, a um resíduo de tirosina) e um fármaco (por exemplo, no grupo amino épsilon de um resíduo de lisina), e o veículo pode incorporar um agente terapêutico ou de diagnóstico. Os agentes terapêuticos e de diagnósticos podem ser covalentemente associados à molécula de ligação (por exemplo, conjugada a grupos dissulfeto, cadeias laterais de carboi-drato, ou qualquer outro grupo reativo na molécula de ligação.
Em uma outra concretização, um veículo, um agente terapêutico ou de diagnóstico pode ser ligado na região principal de um componente de anticorpo reduzido através da formação de ligação de dissulfeto. Como uma alternativa, peptídeos podem ser ligados a um componente de anticorpo u-sando-se um reticulador heterobifuncional, tal como 3-(2-piridilditio)proprionato de N-succinila (SPDP). Yu e outros, Int. J. Câncer 56: 244 (1994). Técnicas gerais para tal conjugação são bem-conhecidas na técnica. (Ver por exemplo, Wong, Chemistry of Protein Conjugation e Cross-linking (CRC Press 1991 ); Upeslacis e outros, "Modification of Antibodies by Chemical Methods," in Monoclonal Antibodies Principies e Applications, Bir-ch e outros (eds.), págs. 187D230 (Wiley-Liss, Inc. 1995); Price, "Production e Characterization of Synthetic Peptide- Derived Antibodies," in Moniclonal Antibodies: Production, Engineerting e Clinicai Application, Ritter e outros (eds.), págs. 60D84 (Cambridge University Press 1995)). Alternativamente, o veículo, agente terapêutico ou agente de diagnóstico pode ser conjugado através da uma porção de carboidrato na região de Fc de um anticorpo. O grupo de carboidrato pode ser usado para aumentar o carregamento do mesmo peptídeo que está ligado a um grupo tiol, ou a porção de carboidrato pode ser usado para ligar um peptídeo diferente.
Método para a conjugação de peptídeos a componentes de anticorpo através da uma porção de carboidrato de anticorpo são bem-conhecidos por aqueles versados na técnica (Ver por exemplo, Shih e ou-tros, hit. J. Câncer 41 : 832 (1988); Shih e outros, Int. J. Câncer 46: 1101 (1990); e Shih e outros, a patente U.S. n9 5.057.313, todos os quais são incorporados em sua totalidade por referência). Química similar pode ser usa- da para conjugar um ou mais anticorpos hl_243, ou seus componentes, a um ou mais veículos, agentes terapêuticos ou agentes de diagnóstico. Em uma concretização, um método geral envolve a reação de um componente de anticorpo tendo uma porção de carboidrato oxidado com um polímero de veículo que tem pelo menos uma função de amina livre e que é carregado com uma pluralidade de peptídeos. Esta reação resulta em uma ligação de base de Schiff inicial (imina), que pode ser estabilizada por redução a uma amina secundária para formar o conjugado de sinal.
Em uma concretização, a região de Fc pode estar ausente, por exemplo, se a molécula de ligação de hl_423 é um fragmento de anticorpo. Alternativamente, uma porção de carboidrato pode ser introduzido para dentro da região variável de cadeia leve do anticorpo de comprimento total ou fragmento de anticorpo. (Ver por exemplo, Leung e outros, J. Immunol. 154: 5919 (1995); Hansen e outros, a patente U.S. n- 5.443.953 (1995), Leung e outros, U.S. patent Ns 6.254.868, cuja totalidade é incorporada por referência). De acordo com estas concretizações, a porção de carboidrato enge-nheirada pode ser usada para ligar um veículo, um agente terapêutico ou de diagnóstico.
Veículos (lipídios, lipossomas, micelas, polímeros e nanopartículas)
Quaisquer métodos para a formação de lipossomas e micelas podem ser usados e são conhecidos na técnica (Ver por exemplo, Wrobel e outros, Biochimica et Biophysica Acta, 1235:296 (1995); Lundberg e outros, J. Pharm. Pharmacol., 51 :1099-1105 (1999); Lundberg e outros, Int. J. Pharm., 205:101 - 108 (2000); Lundberg, J. Pharm. Sei., 83:72-75 (1994); Xu e outros, Molec. Câncer Then, 1 :337-346 (2002); Torchilin e outros, Proc. Natl Acad. Sei. USA, 100:6039-6044 (2003); U.S. 5.565.215; U.S. 6.379.698; e a patente U.S. nQ 2003/0082154). Nanopartículas ou nanocápsulas formadas a partir de polímero, sílica ou metais, que são contempladas aqui para fornecimento de fármaco ou imagem, foram descritos. (Ver por exemplo, West e outros, Applications of Nanotechnology to Biotechnology, 11 :215-217 (2000); a patente U.S. nQ 5.620.708; a patente U.S. ne 5.702.727; e a patente U.S. nQ 6.530.944).

Imunolipossomas
Alguns métodos para conjugar anticorpos ou moléculas de ligação a lipossomas para formar um veículo direcionado para agentes terapêuticos ou diagnósticos foi descrito (Ver por exemplo, Bendas, Biodrugs, 15:215-224 (2001 ); Xu e outros, Molec. Câncer Ther., 1 :337-346 (2002); Torchilin e outros, Proc.Natl Acad. Sei., 100:6039-6044 (2003); Bally, e outros, J. Liposome Res., 8:299-335 (1998); Lundberg, Int. J. Pharm., 109:73-81 (1994); Lundberg, J. Pharm. Pharmacol., 49:16- 21 (1997);Lundberg, An-ti-cancer Drug Design, 13:453-461 (1998)). Ver também U.S. 6,306,393; a patente U.S. ne de série 10/350.096; a patente U.S. ns de série 09/590.284, e a patente U.S. nQ de série 60/138.284, depositado em 9 de junho de 1999. Todas essas referências são incorporadas aqui por referência.
Excipientes farmaceuticamente aceitáveis
Em uma concretização, os imunoconjugados ou composições podem incluir um ou mais excipientes farmaceuticamente adequados, um ou mais ingredientes adicionais, ou suas combinações.
Em uma outra concretização, o imunoconjugado ou composições descritos aqui podem ser formulados de acordo com métodos conhecidos para preparar composições farmaceuticamente úteis, pelo que o imuno-conjugado ou composições são combinados em uma mistura com um exci-piente farmaceuticamente adequado. Solução salina tamponada por fosfato estéril é um exemplo de um excipiente farmaceuticamente adequado. Outros excipientes adequados são bem-conhecidos por aqueles na técnica (Ver por exemplo, Ansel e outros, Pharmaceutical Dosage Forms e Drug Delivery Systems, 5th (Lea & Febiger 1990), e Gennaro (ed), Remington's Pharmaceutical Sciences, 18th Edition (Mack Publishing Company 1990), e suas edições revisadas.
Em uma outra concretização, o imunoconjugado ou composições descritos aqui podem ser formulados para administração intravenosa através de, por exemplo, injeção bolus ou infusão contínua.
Formulações para a injeção podem ser apresentadas, por e-xemplo, em forma de dosagem unitária, por exemplo, em ampolas ou recipi- entes de múltiplas doses, com um conservante adicionado. As composições podem tomar tais formas como suspensões, soluções ou emulsões em veículos aquosos ou oleosos, e podem conter agentes formuladores tais como agentes de suspensão, estabilização e/ou dispersão. Alternativamente, o ingrediente ativo pode estar em forma de pó para constituição com um veículo adequado, por exemplo, água livre de pirogênio, antes do uso. Métodos farmacêuticos adicionais podem ser empregados para controlar a duração de ação do conjugado de diagnóstico, terapêutico ou anticorpo nu. Por e-xemplo, preparações de liberação de controle podem ser preparadas através do uso de polímeros para complexar ou adsorver o imunoconjugado ou anticorpo nu. Em um exemplo, polímeros biocompatíveis incluem matrizes de poli(acetato de etileno-co-vinila) e matrizes de um copolímero de polianidro de um diméro de ácido esteárico ou ácido sebácido. Sherwood e outros, Bio/Technology 10: 1446 (1992). Algumas das taxas de ligação de um imuno-conjugado ou anticorpo a partir de tal matriz depende do peso molecular do imunoconjugado ou do anticorpo, da quantidade de imunoconjugado, do anticorpo dentro da matriz, e do tamanho das partículas dispersas. Saltzman e outros, Biophys. J. 55: 163 (1989); Sherwood e outros, supra. Other solid dosage forms are described in Ansel e outros, Pharmaceutical Dosage Forms e Drug Delivery Systems, 5th Edition (Lea & Febiger 1990), e Gennaro (ed.), Remington's Pharmaceutical Sciences, 18th Edition (Mack Publi-shing Company 1990), e suas edições revisadas.
Em uma concretização, o imunoconjugado ou as composições podem também ser administrados a um mamífero subcutaneamente ou ain-da por outras rotas parenterais. Além do mais, a administração pode ser por infusão contínua ou por boluses simples ou múltiplos, a dosagem de um i-munoconjugado, proteína de fusão ou anticorpo nu administrado para seres humanos variará dependendo de tais fatores como a idade do paciente, o peso, a altura, o sexo, a condição médica geral e a história médica anterior etc. Em uma concretização particular, ao receptor pode ser administrado uma dosagem de composição ou imunoconjugado incluindo o imunoconjugado que está na faixa de desde cerca de 1 mg/kg a mg/kg como uma infu- são intravenosa única, embora uma dosagem mais baixa ou mais alta também possa ser administrada quando circunstâncias impõem. Esta dosagem pode se repetida quando necessária, por exemplo, uma vez por semana por 4-10 semanas, de preferência uma vez por mês por 8 semanas, e mais de preferência, uma vez por mês por quatro semanas. Pode também ser dada menos frequentemente, tal como em semanas alternadas por vários meses. A dosagem pode ser dada através de várias rotas parenterais, com auxiliar apropriado da dose e escala.
Em uma concretização, para as finalidades de terapia, o imuno-conjugado ou composição incluindo o imunoconjugado, é administrado a um mamífero em uma quantidade terapeuticamente eficaz. Um indivíduo adequado para os métodos de diagnóstico e terapêuticos descritos aqui pode ser um ser humano, embora um indivíduo animal não humano seja também contemplado.
Em um exemplo uma preparação de anticorpo é dito ser administrado em uma "quantidade terapeuticamente eficaz" se a quantidade administrada é fisiologicamente significativa. Um agente é fisiologicamente significativo se sua presença resulte em uma mudança detectável na fisiologia de um mamífero receptor. Em particular, uma preparação de anticorpo é fisi-ologicamente significativa se sua presença invoca uma resposta antitumor ou atenua os sinais e sintomas de um estado de doença auto-imune. Um efeito fisiologicamente significativo poderia também ser a evocação de uma resposta imune humoral e/ou celular no mamífero receptor.
Métodos de tratamento usando-se composições incluindo anticorpos L243 humanizados, quiméricos e humanos
Em uma concretização, doenças imunológicas que podem ser tratadas com os anticorpos da presente invenção podem incluir, por exemplo, doenças da articulação tais como espondilite anquisolante, artrite reumatóide juvenil, artrite reumatóide; doenças neurológicas tais como esclero-se múltipla e miastenia grave; doença pancreática tais como diabetes, especialmente diabetes de início juvenil; doença de trato gastrointestinal tais como hepatite ativa crónica, doença celíaca, colite ulcerativa, doença de Crohn, anemia perniciosa; doenças de pele tal como psoríase ou esclero-derma; doenças alérigas tais como asma e em condições relacionadas com transplante tais como exerto versus doença hospedeira e rejeição de aloen-xerto.
Em uma concretização preferida da presente invenção, composições e métodos que são providos podem incluir os anticorpos descritos aqui, ou seus imunoconjugados, para o tratamento de um distúrbio ou doença auto-imune. Imunoterapia de distúrbios auto-imunes usando-se anticorpos que direcionam células B é descrita na publicação do pedido PCT nQ 00/74718, que reivindica prioridade ao pedido de patente de patente US NQ de série 60/138.284, cujo cada conteúdo é incorporado aqui em sua totalidade. Doenças auto-imunes incluem mas não são limitadas a púrpura trom-bocitopênica idiopática aguda, púrpura trombocitopênica idiopática crónica, dermatomiosite, SydenhanYs chorea, miastenia grave, lúpus eritematoso sistémico, nefrite de lúpus, febre reumática, síndromes poliglandulares, pen-figóide bolhoso, diabetes mellitus, púrpura Henoch-Schonlein, nefrite pós-streptococcal, eritema nodoso, arterite de Takayasu's, doença de Addison, artrite reumatóide, esclerose múltipla, sarcoidose, colite ulcerativa, eritema multiforme, nefropatia de IgA, poliarterite nodosa, espondilite anquilosante, síndrome de Goodpasture, tromboangite obliterante, síndrome de Sjogren, cirrose biliar primária, tiroidite de Hashimoto, tirotoxicose, escleroderma, hepatite ativa crónica, polimiosite/dermatomiosite, policondrite, pamphigus vul-garis, granulomatose de Wegener, nefropatia membranosa, esclerose lateral amiotrófica, tabes dorsal, arterite de célula gigante/polimialgia, anemia perni-ciosa, glomerulonefrite rapidamente progressiva, psoríase, e alveolite fibro-sante.
Em uma outra concretização da presente invenção composições e métodos são providos para tratar um distúrbio selecionado do grupo que consiste em um carcinoma, um sarcoma, um glioma, um linfoma, uma leu-cernia, ou um câncer de pele. O carcinoma pode ser selecionado do grupo que consiste em um câncer de pele, esofâgeno, gástrico, colônico, retal, pancreático, pulmão, mama, ovariano, vesícula urinária, endometrial, cervi- cal, testicular, renal, adrenal ou um fígado. Doença relacionada com a célula B pode ser uma forma indolente de linfoma de célula B, uma forma agressiva de linfoma de célula B, linfoma de não Hodgkin, uma leucemia linfocítica crónica, uma leucemia linfocítica aguda, uma macroglobulinemia de Wal- denstrom, ou um mieloma múltiplo. Além disso, a doença relacionada com a célula B pode ser um uma doença de tipo veterinário ou humano. Por outro lado, uma doença relacionada com célula T pode incluir linfoma ou leucemia de célula de humano ou outros mamíferos, psoríase de pele, artrite psoriáti- ca ou micose fungóides. Em um exemplo, a doença metabólica pode ser uma miloidose. Em um exemplo, a doença degenerativa pode ser doença de Alzheimer.
Também, contemplado aqui em uma concretização da invenção é o uso de anticorpos, incluindo imunoconjugados, como uma composição para o tratamento de qualquer um dos seguintes distúrbios ou doenças, on-' de a doença ou o distúrbio é selecionado do grupo que consiste em uma doença de desregulação imune, uma doença auto-imune, rejeição de exerto de órgão, doença de enxerto versus hospedeiro, doença metabólica (por exemplo, amiloidose), e doença neurodegenerativa (por exemplo, doença de Alzheimer). O distúrbio ou a doença maligna é selecionada do grupo que consiste em um tumor sólido, um tumor hematopoiético (linfoma, leucemia, mieloma e similares). O tumor sólido é selecionado do grupo que consiste em um melanoma, carcinoma e sarcoma e o carcinoma é selecionado do grupo que consiste em um carcinoma renal, carcinoma de mama, carcinoma de pulmão, carcinoma gastrointestinal, e carcinoma urogenital. A malignida- de de célula B é selecionada do grupo que consiste em formas indolentes de linfomas de célula B, formas agressivas de linfomas de célula B, leucemias linfáticas crónica, leucemias linfáticas aguda, macroglobulinemia de Wal- denstrom, e mieloma múltiplo. Há também distúrbios relacionadas e distúrbios de célula B não malignos, tais como muitos distúrbios desreguladores imunes e auto-imunes, incluindo septicemia e choque sético entre as doenças desreguladoras imunes (uma lista de doenças desreguladoras imunes pode ser encontrada mais compreensivamente no pedido de patente provi- sório U.S. No.60/634.076 depositado em 8 de dezembro de 2004, por Gol- denberg e Hansen, e incorporado aqui em sua totalidade). Em particular, as composições descritas aqui são particularmente úteis para o tratamento de várias doenças auto-imunes, bem como formas indolentes de linfomas de célula B, formas agressivas de linfomas de célula, leucemias linfáticas crónica, leucemias linfáticas aguda, mieloma múltiplo, e macroglobulinemia de Waldenstrom, bem como outras malignidades hematopoiéticas, tais como leucemias mielóide aguda e crónica e leucemias de célula T e linfomas. Por exemplo, os componente de anticorpo hl_243 e imunoconjugados podem ser usados de preferência para tratar tanto formas indolentes quanto agressivas de linfoma de não Hodgkin e leucemias linfóides.
Em uma outra concretização, os anticorpo L243 humanizados, quiméricos e humanos da presente invenção podem ser usados para tratar os distúrbios e doenças acima mencionadas, quanto apropriados, em todos os mamífero, incluindo ser humano, e mamíferos domésticos, incluindo mas não limitados a, cachorros, gatos, cavalos e gado.
Em uma concretização particular, o método para o tratamento de uma malignidade de célula B pode incluir administração a um indivíduo com uma malignidade relacionada com célula B, de uma composição terapêutica incluindo um veículo farmaceuticamente aceitável, um agente terapêutico e um imunoconjugado incluindo um anticorpo L243 ou seu componente (por exemplo, um anticorpo L243 humanizado, quimérico ou humano ou seu fragmento ou uma sua proteína de fusão de nat), em que a malignidade de célula B é um linfoma ou uma leucemia. Mais especificamente, a malignida-de de célula B são formas indolentes de linfomas de célula B, formas agressivas de linfomas de célula B, mieloma múltiplo, leucemias linfáticas crónicas, ou leucemias linfáticas aguda. Em uma concretização particular, um imunoconjugado ou composição incluindo o imunoconjugado pode ser administrado intravenosa ou intramuscularmente a uma dose de cerca de 20-2000 mg que ulteriormente inclui a administração do conjugado ou da composição antes, simultaneamente, ou depois da administração de pelo menos um agente terapêutico adicional ou um agente de diagnóstico usado para detectar ou tratar malignidade de célula. Por exemplo, um agente adicional pode incluir um imunoconjugado adicional como descrito aqui, incluindo um agente terapêutico ou de diagnóstico. De acordo com estas concretizações, um agente terapêutico pode incluir um anticorpo nu, um imunomodulador, um hormônio, um agente citotóxico, uma enzima, e/ou um anticorpo conjugado a pelo menos um imunomodulador, rótulo radioativo, hormônio, enzima, oligonucleotídeo, RNA de interferência, ou agente citotóxico ou uma sua combinação. Em um exemplo particular, um imunomodulador pode ser uma citocina e o agente citotóxico pode ser um fármaco ou toxina. Em uma con-cretização particular, um anticorpo que pode ser administrado em combinação com um anticorpo nu ou com um imunoconjugado suplementar de preferência reage com CD4, CDS, CDS, CD14, CD15, CD19, CD21 , CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54.CD74, CD80, CD126, CD138, CD154, B7, MUC1 , MUC2, MUC3, MUC4, MUC16, NCA66, antígeno de necrose, PAM-4, KS-1 , 90 Le(gama), MAGE, 1a, IL- 2, IL-6, tenascina, HM1.24, VEGF, EGFR, EGP-1 , EGP-2, receptor de folato, gonodotropina coriônica, CEA, antígeno p específico de cólon (CSAp), fator de crescimento de tipo insulina (ILGF), fator de crescimento placental (PIGF), ácido fosfatase prostático, PSA, PSMA, T101 , TAG, TAG- 72, Her2/neu, anidrase carbónica IX, IL-6, SIOO, alfa fetoproteína, A3, CA125, antígeno carcinoembriônico (CEA), antígenos de reação cruzada não específicos tais como CD66 (a, b, c, d), MART-1 , TRP-1 , TRP-2, amilóide, ou gp100.
É contemplado aqui que um tratamento de uma malignidade po-de incluir a administração a um indivíduo com uma malignidade outra que não linf orna ou leucemia, de uma composição terapêutica que pode incluir: (1 ) um anticorpo hL243, ou seu imunoconjugado, e um veículo; (2) um efe-tor; e (3) um excipiente farmaceuticamente aceitável. A composição pode ser administrada intravenosa ou intramuscularmente a uma dose de 20-2000 mg. Além disso, a composição pode ser administrada antes, simultaneamente ou depois da administração de pelo menos um agente terapêutico ou de diagnóstico adicional. Os agentes terapêuticos, como descritos acima e atra- vés de todo o relatório, podem incluir um imunomodulador, um hormônio, um agente citotóxico ou uma molécula de ligação (ou nua ou conjugada a pelo menos um imunomodulado, rótulo radioativo, hormônio, enzima agente citotóxico, oligonucleotídeo anti-sentido, RNA de interferência, ou uma sua com-binações, onde o imunomoculador de preferência é uma citocina e o agente citotóxico de preferência é um fármaco ou uma toxina). Um agente terapêutico ou agente de dianóstico pode incluir as composições ou os imunoconju-gados como descritos aqui. Em uma concretização particular, um anticorpo pode ser administrado em combinação com a composição terapêutica e/ou de diagnóstico para tratar uma malignidade que não é uma malignidade de célula B, mas é provavelmente reativa com um marcador outro que não a-quele reconhecido pelo anticorpo hl_243, que é expresso pelas células que compreendem a malignidade que é tratada, e o anticorpo seria formulado em um veículo farmaceuticamente aceitável. Exemplos de anticorpos que po-dem ser administrados para antígenos associados a melanoma maligno são aqueles anticorpos reativos com MART-1 , TRP-1 , TRP-2 e gp100. Além disso, anticorpos preferidos para antígenos associados a mieloma múltiplo incluem aqueles reativos com MUC1 , CD74, e CD38. As composições para o tratamento pode conter o anticorpo WL243, ou seus imunoconjugados, sozi-nhos ou em combinação com outros anticorpos, tais como anticorpos humanizados, quiméricos ou humanos.
Em um exemplo, composições podem incluir um imunomodulador como um efetor. Como usado aqui, o termo "imunomodulador" inclui ci-toicnas, fatores de cresimento de célula tronco, linfotoxinas, tal como fator de necrose de tumro (TNF) e fatores hematopoiéticos, tais como inteleucinas (por exemplo, interleucina-1 (IL-1 ), IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, e IL-21 ), fatores de estimulação de colónia (por exemplo, fator de estimulação de colónia de granulócito (G-CSF) e fator de estimulação de macrófago de gra-nulócito (GMDCSF)), interferons (por exemplo, interferons-alfa, beta e ga-ma), fator de crescimento de célula tronco designado "fator SI", eritropoieti-na, trombopoietina ou uma sua combinação. Exemplos de porções imuno-moduladoras adequadas incluem IL-1 , IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL- 21 , e uma sua combinação e inteferon-alfa, beta, e gama TNF-alfa e beta, e similares. Em uma concretização, o imunomodulador pode estar presente na composição, ou alternativamente, o imunomodulador pode ser administrado antes, simultaneamente ou depois da administração das composições tera- pêuticas e/ou de diagnóstico. Em uma concretização particular, o anticorpo hl_243 pode também ser conjugado ao imunomodulador. O imunomodulador pode também ser conjugado a um anticorpo híbrido que consiste em um ou mais anticorpos que se ligam a antígenos diferentes.
Em um exemplo, terapias multimodais contempladas aqui po-dem incluir imunoterapia com imunoconjugados tal como anticorpo hl_243 suplementado com a administração de moléculas de ligação adicionais (por exemplo, anti-CD22, anti-CD19, anti-CD21 , anti- CD20, anti-CD80, anti-CD23, anti-CD46 ou HLA-DR, de preferência os anticorpo de dímero HLA-DR na forma de anticorpos nus, proteínas de fusão ou como imunoconjuga-dos). Além disso, uma micela, lipossoma ou nanopartícula, como descrito aqui pode incluir moléculas de ligação além dos anticorpo hl_243. Por exemplo, anticorpos podem ser anticorpos policlonais, monoclonais, quiméricos humanizados ou humanos que reconhecem pelo menos um epitopo nos determinantes antigene observados acima. Além disso, anticorpos anti-C19 e anti-CD22 são conhecidos na técnica (Ver por exemplo.Ghetie e outros, Câncer Res. 48:2610 (1988); Hekman e outros, Câncer Immunol. Immuno-ther. 32 :364 (1991 ); Longo, Curr. Opin. Oncol. 8:353 (1996) e as patentes U.S N— 5.798.554 e 6.187.287, incorporados em sua totalidade por referência).
Em uma concretização particular, uma outra forma de terapia multimodal pode ser onde indivíduos recebem imunoconjugados de hl_243 em combinação com quimioterapia de câncer padrão. Por exemplo, "CVB" (1 ,5 g/m2 de ciclofosfamida, de 200-400 mg/m2 de etoposídeo, e de 150-200 mg/m2 carmustina) é um regime usado para tratar um linfoma de não Hodg-kin. Patti e outros, Eur. J. Haematol. 51 :18 (1993). Outros regimes quimiote-rapêuticos de combinação adequados são bem-conhecidos por aqueles versados na técnica (Ver por exemplo, Freedman e outros, "Non-Hodgkin's Lymphomas," in Câncer Medicine, Volume 2, 3rd Edition, Holland e outros (eds.), págs. 2028-2068 (Lea & Febiger 1993)). Como uma ilustração, a primeira geração de regimes quimioterapeuticos para o tratamento de linfoma de não Hodgkin de grau intermediário (NHL) incluem C-MOPP (ciclofosfami-da, vincristina, procarbazina e prednisona) e CHOP (ciclofosfamida, doxor-rubicina, vincristina, e prednisona), Em uma concretização particular da presente invenção, a segunda geração de regime quimioterapêutico pode ser m-BACOD (metotrexato, bleomicina, doxorrubicina, ciclofosfamida, vincristina, dexametasona e leucovorina), enquanto uma terceiro regime é MACOP-B (metotrexato, doxorrubicina, ciclofosfamida, vincristina, prednisona, bleomicina e leucovorina). Terapêutica adicional pode incluir butirato de fenila e e briostatina-1. Em uma concretização preferida terapia multimodal, tanto fármacos quimioterapêuticos quanto citocinas podem ser administrados com um anticorpo, um imunoconjugado ou uma proteína de fusão. As citocinas, fármacos quimioterapêuticos ou anticorpo ou imunoconjugado podem ser administrados em qualquer ordem, ou simultaneamente.
Em uma concretização particular, NHL pode ser tratado com 4 infusões semanais do imunoconjugado hL243 (por exemplo, uma composição terapêutica) a uma dose de 25-700 mg/m2 semanalmente por 4 sema-nas consecutivas ou em semanas alternadas (iv durante 2-8 horas), repetida quando necessário durante os próximos meses/anos, mais de preferência a uma dose de 100-400 mg/m2 semanalmente por 4 semanas consecutivas ou em semanas alternadas (iv. durante 2-8 horas), repetida quando necessário durante os próximos meses/anos. Além disso, NHL pode ser tratado com 4 infuões quinzenalmente como acima, mas combinado com epratuzumab (anticorpo humanizado anti-CD22) no mesmo dia, a uma dose de 360 mg/m2, dada como uma infusão iv durante 1 h, ou antes, durante ou depois da infusão de imunoconjugado de anticorpo hL243. Alternativamente, HL pode ser tratado com 4 infusões semanalmente do imunoconjugado de anticorpo hL243 como acima, combinado com uma ou mais injeções de CD22 mAb radiomarcado com um isótopo terapêutico tais como ítrio-90 (a dose de 90-Y entre 5 e 35 mCi/metro quadrado como uma ou mais injeções durante um período de semanas ou meses. Em um exemplo, quando usado em pacientes com respostas mais baixas a anticorpos CD20, WL243 pode ser combinado com tais anticorpos CD20 como rituximab ou hA20. De acordo com este exemplo, a última combinação pode ser dada sequencialmente ou con-temporaneamente, ou durante a mesma semana ou mês, e a doses variáveis, tais como 375 mg/m2 uma vez por mês por infusõa iv para rituximab ou hA20 e 250 mg/m2 para hL243 também dada uma vez por semana por infusão iv. Em todos os casos acima mencionados, as doses podem ser fracio-nadas, administradas como infusões contínuas ou por rotas parenterais co-nhecidas na técnica. Elas podem também ser administradas por outras rotas, tal como subcutânea.
Além disso, em uma concretização uma composição terapêutica como descrita aqui pode conter uma mistura de moléculas híbridas de imunoconjugados de hl_243 dirigidas para epitopos de não bloqueamento, dife-rentes reconhecidos pelo anticorpo hl_243. De acordo com esta concretização, composições terapêuticas podem incluir uma mistura de imunoconjugados de hL243 que ligam pelo menos dois epitopos reconhecidos pelo anticorpo hl_243. Também, os imunoconjugados descritos aqui podem conter uma mistura de anticorpos hl_243 com sequências de CDR variáveis.
Em uma concretização da presente invenção, os anticorpos hl_243, ou seus imunoconjugados, podem ser usados para o tratamento de leucemia ou linfoma de célula B e outras doenças ou distúrbios de célula B bem como outras malignidades em que células malignas associadas ou afe-tadas são reativas com epitopos reconhecidos pelo anticorpo hl_243. Por exemplo, anticorpos hl_243, ou seus imunoconjugados podem ser usados para tratar doenças de derregulação imune e doenças auto-imunes relacionadas, incluindo mas limitadas a doenças auto-imunes de classe III tais como trombocitopenias imunemediadas, tais como púrpura trombocitopênica idiopática aguda, púrpura trombocitopênica idiopática crónica, dermatomiosi-te, síndrome de Sjogren, esclerose múltipla, Sydenham's chorea, miastenia grave, lúpus eritematoso sistémico, nefrite de lúpus, febre reumática, síndromes poliglandulares, penfigóide bolhoso, diabetes mellitus, púrpura He- noch-Schonlein, nefrite pós-streptococcal, eritema nodoso, arterite de Taka-yasu's, doença de Addison, artrite reumatóide, sarcoidose, colite ulcerativa, eritema multiforme, nefropatia de IgA, poliarterite nodosa, espondilite anqui-losante, síndrome de Goodpasture, tromboangite obliterante, cirrose biliar primária, tiroidite de Hashimoto, tirotoxicose, escleroderma, hepatite ativa crónica, polimiosite/dermatomiosite, policondrite, pamphigus vulgaris, granu-lomatose de Wegener, nefropatia membranosa, esclerose lateral amiotrófica, tabes dorsal, arterite de célula gigante/polimialgia, anemia perniciosa, glome-rulonefrite rapidamente progressiva, e alveolite fibrosante.
Em uma concretização mais particular, anticorpos hl_243, ou i-munoconjugados ou seus fragmentos ou suas proteínas de fusão anticorpo, podem ser administrados a um indivíduo com uma ou mais destas doenças auto-imunes. Os anticorpo hl_243 descritos aqui são particularmente úteis no método de tratamento de distúrbios auto-imunes, descritas no pedido de pa-tente pedente U.S. no de série 09/590.284 depositada em 9 de junho de 2000 entitulado "Immunotherapy of Autoimmune Disorders using Antibodies that Target B-Cells," que é incorporada em sua totalidade por referência. Em uma concretização particular, os anticorpos hl_243 podem ser administrados intravenosa ou intramuscularmente a uma dose de 20-2000 mg. Além disso, os anticorpos hl_243 podem ser administrados antes, durante ou depois da administração de pelo menos um agente terapêutico ou de diagnóstico. Em uma conretização mais particular, o agente terapêutico como descrito aqui, pode incluir um anticorpo, um imunomodulador, um hormônio, uma enzima, um agente citotóxico, um anticorpo conjugado a pelo menos um imunomodu-lador, rótulo radioativo, hormônio, enzima ou agente citotóxico, oligonucleo-tídeo de anti-sentido, um RNA de interferência, ou uma sua combinação, onde o imunomodulador é uma citocina e o dito agente citotóxico é um fármaco ou uma toxina. Por exemplo, o agente terapêutico pode incluir um i-munoconjugado como descrito aqui. Em uma concretização particular, anti-corpos que podem ser administrados em combinação com um anticorpo nu ou como um imunoconjugado suplementar incluem anticorpo que reagem com, isto é, mAbs a antígenos específicos, tais como CD4, CDS, CDS, CD14, CD15, CD19, CD21 , CD22, CD23, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD74, CD80, CD126, CCD138, CD154, B7, MUC1 , MUC2, MUC3, MUC4, MUC16, NCA66, antígenos de necrose, PAM-4, KS-1 , Le(y), MAGE, 1 a, IL-2, IL-6, tenascina, HM1.24, VEGF, EGFR, EGP-1 , EGP-2, receptor de folato, gonadotropina coriônica humana, antíge-no-p específico de cólon (CSAp), fator de crescimento de tipo insulina (ILGF), fator de crescimento placental(PIGF), fosfatase de ácido prostático, PSA, PSMA, TIOI, TAG, TAG-72, Her2/neu, anidrase carbónica IX, IL-6, S100, alfa- fetoproteína, A3, CA125, antígeno carcinoembriônico (CEA), antígenos de reação cruzada não específicos tais como CD66 (a, b, c, d), MART-1 , TRP-1 TRP-2, gp100, amilóide, formulados em um veículo farmaceuticamente aceitável.
Como usado aqui uma "composição farmacêutica" refere-se a uma composição incluindo um fármaco em que o veículo é um veículo far-maceuticamente aceitável, enquanto uma "composição veterinária" é uma em que o veículo é um veículo veterinariamente aceitável. O termo "veículo farmaceuticamente aceitável" ou "veículo veterinariamente aceitável" pode incluir qualquer meio ou material que não é biologicamente ou de outra maneira indesejável, isto é, o veículo pode ser administrado a um organismo juntamente com uma composição ou um composto da presente invenção sem causar efeitos biológicos indesejáveis ou interagir de um modo nocivo com o complexo ou qualquer um de seus componentes ou o organismo. E-xemplos de reagentes farmaceuticamente aceitáveis são providos na The United States Pharmacopeia, The National Formulary, United States Pharr-nacopeial Convention, Inc., Rockville, MD 1990, aqui incorporado por referência em sua totalidade no presente pedido, como é Pharmaceutical Dosa-ge Forms & Drug Delivery Systems, 7th Edition, Ansel e outros, editors, Lip-pincott Williams & Wilkins, 1999.
Um fármaco (isto é complexo ou construto direcionável) pode ser incluído na composição farmacêutica em uma quantidade suficiente para produzir o efeito desejado no paciente. As composições farmacêuticas da presente invenção podem ulteriormente compreender outros componentes químicos, tais como diluentes e excipientes. Um "diluente" é um composto químico diluído em um solvente, de preferência um solvente aquoso, que facilita dissolução do fármaco no solvente e pode também servir para estabilizar a forma biologicamente ativa do fármaco ou um ou mais de seus com-ponentes. Sais dissolvidos em soluções tamponadas são utilizados como diluentes na técnica. Por exemplo, diluentes preferidos são soluções tamponadas contendo um ou mais sais diferentes. Uma solução tamponada preferida é solução tamponada por fosfato (particularmente em combinação com composições destinadas a administração farmacêutica), como ela imita as condições de sal do sangue humano. Uma vez que sais de tampão podem controlar o pH de uma solução a concentrações baixas, um diluente tampo-nado raramente modifica a atividade biológica de um peptídeo biologicamente ativo.
Em uma concretização da presente invenção, as composições farmacêuticas facilitam a administração de anticorpos humanizados a um organismo, de preferência um animal, de preferência um mamífero. Mamíferos particulares incluem animais bovino, canino, equino, felino, ovino e suíno, e primatas não humanos. Humanos são particularmente preferidos. Técnicas múltiplas de administração ou fornecimento de um composto existem na técnica incluem mas não são limitadas a, administração oral, retal (por exemplo, enema ou supositório), aerossol (por exemplo, fornecimento nasal ou pulmonar), parenteral (por exemplo, i.v., Lm., s.c), e tópica. De preferência, quantidades suficientes da composição ou do composto podem ser fornecidas para alcançar o efeito pretendido. A quantidade particular da com-posição ou do composto a ser fornecido dependerá de muitos fatores, incluindo do efeito a ser alcançado, do tipo de organismo ao qual a composição é fornecida, da rota de fornecimento, do regime de dosagem, e da idade, da saúde e do sexo do organismo. Como tal, a dosagem particular de uma composição ou composto da concretização descrita aqui é uma dada formu-lação é deixada para o discernimento do técnica normalmente versado (por exemplo, o discernimento do provedor de saúde).
Aqueles versados na técnica apreciarão que quando as compo- sições farmacêuticas da presente invenção são administradas como agentes para alcançar um resultado biológico desejado particular, que pode incluir um efeito(s) terapêutico(s) ou protetor(es) (incluindo vacinação), pode ser necessário combinar a composição ou os compostos descritos aqui com um veículo farmacêutico aceitável. A escolha de veículo farmacêutico e a preparação da composição ou do composto como um agente terapêutico ou prote-tor dependerá do uso pretentendio e do modo de administração. Formulações e métodos adequados de administração de agentes terapêuticos incluem, mas não são limitados a, aqueles para fornecimento oral, pulmonar, na-sal, bucal, ocular, dérmico, retal ou vaginal.
Dependendo do modo de fornecimento empregado, a entidade funcional dependente de contexto pode ser fornecida em uma variedade de formas farmaceuticamente aceitáveis. Por exemplo, entidade funcional dependente de contexto pode ser fornecida na forma de um solução, solução, emulsão, dispersão, micela, lipossoma, e similares, incorporada em uma pílula, cápsula, comprimido, supositório, aerossol, gotículas ou spray. Pílulas, comprimidos, supositórios, aerossóis, pós, gotículas e sprays podem ter estruturas de mútiplas camadas, complexas e têm uma faixa grande de tamanhos. Aerosóis, pós, gotículas e spray podem variar de pequeno (cerca de 1 mícron a grande (cerca de 200 micra) de tamanho.
Composições farmacêuticas descritas aqui podem ser usadas na forma de um sólido, pó liofilizado, uma solução, uma emulsão, uma dispersão, uma micela, um lipossoma e similares, em que a composição resultante contém um ou mais dos construtos ou complexos direcionáveis de concreti-zações da presente invenção, como um ingrediente ativo, em mistura com um excipiente ou veículo orgânico ou inorgânico adequado para as aplicações enterais e parenterais. O ingrediente ativo pode ser combinado, por exemplo, com os veículos farmaceuticamente aceitáveis, não tóxicos usuais para comprimidos, cápsulas, supositórios, soluções, emulsões, suspensões, e qualquer outra forma adequada para o uso. Os veículos que podem ser usados incluem glicose, lactose, manose, goma acácia, gelatina, manitol, pasta de amido, trissilicato de magnésio, talco, amido de milho, queratina, sílica coloidal, amido de batata, uréia, triglicerídeos de comprimento de cadeia médio, dextranos, e outros veículos adquados para o uso na preparação de fabricação, em forma sólida, semi-sólida ou líquida. Além disso agentes auxiliares, de estabilização, de espessamento e de coloração e perfumes podem ser usados. Exemplos de um agente de estabilização por através da seca incluem triulose, de preferência a concentrações de 0,1% ou mais (ver, por exemplo, a patente U.S. ne 5.314.695).
Embora necessidades individuais possam variar, determinação de faixas ótimas para quantidades eficazes de composições farmacêuticas está dentro da habilidade na técnica. Doses humanas podem ser extrapoladas a partir de animais de estudo Katocs e outros, capítulo 27 In: Reming-ton's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990). Em geral, a dose necessária para prover uma quantidade eficaz de uma composição farmacêutica, que pode ser ajustada por aque-le versado na técnica, variará depedendo da idade, da saúde, da condição física, do peso, e do tipo e extensão da doença ou distúrbio do receptor, frequência do tratamento, da natureza da terapia concorrente (se existente) e da natureza e escopo do(s) efeito(s) desejado(s). Ver por exemplo, Nies e outros, capítulo 3 In: Goodman & Oilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman e outros, eds., McGraw-Hill, New York, N. Y., 1996).
Administração dosada de composições terapêuticas é dependente da severidade e responsividade do estado da doença a ser tratado, com o curso do tratamento durando de vários dias a vários meses, ou até que uma cura seja efetuada ou uma diminuição do estado da doença seja alcançado. Escalas de adminsitração dosada ótimas podem ser calculadas a partir de medições de acúmulo de fármaco no corpo do paciente. O termo "paciente" destina-se a incluir animais (por exemplo, gatos, cachorros e cavalos) bem como seres humanos. Pessoas de habilidade normal podem fa-cilmente determinar dosagens ótimas, metodologias de administração dosada e taxas de repetição. Dosagens ótimas podem variar dependendo da potência relativa de agentes terapêuticos individuais, e podem em geral ser estimadas em base no ECos demonstrado ser eficaz em modelos de animais in vitro ou in vivo.
A faixa de doses (a quantidade de complexo ou construto dire-cionável adminsitrado) é ampla, uma vez que em geral a eficácia de um efei-to terapêutico para mamíferos diferentes varia amplamente com doses tipicamente sendo de 20, 30 ou ainda 40 vezes menores (por unidade de peso de corpo) no género humano do que no rato. Em geral, a dosagem é de 0,01 ^g a 100 mg por kg de peso de corpo, de preferência de 0,01 μg a 10 mg/kg de peso de corpo, de 0,01 μg a 50 m g/kg de peso de corpo, de 0,01 μg a 100 mg/kg de peso de corpo, de 0,01 μg a 10 mg/kg de peso de corpo, de 0,01 μg a 1 mg/kg de peso de corpo, de 0,01 μg a 100 μg/kg de peso de corpo, de 0,01 μg a 10 μg kg de peso de corpo, de 0,01 μg a 1 μg/kg de peso de corpo, de 0,01 μg a 10 μg/kg de peso de corpo, de 0,01 μg a 1 μg/kg de peso de corpo, de 0,01 μg a 0,1 μg/kg de peso de corpo, e varia com ba-se nos limites das faixas precedentes de concentrações. Assim, por exemplo, a descrição precedente de dosagens inclui dosagens dentro da faixa de 10 mg a 100 mg por kg de peso de corpo, de 1 ,0 mg a 100 mg/kg de peso de corpo, de 0,1 mg a 100 mg/kg de peso de corpo, etc.
Em uma concretização, doses podem ser dada uma vez ou mais diária, semanal, mensal ou anualmente, ou ainda uma vez a cada 2 a 5 ou mais anos. Pessoas de habilidade normal na técnica podem estimar taxas de repetição para administração dosada com base nos tempos de residência e concentrações medidos do complexo ou construto direcionável em fluidos ou tecidos de corpo. Após o tratamento bem-sucedido, pode ser desejável que o paciente se submeta a terapia de manutenção para prevenir a recorrência do estado da doença, em que o agente terapêutico é administrado nas doses de manutenção, variando de 0,01 ug a 100 mg por kg de peso de corpo, uma vez ou mais diariamente, a uma vez a cada 5 anos.
Em uma concretização, um dose particular pode ser calculada de acordo com a área de superfície ou peso de corpo apropriado do paciente. Outros fatores na determinação da dosagem apropriada podem incluir a doença e a condição a ser tratada ou prevenida, a severidade da doença, a rota de administração e a idade, o sexo e a condição médica do paciente. Outro refinamento dos cálculos necessários para se determinar a dosagem apropriada para o tratamento é rotineiramente feita por aqueles versados na técnica, especialmente à luz dos ensaios e informação de dosagem descri-tos aqui. A dosagem pode também ser determinada através do uso de ensaios conhecidos para a determinação de dosagens usadas em combinação com os dados de dose-resposta.
Em uma concretização, uma dosagem do paciente individual pode ser ajustada uma vez que o progresso da doença é monitorado. Níveis no sangue do complexo ou contruto direcionável em um paciente podem ser medidos para ver se a dosagem necessita ser ajustada para alcançar os resultados desejado.
Em um exemplo, farmacogenômico pode ser usado para determinar quais construtos e/o complexo direcionáveis, e suas dosagens, são mais prováveis de serem eficazes para um dado indivíduo (Schmitz e outros, Clinica ChimicaActa 308: 43-53, 2001 ; Steimer e outros, Clinica ChimicaActa 308: 33-41 , 2001 ).
A administração dos anticorpos humanizados descritos aqui podem ser parenteral, incluindo intravenosa, intra-arterial, intreperitoneal, in-tramuscular, subcutânea, intrapleural, intratecal, intracavitário, por perfusão através de um cateter ou por injeção intralesional direta. De acordo com esta administração os anticorpos podem ser administrados uma vez diariamente, uma vez ou mais vezes semanalmente, uma ou mais vezes mensalmente, e uma vez ou mais vezes anualmente.
O conteúdo dos artigos, patentes e pedidos de patente, e todos os outros documentos e informação eletronicamente disponível mencionada ou citada aqui, são incorporados por referência em sua totalidade na mesma extensão que se cada publicação individual fosse especificamente e individualmente indicada a ser incorporada por referência. Requerentes reservam o direito a incorporar fisicamente neste pedido de patente quaisquer e todos os materiais e informação de quaisquer tais artigos, patentes, pedidos de patente ou outros documento.

Concretizações ilustrativamente descritas aqui podem adequadamente ser praticadas na ausência de qualquer (quaisquer) elemento(s), limitação ou limitações, não especificadamente descrito(s) aqui. Assim, por exemplo, os termos "compreendendo", "incluindo", "contendo", etc serão li-dos expansivamente e sem limitação. Adicionalmente, os termos e expressões empregados aqui foram usados como termos de descrição e não de limitação, e não há intenção no uso de tais termos e expressões e excluindo quaisquer equivalentes das características mostradas e descritas ou suas porções, mas é reconhecido que várias modificações são possíveis dentro do escopo da presente invenção reivindicada. Assim, seria entendido que embora a presente invenção tenha sido especificamente descrita por características opcionais e concretizações preferidas, modificações e variações incorporadas aqui descritas podem ser recorridas por aqueles versados na técnica, e que tais modificações e variações estão consideradas dentro do escopo desta invenção.
Concretizações da presente invenção foram descritas amplamente e genericamente aqui. Cada uma das espécies e agrupamentos sub-genéricos mais estreitos que cãem dentro da descrição genérica podem também fazer parte da invenção. Isto inclui a descrição genérica aqui com uma condição ou limitação negativa que remove qualquer material objeto do género, independentemente se ou não o material extirpado é especificamente relatado aqui.
Além disso, onde características ou aspectos são descritos em termos de grupos Markush, aqueles versados na técnica reconhecerão que as concretizações também desse modo descritas em termos de qualquer subgrupo ou membro individual de membros do grupo Markush.
As concretizações são ulteriormente ilustradas pelos seguintes exemplos e protocolos detalhadas. No entanto, os exemplos são meramente destinados a ilustrar concretizações e não devem ser intepretados como limi-tante do escopo aqui. O conteúdo de todas as referências e patentes publicadas e pedidos de patente citados através deste pedido de patente são incorporados aqui por referência.

Exemplos
Exemplo 1. Construção de um anticorpo L243 humanizado
Clonagem molecular de genes de L243 VH e V
Em um método exemplar, o clone de célula de hibridoma que produz o mAb ml_243 foi cultivado em meio de HSFM (Life Technologies, Inc.,) foi suplementado com 10% de FBS (clone Hy). Os genes que codificam o VK (VK1 BACK/CK31) e VH (VH 1 BACK/VH1 FOR) de ml_243 foram clonados por RT-PCR a as sequências foram determinadas por sequencia-ção de DNA. Múltiplos clones independentes foram sequenciados para eli-minar possíveis erros que resultam da reação por PCR.
Projeto de sequência de genes de hl_243 V.
Em um exemplo, por pesquisar as sequências de VK e VH humanas na base de dados, os FRs de ml_243 VK e VH demonstraram exibir o grau mais alto de homologia de sequência a REI VK e RF-TS3 VH humana, respectivamente. Uma exceção é o FR4 de ml_243 VH, que mostrou a homologia de sequência mais alta com aquele de NEWM VH. Portanto, em um exemplo sequências de estrutura de REI humanas foram usadas como a armação para o exerto do CDRs de ml_243VK (figura 5), e uma combinação de sequências de armação de NEWM e RF-TS3 foram usadas oara hl_243Vn (figura 6). De fato, hl_243 VH tem as mesmas estruturas de VH humano como aquele de um outro Ab humanizado, hRS7 (Govindan e outros, Breast Câncer Res. Treat. 84,173-182, 2004). Há numerosas mudanças de aminoácidos em cada cadeia externa das regiões de CDR quando comparadas com as estruturas de anticorpo humano de partida. Vários resíduos de aminoácidos em FRs de camundongo que flanqueiam o CDRs putativos foram mantidos no hl_243 Fv remodelado com base nas diretrizes anteriormente establecida (Qu e outros, Clin. Câncer Res. (1999) 5 3095s-3100s). Estes resíduos são R37, K39, V48, F49, e G100 de ml_243Vk e F27, K38, K46, A68, e F91 de ml_243 VH (figuras 3 e 4 respectivamente). Também ver SEQ. ID. 3 e 4 respectivamente para a sequência de hl_243 VL e hL243VH respectivamente.
Construção de sequências de Lh43 V Uma estratégia modificada como descrita por Leung e outros (Mol. Immunol. (1995) 32 1413- 1427) foi usada para construir o genes de VK e VH projetados para hl_243 usando-se uma combinação de síntese de oligonucleotídeo longo e PCR como ilustrado na figura 4. Para a construção do domínio de hl_243 VH, dois oligonucleotídeos longos, hl_243VHA (175-mer) e hl_243VHB (168- mer) foram sintetizados no sintetizador de DNA automatizado (Applied Biosystem). hl_243VHA representa nt de 23 a 197 do domínio de HL243VH.
5'-GGTCTGAGTT GAAGAAGCCT GGGGCCTCAG TGAAGGTTTC CTG-CAAGGCT TCTGGATTTA CCTTCACAAA CTATGGAATG AACTGGGTGA AGCAGGCCCC TGGACAAGGGCTTAAGTGGA TGGGCTGGAT AAA-CACCTAC ACTAGAGAGC CAACATATGCTGATGACTTC AAGGG-3 (SEQ ID NO: 16) hl_243VHB representa o filamento secundário do domínio de hl_243VH complementar a nt 176 a 343. 5'-ACCCTTGGCC CCAGTAGTCA AAACCCGTAG GTACAACCGC AGTAATATCT CTTGCACAGA AATA-CACGGC AGTGTCGTCA GCCTTTAGGC TGCTGATCTG GAGATATGCC GTGCTGACAG AGGTGTCCAA GGAGAAGGCA AACCGTCCCT TGA-AGTCATC AGCATATG-3' (SEQ ID NO: 17)
As sequências 3'-terminais (resíduos 22 nt) de hl_243VHA e B são complementares entre si, como as sequências sublinhadas acima. Em um exemplo, sob condições de PCR definidos, extremidades 3' de hl_243VHA e B anelam para formar um DNA de filamento duplo curto flanqueado pelo resto dos oligonucleotídeos longos. Cada extremidade anelada serve como um iniciador para a replicação do DNA de filamento único em uma reação por PCR, resultando em um DNA de filamento duplo do nt 23 a 343 de hl_243VH. Este DNA foi ulteriormente ampliando na presença de um par de iniciador de oligonucleotídeo curto, hRS7VHBACK e hl_243VHFOR, para formar o hl_243VH de comprimento total. Por causa da identidade de sequência entre hRS7VH e hl_243VH nesta região, hRS7VHBACK, anteri-ormente projetado e usado para hRS7 Ab, foi usada aqui. hRS7VHBACK 5'-GTGGTGCTGC AGCAATCTGG GTCTGAGTTG AGAAGCC-3' (SEQ ID NO: 18) hL243 VHFOR 5'-TGAGGAGACG GTGACCAGGG ACCCTTGGCCCCAG-TAGT-3' (SEQ ID NO: 19)
Neste exemplo uma quantidade mínima de hl_243VHA e B (determinada empiricamente) foi ampliada na presença de 10 ul de 10x tampão de PCR (KCI a 500 mM 100 mM tampão de Tris.HCL, pH 8,3, MgCI2 a 15 mM), 2 umoles de hRS7VHBACK e hl_243 VHFOR, e 2,5 unidades de Taq DNA (Perkin Élmer Cetus, Norwalk, CT). Esta mistura de reação foi submetida a 3 ciclos de reação por PGR que consiste em desnaturação a 94°C por 1 minuto, anelamento a 4°C por 1 minuto, e polimerização a 72°C por for 1 ,5 minuto, e seguido por 27 ciclos de reação por PCR que consiste em desnaturação a 94°C por 1 minuto, anelamento a 55°C por 1 minuto, e polimerização a 72°C por 1 minuto. Produto ampliado por PCR de filamento duplo para hl_243 VH era purificado para gel, digerido por restrição com Pstl e BstEII e foi clonado nos sítios de PstI/BstEII complementares do vetor de estágio de cadeia pesada, VHpBS4.
Em um exemplo, para a construção do DNA de comprimento total da sequência de VK humanizada, hl_243 VKA (155-mer) e hL243VKB (155-mer) foram sintetizados como descritos acima. hl_243VKA e B foram ampliados por dois oligonucleotídeos curtos hlmmu3 1VKBACK e hlmmu3 IVKFOR como descritos acima. hlmmuS 1 VKB ACK e hlmmuSI VKFOR foram projetados e foram designados e foram usados anteriormente para um anti-AFP Ab humanizado (Qu e outros, Clin. Câncer Res. 5 3095-3100). hl_243VKA representa nt 21 a 175 do domínio de hl_243VD.
5'-TCCATCATCT CTGAGCGCAT CTGTTGGAGA TAGGGTCACT AT-CACTTGTC

GAGCAAGTGA GAATATTTAC AGTAATTTAG CATGGTATCG TCAGAA-ACCA

GGGAAAGCAC CTAAACTGCT GGTCTTTGCT GCATCAAACT TAGCA-GATGG TGTGC-3' (SEQ ID NO:20) hl_243VKB representa o filamento menor do domínio de hl_243VK complementar a nt 154 a 312.
5' -CAGCTTGGTC CCTCCACCGA ACGCCCACGG AGTAGTCCAA AA- ATGTTGACAATAATATGT TGCAATGTCT TCTGGTTGAA GAGAGCTGAT GGTGAAAGTATAATCTGTCC CAGATCCGCT GCCAGAGAAT CGCGA-AGGCA CACCATCTGCTAAGTTTGA-3' (SEQ ID N0:21)
hlmmu3 IVKBACK 5'-GACATTCAGC TGACCCAGTC TCCATCATCT CT- GAGCGC-3' (SEQ ID NO:22)
hlmmu3 IVKFOR 5'-CCGGCAGATC TGCAGCTTGG TCCCTCCACC G-3' (SEQ ID NO:23)
Produtos de PCR purificados por gel para hl_243 VK neste e-xemplo foram digeridos por restrição com Pvull e Bgl HI e foi clonado no sí-tios de Pvul/Bcll complementares do vetor de estágio de cadeia leve, VKp-BR2. O vetor de expressão final hl_243pdHL2 foi construído por sublonagem sequencial dos fragmentos de Xbal-BamHI e Xhol/Notl de hl_243Vic e VH, respectivamente, em pdHL2 como descritos acima.
Construção dos vetores de expressão para anticorpos hL243.
Em um exemplo, um vetor de expressão final hl_243pdHL2 foi construído por sublonagem sequencial dos fragmentos de Xbal-BamHI e Xhol/Notl de hl_243Vx e VH, respectivamente, em pdHL2 como descrito anteriormente (Losman e outros Câncer, 80:2660 (1997)). O vetor de expressão pdHL2, como descrito por Gilles e outros (J. Immunol. Methods 125:191 (1989), contém a sequência genômica da cadeia γΙ humana, portanto, o hl_243 é um isótipo de IgGI/K.
Em um método exemplar, para construir o vetor de expressão para hl_243 de outro isótipo, tal como lgG4/K, a sequência genômica de cadeia γΙ humana foi substituída com aquela de cadeia of γ4 humana, que foi obtida por ampliação por PCR. O modelo usado era o DNA genômico extraído a partir de células de ATCC CRL-11397 e o par inicador era P-Sacll (5'-CCGCGGTCACATGGCACCA CCTCTCTTGCAGCTTCCACCA AGGGCCC-3') (SEQ ID NO:24) e P-Eagl (5'-CCGGCCGTCG CACTCAT TTA CCCA-GAGACA GGG-31) (SEQ ID NO:25). O produto de PCR ampliado foi clonado em vetor de sequenciação de TOPO-TA (Invitrogen) e a sequência foi confirmada por sequenciação de DNA.
Um ponto de mutação, Ser241 Pro (com base na numeração de Kabat) foi introduzido na região principal da sequência γ4 para evitar formação de semimoléculas quando a lgG4 Ab é expressa em culutras de células de mamífero (Schuurman e outros, Mol. Immunol. 38: 1 (2001)). A sequência de região principal de γ4 humana entre sítios de restrição de Pstl e STuI (56 pb) foi substituída com um fragmento de DNA sintético com uso do códon de TCA como substituto de Ser241 a CCG como substituto de Pro. A sequência genômica γΙ em hl_243pdHL2 foi substituída com a sequência γ4 mutada, resultando no vetor de expressão final, designada como hl_243Y4PpdHL2, para a lgG4 isótipo hl_243.
Transfecção e expressão de anticorpos hL243
Em um método exemplar, cerca de 30 μg do vetor de expressão para hl_243 ou hl_243y4P foram linearizados por digestão com Sail e foram transfectados em células de Sp2/0-Ag14 por eletroporação (450V e 25 uF). As células tranfectadas foram laminadas em placas de 96 cavidades por 2 dias e então selecionadas para resistência a fármaco por adição de MTX no meio a uma concentração final de 0,025 pM. Colónias resistentes a MTX emergiram nas cavidades 2-3 semanas. Sobrenadantes oriundos das colôni-cas que sobrevivem a seleção foram triados quanto a secreção de Ab humano por ensaio de ELISA. Resumidamente, 100 ul de sobrenadantes foram adicionados nas cavidades de uma placa de microtítulo pré-revestida com Ab específico de fragmento de GAH-lgG, F(ab')2 e foram incubados por 1 h a temperatura ambiente. Proteínas não ligadas foram removidas por lavagem três vezes com tampão de lavagem (PBS contendo 0,05% de polissor-bato 20). GAH-lgG conjugado por HRP, Ab específico de fragmento de Fc foi adicionado às cavidades. Após a incubação de 1 h, a placa foi lavada. O Ab conjugado por HRP ligado foi descrito pela leitura de A490 nm depois da adição de uma solução de substrato contendo OPD a 4 mM e 0,04% de H2O2. Clones de célula positiva foram expandidos e hl_243 e hl_243y4P foram purificados de sobrenadante de cultura de célula por cromatografia por afinidade em uma coluna de proteína A.
A especificidade de ligação de Ag de hL243.
Em um exemplo, atividade e especifificadade de ligação de Ag de HL243 foram mostradas por um ensaio de ligação de superfície de célula. Células Raji foram incubadas em PBS/BSA (1%) contendo concentração saturada de hl_243 purificado (20 μg/ml) por 1 h a 4°C. Depois da lavagem, hl_243 ligado a superfície de célula foi detectado por incubação das célulase Raji no tampão contendo um segundo anticorpo conjugado por PE (IgG de anti-humano de cabra, frgmento de Fc específico) e contagem em um sistema de Guave PCA (Guava Technologies, Inc., Hayword, CA). Como mostrado na figura 7, hl_243 ligado a um antígeno em células de Raji reconhecido por ml_243 uma vez que a ligação é especificamente bloqueada por pré-incubação das células com ml_243, indicando a especificidade de ligação de Ag de ml_243 é preservada na versão humanizada.
A atividade de ligação de Ag de Ι_243γ4Ρ.
Em um método exemplar, um ensaio de ligação de célula de competição foi realizado para avaliar a imunorreatividade de hL243y4P em relação ao ml_243 de origem. Uma quantidade constante de L243 ou hl_243y4P de camundongo marcado com I (100,000 cpm, -10 uCi/ug) foi incubada com células de linfoma humanas (Raji, Daudi ou Ramos) na presença de concentrações variáveis (0,2-700 nM) de hl_243y4P purificada ou L243 de camundongo a 4°C por 1 -2 h. Abs não ligados foram removidos por lava-gem das células em PBS. A radioatividade associada a células foi determinada depois da lavagem. Como mostrado na figura 8, L243 e hl_243y4P mAbs de camundongo competiam entre si para a ligação ao antígeno de superfície de célula, indicando que eles reconhecem o mesmo determinante antigênico. ηΙ_243γ4Ρ mostrou uma atividade mais forte de -2 vezes aparen-tes do que ml_243 uma vez que ela competia melhor do que mL243 (ECso de ~7 vs. -16,5 nM).
A constante de afinidade de ligação de antígeno de hL243y4P foi determinada por ensaio de ligação de superfície de célula direto dos anticorpos radiomarcados e Análise de diagrama de Scatchard. Para medir ligação de antígeno de superfície de célula específica, dois conjuntos de células foram preparados e foram usados no ensaio de ligação para estimar a ligação total e específica de radioatividades, respectivamente. As células para liga- ção não específica foram pré-incubadas com quantidade em excesso de Ab não marcado para bloquear todos os sítios de antígeno de superfície antes da adição do anticorpo radiomarcado, enquanto aqueles para a ligação total foram pré-incubados em PBS. Depois da pré-incubação, quantidades variá-veis ou de 125l-hL243y4P ou 125l-mL243 foram adicionadas e foram incubadas com 2x105 células de linfoma humanas (Raji, Daudi ou Ramos) a 4°C por 2 h e anticorpos não ligados foram removidos por lavagem. A radioativi-dade associada a célula foi contada. A ligação de superfície de célula específica do anticorpo radiomarcado a uma dada concentração de anticorpo ra-diomarcado foi calculada como: as contagens de substratos de ligação totais como contagens de ligação não específica. Análise de diagrama de Scat-chard foi então realizada para determinar o número máximo de sítios de ligação de hl_243y4P e ml_243 por célula e as constantes de dissociação aparentes da ligação de equilíbrio. Como mostrado na figura 9, a ligação máxi-ma de hl_243y4P e ml_243 a células Daudi era virtualmente a mesma, -6x 05 moléculas/célula, que indicam que elas estão ligadas ao mesmo Ag. Os valores constantes de dissociação aparentes para hL243y4P e ml_243 foram calculados serem 2,6 e 14 nM, respectivamente. Resultados similares foram obtidos com células de Raji e Ramos (dados não mostrados).
Exemplo 2. Estudos funcionais de ηΙ_243γ4Ρ Studies
Em um método exemplar, estudos à base de célula in vitro foram conduzidos para determinar se hl_243y4P tinha retido seu efeito antiprolifera-tivo e se funções célula efetora e funções de ligação complementos foram abolidas. Neste estudo de exemplo descrito abaixo indicam que o efeito an-tiproliferativo tinha sido mantido, enquanto funções de célula efetora e funções de ligação de complementos tinham sido abolidas.
Ensaio de célula efetora
O objetivo de substituição de região de Fc de hl_243 com uma região de Fc de isótipo de lgG4 era para abolir funções de célula efetora a-través de receptor de Fey e ligação de complemento. Ensaios de CDC e ADCC foram realizados para avaliar essas funções por hl_243y4P.
CDC Células Daudi foram incubadas com diluições em série dos anticorpos hl_243, hL243y4P, hA20 (como um outro controle positivo) e hMN14 (controle negativo) na presença de complemento humano para 2 h. Isto foi seguido pela adição de resazurina para avaliar viabilidade de célula. Tanto controles de lise máximo quanto não tratados foram incluídos. Leituras de fluorescência foram obtidas 5 horas depois da adição de resazurina. O nível de fluorescência obtido está diretamente correlacionado com a quantidade de células viáveis. % de células viáveis foi calculada pela fórmula (Teste - lise máxima)/(controle não tratado - lise máxima) x 100. Os resultados indicam que hl_243y4P não produz qualquer efeito citotóxico mediado por complemento sobre as células em comparação com hl_243 (EC50= 2,6 nM) e hA20 (EC50= 0,66 nM). Ver a figura 10.
ADCC
Células Daudi células foram incubadas com hA20, hl_243, hl_243y4P e hMN-14 a 5 μg/ml. Célula efetoras foram adicionadas a uma razão de 50:1 Depois de 4 horas lise de célula foi avaliada por liberação de LDH (figura 11 A) e lise de célula (figura 11 B).
Nestes resultados onde os efeitos de anticorpo sozinho sobre célula efetoras são mostrados pode ser visto que o KL243 induziu lise significativa de célula efetoras enquanto hL243y4P não induziu. Quando figuras de lise específica são corrigidas para o efeito sobre células efetoras hl_243y4P mostra lise muito reduzida de células alvo em comparação com hl_243 (12% vs 48%).
Ensaios de proliferação In Vitro
Ensaios colorimétricos multiplex utilzando-se tanto biorredução de MTS (para a determinação do número de células viáveis) quanto BrdU (para a quantificação de proliferação de célula com base na medição de incorporação de BrdU durante síntese de DNA) foram realizados. Células Daudi e Raji foram incubadas com diluições em série de hl_243y4P por 2 e 3 dias. ml_243 e hMN-14 foram usados como controles positivos e negativos respectivamente. Depois da incubação, ensaios de BrdU e MTS foram realizados. Resultados dos ensaios de MTS são mostrados abaixo. Ensaios de BrdU deram resultados similares.
Em um método exemplar, ensaios colorimétricos multiplex utilizando tanto biorredução de MTS (para a determinação do número de células viáveis) quanto BrdU (para a quantificação de proliferação de célula com base na medição de incorporação de BrdU durante a síntese de DNA) foram realizados. Células Daudi e Raji foram incubadas com diluições em série de hL243y4P por 2 e 3 dias. L243 e hMN14 de camundongos foram usados como controles positivos e negativos, respectivamente. Depois da incubação, ensaios de BrdU e MTS foram realizados. Resultados dos ensaios de MTS assays são mostrados nas figuras 12 e 13. Ensaios de BRDU deram resultados similares (não mostrados). Estes resultados indicam que hl_243y4P inibe proliferação de linhas de células de Raji e Daudi. No entanto em experiências similares no linha de célula negativa de EBV Ramos, inibição de proliferação era apenas observada na presença de um anti Fc (Fab)2 de reticulação.
Exemplo 3: Comparação de eficácia in vivo de hl_243y4P e ml_243 (lgG2a) em um modelo de xenoenxerto de linfoma linfoma de não Hodgkin humano
Em um método exemplar, um estudo terapêutico foi realizado para comparar a eficácia in vivo de isótipos de anticorpo monoclonal de L243-lgG4 humanizado e L243-lgG2a de camundongo, em um modelo de xenoenxerto de linfoma de não Hodgkin humano (Raji). Antes de estudos in vitro foram mostrados que substituição da região de Fc de L243-lgG1 com um isótipo de lgG4 abrange a funções de célula efetora do anticorpo (ADCC e CDC), enquanto retendo os efeitos antiproliferativos. Estudos anteriores usando-se anticorpos de anti-HLA-DR totalmente humanos como um isótipo de lgG4 foram também mostrados para minizar efeitos colaterais devido a funções efetoras mediadas por porção de Fc enquanto provendo excelente atividade tumoricidal in vitro, e in vivo em modelos de xenoenxerto de linfoma de não Hodgkins e modelos de animais (macacos cinomólogos) com e-feitos hematológicos de longa duração. Ver Nagy e outros, Nature Medicine, 8:801 (2002). Assim, este estudo visava determinar se hl_243-lgG4 poderia manter eficácia antitumor significativa em um modelo de xenoenxerto. Na ausência de quantidade suficiente de hl_243-lgG1 , mL243 lgG2a foi usada (lgG2a de camundongo é o equivalente de lgG1 humano em fixação de complemento, e efetivando ADCC).
A camundongos de SCID foram injetados com 2,5 milhões de células de Raji. Terapia com hl_243-lgG4 ou mL243-lgG2a foi iniciada 1 dia pós administração de célula de tumor. Ambos os grupos de camundongos injetados com solução salina ou com anticorpo de controle não específico, hMN-14, tinha um tempo de sobrevivência médio (MST) de 17 dias. Todos os grupos de camundongos tratados com L243 humanizados ou de camundongo tinham significativamente perído de vida aperfeiçoado em comparação com camundongos injetados com solução salina ou hMN-14 (PO.0001). Tratamento com várias doses de hl_243 lgG4 resultou em uma relação de dose-resposta, com camundongos que recebem doses mais altas tendo tempos de sobrevivência melhor. No grupo de animais tratados com várias doses de ml_243 lgG2a, a taxa de cura era na faixa de 80-100%. Ver a figura 14.
Este estudo mostrou a retenção concorrente de eficácia antitu- mor e remoção de atividade de ligação de complemento do construto de lgG4 de L243. Embora, este estudo foi realizado em camundongos, benefícios terapêuticos significativos usando-se os construtos acima mencionados podem ser alcançados em todos os mamíferos que sofrem de doenças auto-imunes, linfomas, ou leucemias. Em particular, os construtos acima mencionados podem eficazmente ser usados em (i) animais domésticos, especialmente gatos, cachorros, e cavalos, para tratar doenças auto-imunes e linfo-mas/leucemias; e (ii) seres humanos, para o tratamento de doenças auto-imunes, linfomas, e leucemias, bem como desreguladores imunes, metabólicos e doença neurodegenerativas que envolvem expressão de HLA-DR. Exemplo 4: Comparação in vitro de hL243 com L243 e Mabs de célula célula anti-B no Tratamento de linfomas humanos e caninos
Uma amostra de 0, 5 mg de hl_243 (isótipo de lgG4) foi testada quanto a reatividade com linhas de células de linfoma e um aspirado de lin-foma de célula B de cachorro em comparação com o L243 de camundongo bem como em comparação com outros MAbs de célula anti-B. Dos estudos funcionais foram também feitos. A capacidade do hl_243 de induzir apoptose no aspirado de linfoma de cachorro foi determinada, e a atividade antiprolife- rativa do hl_243 foi testada contra Namalwa, uma linha de célula de linfoma humana relatada a ser resistente a rituximab.
A ligação de MAbs humanizados ou quiméricos sobre linfomas de célula B humanos foram medidos por por citometria de fluxo usando-se um separador de célula ativada ou fluorescência (FACS) em que a seguir MAbs - hMN-14, hLL 1 , hl_L2, hA20, Rituxan, e hl_243 foram manchados com IgG Fc de anti-humano de cabra de FITC (GAH). As linhas de células escolhidas eram células de Namalwa (uma linha de célula de linfoma de célula B humana resistente a rituximab), SU-DHL-6 (a human B-célula non- Hodgkin linfoma), WSU-FSCCL (uma linha de células de linfoma de célula B humana de baixo grau negativa a EBV), Raji, Daudi, e Ramos: Como mostrado na tabela 2, hl_243 ligado a todas as linhas de células acima mencionadas. Em particular, hL243 ligado às células de Namalwa que são respon- sividade de CD20, mostrando maior ligação do que outros MAbs humanizados. Ver a tabela 1. Além do mais, hl_243 demontrou atividade antiproliferati- va na linha de linfoma de célula B humana resistente a rituximab, Namalwa, como medido por um ensaio de captação de 3-H-timidina. O outro anticorpo CD20, A20 humanizado (hA20), desenvolvido por Immunomedics, Inc., mostrou resultados similares a rituximab, um anti-CD20 quimérico conhecido como Rituxan(R). Ver Stein e outros (2004) CHn. Câncer Res. 10: 2868-2878.
Como mostrado na figura 16A-B, o hl_243 forneceu 28% inibição de proliferação quando dado sozinho; isto foi aumentado para 51% quando hl_243 foi dado em combinação com segundo anticorpo de IgG anti-humano. Quando usado em combinação com rituximab a atividade foi aumentada para um nível maior do que aquele de qualquer MAb sozinho. Ver a figura 16-B.
Os estudos também demonstraram que hl_243 tem uma afinidade de ligação maior a células de linfoma de cachorro do que outros MAbs humanizados. Ver a tabela 3. Além disso, KL243 era capaz de induzir apop- tose nas células de linfoma de cachorro quando reticuladas com um segundo anticorpo de IgG anti-humano, medido como % de células com um conteúdo de DNA de fase su GO/G1. Ver a figura 15.
Exemplo 5: Combinações de anticorpo hl_243 e seus métodos de efeitos Anticorpos
Em um método exemplar, o clone de célula de hibridoma que produz o anticorpo monoclonal de anti-HLA-DR, L243, foi obtido a partir de ATCC (número de ATCC HB-55). Células foram cultivadas em meio de HSFM (Life Technologies, Inc. ) foram suplementadas com 10% de FBS (Hyclone). Os genes que codificam os genes de VK e VH de L243 foram clo- nados por RT-PCR. O L243 humanizado (lgG1/kapa isótipo), hL243-yl, foi gerado similarmente, como descrito anteriormente (Leung e outros, Hybri- doma 13:469 (1994); Leung e outros, Mol. Immunol. 32:1413 (1995); Stein e outros, Blood 104:3705 (2004); Govindan e outros, Breast Câncer Res. Tre- at. 84:173 (2004)).
O lgG4/kapa isótipo de hL243, hL243gama4p, pode ser construído por substituição da sequência de codificação de região constante de cadeia pesada para a cadeia de γ1 humana com aquela de cadeia de γ4. Uma mutação de ponto, Ser241 Pro (com base na numeração de Kabat) foi introduzido para dentro da região principal da sequência de γ4 a fim de evitar formação de semimoléculas quando um anticorpo é expresso e é produzido em culturas de células de mamífero (Schuurman e outros Mol Immunol. 38:1 (2001)). Outros MAbs usados nos estudos eram riruximab, adquirido da, por exemplo, IDEC Pharmaceuticals Corp. (San Diego, CA), e hMN-14, ou labe-tuzumab (lgG1 de antiantígeno carcinoembriogênico humanizado), provido pela Immunomedics, Inc. A construção e caracterização de hMN-14, usadas aqui como um controle de isótipo negativo, foram anteriormente descritas. Células
Linhas de células exemplares foram usadas em vários estudos. Por exemplo, as linhas de linfoma de Burkitt, Daudi, Raji, e Ramos, foram adquiridas da American Type Culture Collection (Manassas, VA). Linhas de células de linfoma de Non-Burkitt foram obtidas como se segue. RL e SU- DHL-6, que contêm o deslocamento cromossomal t(14;18), foram obtidos do Dr. John Gribben (Dana-Farber Câncer Institute, Boston, MA) e Dr. Alan Epstein (University of Southern Califórnia, Los Angeles, CA), respectivamente. Linhas de células SU-DHL-4, SU-DHL-10, e Karpas422 foram providas por Dr. Myron Czuczman (Roswell Park Câncer Institute, Buffalo, NY), e linhas de células de WSU-FCCL e DoHH2 foram obtidas da Dr. Mitchell Smith (Fox Chase Câncer Center, Philadelphia, PA). As células foram desenvolvidas como Culturas de suspensão em DMEM (Life Technologies, Gaithers- burg, MD), suplementadas com 10% de soro bovino fetal, penicilina (100 U/ml), estreptomicina (100 g/ml), e L-glutamina (2 mM) (meio completo). A especificidade de ligação de antígeno de hL243 MAbs
Especificidade e atividade de ligação de antígeno de hL243y1 foi mostrado por um ensaio de ligação de superfície de célula. Células de Raji foram incubadas em PBS/BSA (1%) contendo uma concentração de saturação de hL243 purificado (20 g/ml) por 1 h a 4°C. Depois da lavagem, hL243y1 ligada a superfície de célula foi detectada por incubação das células de Raji células no tampão contendo um segundo anticorpo conjugado por PE (IgG de anti-humana de cabra, específico de fragmento de Fc) e contagem em, por exemplo, um sistema de Guave PCA (Guava Technologies, Inc., Hayword, CA).
Um ensaio de ligação de célula de competição foi realizado para avaliar a reatividade de hl_243y4P em relação ao mL243 orgiem. Uma quantidade constante L243 ou hL243y4P de camundongo 125l-marcado (100.000 cpm, - 0 μθί/μς) foi incubado com células de linfoma humanas (Raji, Daudi ou Ramos) na presença de concentrações variáveis (0,2-700 nM) de hL243y4P ou L243 de camundongo purificado a 4°C por 1-2 h. MAbs não ligados foram removidos por lavagem das células em PBS. A radioatividade associada a células foi determinada depois da lavagem.
Em um exemplo, a constante de afinidade de ligação de antígeno de ηΙ_243γ4Ρ foi determinada por ensaio de ligação de superfície de célula direto dos anticorpos radiomarcados e Análise de diagrama de Scatchard.

Para medir ligação de antígeno de superfície de célula, dois conjuntos de células foram preparada e foram usadas no ensaio de ligação para estimar a ligação total e específica de radioatividades, respectivamente. As células para ligação não específica foram pré-incubadas com quantidade em excesso de MAb não marcado para bloquear todos os sítios de antígeno de superfície antes da adição do anticorpo radiomarcado, enquanto aquelas para ligação total foram pré-incubadas em PBS. Depois da pré-incubação, quantidades variáveis de ou 125Ι-ηΙ_243γ4Ρ ou 125l-mL243 foram adicionadas e foram incubadas com 2x105 células de linfoma humanas (Raji, Daudi ou Ramos) a 4°C por 2 h e anticorpos não ligados foram removidos por lavagem. A radioatividade associada a célula foi contada. A ligação de superfície de célula específica do anticorpo radiomarcado a uma dada concentração de anticorpo radiomarcado foi calculada como: as contagens de substratos de ligação totais as contagens de ligação não específica.
Ensaios citométricos de fluxo
Immunofenotipação: ensaios de imunofluorescência total foram realizados com o painel de linhas de células descritas acima, usando-se IgG de anti- humana de cabra de FITC (Tago, Inc., Burlingame, CA) essencialmente como descrito anterioremente, e analisado por citometria de fluxo usando-se a FACSCaliber (Becton Dickinson, San Jose, CA).
Análise de exemplo apoptose: análise de citométrica de fluxo de DNA celular foi realizada após o manchamento com iodeto de propídio. Células foram colocadas em placas de 24 cavidades (5x105 células/cavidade) e subsequentemente foram tratadas com MAbs (5 μg/ml). Três cavidades foram preparadas cada uma com MAb para estudar os efeitos de reticulação com segundos anticorpos de anti-humanos de cabra ou de anticamundongo de cabra. Após uma incubação de 20 min com o MAbs primário (37°C, 5% de CO2), segundo anticorpo específico de Fcgama de IgG de anticamundongo de cabra de F(ab')2 (Jackson Laboratories, West Grove, PA) foi adicionado a uma cavidade a partir de cada MAb primário para ajustar a segunda concentração de anticorpo a 20 μg/ml. Específico de Fc-gama de IgG de anti-humana de cabra F(ab')2 (Jackson Laboratories) era similarmente adicionado à segunda cavidade a partir de cada MAb primário, e o volume do terceiro conjunto foi equalizado por adição de meio. Após uma incubação de 48 (37°C, 5% de C02), células foram transferidas para testar tubos, foram lavadas com PBS, e então foram ressuspensas em solução de iodeto de propí- dio hipotônica (50 mg/ml iodeto de propídio em 0,1% de citrato de sódio, 0,1 % de Triton X-100). Amostras foram analisadas por citometria de fluxo usando-se um FACSCaliber. Percentagem de células apoptóticas foi definida como a percentagem de células com manchamento de DNA antes do pico de G1/G0 peak (hipodiplóide).
Construção e caracterização de hL243.
Em um método exemplar, dois MAbs de anti-DR humanizados foram gerados. hL243yl foi projetado para ter regiões constantes de lgG1/kapa humanas, e hl_243gama4p foi construído por substituição da sequência de codificação de região constante de cadeia pesada para a cadeia de γ1 humana com aquela da cadeia de γ4 humana. Uma mutação de ponto, Ser241 Pro, foi introduzido para dentro da região principal da sequência de γ4 a fim de reduzir a formação de semimoléculas quando um anticorpo é expresso e é produzido em culturas de células de mamífero (Schuurman e outros Mol Immunol. 38:1 (2001)). A capacidade dos dois anticorpos L243 humanizados, γΙ e γ4Ρ, para se ligar células de Raji é mostrada na figura 7, 8 e 17. Na figura 7, ΚιΙ_243γΙ que se liga a células de Raji é especificamente bloqueado por pré-incubação das células com o L243 de camundongo de origem (ml_243), indicando que especificidade de ligação de antígeno de ml_243 é preservada na versão humanizada.
Em um exemplo, a reatividade de hl_243y4P em relação ao parente ml_243 foi avaliada e um ensaio de ligação de célula de competição foi realizado. Uma quantidade constante de ml_243 ou hl_243y4P 25l-marcado foi incubada com células de linfoma humanas (Raji, Daudi ou Ramos) na presença de concentrações variáveis de hl_243y4P ou ml_243 purificado. Como mostrado na figura 8, ml_243 e hL243y4P MAbs competiam uns com outros para a ligação ao antígeno de superfície de célula, indicando reconhecimento de um determinante antigênico comum. hl_243y4P tinha uma aparente aproximadamente de atividade de ligação 2 vezes mais forte do que mL243 (EC50 de ~7 vs. -16,5 nM). O número máximo de sítios de ligação de hl_243y4P e ml_243 por célula e as constantes de dissociação aparentes da ligação de equilíbrio foram determinados por Análise de diagrama de Scatchard. Como mostrado na figura 17, a ligação máxima de hl_243y4P e ml_243 a células de Daudi era virtualmente idêntica, cerca de 6x105 moléculas/célula, consistente com a ligação de um antígeno comum. Os valores constantes de dissociação aparentes para hL243y4P e ml_243 foram calculados serem 2,6 nM e 14 nM, respectivamente. Resultados similares foram obtidos com células de Raji e células de Ramos (dados não mostrados). Expressão de antígeno em célula de linfoma cultivada
Em um método exemplar, análise de citometria de fluxo foi realizada usando-se manchamento imunofluorescente indireto para mostrar que hL243y4P se liga a um painel de céulas B de linfoma humanas cultivadas. Uma comparação com outros antígenos de superfície é mostrada. Como visto na tabela 4, o hl_243y4P MAb se liga a todas as linhas de células testadas. Uma expressão mais forte foi observada em Daudi e Raji, mas o nível de manchamento por fluorescência é forte em todas as linhas de células. Ligação foi comparada com aquela de MAbs humanizados contra outros antígenos de célula B (CD74, CD22, CD20), MaB de anti-CD20 quimérico humano de camundongo rituximab, e um anti-CEA MAb humanizado (controle negativo). O manchamento com hl_243y4P é marcadamente maior do que aquele de CD22 e CD74 sobre todas as sete linhas de células. Manchamento de CD20 era mais variável, como mostrado por reatividade com o (hA20) humanizado e MAbs quimérico (rituximab) MAbs. As linhas de Burkitt, Daudi, Raji, e Ramos, expressam níveis intermediários de CD20, enquanto que as linhas de linfoma de célula B grandes difusas e foliculares avaliadas variadas, a comparação com expressão de HLA-DR medida por ligação de hL243y4P, SU-DHL-6 tem expressão de CD20 mais alta, Namalwa, e WSU-FSCCL de expressão de CD20 mais baixa, e RL cerca de expessão igual em ambos os antígenos.
Ensaios de célula efetora Em um exemplo, a região de Fc de hl_43 foi substituída com uma região de Fc de isótipo de lgG4 para abranger funções de célula efetora a- través da ligação de complemento e de receptor de Fc através de receptor de Fc e ligação de complemento. Ensaios de CDC e ADCC foram realizados para avaliar essass funções.
Em um outro método exemplar, células de CDC Daudi foram incubadas com diluições em série dos anticorpos hl_243gamal, hl_243y4P, hA20 (como um outro controle positivo) e hMN14 (anti- CEA, controle negativo) na presença de complemento humano por 2 h. Isto foi seguido pela adição de resazurina para avaliar viabilidade de célula. Tanto controles de lise máximo quanto os controles não tratados foram incluídos. Leituras de fluorescência foram obtidas 5 h depois da adição de resazurina. O nível de fluorescência obtido está diretamente correlacionado com o número de células viáveis. Os resultados aqui indicam que hl_243y4P não produz um efeito cito- tóxico mediado por complemento sobre células em comparação com hl_243gamal (EC50= 2,6 nM) e hA20 (EC50= 0,66 nM) onde CMC foi observado (figura 10 e 18).
Indução de ADCC foi medida em Raji, Daudi, e SU-DHL-6 por liberação de AM de calceína. A atividade de hl_243y4P foi comparada com aquela de rituximab e L243 de camundongo, como um controle positivo. Como esperado, rituximab e o L243 de camundongo significativamente induziu mais lise de célula do que os controles negativos (nenhum MAb e MN-14 de camundongo e humanizado) e hl_243y4P não induziu (figura 19).
Efeitos antiproliferativos in vitro
Em um exemplo, o efeito de hl_243 sobre proliferação celular foi avaliado usando-se o ensaio de captação de 3H-timidina em Raji, FSCCL, e Namalwa (figura 20B e Tabela 5). O efeito de hL243y4P foi comparado com aquele de rituximab e com rituximab combinado com hl_243y4P, na presença ou ausência de um anticorpo de anti-Fc de reticulação. Em FSCCL, anteriormente demonstrou ser relativamente intenso para rituximab, hL243y4P forneceu inibição de proliferação significativamente maior do que rituximab. Em Ramos, hL243 e atividade de rituximab eram similares, e a combinação era mais eficaz do que cada uma sozinha. A combinação pode ter um efeito sinérgico. Reticulação com anticorpo de Fc de anti-humano é exigido ativi- dade proliferativa significativa a ser vista em Ramos. Em Namalwa, como com FSCCL, hl_243y4P forneceu inibição de proliferação significativamente maior do que rituximab e a combinação de rituximab e hl_243y4P forneceram inibição de proliferação significativamente maior do que qualquer MAb sozinho.
Avaliação de indução por apoptose
Em um método exemplar, o mecanismo de hl_243 y4P-induziu ensaios de morte de célula foi avaliado por medição de vários marcadores de apoptose foram realizados. Estes incluíam indução de fragmentação de DNA, manchamento com Annexin V/7-AAD, medição de caspase-3 ativada, perda de ativação e potencial de membrana mitocondrial da trajetória de sobrevivência de AKT.
Em um outro exemplo, fragmentação de DNA foi avaliada por citometria de fluxo em SU-DHL-6 e Namalwa. Células foram cultivadas com os MAbs por 48 h com ou sem um segundo MAb para a reticulação, seguido por manchamento de DNA com iodeto de propídio. Células foram analisadas por citometria de fluxo, e fluorescência positiva abaixo da região de G1 representa fragmentação de DNA e é uma medida de apoptose. Atividade de hl_243 γ4Ρ foi comparada com aquela de MAbs humanizados contra outros antígenos de célula B, incluindo anti-CD74 (hLL1), anti CD22 (hl_L2, epratu-zumab), anti-CD20 (hA20), bem como o MAb quimérico humano-camundongo rituximab. Controles incluídos no primeiro MAb e o anti-CEA MAb, hMN-14 humanizado de controle negativo. hl_243 γ4Ρ induziu apoptose em ambas as linhas de células, a níveis similares a ou maior do que os outros MAbs de célula de anti-B (figura 21 A e 21 B).
Em uma concretização particular, um kit foi usado (por exemplo o kit de Guava Nexin®) para discriminar entre células morta das apoptóticas e não apoptóticas em células de Daudi. Neste exemplo, o kit utiliza Annexin-V-PE para detectar fosfattidilserina (PS) na membrana externa de células apoptóticas e um corante impermeabilizante de célula 7- AAD com um indi- cador de integridade estrutural de membrana. 7-AAD é excluído do fígado, células saudáveis e células apoptóticas precoces, mas permea células mortas e apoptóticas de estágio tardio. Como mostrado na figura 21 B os resultados deste estudo indicavam que hl_243y4P induziu apoptose similar a ml_243 após tratamento tanto por 4 h quanto 24 h. Em contraste com isso, o anti-CD20 MAb não induziu apoptose mensurável em Daudi. Portanto, hiper- reticulação por um agente secundário, tal como proteína A ou IgG de anti- humano IgG pode ser usado para a indução de apoptose por anti-CD20 MAbs em muitas linhas de células incluindo Daudi.
Em um outro exemplo, efeitos de L243 de camundongo e humanizado sobre potencial mitocondrial foram estudados em células diferentes a saber, SU-DHL-6, Daudi, Raji, WSU-FSCCL, RL, e Namalwa. Resultados são representados na 22 indicando mudanças apotóticas no potencial de membrana mitocondrial foram observados com tanto L243 MAbs de camundongo quanto humanizados. Reticulação com um segundo anticorpo não pode ser necessário, mas pode aumentar o efeito em 2 de 6 linhas de células avaliadas, FSCCL e Namalwa. A perda de potencial de membrana mitocondrial induziu by hl_243y4P foi maior do que aquela do anti-CD20 MAb (hA20), sem um agente de reticulação. Com reticulação dos níveis de hA20 são aumentados por aqueles de hl_243y4P em 3 das 6 linhas de células (RL, SU-DHL-6, e Daudi.).
Em um exemplo, indução de caspase-3 ativada por L243 humanizado e de camundongo foi avaliada por citometria de fluxo em um painel de linhas de células de linfoma. Resultado sumarizado na tabela 6 representa tanto L243 de camundongo quanto humanizado induzem ativação de caspase-3, a níveis similares, na ausência de reticulação com o segundo anticorpo. A ativação de caspase-3 ativada com o L243 MAbs é maior em todas as linhas de células do que aquela de hA20. Com um segundo anticorpo estes níveis são aumentados e o efeito de hA20 é similar àquele do hL243y4P, exceto em Namalwa e FSCCL, duas linhas de células que rotineiramente observou-se ser relativamente insensíveis a anti-CD20 MAbs. Caspase-3 clivada foi também analisada em Daudi durante um curso de tempo de 2 di- as (figura 23A). A atividade continua aumentar por cerca de 2 dias de incubação de L243gama4P. Pontos de tempo menos do que 1 h não eram feitos.
Em um exemplo, o envolvimento de AKT no mecanismo de ação de L243 foi analisado em 6 linhas de células por citometria de fluxo. Células foram incubadas com vários MAbs por 2 dias, então foram analisados quanto a fosfo-AKT. Os resultados listados na Tabela 7 mostram que L243 ativa AKT em todas as linhas de células. Níveis de Fosfo-AKT em células tratadas, anti-CD20, hA20, bem como células tratadas com anti-CD74 e anti- CD22 (não mostradas), são similares a células não tratadas em todas as linhas de células. Para determinar o curso de tempo de células de Daudi de ativação de P-AKT foram incubadas com MAbs por várias vezes, MAbs foram removidos (por centrifugação) em pontos de tempo de 0 min a por volta de 2 dias (figura 23B). Estes resultados representam ativação de AKT por L243 pode ocorrer mais rápido do que pode ser medida por este ensaio, uma vez que mesmo nos níveis de P-AKT de ponto de tempo 0 são iguais ao ponto de tempo por 2 dias.
Eficácia terapêutica in vivo de hl_243 em um modelo de xenoenxerto de linfoma de não Hodgkin
ÍRaiQ
Em um método exemplar, um estudo terapêutico foi realizado para comparar a eficácia in vivo de anticorpos monoclonais de hl_243y4P e ml_243 (isótipo de lgG2a), em um modelo de xenoenxerto de linfoma de não Hodgkin humano (Raji). O objetivo deste estudo era para determinar se hL243y4P pode manter eficácia antitumor significativa em um modelo de xenoenxerto. Camundongos SCKI foram injetados com 2,5 x 106 células de Raji. Terapia com hL243y4P ou ml_243 foi iniciada 1 dia-pós administração de célula de tumor. Resultados são mostrados na figura 24. Ambos os grupos de camundongos injetados com solução salina ou com anticorpo de controle não específico, hMN14, tinha um tempo de sobrevivência médio (MST) de 17 dias. Todos os grupos de camundongos tratados com ou L243 humanizado ou de camundongo tinha significativamente aperfeiçoado semivida em comparação com camundongos injetados com solução salina ou hMN14 (P<0,0001 ). Tratamento com várias doses de hl_243y4P resultou em uma relação de dose-resposta, com camundongos que recebem doses mais altas tendo tempos de sobrevivência melhor. No grupo de animais tratados com várias doses de ml_243 lgG2a, a taxa de cura era na faixa de 80-100%. Tabela 1. Comparação de ligação de MAbs de camundongo e humanizado em Namalwa
MAbs GEO MEAN MAbs GEO MEAN humanizados Fluorescência 2- de Fluorescência 2S
AB: FITC GAH camundongo Ab: FITC GAM

Nenhum 2,52 Nenhum 2,91
HMN 14 2,49 Ag8 3,64
hRS7 2,47 MN14 3,32
hl_L1 10,06 RS7 3,39
hLL2 6,76 LL1 17,31
hA20 6,28 LL2 10,46
Rituximab 7,33 1 F5 3,83
HL243 324,16 m2B8 6,16
L243 594,96
Tabela 2. Fenotipação de linhas de células (ligação de MAbs humanizados ou quiméricos em linhas de células B por ensaio de FACS).
Ensaio indireto usando-se manchamento com FITC-GAH Fc 2nd Ab fluorescência média Retuxima
geométrica
Nenhum hMN14 hl_L1 hA20 ab HL243

Namalwa 2,5 2,36 7 .81 6,4 10. .1 1 14,12 260,8

SU-DHL-6 4,6 4,94 17 .29 1 1 1 199 .34 1308,89 572,2

WSU- 2,6 2,66 8 .66 4,1 8. .91 12,45 466,7 FSCCL
Raji 6,8 6,96 95 .10 22. 267 .09 394,57 971 ,9

Daudi 3,1 3,16 48 .77 51 . 240. .96 380,45 937,4

Ramos 3,1 3,13 23 .25 14. 203. .65 374,98 277,5 Tabela 3. Fenotipação de aspirado de linfoma de cachorro
MAbs de camundongo MAbs humanizados
% FL médio % FL médio

Nenhum 3,85 3,37 Nenhum 4,48 3,24

Ag8 2,81 3,04 hMN-14 4,63 3,24

L243 77,77 10,41 hl_243 26,33 5,47 m2B8 2,61 3,1 1 hA20 3,96 3,25

LL1 6,69 4,01 hl_L1 4,71 3,33

LL2 5,05 3,73 hLL2 4,85 3,37

Tabela 4. Ligação de MAbs humanizados ou quiméricos em linhas de células B. Um ensaio de citometria de fluxo indireto foi realizado usahdo-se man- chamento de segundo anticorpo FITC-GAH Fc.
fluorescência média geométrica
Anti- anti- Anti- Anti- Anti- Anti- NeCD20 HLA-DR
CEA CD74 CD22 CD20
nhum (Ritu- (hL243y4
(hMN14) (hLL1) (hLL2) (hA20)
ximab) P)

Daudi 3,2 3,2 48,8 51 ,7 241 ,0 380,5 937,4

Namalwa 2,6 2,4 7,8 6,4 10,1 14,1 260,9

Raji 6,9 7,0 95,1 22,6 267,1 394,6 972,0

Ramos 3,1 3,1 23,3 14,6 203,7 375,0 277,6

RL 2,4 2,8 7,9 5,1 127,5 147,8 112,2

SU-DHL-6 4,6 4,9 17,3 11 ,0 1199,3 1308,9 572,3

WSU- 2,7 2,7 8,7 4,2 8,9 12,5 466,8

FSCCL
Tabela 5. Sumário da atividade antiproliferativa de MAbs com e sem reticu-lação (% de Inibição de captação de 3-H-Timidina)
Rituximab+hL243 Rituximab hL243y4P

Atividade antiDroliferativa de MAbs sem reticulacão
Ramos 18,2±4,9 -7,9±3,6 10,1±1 1 ,9
(0,0001 )a (0,3619)

FSCCL 75,9±10,2 13,4±12,3 78,9±1 ,7
(0,0028) (0,661 1 )

Namalwa 50,1±1 ,1 13,8±5,6 27,8±3,3 Rituximab+hL243 Rituximab ηΙ_243γ4Ρ

Atividade antiproliferativa de MAbs sem reticulacão
(0,0061) (0,0038) Atividade antiproliferativa de MAbs na presença de 2° Ab anti-humano

Ramos 69,0±7,0 5,05±9,4 56,8±0,8
(0,0519) (0,0073)

FSCCL 94,5±0,9 28,1±9,6 94,5±0,8
(0,0067) (0,9984)

Namalwa 58,1±2,1 14,7±7,0 51 ,5±3,0
(0,0050) (0,0416) a número entre parênteses representam valores de P dos MAbs simples em comparação com a combinação de rituximab+hl_243y4P.
Tabela 6. Ensaio de caspase-3
caspase-3 clivado (% acima de nenhum controle de MAb
MAbs humanizados MAbs de camundongo hL243g4 hA20 hMN-14 mL243 mMN-14
P
nenhuma
reticulação
Ramos 26,9 3,2 0,8 15,8 3,9

Namalwa 18,4 -0,1 0,2 9,4 0,5

FSCCL 46,4 0,7 0,3 26,2 -0,7

Daudi 48,1 7,9 0,9 45,8 1 ,0

RL 22,5 1 ,5 -0,1 18,2 -0,3

SU-DHL-6 52,2 30,9 2,3 46,5 0,2

Raji 22,5 1 ,5 -0,1 18,2 -0,3 com 2- Ab
Ramos 71 ,7 67,8 7,3 40,3 3,0

Namalwa 72,2 20,4 7,9 25,2 -0,3

FSCCL 86,7 20,0 8,4 55,0 1 ,5

Daudi 68,9 72,0 2,9 51 ,2 0,0

RL 37,3 24,2 4,0 4,0 0,7

SU-DHL-6 72,1 75,8 5,5 51 ,4 -0,9

Raji 59,8 37,4 2,8 20,4 -0,3 Tabela 7. Ensaio de P-AKT



Todas as composições e/ou métodos e/ou aparelho descritos e reivindicados aqui podem ser produzidos e executados sem experimentação imprópria à luz da presente descrição. Embora as composições e métodos desta invenção tenham sido descritos em termos de concretizações preferidas, será evidente por aqueles versados na técnica que a variação pode ser ampliada às composições e/ou métodos e/ou aparelhos e nas etapas ou na sequência de etapas do método descrito aqui sem se afastar do conceito, espírito e escopo da invenção. Mais especificamente, será evidente que certos agentes que são tanto quimicamente quanto fisiologicamente relatados podem ser usados como substitutos dos agentes descritos aqui enquanto os resultados iguais ou similares seriam alcançados. Todos os tais substitutos e modificações aparentes por aqueles versados na técnica são imaginados estarem dentro do espírito, escopo e conceito da invenção como definido pelas reivindicações anexas.

LISTAGEM DE SEQUENCIA
<110> IMMU OMEDICS, INC.
GOLDENBERG, David M.
HANSEN, Hans J..
QU, Zhengxing
CHANG, Chien-Hsing
<120> Anticorpos L243 Humanizados
<130> Fase Nacional do PCT/US06/07598
<150> PCT/US06/07598
<151> 2006-03-03
<150> US 60/657,695
<151> 2005-03-03 .
<160> 25
<170> Versão Patente 3.4
<210> 1
<211> 324
<212> DNA
<213> Anticorpo anti-HLA-DR de camundongo
<220>
<221> CDS
<222> (1)..(321)
<400> 1
gac atc cag atg act cag tct cca gcc tcc cta tct gta tct gtg gga 48 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Val Ser Val Gly
1 5 10 15
gaa act gtc acc atc aca tgt cga gca agt gag aat att tac agt aat 96 Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn
20 25 30
tta gca tgg tat cgt cag aaa cag gga aaa tct cct cag ctc ctg gtc 144 Leu Ala Trp Tyr Arg Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val
35 40 45
ttt gct gca tca aac tta gca gat ggt gtg cca tca agg ttc agt ggc 192 Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tca ggc aca cag tat tcc ctc aag ate aac age ctg cag tet 240 Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln Ser
' 5 65 70 75 80
gaa gat ttt ggg gat tat tac tgt caa cat ttt tgg act act ceg tgg 288 Glu Asp Phe Gly Asp Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp
85 90 95
gcg ttc ggt gga ggc acc aac ctg gaa ate aaa cgt 324 10 Ala Phe Gly Gly Gly Thr Asn Leu Glu Ile Lys
100 105
<210> 2
<211> 107
<212> PRT
15 <213> Anticorpo anti-HLA-DR de camundongo
<400> 2
Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Val Ser Val Gly
1 5 10 15
Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn
0 20 25 30
Leu Ala Trp Tyr Arg Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val
35 40 45
Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
5 Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln Ser
65 70 75 80
Glu Asp Phe Gly Asp Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp
85 90 95
Ala Phe Gly Gly Gly Thr Asn Leu Glu Ile Lys
0 100 105
<210> 3
<211> 363 <212> DNA
<213> Anticorpo L243 Anti-HLA-DR de camundongo
<220>
<221> CDS
<222> (1)..(360)
<400> 3
cag ate cag ttg gtg cag tet gga cct gag ctg aag aag cct gga gag Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu 1 . 5 10 15 aca gtc aag ate tec tgc aag get tet ggg ttt acc ttc aca aac tat Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr

20 25 30 gga atg aac tgg gtg aag cag get cca gga aag ggt tta aag tgg atg Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met

35 40 45
ggc tgg ata aac acc tac act aga gag cca aca tat get gat gac ttc Gly Trp Ile Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60
aag gga cgg ttt gec ttc tet ttg gaa acc tet gec age act gec tat Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr 65 70 75 80 ttg cag ate aac aac etc aaa aat gag gac acg get aaa tat ttc tgt Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala Lys Tyr Phe Cys
85 90 95 gca aga gat att act gcg gtt gta cct acg ggt ttt gac tac tgg ggc Ala Arg Asp Ile Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly

100 105 110 caa ggc acc act etc acc gtc tec tca
Gln Gly Thr Thr Leu Thr Val Ser
115 120
<210> 4
<211> 120 <212> PRT
<213> Anticorpo L243 Anti-HLA-DR de camundongo
<400> 4
Gln lie Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys lie Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr

20 25 30
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met

35 40 45
Gly Trp lie Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60
Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr 65 70 75 80

Leu Gln lie Asn Asn Leu Lys Asn Glu Asp Thr Ala Lys Tyr Phe Cys
85 90 95

Ala Arg Asp lie Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly

100 105 110
Gln Gly Thr Thr Leu Thr Val Ser
115 120
<210> 5
<211> 324
<212> DNA
<213> Anticorpo de camundongo humanizado
<220>
<221> CDS
<222> (1)..(324)
<400> 5
gac ate cag ctg acc cag tct cca tca tct ctg age gca tct gtt gga Asp lie Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 gat agg gtc act ate act tgt cga gca agt gag aat att tac agt aat Asp Arg Val Thr lie Thr Cys Arg Ala Ser Glu Asn lie Tyr Ser Asn 20 25 30
tta gca tgg tat cgt cag aaa cca ggg aaa gca cct aaa ctg ctg gtc 144 Leu Ala Trp Tyr Arg Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Val
35 40 45
ttt gct gca tca aac tta gca gat ggt gtg cct tcg cga ttc tct ggc 192 Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
age gga tct ggg aca gat tat act ttc acc ate age tct ctt caa cca 240 Ser Gly Ser Gly Thr Asp Tyr Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80 gaa gac att gca aca tat tat tgt caa cat ttt tgg act act ceg tgg 288 Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp
85 90 95
gcg ttc ggt gga ggg acc aag ctg cag ate aaa cgt 324 Ala Phe Gly Gly Gly Thr Lys Leu Gln Ile Lys Arg
100 105
<210> 6
<211> 108
<212> PRT
<213> Anticorpo de camundongo, humanizado
<400> 6
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn
20 25 30
Leu Ala Trp Tyr Arg Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Val
35 40 45
Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp 85 90 95
Ala Phe Gly Gly Gly Thr Lys Leu Gln lle Lys Arg
100 105
<210> 7
' 5 <211> 363
<212> DNA
<213> Anticorpo de camundongo humanizado
<220>
<221> CDS
10 <222> (1)..(363)
<400> 7
cag gtg caa ctg cag caa tct ggg tct gag ttg aag aag cct ggg gcc 48 Gln Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala
1 5 10 15
15 tca gtg aag gtt tcc tgc aag gct tct gga ttt acc ttc aca aac tat 96 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr
20 25 30
gga atg aac tgg gtg aag cag gcc cct gga caa ggg ctt aag tgg atg 144 Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp et
0 35 40 45
ggc tgg ata aac acc tac act aga gag cca aca tat gct gat gac ttc 192 Gly Trp lle Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe
50 55 60
aag gga cgg ttt gcc ttc tcc ttg gac acc tct gtc age acg gca tat 240 5 Lys Gly Arg Phe Ala Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr
65 70 75 80 etc cag ate age age cta aag gct gac gac act gcc gtg tat ttc tgt 288 Leu Gln lle Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Phe Cys
85 90 95
0 gca aga gat att act gcg gtt gta cct acg ggt ttt gac tac tgg ggc 336 Ala Arg Asp lle Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly
100 105 110 caa ggg tcc ctg gtc acc gtc tcc tca
Gln Gly Ser Leu Val Thr Val Ser Ser
115 120
<210> 8
<211> 121
<212> PRT
<213> Anticorpo de camundongo humanizado
<400> 8
Gln Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala

1 . 5 10 . 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr

20 25 30
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met

35 40 45
Gly Trp lie Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60
Lys Gly Arg Phe Ala Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr 65 70 75 80

Leu Gln lie Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Phe Cys
85 90 95

Ala Arg Asp Ile Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly

100 105 110
Gln Gly Ser Leu Val Thr Val Ser Ser
115 120
<210> 9
<211> 108
<212> PRT
<213> homo sapiens
<400> 9
Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala Ser

1 5 10 15

Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala 20 25 30
Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp et Gly

35 40 45
Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

50 55 60
Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr Leu 65 70 75 80

Gln Ile Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95

Arg Glu Asp Ser Asn Gly Tyr Lys Ile Phe Asp Tyr
100 105
<210> 10
<211> 121
<212> PRT
<213> Murinae gen. sp.
<400> 10
Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr

20 25 30
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met

35 40 45
Gly Trp Ile Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60
Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr 65 70 75 80

Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala Lys Tyr Phe Cys
85 90 95

Ala Arg Asp Ile Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly

100 105 110
Gln Gly Thr Thr Leu Thr Val Ser Ser <210> 11
<211> 121
<212> PRT
<213> Atnicorpo humanizado
<400> 11
Gln Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr

20 25 30
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Lys Trp Met

35 40 45
Gly Trp Ile Asn Thr Tyr Thr Arg Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60
Lys Gly Arg Phe Ala Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr 65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Phe Cys
85 90 95

Ala Arg Asp Ile Thr Ala Val Val Pro Thr Gly Phe Asp Tyr Trp Gly

100 105 110
Gln Gly Ser Leu Val Thr Val Ser Ser
115 120
<210> 12
<211> 119
<212> PRT
<213> Homo sapiens
<400> 12
Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala Ser

1 5 10 15

Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala

20 25 30
Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 35 40 45 Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

50 55 60
Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr Leu 65 70 75 80

Gln Ile Ser Ser Leu Lys Ala Asp Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95

Arg Glu Asp Ser Asn Gly Tyr Lys Ile Phe Asp Tyr Trp Gly Gln Gly

100 105 110
Ser Leu Val Thr Val Ser Ser
115
<210> 13
<211> 107
<212> PRT
<213> homo sapiens
<400> 13
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ile Lys Tyr

20 25 30
Leu Asn Trp Tyr Gln Gln Thr Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45
Tyr Glu Ala Ser Asn Leu Gln Ala Gly Val Pro Ser Arg Phe Ser Gly

50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Phe Thr Ile Ser Ser Leu Gln Pro 65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Gln Ser Leu Pro Tyr
85 90 95

Thr Phe Gly Gln Gly Thr Lys Leu Gln Ile Thr
100 105
<210> 14
<211> 108
<212> PRT <213> camundongo
<400> 14
Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Val Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn

20 25 30
Leu Ala Trp Tyr Arg Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val

35 40 45
Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly

50 55 60
Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Ser Leu Gln Ser 65 70 75 80

Glu Asp Phe Gly Asp Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp
85 90 95

Ala Phe Gly Gly Gly Thr Asn Leu Glu Ile Lys Arg
100 105
<210> 15
<211> 108
<212> PRT
<213> camundongo humanizado
<400> 15
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Asn

20 25 30
Leu Ala Trp Tyr Arg Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Val

35 40 45
Phe Ala Ala Ser Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly

50 55 60
Ser Gly Ser Gly Thr Asp Tyr Thr Phe Thr Ile Ser Ser Leu Gln Pro 65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Phe Trp Thr Thr Pro Trp 85 90 95

Ala Phe Gly Gly Gly Thr Lys Leu Gln lie Lys Arg
100 105
<210> 16
<211> 175
<212> DNA
<213> camundongo humanizado
<400> 16
ggtctgagtt gaagaagcct ggggcctcag tgaaggtttc ctgcaaggct tctggattta ccttcacaaa ctatggaatg aactgggtga agcaggcccc tggacaaggg cttaagtgga tgggctggat aaacacctac actagagagc caacatatgc tgatgacttc aaggg <210> 17
<211> 168
<212> DNA
<213> camundongo humanizado
<400> 17
acccttggcc ccagtagtca aaacccgtag gtacaaccgc agtaatatct cttgcacaga aatacacggc agtgtcgtca gcctttaggc tgctgatctg gagatatgcc gtgctgacag aggtgtccaa ggagaaggca aaccgtccct tgaagtcatc agcatatg
<210> 18
<211> 38
<212> DNA
<213> camundongo humanizado
<400> 18
gtggtgctgc agcaatctgg gtctgagttg aagaagcc
<210> 19
<211> 38
<212> DNA
<213> camundongo humanizado
<400> 19
tgaggagacg gtgaccaggg acccttggcc ccagtagt
<210> 20 <212> DNA
<213> camundongo humanizado
<400> 20
tccatcatct ctgagcgcat ctgttggaga tagggtcact atcacttgtc gagcaagtga gaatatttac agtaatttag catggtatcg tcagaaacca gggaaagcac ctaaactgct ggtctttgct gcatcaaact tagcagatgg tgtgc
<210> 21
<211> 159
<212> DNA
<213> camundongo humanizado
<400> 21
cagcttggtc cctccaccga acgcccacgg agtagtccaa aaatgttgac aataatatgt tgcaatgtct tctggttgaa gagagctgat ggtgaaagta taatctgtcc cagatccgct gccagagaat cgcgaaggca caccatctgc taagtttga
<210> 22
<211> 38
<212> DNA
<213> camundongo humanizado
<400> 22
gacattcagc tgacccagtc tccatcatct ctgagcgc
<210> 23
<211> 31
<212> DNA
<213> camundongo humanizado
<400> 23
ccggcagatc tgcagcttgg tccctccacc g
<210> 24
<211> 47
<212> DNA
<213> camundongo
<400> 24 ccgcggtcac atggcaccac ctctcttgca gcttccacca agggccc 47

<210> 25
<211> 33
<212> DNA
<213> camundongo
<400> 25
ccggccgtcg cactcattta cccagagaca ggg 33