Processing

Please wait...

Settings

Settings

Goto Application

1. WO2020141106 - ENGINEERED EXTERNALLY REGULATED ARTIFICIAL TRANSCRIPTION REGULATORY SYSTEM BASED ON ENGINEERED NFAT

Note: Text based on automatic Optical Character Recognition processes. Please use the PDF version for legal matters

[ EN ]

Engineered externally regulated artificial transcription regulatory system based on engineered NFAT

FIELD OF THE INVENTION

Induced Engineered NFAT artificial transcription factors, combined with heterodimerization domains can modulate NFAT dependent transcription factors and affect the proliferation and activation state of T cells and/or CAR T cells that are used in cancer immunotherapy and therefore regulate the therapeutic function of T cells and/or CAR T cells.

BACKGROUND OF THE INVENTION

CAR T cells (Chimeric antigen receptor and methods of use thereof; US 2017/0143765) present a therapeutic option for various malignant diseases based on their ability to specifically recognize the selected tumour surface markers, triggering immune cell activation and cytokine production that results in killing cancerous cell expressing specific surface markers recognized by the CAR. The main therapeutic effect of CAR is a specific T cell activation of adequate cell number with sequential destruction of tumorous cells in a safe therapeutic manner. In order to increase T cell activation, 4-1 BB (Imai, C. et al., Leukemia 18, 676-684, 2004) to prolong T cell survival and CD28 (Savoldo, B. et al., J. Clin. Invest 121 , 1822-1826 (201 1) to increase the potency of T cell response, was introduced into CAR. CAR T-cells are highly efficient in tumour cell destruction, but may cause serious side effects so their activity needs to be carefully controlled.

Therapeutic use of CAR also presents some drawbacks. There are reports on deaths of several patients due to the off tumour cross-reaction; tumour antigens, which are recognized by CARs are also expressed on normal cells within the organism, resulting in killing of non-tumorous cells. Another probably even more serious side effect that occurs quite frequently is a cytokine release syndrome (CRS) due to the over-activation of T cells that results in strong inflammatory production, leading to high fever, hypotension, hypoxia, organ failure and even death of the treated patient. Additionally neurological toxicities and tumour lysis syndrome can occur.

An important factor that is important for the effective therapy is the appropriate number of infused engineered CAR-T cells into the human body to achieve the desired anti-cancerous effect. There are different reports and recommendations (from 107 to 1011 cells for different malignancies) on the number of transferred cells and also a large variation on therapeutic T cell persistence within the human body (from 2 days for the 1st generation CARs to couple of weeks or up to 10 months

for some of 2nd and 3rd generation CD-19 CARs) with different outcomes on the relevant disease.

In some cases, a higher number of infused CAR T cells resulted in greater cytokine production leading towards CRS and other toxicities, which can be treated with some specific drugs, like IL-6 antibodies or with high dosage of corticosteroids, but this can result in CAR T cell depletion. In order to avoid CRS, sometimes lower numbers of CARs are introduced into patients or several infusions are made, which again can end either in no therapeutic effect or in severe CRS.

Different approaches were made to influence CAR T cell proliferation and their activation by adding T cell growth factors, such as IL-2, into patients; however, this approach of increasing the number of activated T cells with no external control over their number can again lead to non-optimal therapeutic effects and severe side effects. Different improvements were made by designing synthetic receptors or small molecule-inducible systems, which influence regulated expansion and survival of CAR T cells.

Upon CAR stimulation NFAT, an endogenous TF central to T cell activation, is activated, which regulates T cell number and activation state. The NFAT family consists of five members, where NFAT3 is the only one not expressed in the immune system. NFAT5 is also the only one that is not regulated by the calcium-calcineurin action. All NFATs have a highly conserved DNA-binding domain, which is structurally related to the REL-Family transcription factors (NF-KB transcription factor is also a part of this family). The REL-homology region (RHR) confers a common DNA-binding specificity. The other part of NFAT is the NHR (NFAT-homology) domain that contains a potent transactivation domain. The NHR domain comprises 14 serine residues which are phosphorylated in resting T cells. Upon T cell receptor (TCR) stimulation, a signalling cascade is activated, which results in calcineurin-mediated dephosphorylation of 13 serine residues, exposing the nuclear localization signal (NLS) of NFAT and resulting in the translocation of NFAT into the cell nucleus, where it influences transcription of genes related to T cell proliferation and activation (for example: IL-2, TNFa, IFNy, IL-4 etc.).

Cytokine IL-2 that is secreted from cells as a result of activation via the NFAT-mediated signalling pathway is a strong inductor for T cell activation and proliferation. NFAT1 , 2 and 4 (all are involved in T cell function) are regulated by the influx of calcium, which activates the calmodulin-dependent phosphatase calcineurin. Several reports have shown that the NFAT is also regulated by cytokine signalling; higher induction of NFAT transcription is triggered by IL-2, IL-6 and IL-15 stimulation. NFAT1 and 2 strongly contribute to the clonal expansion of activated T cells through IL-2 synthesis.

NFAT can act in combination with different transcription partners. The main transcriptional partner is AP-1 (activator protein-1). Dimers of FOS and JUN form quaternary complexes with NFAT and DNA. The cooperation between NFAT and AP-1 results, besides the calcium signalling, also in the Ras/MAPK signalling and therefore influences a wide range of transcription changes (IL2, TNFa, CXCR etc). There are studies that confirmed DNA binding sequences and also the sites which are occupied by the NFAT/AP-1 complex. NFAT can also bind to the NF-KB like sites, to STAT and NFAT-GATA sites. NFAT therefore has a major role in T cell activation and proliferation, its induction of IL-2 secretion is the first and most important signal that enhances the T cell proliferation.

CAR expression has been put under the NFAT driven promoter, and enhanced IL-12 production was achieved also under the NFAT driven promoter, which is activated upon CAR or TCR stimulation.

Nowadays CAR-mediated signaling can be regulated by small molecules, such as rapalogs, giberilin etc. and therefore making CAR T-cell therapy controllable. For controllable protein-protein interactions various protein heterodimerization system are in use. Heterodimerization domains (domains FKBP and FRB, which dimerize in the presence of a rapalog; domains GID1 and GAI which form a heterodimer, when giberellin is added; abscisic acid inducible heterodimerization of ABI and PYL1 domains) assemble upon induction of heterodimerization and trigger activation of the signalling pathway (Wu, C.-Y. et al., Science, 80, 350, aab4077, 2015). These hetrodimerization domains for which orthogonality was shown were also used for the induced transcriptional regulation by fusing them with different DNA binding domains. CAR-mediated signaling reported so far has regulated at the level of reconstitution of the CAR receptor, which then engages the endogenous signaling pathway.

For a wider use at an earlier disease stage, application of CAR T cell-based therapy, its safety and controllability needs to be improved by the introduction of additional regulation of CAR-T cells. On the other hand, the downstream signaling pathway has not been regulated although this represents the possibility to introduce tighter and more effective control of T cell activation and proliferation.

SUMMARY OF THE INVENTION

The present invention provides an engineered NFAT artificial transcription factor system based on the selection of heterodimerization (HD) domains (HD system), which allows regulated expression in cells upon addition of one or more chemical inductors that can provide external chemical regulator signals. Such chemical inductors can be small molecules, such as rapalog, gibberellin and/or abscisic acid.

Protein partners of the HD system dimerize into a functional form when the appropriate heterodimerizing signal is present. One partner of the HD system is connected to a truncated version of an NFAT protein (NFAT truncated of its own transactivation domain), which comprises a DNA binding domain targeting genes important for the appropriate T cell response. Truncated NFAT I is still able to bind to the target DNA sites within the genome but does not trigger activation and therefore competes with the endogenous NFAT variants and therefore acts as a competitive repressor. The other partner of the selected heterodimerization system is fused with an transcriptional activation domain (e.g. VP16, VP64, VPR) or repressor domain (e.g. KRAB domain). By the addition of an external small chemical inductor or regulator, respectively, (for example a rapalog, gibberellin or abscisic acid) that acts to promote heterodimerization, two partners of an HD system dimerize into a heterodimer and recruit a transcription activation or repression domain to a desired NFAT-binding DNA region within a T cell genome. NFAT mostly binds to an IL2 promotor thus influencing IL-2 synthesis and production, which then proliferates and activates T cells; also therapeutic CAR T cells. In this system, an engineered NFAT domain with an HD domain fused to it remains under the control of T cell signalling and calcineurin dephosphorylation, which means that the response of cells to target cancer cells remains functional; its intensity, however, can be regulated.

We chose NFAT2 (NFATd) which promotes higher IL4 production and is connected to the enhanced cytotoxic T cell generation. There is also strong evidence that NFAT2 is crucial for inducing the cytotoxic effect of cytotoxic CD8+ cells based on CHIP-seq analysis, which reveals that NFAT2 can bind to several genes that control cytotoxic activity of T cells. Nevertheless, all NFAT (NFAT1 , NFAT4, NFAT5) could be used with probably similar efficiency.

For example, abscisic acid induces heterodimerization of an engineered NFAT, genetically fused to an ABI protein and as the second component a VPR activation domain, genetically fused to a PYL1 protein partner of the HD system, thus influencing the engineered NFAT TF to bind to the IL2 promotor and upregulating IL2 synthesis and secretion, thereby augmenting T cells

activation and increasing its proliferation. In the absence of abscisic acid, the engineered NFAT lacking its own transactivation domain can bind to the corresponding sites and prevents binding of an endogenous NFAT, thereby preventing IL2 transcription. Therefore, T cell activation is in a constitutively repressed state and is activated only in the presence of the chemical inductor (regulator), which makes the system safer and less prone to point mutations that enable escape of the regulation. But if PYL1 is connected to a KRAB repressor domain, heterodimerization (HD) of two protein partners of the HD system occurs after the induction of the HD system to provide an artificial engineered NFAT TF, which downregulates cytokine IL2 synthesis and therefore makes T cells, also CAR T cells, less activated and also less prone to proliferation. Even the naked exogenous NFAT (without the KRAB protein partner of the HD system), connected with just the protein partner of the HD system can downregulate the IL2 promoter only by competing with the natural endogenous NFAT TF for binding to its DNA binding sites. The same influence on IL2 synthesis can be achieved by using different protein partners of different HD systems with various chemical signals for inducing HD.

Induced NFAT artificial transcription factors of the present invention can be used for the regulation of proliferation and activation of T cells including various CAR and TCR T cells. NFAT artificial transcription factors of the present invention can be used in various CAR T cells thus influencing the activation and proliferation state of proliferating CAR T cells in the patient’s body. When higher numbers of proliferating T or CAR T cells are needed (based on clinical findings of the patient’s health status) activation of T/CAR T cells is induced by the addition a chemical inductor or regulator for HD of activating NFAT engineered TF, thus increasing proliferation of T/CAR T cells, increasing their activation and effectiveness in tumor cell killing. But when T/CAR T cell numbers need to be diminished, the chemical inductor (regulator) is withdrawn or another repressor NFAT engineered TF can be induced by the second HD. This results in a smaller number of CAR T cells, which lowers the risk for developing CRS and other side effects of CAR T cell therapy.

The invention provides orthogonal sets of engineered NFAT TF by combining two protein partners of different HD systems on a single NFAT protein in order to simultaneously upregulate or downregulate IL2 synthesis by introducing appropriate an signal for HD, thus making T/CAR T cell therapy more regulated, as depicted in Figure 1.

Effective regulation of the proliferation and activation state of CAR T cells as provided with this invention makes CAR T cell therapy more controllable, more efficient and safer.

FIGURE LEGENDS

Figure 1 : A schematic diagram of action of the engineered transcription factor based on NFAT (Nuclear factor of activated T cells) according to the invention, combined with different protein partners of heterodimerization (HD) systems for chemically regulated activation and proliferation of CAR (chimeric antigen receptor) T cells. A) By the addition, for example of a rapalog (e.g. rapamycin), heterodimerization of FKBP (FK506 binding protein) and FRB FRB (FKBP-rapamycin binding domain of mammalian target of Rap (mTOR)) occurs, resulting in NFAT-driven IL-2 upregulation, and upregulation of NFAT-driven genes, which triggers increased proliferation of CAR T cells. In order to suppress activation of infused overactivated engineered T cells, abscisic acid (ABA) is added. Addition of ABA leads to heterodimerization of PYL1 (abscisic acid receptor 1) and ABI (ABA Insensitive), which results in the formation of an engineered heterodimer comprising NFAT and KRAB (Kruppel associated box) that suppresses the transcription of IL-2 or other NFAT-driven genes and, consequently, activation and proliferation of T cells is reduced. B) In the absence of a chemical inductor an engineered NFAT transcription factor that lacks its endogenous transactivation domain binds to the appropriate DNA target sites and competes with an endogenous NFAT, acting effectively as a competitive repressor suppressing the transcription of IL-2 or other NFAT-driven genes and, consequently, activation and proliferation of T cells is reduced.

Figure 2: A schematic presentation of constructs for engineered NFAT transcription factors, which influence proliferation and activation of CAR T cells a) Constructs for engineered NFAT transcription factors (without its own transactivating domain) based on gibberellic acid-induced heterodimerization between protein partners GAI (Giberellin Insensitive) and GID1 (Giberellin Insensitive Dwarf 1), fused with an activator domain, e.g. VPR (VP64-p65-Rta) or fused with a repressor domain, e.g. KRAB (Kruppel associated box) b) Constructs for engineered NFAT transcription factors (without its own transactivating domain) based on abscisic acid-induced heterodimerization between protein partners ABI (ABA Insensitive) and PYL1 (abscisic acid receptor 1), fused with an activator domain, e.g. VPR (VP64-p65-Rta) or fused with a repressor domain, e.g. KRAB (Kruppel associated box) c) Constructs for engineered NFAT transcription factors (without its own transactivating domain) based on rapalog-induced heterodimerization between protein partners DmrA (FKBP) and DmrC (FRB), fused with an activator domain, e.g. VPR (VP64-p65-Rta) or fused with a repressor domain, e.g. KRAB (Kruppel associated box) d) Constructs for orthogonal engineered NFAT transcription factors (without its own transactivating domain) based on simultaneous induction of repression or activation of the NFAT artificial

transcription factor by adding different chemical inductors of heterodimerization. In this case, the NFAT protein comprises two first protein domains, e.g. ABI and GAI, or ABI and DmrA or GAI and DmrA.

Figure 3: Activation of engineered NFATd artificial transcription factor based on gibberellic acid-induced heterodimerization. By the addition of gibberellic acid, heterodimerization of GAI-NFAT (the first component) and GID1-VPR (the second component) occured, wherein GAI (Gibberellin Insensitive) is the at least one first protein domain, GID1 (Giberellin Insensitive Dwarf 1) is the second protein domain and VPR (VP64-p65-Rta) is the gene transcription activation domain. This resulted in activation of the luciferase reporter gene, which was even further enhanced by the addition of the Ca-ionophore A23187 (Sigma).

Figure 4: Activation of engineered NFATd artificial transcription factor based on rapalog (rapamycin)-induced heterodimerization. By the addition of rapamycin as the chemical inductor, heterodimerization of DmrA-NFAT (the first component) and DmrC-VPR (the second component) occured, wherein DmrA (FKBP) is the at least one first protein domain, DmrC (FRB) is the second protein domain and VPR (VP64-p65-Rta) is the gene transcription activation domain. This resulted in activation of the luciferase reporter gene, which was even further enhanced by the addition of the Ca-ionophore A23187 (Sigma).

Figure 5: Activation of engineered NFATd artificial transcription factor based on abscisic acid (ABA)-induced heterodimerization. A) By the addition of ABA, heterodimerization of ABI-NFAT (the first component) and PYL1-VPR (the second component) occured, wherein ABI (ABA Insensitive) is the at least one first protein domain, PYL1 (abscisic acid receptor 1) is the second protein domain and VPR (VP64-p65-Rta) is the gene transcription activation domain. This resulted in activation of the luciferase reporter gene, which was even further enhanced by the addition of the Ca-ionophore A23187 (Sigma). B) Titration of amounts of DNA needed for luciferase reporter gene activation.

Figure 6: Influence of an engineered NFATd transcription factor on IL2 production. Addition of abscisic acid (ABA) resulted in ABI-NFATd mediated IL2 promotor activation and IL2 secretion in the Jurkat T cell line. By the addition of ABA, heterodimerization of ABI-NFAT (the first component) and PYL1 -VPR (the second component) occured, wherein ABI (ABA Insensitive) is the at least one first protein domain, PYL1 (abscisic acid receptor 1) is the second protein domain and VPR (VP64-p65-Rta) is the gene transcription activation domain.

Figure 7: Influence of different engineered NFATd transcription factors on IL2 production. Addition of an inductor of heterodimerization between protein partners resulted in ABI-NFATd , DmrA-NFATd and GID-NFATd mediated IL2 promotor activation and IL2 secretion in the Jurkat T cell line. The enhancement of IL2 secretion was observed only in the presence of the appropriate chemical inductor of the HD systems. Rapamycin promoted heterodimerization of FKBP-tNFAT2 and FRB-VPR, gibberellin promoted heterodimerization of GAI-tNFAT2 and GID1-VPR and abscisic acid promoted heterodimerization of ABI-tNFAT2 and PYL1 -VPR. Proper reconstitution of the components of the engineered NFAT TF resulted in IL2 promoter binding and subsequent human IL2 gene expression upregulation, as measured by an ELISA.

Figure 8: Engineered ABI-NFATd , part of the complete Transcription Factor, competes with endogenous NFAT transcription factor for binding to IL2 promotor DNA binding sites. Engineered ABI-NFATd is the first component comprising an NFAT protein lacking its own transactivation domain fused with ABI (ABA Insensitive) as the at least one first protein domain. Expression of artificial ABI-NFATd in a CD3/CD28 stimulated Jurkat T cell line lowered IL2 production, thus indicating competition between endogenous NFAT and the engineered ABI-NFATd transcription factor. The Jurkat T cell line was stimulated with dynabeads that were coated with antibodies against CD3 and CD28 (Gibco). IL2 production was measured by an ELISA.

Figure 9: Engineered ABI-NFATd , part of the complete TF, competes with endogenous NFAT transcription factor for binding to IL2 promotor DNA binding sites in different time points. Expression of artificial ABI-NFATd in anti-CD3/anti-CD28/PMA stimulated Jurkat T cell line cells lowers IL2 production after 48 hours, thus indicating competition between endogenous NFAT and engineered ABI-NFATd transcription factor.

Figure 10: The addition of engineered ABA-induced Transcription Factor enhanced T cell activation. Expression of abscisic acid (ABA)-induced engineered ABI-NFATd and PYL1-VPR Transcription Factor in Jurkat T cell line cells increased IL2 production compared to T cells, activated only with an anti-CD3/anti-CD28/PMA cocktail. Engineered ABI-NFATd is the first component comprising an NFAT protein lacking its own transactivation domain fused with ABI (ABA Insensitive) as the at least one first protein domain. PYL1-VPR is the second component comprising PYL1 (abscisic acid receptor 1) as the second protein domain and VPR (VP64-p65-Rta) as the gene transcription activation domain. By the addition of ABA, heterodimerization of ABI-NFAT (the first component) and PYL1 -VPR (the second component) occured, thereby

resulting in the formation of an activating engineered transcription Factor that enhanced expression of the IL2 gene, as measured by an ELISA.

Definitions

The term “NFAT”, as used herein, refers to the Nuclear factor of activated T cells transcription factors which belong to NFAT family. NFAT family consists of five members, where NFAT3 is the only one not expressed in immune system. NFAT5 is also the only one that is not regulated by the calcium-calcineurin action. All NFATs have highly conserved DNA-binding domain, which is structurally related to the REL-Family transcription factors (NF-KB transcription factor is also a part of this family). REL-homology region (RHR) confers a common DNA-binding specificity. The other part of NFAT is NHR (NFAT-homology) domain that contains a potent transactivation domain. NHR domain comprises 14 serine residues which are phosphorylated in resting T cells. Upon TCR (T cell receptor) stimulation, a signalling cascade is activated which results in calcineurin-mediated dephosphorylation of 13 serine residues, exposing the nuclear localization signal (NLS) of NFAT and resulting in the translocation of NFAT into the cell nucleus where it influences transcriptional regulation related for T cell proliferation and activation (for example: IL-2, TNFa, IFNy, IL-4 etc). The term“truncated NFAT” or“tNFAT”, respectively, refers to NFAT shortened for his own DNA transactivation domain, resulting in lack of ability to activate gene transcription.

The term“transcription factor”, as used herein, relates to sequence-specific DNA-binding protein which dictates the rate of transcription of genetic information from DNA to messenger RNA by binding to its own specific DNA sequence. The term“engineered transcription factor” herein relates to NFAT based transcription factors which were modulated by molecular cloning techniques and are diffent from natural occurring endogenous transcription factors. The artificial engineered transcription factor herein is combined from DNA binding domain connected with a protein partner of a HD system and Transcriptional activation or repressor domain connected with appropriate protein partner of a HD system. The term“endogenous” relates to molecules that naturally occur in living organisms.

The term“transcriptional regulation”, as used herein” relates to action of controlling gene transcription in order to enhance or upregulate expression of a certain gene and diminish or downregulate expression of a ceratin gene by binding to the DNA in the proximity of the gene promoter or enhancer and influence the attraction of transcription regulating molecules as activators or repressors. The term“NFAT dependent gene regulation” relates to the action of an NFAT transcription factor to promote gene expression regulation by binding to its DNA binding sites, preferably to IL2 promotor.

The term“activation domain”, as used herein, relates to a part of transcription factor that in complex with DNA binding domain promotes the recruitment of RNA polymerase in order to enhance the transcription of certain genes. The activation domain herein relates to p65 domain-part of NF-KB transcription factor, VP16 or VP64 (4 repeats of VP16)-part of Herpes simplex virus and/or VPR activation domain, assembled p65, VP64 and Rta activator from Epstain-Barr virus.

The term“repressor domain”, as used herein, relates to a part of a transcription factor that in complex with a DNA binding domain blocks the recruitment of RNA polymerase in order to suppress the transcription of certain genes. The repressor domain, as used herein, relates, in particular, to the Kruppel-associated box or the KRAB-domain and its analogs. The repressor domain usually belongs to Zinc finger protein based transcription factors.

The term“heterodimerization system”, as used herein, refers to a pair of protein domains or protein partners that connect in the presence of an inductor or a signal for dimerization. The term "heterodimerization", as used herein, refers to protein domains that connect to other domains of a different type through covalent or non-covalent interactions. The term "constitutive dimerization domains", as used herein, refers to dimerization domains that connect themselves independently, such as, for example, coiled coils. The term "inducible heterodimerization domain", as used herein, refers to heterodimerization domains that merge only in the presence of a heterodimerization inductor.

The term "heterodimerization inductor" refers to a signal, a chemical ligand, which cause the heterodimerization of protein domains that do not have intrinsic affinity with each other and can not be connected independently in the absence of a heterodimedimerization ligand or signal. A heterodimerization inductor according to the invention can be a small molecule, such as rapalog, abscisic acid, or gibberellin.

The term“chemical ligand”, as used herein, refers to a small molecule, such as rapamycin and its rapalogs that can bind to proteins, preferably to FKBP-FRB heterodimerization domains; to plant hormones, such as abscisic acid and giberellin that can bind to proteins, preferably to ABI-PYL1 and GID-GAI1 heterodimerization domains.

The term "signalling" used herein refers to one or more events in a cell that occur after heterodimerization domains assemble a functional engineered NFAT transcription factor, which binds to specific DNA sequence and alter gene expression.

The term“orthogonal”, as used herein, refers to the characteristic of the components of the engineered transcription factor to take place separately, i.e., that the individual parts of different heterodimerization systems do not interact with parts of other heterodimerization systems of endogenous or exogenous signalling pathways. The main feature of the orthogonal transcription factor is that the input signal of each system leads to the heterodimerization independently of the presence or absence of other systems or their input and output signals.

The term“cell”, as used herein, refers to an eukaryotic cell, a cellular or multicellular organism (cell line) cultured as a single cell entity that has been used as a recipient of nucleic acids and includes the daughter cells of the original cell that has been genetically modified by the inclusion of nucleic acids. The term refers primarily to cells of higher developed eukaryotic organisms, preferably vertebrates, preferably mammals.

The term“cells” also refers to human cell lines and plant cells. Naturally, the descendants of one cell are not necessarily completely identical to the parents in morphological form and its DNA complement, due to the consequences of natural, random or planned mutations. A "genetically modified host cell" (also "recombinant host cell") is a host cell into which the nucleic acid has been introduced. The eukaryotic genetically modified host cell is formed in such a way that a suitable nucleic acid or recombinant nucleic acid is introduced into the appropriate eukaryotic host cell. The invention hereafter includes host cells and organisms that contain a nucleic acid according to the invention (transient or stable) bearing the operon record according to the invention. Suitable host cells are known in the field and include eukaryotic cells. It is known that proteins can be expressed in cells of the following organisms: human, rodent, cattle, pork, poultry, rabbits and the like. Host cells may include cultured cell lines of primary or immortalized cell lines.

The term“T cell”, as used herein, relates to lymphocytes, theT-subset of white blood cells, a specific mononuclear immune cell population that interacts in the adaptive immune system by recognizing antigen peptides bound to major histocompatibility complex molecules with a T cell receptor. Recognition of antigen peptides via a TCR activates signaling pathways, which result in cytokine signaling and a cytotoxic effect. The term“immune system”, as used herein, relates to an organ system in higher developed organisms composed out of specific cell subtypes, which act in order to eliminate foreign molecules from the organism.

The term“CAR T cells”, as used herein, relates to all T cells that bear a coding sequence for CAR expression, and preferably, can have anticancer therapeuthic effect. The term“CAR”, as used herein, refers to“chimeric antigen receptor” that is transiently or stabilly expressed in T cells. CAR is a recombinant receptor, composed of the extracellular recognition domain, transmembrane domain and cytosolic activation domains that is localized at the T cell plasma membrane capable of recognizing tumor specific surface molecules independently of MHC and

is used in cancer therapy. Upon specific recognition of the tumor surface molecules it triggers activation of a T cell. Recognition of specific Ag by CARs and T cell activation results in sequential killing of the tumor cells.

The term “nucleic acids”, as used herein, refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length and is not limited to single, double or higher chains of DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers with a phosphorothioate polymer backbone made from purine and pyrimidine bases or other natural, chemical or biochemically modified, synthetic or derived nucleotide bases.

The term“protein”, as used herein, refers to the polymeric form of amino acids of any length, which expresses any function, for instance localizing to a specific location, localizing to specific DNA sequence, facilitating and triggering chemical reactions, transcription regulation.

The term "recombinant", as used herein, means that a particular nucleic acid (DNA or RNA) is a product of various combinations of cloning, restriction and / or ligation leading to a construct having structurally coding or non-coding sequences different from endogenous nucleic acids in a natural host system.

The insertion of the vectors into the host cells is carried out by conventional methods known from the field of science, and the methods relate to transformation or transfection and include: chemically induced insertion, electroporation, micro-injection, DNA lipofection, cellular sonication, gene bombardment, viral DNA input, as well as other methods. The entry of DNA may be of transient or stable. Transient refers to the insertion of a DNA with a vector that does not incorporate the DNA of the invention into the cell genome. A stable insertion is achieved by incorporating DNA of the invention into the host genome. The insertion of the DNA of the invention, in particular for the preparation of a host organism having stably incorporated a nucleic acid, e.g. a DNA, of the invention, can be screened by the presence of markers. The DNA sequence for markers refers to resistance to antibiotics or chemicals and may be included on a DNA vector of the invention or on a separate vector.

DETAILED DESCRIPTION OF THE INVENTION

The invention relates to an engineered externally regulated artificial transcription regulatory system and an engineered NFAT transcription factor (TF) that is made of a combination of two or more orthogonal protein partners of different heterodimerization (HD) systems, connected with an engineered NFAT and different activation and/or repressor DNA domains that reconstitute upon addition of a chemical inductor of heterodimerization. Functional NFAT TF

influences the transcription of NFAT-driven genes and, subsequently, the T cell/CAR T cell activation and/or proliferation state. Chemical control over the activation and/or proliferation state of T cell/CAR T cells of this invention presents a novel way of controlling and regulating T cell/CAR T cell function in cancer therapy.

The engineered externally regulated artificial transcription regulatory system and the engineered NFAT transcription factors that can be used for the controllable regulation of T cells/CAR T cells according to the invention can comprise the features listed below.

The invention provides an engineered externally regulated artificial transcription regulatory system comprising two components: a) a first component comprising an NFAT protein lacking its own transactivation domain, fused with at least one first protein domain of a chemical signal-inducible heterodimerization protein complex, and b) a second component comprising a gene transcription activation or repressor domain, fused to a second protein domain that binds to the at least one first protein domain of the chemical signal-inducible heterodimerization protein complex.

The invention further provides an engineered NFAT transcription factor comprising the a) first component and the b) second component of the engineered externally regulated artificial transcription regulatory system according to the invention. The engineered NFAT transcription factor can comprise a sequence for binding to endogenous NFAT binding DNA sites.

The at least one first protein domain of the first component can be a single protein partner of a selected chemically inducible heterodimerization system (e.g. ABI-PYL1 , FKBP-FRB or DmrC-DmrA, GAI-GID1) that is genetically fused to a truncated NFAT that has a deletion of its own DNA transactivation domain; for example: ABI or FKBP or GAI can be connected to a truncated NFAT protein (e.g. NFAT1 , NFAT2, NFAT4, NFAT5). The first component can also comprise more than one first protein, e.g. two first proteins, such as FKBP and ABI.

The second protein domain of the second component can be a second protein partner of a selected heterodimerization system (e.g. ABI-PYL1 , FKBP-FRB or DmrC-DmrA, GAI-GID1) that is genetically fused to a transcriptional activation domain (e.g. p65, VP16, VP64, VPR or an activation domain of NFAT belonging to a REL-Family) or to a repressor domain (e.g. KRAB); for example PYL1 or FRB or GID1 can be genetically fused to VPR or KRAB.

Addition of a chemical inductor of heterodimerization (HD) can trigger heterodimerization of the first component and the second component by heterodimerization of two protein partners

(i.e. the at least one protein domain and the second protein domain) of the regulatory system or of the engineered NFAT transcription factor according to the invention, thereby resulting in a functional engineered NFAT-based transcription factor, which can influence the regulation of the transcription of NFAT dependent genes.

A chemical inductor for triggering heterodimerization of the at least one first protein domain of the a) first component and the second protein domain of the b) second component of the regulatory system or of the engineered NFAT transcription factor according to the invention can be, e.g. rapalog (e.g. rapamycin) for triggering heterodimerization of a FKBP-FRB HD system (the at least one first protein domain is FKBP, the second protein domain is FRB), abscisic acid for triggering heterodimerization of a ABI-PYL1 HD system (the at least one first protein domain is ABI, the second protein domain is PYL1), gibberellin for triggering heterodimerization of a GID-GA1 HD system (the at least one first protein domain is GID, the second protein domain is GA1) or any other relevant physiological chemical signal.

In one embodiment of the invention, the second component of the regulatory system or of the engineered NFAT transcription factor according to the invention can be a repressor domain. Following heterodimerization with a suitable first component, an engineered NFAT transcription factor can be formed that can effect downregulation of NFAT-dependent genes in overactivated T cells. Such an engineered NFAT transcription factor that downregulates NFAT-dependent genes can comprise NFAT-ABI as the first component and PYL1 -KRAB as the second component that form a heterodimer upon addition of abscisic acid as the chemical inductor (see, e.g. Fig.1 A, embodiment on the right).

In a further embodiment of the invention, the second component of the regulatory system or of the engineered NFAT transcription factor according to the invention is missing so that the regulatory system or the engineered NFAT transcription factor only comprises the first component, which comprises an NFAT protein lacking its own transactivation domain (a truncated NFAT). In this embodiment, downregulation of NFAT-dependent genes can result from the truncated NFAT in T cells/CAR T cells in the absence of a chemical inductor, wherein exogenous truncated NFAT competes for DNA binding sites with endogenous NFAT (see, e.g. Fig. 1 B).

In a further embodiment of the invention, the second component of the regulatory system or of the engineered NFAT transcription factor according to the invention can be a gene transcription activation domain. Following heterodimerization with a suitable first component, an engineered NFAT transcription factor can be formed that can effect upregulation of NFAT-dependent genes. Such an engineered NFAT transcription factor that upregulates NFAT-dependent genes can comprise NFAT-FKBP as the first component and FRB-VPR as the second component that form a heterodimer upon addition of rapalog as the chemical inductor (see, e.g. Fig.1 A, embodiment on the left). Such an engineered NFAT transcription factor can drive activation and/or proliferation of cells, such as T cells or CAR T cells that contain the upregulating engineered NFAT-based transcription factor.

In a further embodiment, the regulatory system or the engineered NFAT transcription factor according to the invention comprises a first component comprising more than one first protein domain, e.g. two or three first protein domains. In this embodiment, orthogonal pairs of engineered NFAT transcription factors, which result from connecting a truncated NFAT protein lacking its own transactivation domain with two first protein domains, i.e. protein partners from different HD systems, i.e. two different first protein domains of a chemical signal-inducible HD protein complex, thereby resulting in simultaneous triggering of heterodimerization in response to two different chemical signals generated by two different chemical inductors, Such a regulatory system or engineered NFAT transcription factor can comprise two first protein domains, e.g. ABI and FKBP, or ABI and GAI, or GAI and FKBP, in which both of these two first protein domains are fused to the truncated NFAT at the N-terminus and the C- terminus, respectively. When introducing the appropriate protein partner of the HD system (i.e. the second protein domain of the second component), connected with a repressor and/or an activator domain, it will form a heterodimer with the respective first protein domain on the truncated NFAT protein in response to applying the appropriate chemical inductor for inducing heterodimerization. Depending on the nature of the chemical inductor added, upregulation and/or downregulation of NFAT dependent genes can be achieved. Thus, a truncated NFAT comprising two first protein domains, e.g. ABI and FKBP, or ABI and GAI, or GAI and FKBP, can be regulated independently by two different chemical inducers of heterodimerization. So, e.g. the addition of rapalog as the chemical inductor will induce heterodimerization of NFAT-FKBP with FRB-VPR, thereby causing upregulation of expression of NFAT-controlled genes, whereas the addition of abscisic acid as the chemical inductor will induce heterodimerization of NFAT-ABI with PYL1-KRAB, thereby causing downregulation of expression of NFAT-controlled genes. In such a system, the truncated NFAT comprising two different first protein domains can be pushed in either direction, i.e. upregulation or downregulation, depending on what chemical inductor is added (see Fig. 1 A).

In a further embodiment, the regulatory system or the engineered NFAT transcription factor according to the invention comprises several repeats of the at least one first protein domain and/or the second protein domain, e.g. 10 repeats of a coiled coil. In this embodiment, the upregulation and/or downregulation of NFAT-dependent genes can be enhanced. Several repeats (for example 10 repeats of coiled coil) of the at least one first protein domain can then bind to several repeats (for example 10 repeats of coiled coil) of the second protein domain, which is fused to a transcriptional activator and/or repressor domain. The first component comprising the at least one first protein domain having several repeats then heterodimerizes with the second component comprising the second protein domain having several repeats after the appropriate chemical inductor is added. In this embodiment, the repeats can act as constitutive dimerization domains that assemble upon the heterodimerization signal by the chemical inductor as orthogonal coiled coil pairs.

In a further embodiment, in the engineered externally regulated artificial transcription regulatory system or the engineered NFAT transcription factor, the at least one first protein domain of the chemical signal-inducible heterodimerization protein complex of the first component is selected from the group consisting of the pairs:

i) FKBP and FRB;

ii) FKBP and calcineurin catalytic subunit A (CnA);

iii) FKBP and cyclophilin;

iv) Homodimer gyrase B (GyrB);

v) DmrA and DmrC;

vi) ABI and PYL1 ; and

vii) GAI and GID1 , and

the second protein domain of the second component is selected from the group consisting of the pairs:

i) FKBP and FRB;

ii) FKBP and calcineurin catalytic subunit A (CnA);

iii) FKBP and cyclophilin;

iv) Homodimer gyrase B (GyrB);

v) DmrA and DmrC;

vi) ABI and PYL1 ; and

vii) GAI and GID1.

If in the aforementioned embodiment one protein domain of the pairs of protein domains listed is used as a fusion partner in the first component, the second protein domain of the respective pair is used in the second component. For example, if FKBP is used as the at least one first protein domain of the first component, then FRB is used as the second protein domain of the second component. In a further example, if ABI is used as the at least one first protein domain of the first component, then PYL1 is used as the second protein domain of the second component.

In a further embodiment, in the engineered externally regulated artificial transcription regulatory system or the engineered NFAT transcription factor, the at least one first protein domain of the chemical signal-inducible heterodimerization protein complex of the first component is selected from the group consisting of the pairs:

i) FKBP and FRB;

ii) FKBP and calcineurin catalytic subunit A (CnA);

iii) FKBP and cyclophilin;

iv) Homodimer gyrase B (GyrB);

v) ABI and PYL1 ; and

vi) GAI and GID1 , and

the second protein domain of the second component is selected from the group consisting of the pairs:

i) FKBP and FRB;

ii) FKBP and calcineurin catalytic subunit A (CnA);

iii) FKBP and cyclophilin;

iv) Homodimer gyrase B (GyrB);

v) ABI and PYL1 ; and

vi) GAI and GID1.

If in the aforementioned embodiment one protein domain of the pairs of protein domains listed is used as a fusion partner in the first component, the second protein domain of the respective pair is used in the second component. For example, if FKBP is used as the at least one first protein domain of the first component, then FRB is used as the second protein domain of the second component. In a further example, if ABI is used as the at least one first protein domain of the first component, then PYL1 is used as the second protein domain of the second component.

The gene transcription activation domain of the second component of the regulatory system or the NFAT transcription factor according to the invention can comprise the VP16, VP64, VPR, p65, or a NFAT transactivation domain or other gene transcription activation domains that recruit components of an RNA polymerase complex to effect transcription of NFAT-targeted genes.

The regulatory system or the NFAT transcription factor according to the invention can further comprise a chemical inductor of heterodimerization capable of inducing functional reconstitution of the regulatory system or of the engineered NFAT transcription factor.

In a further embodiment of the invention, the at least one first protein domain and the second protein domain of the regulatory system or the NFAT transcription factor can be from two different proteins and can have orthologous properties.

In a further embodiment of the invention, the regulatory system or the NFAT transcription factor comprises two different chemical inductors of heterodimerization resulting in two different orthologous NFAT transcription factors.

In another embodiment of the invention, the first and second component form a heterodimer in the presence of a chemical inductor of heterodimerization to form the chemical signal-inducible heterodimerization protein complex. The chemical inductor can be a small molecule, such as a rapalog, abscisic acid or gibberellin.

The second component of the regulatory system or the NFAT transcription factor according to the invention can comprise a gene transcription activation domain, which enhances gene transcription of NFAT-dependent genes.

In a further embodiment of the invention, the second component of the regulatory system or the NFAT transcription factor comprises a gene transcription repressor domain, which downregulates gene transcription of NFAT-dependent genes. In this embodiment, the regulatory system or the NFAT transcription factor preferably functions ex vivo in T cells, T cell lines and/or CAR T cells.

In a further embodiment of the invention, the regulatory system or the NFAT transcription factor does not comprise the second component, and the first component of the regulatory system or the NFAT transcription factor binds to NFAT DNA binding sites and competes with endogenous NFAT protein, thereby resulting in decreased endogenous NFAT signaling.

In yet another embodiment of the invention, the second component comprises a repressor domain, and the binding of the regulatory system or the NFAT transcription factor decreases gene transcription of NFAT-dependent genes, thereby resulting in decreased activation and proliferation of cells.

In a preferred embodiment of the invention, the regulatory system or the NFAT transcription factor comprises FKBP-FRB, p65 and KRAB.

The invention further provides an isolated nucleic acid comprising a nucleic acid encoding a) the first component and/or b) the second component of the regulatory system or of the NFAT transcription factor according to the invention.

The invention further provides a vector encoding the isolated nucleic acids of the invention.

In particular, the invention provides isolated nucleic acid sequences comprising or consisting of SEQ ID NOs: 1 -13, as per the enclosed sequence listing. The invention further provides vectors comprising isolated nucleic acid sequences comprising or consisting of SEQ ID NOs: 1-13, as per the enclosed sequence listing.

The invention further provides a cell comprising the regulatory system, or the NFAT transcription factor, or the isolated nucleic acid(s), or the vector according to the invention.

The cell according to the invention can be a T cell, preferably a CAR T cell.

The invention further provides the regulatory system, or the NFAT transcription factor, or the isolated nucleic acid(s), or the vector, or the cell(s) according to the invention for use as a medicament. Preferably, the cells for use as a medicament are CAR T cells.

The invention further provides the regulatory system, or the NFAT transcription factor, or the isolated nucleic(s), or the vector, or the cell(s) according to the invention for use in a method of treating cancer. In one embodiment of the invention, the aforementioned use comprises the use of a chemical inductor of heterodimerization. Preferably, the cells for use in a method of treating cancer are CAR T cells. Preferably, the types of cancer to be treated according to the aforementioned use according to the invention include B-cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, Hodgkins and Non-Hodgkins Lymphomas, mezotelioma, ovarian cancer and prostate cancer.

In a preferred embodiment, the CAR T cells according to the invention are negatively regulated by the regulatory system or by the NFAT transcription factor according to the invention. In a further embodiment of the invention, the CAR T cells are positively regulated by the regulatory system or by the NFAT transcription factor according to the invention.

In a further embodiment, the regulatory system or the engineered NFAT transcription factor according to the invention comprises only human sequences. In this case, the sequences of the first component and of the second component are human sequences. When the regulatory system or the engineered NFAT transcription factor only comprising human sequences is used as a medicament or is used in a method of treating cancer according to the invention, the absence of any non-human sequences provides the advantageous technical effect of avoiding the generation of an immune response against the regulatory system or the the engineered NFAT transcription factor. In this embodiment, T cells or CAR T cells that comprise the regulatory system or the engineered NFAT transcription factor comprising only human sequences and that are used as a medicament or in a method of treating cancer do not elicit an immune response in the patient that is treated, thereby avoiding any neutralizing antibody production against the components of the regulatory system or the engineered NFAT transcription factor, respectively. For example, the regulatory system or the engineered NFAT transcription factor can comprise FRBP and FKBP protein partners and the transcriptional activation domain p65 and/or the DNA repressor domain KRAB and its variants, wherein all these components are human sequences.

The invention further provides a method for upregulating NFAT-dependent genes comprising the following steps: a) transforming a cell with a nucleic acid encoding the first component and a nucleic acid encoding the second component of the regulatory system of claims 1 and 3-12, or the NFAT transcription factor of claims 2-12, and b) inducing heterodimerization by adding a suitable chemical inductor.

In a preferred embodiment, the method for upregulating NFAT-dependent genes according to the invention induces heterodimerization of NFAT-FKBP as the first component and FRB-VPR as the the second component by adding rapalog (e.g. rapamycin) as the chemical inductor to provide an activating engineered NFAT transcription factor, which upregulates expression of NFAT-dependent genes.

The invention further provides a method for downregulating NFAT-dependent genes comprising the following steps: a) transforming a cell with a nucleic acid encoding the first

component and a nucleic acid encoding the second component of the regulatory system of claims 1 and 3-12, or the NFAT transcription factor of claims 2-12, and b) inducing heterodimerization by adding a suitable chemical inductor.

In a preferred embodiment, the method for downregulating NFAT-dependent genes according to the invention induces heterodimerization of NFAT-ABI as the first component and PYL1-KRAB as the the second component by adding abscisic acid as the chemical inductor to provide a downregulating engineered NFAT transcription factor, which downregulates expression of NFAT-dependent genes.

In a further embodiment of the invention, the method for upregulating NFAT-dependent genes and the method for downregulating NFAT-dependent genes can be performed with a first component comprising an NFAT protein lacking its own transactivation domain, fused with two first protein domains, preferably FKBP and ABI, of a chemical inducible heterodimerization complex. Addition of rapalog (e.g. rapamycin) as the chemical inductor can then to provide an activating engineered NFAT transcription factor, which upregulates expression of NFAT-dependent genes. Alternatively, the addition abscisic acid as the chemical inductor can provide a downregulating engineered NFAT transcription factor, which downregulates expression of NFAT-dependent genes.

The examples described in more detail below are designed to best describe the invention. These examples do not limit the scope of the invention, but are merely intended to provide a better understanding of the invention and its use.

Example 1 : Preparation of cells, which feature a signaling pathway mediated by the engineered chemically-regulated NFAT transcription factor

Preparation of DN A coding for engineered NFAT transcription factors and their targets. In order to prepare DNA constructs, the inventors used molecular biology methods such as: chemical transformation of competent E. coli cells, plasmid DNA isolation, polymerase chain reaction (PCR), reverse transcription - PCR, PCR linking, nucleic acid concentration determination, DNA agarose gel electrophoresis, isolation of fragments of DNA from agarose gels, chemical synthesis of DNA, DNA restriction with restriction enzymes, cutting of plasmid vectors, ligation of DNA fragments, purification of plasmid DNA in large quantities. The exact course of experimental techniques and methods are well known to experts in the field and are described in the manuals of molecular biology.

All the work was performed using sterile techniques, which are also well known to the experts in the field. All plasmids, completed constructs and partial constructs were transformed into the bacteria Escherichia coli by chemical transformation. Plasmids for transfection into cell lines (animal or human) have been isolated using a DNA isolation kit that removes endotoxins.

In the described cases, the NFAT2 was selected from the NFAT family of transcription factors. A truncated form of NFAT2 was prepared by remowing the NFAT2 transactivation domain. The tNFAT was connected via a peptide linker with different protein domains of different heterodimerization systems. ABI from abscisic (ABA)-inducible HD system or GAI from gibberellin-inducible systems or FKBP from a rapamycin and rapalog inducible HD system was connected at the N-terminus of tNFAT2. The appropriate protein partners of the HD systems, e.g FRB from from rapamycin and rapalog inducible HD system or GID1 from the giberellin-inducible HD system or PYL1 from the ABA-inducible HD system was connected to the N-terminus of Transcriptional activation or repressor domains. For otrthogonal engineered NFAT transcription factors two protein heteromdimerization domains were connected to tNFAT2, one at the N-terminus, the other one at the C- terminus. The respective DNA constructs are depicted in Figure 2.

The sequences of engineered NFAT transcription factors and components according to the invention are listed in Table 1. All operons were prepared by techniques according to methods known to experts in the field. The operons were inserted into plasmids suitable for eukaryotic systems. The suitability of the nucleotide sequence was confirmed by the inventors by sequencing and restriction analysis.

Table 1 : Fusion proteins of components of exemplary artificial engineered NFAT2 transcription factors.



Methods and techniques of cultivating cell cultures are well known to experts in the field and are therefore briefly described in order to illustrate the implemented examples. Cells from the HEK293T cell line were grown at 37 ° C and 5% C02. For cultivation, a DMEM medium containing 10% FBS was used, containing all the necessary nutrients and growth factors. Cells Jurkat were grown in RPMI medium containing 10% FBS at 37 ° C and 5% CO2. When the cell culture reached the appropriate density, the cells were grafted into a new breeding flask and / or diluted. For the use of cells in experiments, the number of cells was determined by a hemocytometer and seeded in density 2.5x104 per hole into the microtiter plate with 96 holes 18-24 hours before transfection regarding HEK293 cells. The seeded plates were incubated at 37 0 C and 5% C02 until the cells were 50-70% confluent and ready for transfection by transfection reagent. The transfection was carried out according to the instructions of the transfection reagent manufacturer (e.g., JetPei, Lipofectamine 2000) and was adapted for the microtiter plate used. Jurkat cells (3x106) were electroporated with the use of Neon electroporation system in 100 mI electroporation tips. Afterwards the cells were put in RPMI medium, containg 10% FBS in a well of 12 well plate. On the next day the inductor for heterodimerization and TCR signaling activator were added.

Example 2. Activity of engineered NFAT transcription factor in model mammalian cells at stimulation with various inductors for heterodimerization systems

To detect the activity of engineered NFAT transcription factor firefly (Flue) luciferase reporter was used. Firefly, used as a reporter protein, was placed downstream of three consecutive identical NFAT binding DNA sequence ( ggaggaaaaactgtttcatacagaaggcgt ), which is derived from the IL2 promoter, followed by a minimal promoter with a DNA sequence tagagggtatataatggaagctcgacttccag.

HEK293T cells, seeded in 96-well plates, were transfected one day prior to the experiment with plasmids, which encode for one of the examined engineered NFAT transcription factors (a plasmid for encoding NFAT connected with a protein partner of an HD system and a separate plasmid that encodes the Transcriptional activation and/or repressor domain connected with a protein partner of an HD system); plasmids that encode the previously described luciferase as a reporter protein and plasmid that encodes for luciferase from organism Renilla reniformis Rluc (GenBank AF362545.1). Cells were stimulated on the next day by addition of the Ca-ionophore A23187 (Sigma) to an end concentration 5mM and the appropriate heterodimerization system inductor; rapamycin to an end concentration of 1 mM, abscisic acid to an end concentration 100 mM and giberellin to an end concentration 10 mM one day prior to measurement of activity.

To analyze the activity of reporter proteins, cells were lysed with appropriate buffer according to instructions provided by the manufacturers (Promega). We measured the activity of Flue and Rluc respectively. Rluc was expressed independently of all other components in our system and therefore provided the information of the fraction of transfected cells. Flue presented the activity of induced transcription of Flue by binding the engineered NFAT TF to NFAT DNA binding sites in front if the minimal promoter. Ratio Fluc/Rluc (RLU - relative luciferase units) therefore was indicative of the normalized value of stimulated cells with respect to transfected cells.

Results:

It is clear from Figure 3 that the addition of gibberellic acid or gibberellin influenced the reconstitution of the engineered NFAT transcription factor by promoting heterodimerization of GAI and GID1 protein partners of the HD system and inducing high activation only in case of T cell activation and the addition of a chemical inducer. The assembly of protein partners of the HD system GAI connected with tNFAT2 and GID1 connected with the Transcriptional activator VPR lead to a reconstitution of a functional engineered NFAT transcription factor. NFAT TF then bound to three NFAT DNA binding sites, thereby enhancing the transcription of Flue production. This action took place only in the presence of Ca-ionophore that increases the intracellular calcium which is needed for NFAT signaling. The presence of only tNFAT2, connected to GAI protein and lacking the transcription activation domain did not enhance reportrer protein expression and production.

Figure 4 indicates that the addition of rapamycin influenced the reconstitution of the engineered NFAT transcription factor by promoting the heterodimerization of FKBP (DmrA) and FRB (DmrC) protein partners of the HD system. The assembly of protein partners of the HD system FKBP connected with tNFAT2 and FRB connected with the Transcriptional activator VPR leads to a reconstitution of a functional engineered NFAT transcription factor. NFAT TF then binds to three NFAT DNA binding sites, thereby enhancing the transcription of Flue production. This action took place only in the presence of a Ca-ionophore A23187 (Sigma) that increased the concentration of intracellular calcium ions, which was needed to trigger NFAT signaling. The presence of only tNFAT2, connected to FKBP protein and lacking the Transcriptional activation domain did not enhance reportrer protein expression and production.

Figure 5 demonstrates the effect of ABA-induced reconstituted engineered NFAT TF. The addition of abscisic acid promoted heterodimerization of ABI-tNFAT2 and PYL1-VPR protein partners resulting in a functional engineered NFAT TF, which by binding to a DNA sequence in the reporter plasmid promoted Flue expression. This action took place only in the presence of a Ca-ionophore A23187 (Sigma) that increased the intracellular calcium which was needed for NFAT signaling. The presence of only tNFAT2, connected to ABI protein and lacking the transcriptional activation domain VPR did not enhance reporter protein expression and production, thereby demonstrating that heterodimerization of protein partners occurs in the presence of an inductor of heterodimerization. Figure 5A clearly states the action of an engineered NFAT TF in the range of various DNA concentrations of transfected plasmids.

Example 3. Activity of an engineered NFAT transcription factor in a T cell line by stimulation with various inductors for heterodimerization systems

The Jurkat T cell line was used to determine the activity of an engineered NFAT transcription factor on a transcriptional regulation of a key cytokine for T cells, IL2. Secreted IL2 from stimulated cells is triggered by the engineered tNFAT2 TF binding to IL2 promoter.

To determine the capability of an engineered tNFAT2 TF, Jurkat cells were electroporated with plasmids, encoding the components of an engineered NFAT transcription factor, connected with protein partners of different HD systems. On the next day the appropriate inductor of heterodimerization was separately added to Jurkat cells; rapamycin at an end concentration of 1 mM, abscisic acid at an end concentration of 100 pM and giberellin at an end concentration of 10 pM one day prior to measurement of activity. The activity of the engineered tNFAT2 TF was

determined by human IL2 cytokine measurement in the cell supernatant with an ELISA (Invitrogen) according to the manufacturer’s instrutions. We measured the concentration of secreted IL2. The concentration was determined based on measured adsorbance values and calculated considering the calibration curve, obtained from dilution of the recombinant human IL2 protein that served as a standard.

Result:

Figure 6 indicates that, in the presence of ABA, for the inducible engineered NFAT2 transcription factor the values of human IL2 increased compared to the values arising from non inducible samples. This confirms that upon the addition of ABA, IL2 was secreted due to tNFAT2 driven transcriptional regulation, which demonstrated that tNFAT2i-593 chemically coupled to the activation domain is able to trigger transcription of this key cytokine, while in natural cells it has been proposed that the cooperation between NFAT and AP-1 is required to upregulate the transcription of this gene. The presence of only tNFAT2, connected to the ABI protein and lacking the Transcriptional activation domain VPR did not enhance reporter protein expression and production demonstrating that heterodimerization of protein partners occurs in the presence of an inductor of heterodimerization.

Figure 7 demonstrates that the chemically-inducable heterodimerization systems coupled to tNFAT2 are functional in the T cell line. The enhancement of IL2 secretion was observed only in the presence of the appropriate chemical inductor of the HD systems. Rapamycin promoted heterodimerization of FKBP-tNFAT2 and FRB-VPR, gibberellin promoted heterodimerization of GAI-tNFAT2 and GID1 -VPR and abscisic acid promoted heterodimerization of ABI-tNFAT2 and PYL1-VPR. Proper reconstitution of the components of the engineered NFAT TF resulted in IL2 promoter binding and subsequent human IL2 gene expression upregulation.

Example 4: Competition of an engineered NFAT transcription factor with endogenous NFAT in a T cell line

Engineered tNFAT2 TF composed of tNFAT2 geneticaly fused to a protein partner of an HD system lacking the endogenous transactivation domain can compete with natural endogenous NFAT TF for binding to the target DNA binding sites within the genome. This competition results in a negative regulation of NFAT signaling resulting in diminished IL2 synthesis and negative effect on T cell/CAR T cells activation and proliferation.

To experimentally determine the ability of negative regulation of engineered tNFAT2 on NFAT signaling for T cells/CAR T cells, Jurkat T cells were electroporated with plasmids encoding tNFAT2 connected to the ABI protein partner of the ABI-PYL1 HD system (wherein ABI stands

for“ABA Insensitive” and PYL1 stands for“abscisic acid receptor 1”). On the next day the cells were stimulated with anti CD3/CD28 dynabeads (Gibco), which activated TCR signaling or with a combination of anti CD3/CD28 dynabeads and phorbol 12-myristate 13-acetate (PMA) and with an inductor of heterodimerization. PMA acts as a transient stimulator for PKC (protein kinase type C) which increases the calcium concentration and subsequent NFAT signaling, resulting in enhanced IL2 production from T cells. On the next day, human IL2 was measured with an ELISA (Invitrogen) according to the manufacturer’s instructions. The concentration of secreted IL2 was determined based on the measured adsorbance values and calculated considering the calibration curve, obtained from dilution of the recombinant human IL2 protein that served as a standard. Result:

Figure 8 indicates that a decreased IL2 production was observed only when the cells, stimulated with anti CD3/CD28 dynabeads were electroporated with a plasmid encoding only the tNFAT2 connected to the protein partner of the HD system implicating that the presence of engineered tNFAT2 TF competed with endogenous NFAT for binding sites to the IL2 promoter. This determines that engineered tNFAT2 TF, comprising an NFAT DNA binding domain, acts as a negative regulator for NFAT signaling.

The same decrease in IL2 production was observed in Jurkat T cells, stimulated with a combination of anti CD3/CD28 dynabeads and PMA and electroporated with a plasmid encoding the tNFAT2 connected to the protein partner of the HD system, as depicted in Figure 9. This determines that engineered tNFAT2 TF, composed only of a DNA binding domain acts as a negative regulator for NFAT signaling even if strong NFAT signaling is activated with strong TCR activators.

Example 5: The presence of an engineered NFAT transcription factor enhances the endogenous NFAT-driven signaling pathway

Complete engineered tNFAT2 TF can enhance the already existing NFAT signaling resulting in increased IL2 synthesis and positive effect on T cell/CAR T cell activation and proliferation.

To determine the ability of enhancing regulation of engineered tNFAT2 on NFAT signaling for T cells/CAR T cells, Jurkat T cells were electroporated with plasmids encoding a complete engineered tNFAT2 TF. On the next day, the cells were stimulated with a combination of anti CD3/CD28 dynabeads and phorbol 12-myristate 13-acetate (PMA) and with an inductor of heterodimerization. On the next day, the human IL2 was measured with an ELISA (Invitrogen) according to the manufacturer’s instrutions. We measured the concentration of secreted IL2. The concentration was determined based on measured adsorbance values and calculated considering the calibration curve, obtained from dilution of the recombinant human IL2 protein that served as a standard.

Result:

Figure 10 indicates that an increased IL2 production was observed when the cells, stimulated with anti CD3/CD28 dynabeads and PMA were electroporated with a plasmid encoding the complete engineered tNFAT2 TF and stimulated with the appropriate inductor for heterodimerization of the protein partners of the HD system. This determines that engineered tNFAT2 TF enhances existing NFAT signaling, resulting in increased IL2 production and secretion.