In Bearbeitung

Bitte warten ...

Einstellungen

Einstellungen

Gehe zu Anmeldung

1. WO2003031648 - VERFAHREN ZUM NACHWEIS VON DNA-METHYLIERUNG MITTELS MARKIERTEN S-ADENOSYLMETHIONINANALOGA

Anmerkung: Text basiert auf automatischer optischer Zeichenerkennung (OCR). Verwenden Sie bitte aus rechtlichen Gründen die PDF-Version.

[ DE ]

Verfahren zum Nachweis von DNA-Methylierung mittels markierten S-Adenosylmethioninanaloga

Die vorliegende Erfindung betrifft ein Verfahren zum

Nachweis von DNA-Methylierung, insbesondere an Cytosin und Adenin, in DNA-Proben.

Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Ge-ne in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar . Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms.

5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryotischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR- Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.

Eine relativ neue und die mittlerweile am häufigsten an-gewandte Methode zur Untersuchung von DNA auf 5- Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, dass Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch „normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersu-chende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and im-proved method for bisulphate based cytosine methylation analysis. Nucleic Acids Res. 1996 DEC 15; 24 (2 ): 5064-6) . Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylie-rungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr kleinen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren.

Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Ü-bersichtsartikel entnommen werden: Rein T, DePamphilis ML, Zorbas H. Identifying 5-methylcytosine and related

Grigg G, Clark S. sequencing 5-methylcytosine residues in genomic DNA. Bioassays. 1994 Jun. ; 16 ( 6) : 431-6, 431;
Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Dörfler W. Imprinted segments in the human genome : different DNA methylation patterns in the Prader- Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet . 1997
Mar;6(3) :387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol fort bisulphate genomic sequencing. Nucleic Acids Res. 1994 Feb. 25; 22 ( ): 695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethyla-tion in the 5' region of the pS2 gene andin its expres-sion in human breast cancer cell lines. Gene. 1995 May

19;157 (1-2) :2βl-4; WO 97 46705, WO 95 15373 und WO 45560.

Ein weiteres bekanntes Verfahren ist die sogenannte me-thylierungssensitive PCR (Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. (1996), Methylation-specific

PCR: a novel PCR assay for methylation Status of CpG is-lands. Proc Natl Acad Sei U S A. Sep 3; 93 ( 18 ) : 9821-6) . Für dieses Verfahren werden Primer verwendet, die entweder nur an eine Sequenz hybridisieren, die durch die Bi-sulfit-Behandlung einer an der betreffenden Position un-methylierten DNA entsteht, oder aber umgekehrt Primer, welche nur an eine Nukleinsäure bindet, die durch die Bisulfit-Behandlung einer an der betreffenden Position un-methylierten DNA entsteht. Mit diesen Primern können dem-nach Amplifikate erzeugt werden, deren Detektion wiederum Hinweise auf das Vorliegen einer methylierten oder un-methylierten Position in der Probe liefern, an welche die Primer binden.

Ein neueres Verfahren ist auch der Nachweis von Cytosin-Methylierung mittels einer Taqman PCR, das als Methyl- Light bekannt geworden ist (WO 00/70090) . Mit diesem Verfahren ist es möglich, den Methylierungsstatus einzelner oder weniger Positionen direkt im Verlauf der PCR nachzuweisen, so dass sich eine nachfolgende Analyse der Pro-dukte erübrigt.

Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung lässt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Ge-netics Supplement, Volume 21, January 1999), der dort zitierten Literatur und dem US-Patent 5994065 über Methoden zur Herstellung von festen Trägern für Zielmoleküle wie Oligonucleotide bei vermindertem nichtspezifischen Hintergrundsignal entnehmen.

Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoresziert markierte Sonden verwendet worden. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5 ' -OH der jeweiligen Sonde. Die Detektion der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.

Matrix-assistierte Laser Desorptions/Ionisations- Massenspektro-metrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Ka-ras M, Hillenkamp F. Laser desorption ionization of pro-teins with molecular masses exceeding 10,000 daltons . A-nal Chem. 1988 Oct . 15; 60 (20) : 2299-301) . Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ih- rer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere.

MALDI-TOF Spektroskopie eignet sich ausgezeichnet zur A-nalyse von Peptiden und Proteinen. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut, I. G. und Beck, S. (1995), DNA and Matrix Assisted Laser Desorption Ioniza-tion Mass Spectrometry. Molecular Biology: Current Inno-vations and Future Trends 1: 147-157.) Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. In der MALDI-TOF Spektroskopie spielt die Wahl der Matrix eine eminent wichtige Rolle. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrices gefunden worden, die eine sehr feine Kristallisation ergeben. Für DNA gibt es zwar mittlerweile einige ansprechende Matrices, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, dass sie einem Peptid ähnlicher wird. Phosphorothioatnuklein-säuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut, I. G. und Beck, S. (1995), A procedu-re for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 23: 1367-1373). Die

Kopplung eines „Charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. Ein weiterer Vorteil von „Charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren.

Genomische DNA wird durch Standardmethoden aus DNA von Zeil-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis, Molecular Cloning: A Laboratory Manual, 1989.

Nach der Erfindung der PCR sind in den folgenden Jahren zahlreiche Varianten bekannt geworden, die diese Technik zur Amplifikation der DNA verfeinern. Insbesondere ist hier die Multiplexierung der PCR (Multiplex-PCR) zu erwähnen, wobei man mehr als 2 spezifische Primer einsetzt und dabei in einem Reaktionsgefäß eine Vielzahl von verschiedenen, spezifischen Amplifikationen erzeugen kann. Besonders interessant ist auch die sogenannte Nested PCR, welche unter anderem zum Nachweis besonders geringer DNA Mengen verwendet wird. Diese Art der PCR besteht aus zwei aufeinanderfolgenden Amplifikationen, wobei die Primer der zweiten Amplifikation innerhalb des ersten Amplifika-tes liegen und nicht mit den Primern der ersten Amplifi-kation identisch sind. Dadurch wird eine besondere Spezi-fität erreicht, da die Primer der zweiten Amplifikation nur dann funktionieren, wenn in der ersten Amplifikation das beabsichtigte Fragment erzeugt wurde. Dagegen ist die die Vermehrung etwaiger Nebenprodukte der ersten Amplifi-kation in der zweiten so gut wie ausgeschlossen.

Es sind demnach bislang vielerlei Verfahren zur Methylie-rungsanalyse Stand der Technik. Die vorliegende Erfindung soll jedoch eine Möglichkeit zur Analyse des Methylie-rungsgrades in einem genomischen DNA-Abschnitt bereitstellen. Dabei ist es bevorzugt nicht erforderlich, eine Polymerasereaktion durchzuführen, was die Durchführung des Verfahrens erleichtert. Es ist im Rahmen einer Methy-lierungsanalyse im Bereich der klinischen Diagnostik wesentlich, dass Untersuchungsergebnisse möglichst schnell zur Verfügung gestellt werden können und dass sich der experimentelle Aufwand in möglichst engen Grenzen hält. Dazu ist das hier beschriebene Verfahren in besonderem Masse geeignet.

Das hier beschriebene Verfahren zur Detektion von Cyto-sin-Methylierung besteht in der Kombination der folgenden Schritte:

Zuerst wird die genomische DNA Probe wahlweise mit einem Restriktionsenzym behandelt, so dass diese aus kleineren Fragmenten, bevorzugt in der Grössenordnung zwischen 2 kb und 80 kb besteht. Die DNA Probe wird daraufhin mit einem Bisulfit und einem Radikalfänger, der die Zersetzung der DNA verhindern soll, behandelt und die enstandenen Bisul-fitaddukte alkalisch hydrolysiert . Dabei werden alle methylierten Cytosine im wesentlichen unverändert bleiben, während die nicht methylierten Cytosinbasen in Uracil umgewandelt werden.
Nun kann durch Verwen
düng einer Methyltransferase im nächsten Schritt festgestellt werden, inwieweit diese Umsetzung an gegebenen Positionen stattgefunden hat. So ist es möglich, mit einer Methyltransferase Sssl, welche selektiv die Sequenz
5'CpG-3' methyliert, unter Verwendung eines modifizierten S-Adenosylmethioninderivats zu unterscheiden, ob sich nun an dieser Position nach wie vor ein Cytosin befindet oder ob es in Uracil umgewandelt wurde, da nur die aufmethy-lierten Positionen durch das modifizierte S-Adenosylmethioninderivat und beispielsweise Sssl fluoreszenzmarkiert werden können. Andere Enzyme sind sequenzse-zifischer als Sssl und daher kann man auch zusätzliche Schlüsse auf den Sequenzkontext ziehen. Da diese Positionen jedoch auch nach der Bisulfitbehandlung noch methy-liert vorliegen, muss zuvor eine Demethylierung erfolgen. Dies wird bevorzugt mittels einer Kopierreaktion oder a- ber einer PCR erreicht. Dies hat zudem den Vorteil, dass man genau weiß, welche Abschnitte der genomischen DNA Probe im folgenden auf Methylierung untersucht werden.

Das oben erwähnte modifizierte S-Adenosylmethioninderivat hat die Eigenschaft, das sonst als Methylgruppendonor fungierende S-Adenosylmethionin in der enzymatischen DNA-Methylierung derart zu ersetzen, dass die Methylgruppe durch ein entsprechendes fluoreszenzmarkiertes Analogon ersetzt ist. Die Methyltransferase überträgt also anstelle einer Methylgruppe ein entsprechend fluoreszenzmarkiertes Analogon.

Die erfindungsgemäß verwendbaren modifizierten S-Adenosylmethioninderivate sind in ans ich bekannter Weise herstellbar. Dabei werden derartige Derivate hergestellt, bei denen der Fluorophor an sich bekannt ist. Geeignete Fluoreszenz gebende Moleküle sind dem Fachmann geläufig. Diese Fluoreszenz gebenden Moleküle werden dann in geeig-neter Weise mit S-Adenosylmethionin verknüpft. Diese geschieht insbeondere in das Art, dass dabei Verbindungen entstehen, welche bei der Übertragung der Methylgruppen gleichzeitig die Fluoreszenz gebende Gruppe mit übertragen .

Nach einer PCR werden also die Amplifikate mit dem modifizierten S-Adenosylmethioninderivat und einer Methyltransferase sequenz-spezifisch fluoreszenzmarkiert, und zwar nur dann, wenn an den betreffenden Positionen zuvor eine Methylierung in der genomischen DNA Probe vorlag. Wird nun mit herkömmlichen Methoden wie (Kapillar) Gelelektrophorese, Chromatographie oder ähnlichen Verfahren eine Fragmentanalyse durchgeführt, so werden nur diejenigen Fragmente eine Fluoreszenzmarkierung tragen, die zuvor an der untersuchten Position methyliert vorlagen.

In einer besonders bevorzugten Variante des Verfahrens werden auf diese Art mehrere Fragmente gleichzeitig und besonders bevorzugt auch mehrere Positionen in diesen Fragmenten gleichzeitig auf Methylierung hin untersucht. Dies kann durch nacheinanderfolgende Markierung mit unterschiedlichen Farbstoffen an dem modifizierten S-Adenosylmethioninderivat in Verbindung mit unterschiedlichen sequenzspezifischen Methyltransferasen erfolgen.

Auch ist es möglich, in der PCR mit mehreren Primerpaaren gleichzeitig zu arbeiten und so eine Multiplex PCR auszuführen. Haben die dabei erzeugten Amplifikate verschiedene Längen, so ist eine gleichzeitige Analyse mittels einer der oben genannten Methoden möglich.

Eine weitere Möglichkeit der DNA-Methylierungsanalyse besteht in der Verwendung des modifizierten S-Adenosyl-methioninderivats zusammen mit einer Methyltransferase wie Dnmt 1, welche für hemimethylierte Doppelstränge spe-zifisch ist und zu den sogenannten Maintenance-Methyl-transferasen gehört. Bei diesem Verfahren macht man es sich zunutze, dass nach einer Kopierreaktion eines bestimmten Abschnittes der genomischen DNA-Probe selbiger Abschnitt an den Positionen hemimethyliert vorliegt, die in der genomischen DNA methyliert vorlagen, während die Positionen weiterhin unmethyliert vorliegen, welche vor der Kopierreaktion auch schon unmethyliert vorlagen. Das modifizierte S-Adenosylmethioninderivat in Verbindung mit Dnmtl wird demnach nur an den zuvor methyliert vorliegen-den Positionen selektiv eine Fluoreszenzmarkierung einbauen.

Diese kann nun mittels verschiedener Methoden sichtbar gemacht werden. Limitierend für diese Variante ist die fehlende exponentielle Amplifikation, welche die Verwendung von Dnmtl in diesem Sinne unmöglich machen würde.

Dnmtl kann jedoch auch in Verbindung mit dem modifizierten S-Adenosylmethioninderivat zum Nachweis unmethylier-ter Positionen in einem Pool von DNA Proben generell ein-gesetzt werden. Aus den doppelsträngigen DNA-Probenmolekülen werden dabei nach einem Schmelz- und Reannealingschritt Heteroduplexe gebildet. An den Positionen, an denen teilweise Methylierung vorlag, entstehen nach dem Reannealing hemimethylierte Doppelstränge, wel-ehe sich durch Dnmt 1 und modifizierte S- Adenosylmethioninderivate selektiv fluoreszenzmarkieren lassen. Dieses Verfahren kann zum einen zum Auffinden differentiell methylierter CpG Positionen verwendet werden. Zum anderen kann jedoch durch Beimischung unmethy-lierter DNA bevorzugt eine Fluoreszenzmarkierung dann erfolgen, wenn in einer Probe methylierte Positionen vorlagen. Zum anderen ist selektiv eine Fluoreszenzmarkierung von unmethylierter DNA möglich, wenn zuvor eine Beimischung einer aufmethylierten DNA Probe erfolgt.

Die für die vorstehenden Experimente erforderlichen methylierten und unmethylierten Standard-DNA Proben werden bevorzugt durch Aufmethylierung einer genomischen DNA-Probe mit Sssl erzeugt. Für unmethylierte DNA wird bevor-zugt DNA, welche aus peripherem Blut isoliert wurde, verwendet, die an den meisten zu untersuchenden Positionen unmethyliert vorliegt. Alternativ kann beispielsweise aus Spermien isolierte DNA verwendet werden.

Die fluoreszenzmarkierte genomische DNA kann wie oben beschrieben analysiert werden. Eine zusätzliche interessante Möglichkeit besteht darin, eine 2D Gelelektrophorese durchzuführen, bei welcher nun bei jedem Fragment zusätzlich Information über dessen Methylierungsstatus erhalten werden kann.

Eine weitere Verfahrensvariante besteht darin, dass modifizierte S-Adenosylmethioninderivate zur Übertragung von idealerweise fluoreszierenden Gruppen verwendet werden, welche eine nachfolgende Polymerasereaktion an dem so mo-difizierten DNA-Templat inhibieren. An den Positionen, an denen eine solche Gruppe eingebaut wurde, wird die Polymerasereaktion bevorzugt abbrechen. Dies ließe sich für die Durchführung einer Sequenzierreaktion, vergleichbar einer Sanger-Sequenzierung, nutzen, wobei in dieser Vari-ante jedoch nicht bestimmte Basenabfolgen, sondern untern den jeweils gewählten Bedingungen methylierbare Positionen aufgezeigt würden. Die jeweils methylierbaren Positionen bestimmen sich zum einen nach dem schon vorhandenen Methylierungsstatus des Templats und zum anderen nach der Sequenzspezifität der verwendeten Methyltransferase .

Das folgende Beispiel erläutert die Erfindung.

Beispiel :
Eine genomische DNA-Probe wurde mit dem Restriktionenzym

Mssl verdaut.
Für die Bisulfitreaktion wurde eine Natriumbisulfit- Lösung verwendet.
Die Desulfonierung erfolgte mit 50μl einer 50mM Tris-HCl-Lösung bei pH9 für 20 Minuten bei 96°C.
Die mit Bisulfit behandelte DNA wurde mit den Primeroli-gonukleotiden TAGGAAAAGGAGTTGGATTTTT (Seq-ID 1) und
CCCCCTACCTAACCTATAATCA (Seq-ID 2) des Gens DAXX amplifi-ziert .

Die Amplifikation wurde folgendermaßen durchgeführt:
95°C - 15 Min, 40 Zyklen: 94 °C - 1:00 Min, 55 °C - 0:45 Min, 72 °C - 1:30 Min und eine abschließende Verlängerung bei 72 °C - 10 Min.

In einer anschließenden Reaktion wurde fluoreszenzmarkiertes S-Adenosylmethioninderivat, welches mit analogen Verfahren in an sich bekannter Weise hergestellt wurde, als Methylgruppendonator für die Methylase Sss I (NEB) verwendet. Dafür wurden 500 ng DNA unter Verwendung von 0,5 units Sss I sowie dem S-Adenosylmethioninderivat und dem zugehörigen Reaktionspuffer laut Herstellerangaben für 8 Stunden bei 37 °C inkubiert.
Die durch die fluoreszenzmarkierten S-Adenosylmethionin-derivate markierten Cytosine wurden in einer Fragmentanalyse nachgewiesen.