PATENTSCOPE ist einige Stunden aus Wartungsgründen am Montag 03.02.2020 um 10:00 AM MEZ nicht verfügbar
Suche in nationalen und internationalen Patentsammlungen
Einige Inhalte dieser Anwendung sind derzeit nicht verfügbar.
Wenn diese Situation weiterhin besteht, kontaktieren Sie uns bitte unterFeedback&Kontakt
1. (KR1020130126680) 비-코딩 면역조절 DNA 구조체
Anmerkung: Text basiert auf automatischer optischer Zeichenerkennung (OCR). Verwenden Sie bitte aus rechtlichen Gründen die PDF-Version.
비-코딩 면역조절 DNA 구조체{NON-CODING IMMUNOMODULATORY DNA CONSTRUCT}
기 술 분 야
 본 발명은 핵산 분자, 및 면역계의 조절을 위한 그의 용도에 관한 것이다.
배경기술
 암,  전염성  질환,  알러지  및  천식과  같은  복잡한  질환과  싸우기  위해  새로이  대두되는  전략으로는,  환자의  면역계를  활용하는  것이  있다.    면역계  또는  그의  활성은  특이적  DNA  서열에  의해  조절될  수  있는  것으로  알려져  있다.    대부분의  알려진  면역변경(immunomodifying)  짧은  DNA  서열은,  크리그(Krieg)  등에  의해  기술되어  있는  비메틸화된  사이토신  구아닌  모티프(modif)(CG  모티프)를  함유한다(문헌  [Nature  1995  374:  6522  546-549]).    비메틸화된  CG  모티프의  발생은  원핵생물  또는  바이러스에  비해  진핵생물의  게놈에서는  실질적으로  억제되지  않는다.    따라서,  이러한  모티프를  포함하는  DNA  분자는  자연의  "위험  신호"로서  진화되어  왔으며,  원핵성  또는  바이러스성  병원균에  대항하는  싸움에서  면역계를  발동시킨다(trigger).    이는  비감염성  질환뿐만  아니라  감염성  질환을  치료  또는  예방하는  데  치료적으로  또는  예방적으로  활용될  수  있다.
 비메틸화된  CG  모티프를  포함하는  DNA  구조체는,  수지상  세포(dendritic  cell),  대식세포,  자연  살해(natural  killer)(NK)와  NKT  세포를  포함하는  선천적(innate)  면역계의  효과기(effector)  세포를  강하게  자극함으로써  상당한  생리적  효과를  유도할  수  있다.    비메틸화된  CG  모티프는  선천적  면역패턴  인식  수용기  Toll-유사  수용기(Toll-like  receptor)(TLR)  9에  의해  검출된다.    정확한  인식  메커니즘은  아직  완전히  이해되지  않지만,  근원적  경로를  밝혀내는  상당한  진전이  있어  왔다(크리그(A.  Krieg)의  문헌  [Nat.  Rev.  Drug  Disc.  5:471-484,  2006]).    이는,  상기  수용기에  대한,  비메틸화된  CG를  함유하는  DNA  구조체의  결합에  따라,  다수의  신호  단계(cascade)들이  반응  세포에서  활성화되는  것으로  간주된다.    특징적  표면  분자의  상향조절(upregulation)과  사이토카인(cytokine)의  분비에  의해,  주로  Th1  패턴을  갖는  적응적(adaptive)  면역이  유도된다.    이러한  구조체들은  예컨대  항체,  화학요법  또는  방사선  치료,  백신  또는  사이토카인과  조합하여  사용될  수  있다.    알러지  질환  및  천식은  주로  Th2-매개되어  있다.    Th1/Th2의  비율을  증가시킴으로써,  Th2-매개된  반응들이  감쇠되며,  이로  인해  이러한  유형의  질환이  치료  또는  예방될  수  있다.
 표면  분자들은  예를  들어  분석되는  특이적  세포  유형에  따라  CD40,  CD69,  CD80  또는  CD86을  포함한다.    또한,  사이토카인의  분비는  구별된  세포  유형에  대해  특성화되어  있으며;  사이토카인은  예컨대  대식세포  염증  단백질(MIP)-1α,  MIP-1β,  인터류킨(IL)-6,  IL-8,  인터페론(IFN)-α,  종양  괴사  인자(TNF)-α,  IFN-γ,  단핵구  화학주성  단백질(MCP)-1  또는  10  kDa의  IFN-γ  유도된  단백질(IP-10)을  포함한다.
 질환을  예방  또는  치료하기  위해,  매우  효과적인  접근으로서  예방접종(vaccination)이  입증되어  있다.    강하고  내구성이  있는  면역  반응을  확인하기  위해,  수지상  세포와  같은  항원-제공  세포를  자극할  수  있는  애주번트(adjuvant)는  일반적으로  항원과  함께  투여되며,  그  목적을  위해,  TLR9  작용제(agonist)는  강력한  면역촉진제인  것으로  제시되어  있다.
 비메틸화된  CG  모티프가  면역  반응에  대해  영향을  미치거나  또는  이를  조절하는  근원적  메커니즘의  설명들과는  별개로,  이러한  모티프를  사용함으로써  면역계의  조절을  위한  여러  접근들이  개발되어  있다.    WO  1998/018810에서는,  비메틸화된  CG  모티프를  함유하는  면역자극  서열이,  심지  이들이  단일가닥의  일부인  경우에  더욱  효과적임을  개시하고  있다.    그러나,  개방된  쇄의  단일가닥  DNA  분자를  투여하는  것은,  단일가닥  핵산의  빠른  분해로  인해  실행  불가능하다.    결론적으로,  비메틸화된  CG  모티프를  포함하는  단일-  또는  이중-가닥  DNA  구조체의  보호를  위한  여러  방법들이  개발되어  있다.
 DNA  핵산분해효소(nuclease)에  의한  분해에  대항하는  저항을  달성하기  위해,  핵산  중합체의  주쇄  내의  포스포디에스테르  결합들은  종종  포스포로티오에이트(phosphorothioate)로  변형된다.    이러한  포스포로티오에이트-보호된  핵산의  다소  적은  자극성  활성  이외에,  최근  수년  내의  임상  시도들에서는  포스포로티오에이트-보호의  독성이  약학  조성물  또는  약재에서의  임의의  용도로부터  이러한  핵산을  배제시키거나  또는  심각하게  제한하는  것으로  제시되었다.
 CG  모티프를  포함하는  DNA  서열을  보호하고자  하는  또  다른  접근이  예컨대    EP  1  196  178에  개시되어  있다.    이  문헌은,  CG  모티프를  포함하는  뉴클레오타이드  잔기의  부분적  단일가닥인  아령형의(dumbbell  shaped)  공유적으로  폐쇄된  서열을  포함하는  짧은  데옥시리보핵산  분자를  개시하고  있다("dSLIM").    EP  1  196  178의  개시내용에  따르면,  CG  모티프들은  상기  개시된  분자의  이중가닥  줄기의  양  말단에서  단일가닥  루프(loop)  내에  위치하거나,  또는  이중가닥  줄기  내에  위치하고  있다.    단일가닥의  헤어핀(hairpin)  루프들은,  세포의  내부  또는  외부에  DNA  핵산분해효소에  의한  분해로부터  이중가닥  줄기를  보호한다.
 문서  WO  2010/039137은,  면역자극  모티프를  플랭킹시키는(flank)  서열에서의    및/또는  면역자극이지만  변형을  위한  올리고뉴클레오타이드에서의  하나  이상의  화학적  개질화를  갖는  TLR  매개된  질환을  위한  길항제(antagonist)로서의  면역조절  올리고뉴클레오타이드를  개시하고  있다.    따라서,  WO  2010/039137의  개시된  올리고뉴클레오타이드의  의도는  TLR에  의한  초래되는  면역  반응을  억제하는  것이다.
 WO  2005/042018은  소위  새로운  C-클래스  CpG  올리고뉴클레오타이드를  설명하고  있으며,  여기서  c-클래스  올리고뉴클레오타이드는  분자의  5'  말단  또는  3'  말단에  또는  그  근처에  일반적으로  위치하는  CpG  서열들을  그  특징으로  하고,  분자의  다른  말단에  또는  그  근처에  일반적으로  위치하는  GC-풍부  회문(palindrome)  모티프를  특징으로  한다.    문헌에서는  c-클래스  DNA의  회문  서열의  변화(variation)를  개시하고  있다.
선행기술문헌
   특허문헌
  (특허문헌 0001)    WO 1998/018810
(특허문헌 0002)    WO 2010/039137
(특허문헌 0003)    WO 2005/042018
  (비특허문헌 0001)     문헌 [Nature 1995 374: 6522 546-549] (비특허문헌 0002)     크리그(A. Krieg)의 문헌 [Nat. Rev. Drug Disc. 5:471-484, 2006]
발명의 상세한 설명
   해결하려는 과제
 당해 분야와 관련하여, 본 발명의 목적은, 진핵 세포 내로의 전달 후에도 안정하고 유해한 부작용을 회피하는 대안적 면역조절 DNA 구조체를 제공하는 데 있다.
   과제의 해결 수단
 본 발명은, 하나 이상의 서열 모티프(motif) N 1N 2CGN 3N 4를 포함하는 면역조절용 DNA 구조체로서, N 1N 2 및 N 3N 4는  A,  C,  T  및  G의  임의의  조합이고,  C가  데옥시사이티딘이고,  G가  데옥시구아노신이고,  A가  데옥시아데노신이고,  T가  데옥시티미딘이고,  여기서  상기  구조체는  L-입체형태인  하나  이상의  뉴클레오타이드를  포함하는  선형의  단일-  또는  이중-가닥  DNA  서열인,  면역조절용  DNA  구조체를  교시한다.    N 1N 2는 GT, GG, GA, AT 또는 AA를 포함하는 군으로부터 선택된 요소이고, N 3N 4는 CT 또는 TT를 포함하는 군으로부터 선택된 요소이다.
 본 발명의 다른 실시양태로서, L-입체형태인 하나 이상의 뉴클레오타이드가 DNA 단일가닥의 5'- 및/또는 3'-말단에 위치하는 5개의 터미널 뉴클레오타이드 내에 포함되는 구조체가 제공된다.
 본 발명은, 3개 이상의 연속(consecutive) 데옥시구아노신의 하나 이상의 G 스트레치(stretch)가 5' 및/또는 3' 말단 근처에 위치하고, G 스트레치가 청구항 제1항 또는 제2항에 따른 2개의 서열 모티프들 사이에 위치할 수 있는 DNA 구조체를 추가로 제공한다.
 청구항 제1항 또는 제2항에 따른 2개의 서열 모티프들 사이의 공간(spacing)은 5개 이상의 염기일 수 있으며, 특히 이 경우에는 어떠한 데옥시구아노신도 서열의 요소가 아니다.
 또한, DNA 서열은 단일 또는 이중가닥 DNA를 포함하는 선형의 개방된 쇄 DNA 구조체이거나, 또는 단일가닥 루프를 갖는 하나 이상의 말단을 포함하는 선형의 DNA 구조체인 것이다.
 앞서 정의된 바와 같은 서열 모티프 N 1N 2CGN 3N 4는 DNA 서열의 단일가닥 및/또는 이중가닥 구역 내에 위치할 것이다.
 추가 실시양태로서, 구조체는 분자간(intermolecular) 및/또는 분자내(intramolecular) 염기 쌍 및 하나 이상의 홑(unpaired) 단일가닥 구역을 포함한다.
 더욱이, 분자간 및/또는 분자내 염기 쌍 및 하나 이상의 홑 단일가닥 구역을 포함하는 2개 이상의 구조체가 서로 결찰하는 다량체성(multimeric) 구조체가 제공된다.
 또한, 구조체는, 카르복실, 아민, 아미드, 알드이민(aldimine), 케탈, 아세탈, 에스테르, 에테르, 디설파이드, 티올 및 알데히드 기를 포함하는 군으로부터 선택되는 작용기로 변형되어 있는 L- 또는 D-입체형태인 하나 이상의 뉴클레오타이드를 포함할 수 있다.
 변형된 뉴클레오타이드는 펩타이드, 단백질, 탄수화물, 항체, 지질, 미셀(micelle), 소포(vesicle), 합성 분자, 고분자, 마이크로 프로젝틸(micro projectile), 금속 입자, 나노 입자 또는 고체 상을 포함하는 군으로부터 선택된 화합물에 연결될 수 있다.
 본 발명은, 5' 말단에서의 제 1 G 스트레치 및 청구항 제1항 또는 제2항에 따른 3개의 서열 모티프를 갖되, 상기 제 1 서열 모티프와 제 2 서열 모티프 사이에는 5개 이상의 염기가 위치하고, 데옥시구아노신이 제외되며, 상기 제 2 서열 모티프와 제 3 서열 모티프 사이에 위치하는 G 스트레치를 갖되, 3개의 3' 터미널 데옥시뉴클레오타이드 중 2개는 L-입체형태로 존재하는 DNA 구조체를 제공한다.
 본 발명에 따른 구조체는, 암 또는 자가면역 질환의 치료를 위해, 또는 면역계의 조절을 위해 사용될 수 있다.
 본  발명의  추가  실시양태로서,  앞서  기재된  바와  같은  DNA  구조체를  포함하는  약학  조성물이  제공된다.    약학  조성물은  화학요법제(chemotherpeutic)를  더  포함할  수  있다.
 더욱이,  앞서  기재된  바와  같은  DNA  구조체를  포함하는  백신이  제공된다.    여기서,  DNA  구조체는  애주번트로서  포함될  수  있다.
   발명의 효과
 결론적으로,  L-입체형태의  모든  뉴클레오타이드를  갖는  DNA  구조체(CKm336)가  아무런  영향을  미치지  않았지만,  CKm337(양  말단에  L-입체형태의  뉴클레오타이드를  갖는  D-DNA  구조체)은  놀랍게도  PBMC  및  격리된  pDC  모두에  자극  효과를  가졌다.    분명하게는,  CKm337의  입체형태는  여전히  TLR9에  대한  결합을  허용하고,  CKm336은  TLR9에  대한  결합  또는  이를  자극하는  것이  입체적으로  불가능하다.
 예기치  않게도,  아령형  dSLIM  및  포스포로티오에이트  변형된  올리고와  비교되는,  CKm337에  의해  유도된  자극  패턴은  다른  모든  구조체에  비해  특이하였다.    CKm337은  pDC에  의한  분비된  IFN-α의  양을  가장  많게  유도하였다.    PBMC에  의한  IL-8  분비는  포스포로티오에이트  변형된  분자에  비해  약하였지만,  dSLIM에  비해서는  더  강하였다.    반면,  dSLIM은  PBMC에  의한  분비된  MCP-1의  양을  가장  많게  유도하였지만,  Ckm337는  포스포로티오에이트  변형된  분자에  견줄만하였다.  
 선형  DNA  분자의  5'  말단에  소위  G-스트레치를  직접  도입함으로써  CKm337로  관찰된  효과들을  증가시킬  수  있었다.    또한,  3'  말단에  l-리보오스-포함  데옥시뉴클레오타이드에  의한  분해에  대한  단순한  보호가  올리고를  안정화시키는  데  충분한  것으로  밝혀졌다.    G-스트레치의  확인된  구조적  특징,  CG-모티프,  CG-모티프의  공간  및  상이한  정도와  위치의  L-리보오스  변형된  데옥시뉴클레오타이드의  사용에  의한  보호에  의해,  L-리보오스-포함  올리고뉴클레오타이드의  면역자극  효과의  조정이  허용된다.    매우  분명하게는,  본  발명은  세포의  표적화된  자극  또는  면역계에  대한  면역자극의  DNA  구조체의  구성하기  위한  새로운  도구들을  제시한  것으로  보인다.  
 IFN-α는  수년  동안  항바이러스  사이토카인으로서  알려져  있다.    그것은  Th1  세포  발달에  자극을  부여하며,  따라서  CG-함유  DNA  분자의  효과를  촉진시킨다.    IFN-α는  마우스와  인간  악성종양에서  항종양  활성을  나타내고,  이식된  종양  세포의  종양발생을  부분적으로는  세포독성  T  세포를  활성화시킴으로써  감소시킬  수  있으며,  이로  인해  종양  세포의  세포용해(cytolysis)의  가능성이  증가하게  된다.    모두가  항종양  세포독성에  대해서도  또한  중요한,  NK  세포와  대식세포  활성은,  IFN-α(브라사드(Brassard)  등의  문헌  [J.  Leukoc  Biol.  2002  71:  565-81)에  의해  증가된다.    따라서,  본  발명의  DNA  구조체를  사용하는  자극에  따라  IFN-α의  양을  증가시키면,  암의  치료에  도움이  되는  것으로  예상된다.
 IP-10은  최근  생체  내에서  강력한  혈관생성억제성(angiostatic)  단백질인  것으로  입증되었다.    따라서,  종양  질환의  치료에서  특히  IP-10의  유도는  크게  유리한  것으로  보인다.
 IL-8은  주변  혈액으로부터  조직  내로의  호중구의  활성화와  이동을  중재하는  것으로  알려져  있는  염증성  사이토카인이다.    생성된  호중구  침투는  난소암에  대해  제시된  바와  같이  종양  성장을  억제하는  데  부분적으로  책임을  가질  수  있다(리(Lee)  등의  문헌  [J.  Immunol.  2000  164:  2769-75]).    또한,  IL-8은  T  세포와  호염기구에  대한  화학주성을  갖는다.    따라서,  적어도  일부  종양  유형의  치료  또는  예방에서,  CG-함유  DNA  구조체에  반응하여  선택적으로  IL-8을  상향조절하는  데  유리하다.    반면,  IL-8은  IL-8  분비의  유도가  역효과를  나타내도록  혈관생성을  개시하는  것(counterproductive)이  구축되어  있다.    따라서,  본  발명의  여러  DNA  분자들에  의한  여러  정도의  IL-8  유도는  분자를  목적하는  치료  효과에  맞추어  조정할  수  있다.
 MCP-1은  손상과  감염의  부위에  대한  단핵구/대식세포의  활용에  중요한  역할을  하는  것으로  알려져  있으며,  이로  인해  가능하게는  숙주  항종양  반응을  자극하는  데에  참여하고  있다.    MCP-1은  시험관  내에서  여러  유형의  인간  종양  세포에  대항하여  더  많게  세포증식되는  단핵  세포를  활성화할  수  있는  것으로  나타났다(타카리아에(Zachariae)  등의  문헌  [J.  Exp.  Med.  1990  171:  2177-82).    따라서,  IL-8과  유사하게,  특이적  종양  상황에  따라  MCP-1  발현을  다르게  조절하는  데  유리하다.  
 따라서,  유도된  특이적  사이토카인  패턴은  뚜렷한  종양  유형의  치료와  예방에  유리하다.    물론,  비메틸화된  CG  모티프가  TLR9에  제공되는  특이적  상황에서는,  반응  세포에서  유도된  개별적인  각각의  자극  패턴을  결정한다.  
도면의 간단한 설명
 본  발명의  공개내용는  개시된  실시양태들에  한정되지  않고서  실시예  및  도면에  의해  추가로  예시된다.    이는  다음과  같다:
도  1은  효소  소화  후  DNA  구조체의  아가로스  겔  전기영동이다.
도  2는  마우스  대식세포  세포주의  자극  후의  GFP  강도이다.
도  3은  플라즈마사이토이드  수지상  세포(plasmacytoid  dendritic  cell)(PDC)를  자극한  후의  MIP-1α  농도이다.
도  4는  PDC를  자극한  후의  MIP-1β  농도이다.
도  5는  PDC를  자극한  후의  IL-8  농도이다.
도  6은  PDC를  자극한  후의  IL-6  농도이다.
도  7은  PDC를  자극한  후의  IFN-α  농도이다.
도  8은  PDC를  자극한  후의  TNF-α  농도이다.  
도  9는  주변  혈액  단핵  세포(peripheral  blood  mononuclear  cell)(PBMC)를  자극한  후의  MCP-1과  IL-8  농도이다.
도  10은  PBMC를  자극한  후의  활성화된  T  세포의  빈도이다.
도  11  및  12는  PBMC의  IFN-α,  IP-10  및  IL-8  분비이다.
도  13은  ELAM9  세포의  자극에  대한  l-리보오스  변형된  터미널  데옥시뉴클레오타이드의  효과이다.
도  14는,  비자극된  상태와  비교되는,  CKm532  및  dSLIM에  의한  B-세포  및  PDC의  면역  자극이다.
발명을 실시하기 위한 구체적인 내용
 본  발명의  개시내용의  의미  내에는,  선형의  개방된  쇄  DNA  서열은  DNA  구조체로서  지정된다.    상기  DNA  서열은  단일가닥,  또는  부분적  또는  완전한  이중가닥일  수  있다.    용어  DNA  구조체는  상응하는  DNA  서열의  길이의  제한을  지적하지  않는다.    DNA  구조체의  단량체  단위는  뉴클레오타이드이다.  
 DNA 구조체는 합성하여 제조되거나, 또는 부분적으로 또는 완전하게는 생물학적 기원일 수 있으며, 여기서 생물학적 기원은 DNA 서열의 유전자-기반 제조방법을 포함한다.
 L-DNA  또는  L-입체형태의  뉴클레오타이드는,  자연적으로  발생하는  D-데옥시리보스  대신에,  당  잔기로서  L-데옥시리보스를  포함하는  뉴클레오타이드를  지칭한다.    L-데옥시리보스는  D-데옥시리보스의  거울상  이성질체(거울  이미지)이다.    L-입체형태의  뉴클레오타이드로  부분적으로  또는  완전하게는  이루어진  DNA  구조체는,  부분적  또는  완전한  단일  또는  이중가닥일  수  있지만;  L-입체형태의  뉴클레오타이드는  D-입체형태의  뉴클레오타이드로  하이브리드화(hybridize)할  수  없다(하우저(Hauser)  등의  문헌  [Nucleic  Acid  Res.  2006  34:  5101-11]).    L-DNA는  D-DNA와  동일하게  가용적이며  선택적이다.    그러나,  L-DNA는  자연적으로  발생하는  효소,  특히  엑소-핵산분해효소(exonuclease)에  의해  분해되는  것에  대해  저항적이며,  따라서  L-DNA는  생물학적  분해에  대항하여  보호된다(우라타(Urata)  등의  문헌  [Nucleic  Acid  Res.  1992  20:  3325-32).    따라서,  L-DNA는  매우  광범위하게  적용  가능하다.
 본  발명의  개시내용에  따른  "줄기(stem)"은,  동일한  DNA  분자(이후에,  부분적으로  자기-상보성임)  내에서  또는  다른  DNA  분자들(이후에,  부분적으로  또는  완전하게  상보성임)  내에서  염기  쌍짓기에  의해  형성된  DNA  이중가닥으로서  이해되어야  한다.    분자내  염기-쌍짓기는  동일한  분자들  내의  염기-쌍짓기를  지칭하며,  다른  DNA  분자들  사이의  염기-쌍짓기는  분자간  염기-쌍짓기로서  지칭된다.
 본  발명의  개시내용의  의미  내의  "루프"는  줄기  구조체  내  또는  그의  말단에서의  홑  단일가닥  구역으로서  이해되어야  한다.    "헤어핀"은,  동일한  DNA  분자의  2개의  자기-상보성  구역들이  홑  루프를  갖는  줄기를  형성하기  위해  하이브리드화하는  경우에  발생하는  줄기와  루프의  구별된  조합이다.    아령형은  줄기  구역을  플랭킹하는  양  말단에서  헤어핀을  갖는  선형  DNA  구조체를  묘사한다.    따라서,  본  발명의  개시내용의  문맥에서의  "선형의  DNA  구조체"는,  단일  또는  이중가닥  DNA를  포함하는  선형의  개방된  쇄  DNA  구조체,  또는  이중가닥  DNA  줄기의  양  말단에서  단일가닥  루프를  포함하는  선형의  아령형  DNA  구조체를  묘사한다.
 용어  "DNA  말단"은,  DNA  단일가닥의  5'-  또는  3'  말단을  의미하는  지와  상관없이,  터미널  뉴클레오타이드를  지칭할  뿐만  아니라,  각각의  DNA  말단과  관련하여  5개의  터미널  뉴클레오타이드  또는  최종  3개의  뉴클레오타이드를  포함한다.    DNA  말단의  변형은  각각의  뉴클레오타이드의  적어도  하나에  관한  것이다.
 "G 스트레치"는 본 발명의 개시내용의 의미에서 3개 이상의 연속(consecutive) 데옥시구아노신의 서열로서 이해되어야 한다.
 뉴클레오타이드들이  공유결합  또는  비공유결합적으로  부착되는  "고체상"은,  칼럼(column),  매트릭스(matrix),  비드(bead),  유리,  예컨대  개질된  또는  기능화된  유리,  실리카  또는  실리카계  물질,  예컨대  실리콘  및  개질된  실리콘,  플라스틱(폴리프로필렌,  폴리에틸렌,  폴리스티렌  및  스티렌과  다른  물질과의  공중합체,  아크릴,  폴리부틸렌,  폴리우레탄  등을  포함함),  나일론  또는  니트로셀룰로오스,  수지,  다당류,  탄소뿐만  아니라,  무기  유리,  금속,  나노입자,  및  플라스틱을  지칭하지만  이에  제한되지  않는다.    따라서,  미세적정(microtiter)  플레이트도  또한  본  발명의  개시내용에  따른  고체상의  범위  내에  있다.
 면역조절은  본  발명의  개시내용에  따른  면역자극  및  면역억제를  지칭한다.    우선적으로,  면역자극은,  면역계의  효과기  세포가  증식,  이동,  차별화  또는  임의의  다른  형태로  활성화하도록  자극되는  것을  의미한다.    예컨대,  B  세포  증식은,  헬퍼(helper)  T  세포의  동시-자극(co-stimulatory)  신호를  일반적으로  필요로  하는,  면역자극의  DNA  분자에  의해  동시-자극  신호  없이  유도될  수  있다.
 반면,  면역억제는,  면역계의  활성화  또는  유효성을  감소시키는  것으로  이해되어야  한다.    면역억제는  일반적으로는  예를  들어  이식된  기관의  거부를  방지하기  위해,  골수  이식  후  이식편-숙주(graft-versus-host)  질환을  치료하기  위해,  또는  자가면역  질환,  예를  들어,  류마티스  관절염  또는  크론병(Crohn's  disease)의  치료를  위해  의도적으로  유도된다.
 이와 관련하여, 면역조절도 또한 여전히 성장 중이거나 또는 성숙 단계인 면역 반응에 영향을 미침으로써 또는 확립된 면역 반응의 특성을 조절함으로써 면역 반응의 속성 또는 특성의 영향을 지칭할 수 있다.
 본  발명에서  사용되는  용어  "예방접종"은  질환에  대한  면역을  생성시키도록  항원  물질(백신)을  투여하는  것을  지칭한다.    백신은  여러  병원체,  예컨대  바이러스,  진균,  원생동물  기생충,  박테리아,  또한  알러지  질환  및  천식뿐만  아니라,  종양에  의한  감염의  영향을  방지하거나  완화할  수  있다.    백신은  일반적으로  면역  반응을  강화시키는(boost)  데  사용되는  하나  이상의  애주번트,  예를  들어  면역자극의  핵산을  함유한다.    예방접종은  일반적으로  전염병  및  기타  질환을  방지하는  가장  효과적이고  비용-효과적인  방법인  것으로  간주된다.
 투여되는  물질,  예컨대  생존하고  있지만  약화된  형태의  병원체(박테리아  또는  바이러스),  사망한(죽은)  또는  비활성화된  형태의  이들  병원체,  정제된  물질,  예컨대  단백질,  핵산  인코딩  항원,  또는  세포,  예컨대  종양  세포  또는  수지상  세포일  수  있다.    특히,  DNA  예방접종은  최근에  개발되고  있다.    DNA  예방접종은  인간  또는  동물  세포  내에  DNA  인코딩  항원을  삽입(그리고,  면역계  인식을  출발시키는  발현)함으로써  작동한다.    발현된  단백질을  인식하는  면역계의  일부  세포들은,  이들  단백질에  대항하는  공격  및  이들을  발현시키는  세포에  대항하는  공격을  구축한다(mount).    DNA  백신의  장점들  중  하나는,  그들을  제조  및  저장하는  것이  매우  쉽다는  것이다.    또한,  DNA  백신은  통상적인  백신에  비해  다수의  장점들,  예컨대  넓은  범위의  면역  반응  유형들을  유도하는  능력을  갖는다.
 예방접종은  항원에  대한  노출에  따라  예방접종된  건강한  개인에게서  항원에  대한  면역화(immunity)에  이르게  하는  예방적인  방법으로서  사용될  수  있다.    다르게는,  치료적인  예방접종은,  항원을  향하여  개인의  면역계를  안내함으로써,  예방접종된  개인  환자의  면역계의  개선된  반응을  일으킬  수  있다.    예방적  및  치료적인  예방접종은  인간뿐만  아니라  동물에  적용될  수  있다.
 이  개시내용에서  사용되는  용어  "유전자  치료(gene  therapy)"는,  종양  또는  자가면역  질환과  같은  질환을  치료하기  위하여  개인의  세포  및/또는  생체  조직의  일시적  또는  영구적  유전자  변형(예컨대,  유전자의  삽입,  변경  또는  제거)을  지칭한다.    유전자  치료의  가장  일반적인  형태는  돌연변이화된  유전자를  대체하기  위하여  특정화되지  않은(unspecified)  게놈  위치  내로  기능성  유전자들을  삽입하는  것을  포함하지만,  다른  형태로는  돌연변이를  직접  수정하거나,  또는  바이러스  감염을  가능하게  하는  정상적인  유전자를  변형시키거나,  또는  심지어  유전자  또는  유전자  단편을  그의  전사를  위한  세포  내에  전달하는  것이  포함된다.
 "자가  유전자  치료(autologous  gene  therapy)"는  동일한  개인의  조직  또는  세포를  사용하는  것을  의미한다.    격리된  세포  또는  조직은  유전자  치료에  의해  변형되고  공여자에게  재도입될  것이다.    대조적으로,  "동종  유전자  치료(allogenic  gene  therapy)"는,  수용자  개인  이외의  개인으로부터,  유전자  치료를  위한  세포를  사용하는  것을  지칭한다.    유전자  변형  후,  동종  세포는  수용자에게  도입된다.  
 용어  "생체  외  유전자  치료"는,  개인으로부터의  세포,  예를  들면  조혈  줄기  세포  또는  조혈  전구  세포가,  생체  외에서  유전적으로  변형되고  후속적으로  치료할  개인에게  도입되는  치료적  접근을  지칭한다.    용어는  "생체  내  유전자  치료"는,  개인으로부터의  세포,  예를  들면  조혈  줄기  세포  또는  조혈  전구  세포가,  생체  내에서  바이러스성  벡터  또는  다른  발현  구조체를  사용하여  유전적으로  변형되는  치료적  접근을  지칭한다.
 유전자  치료는  또한  "배자계열  유전자  치료(germ  line  gene  therapy)"와  "체세포  유전자  치료"로  분류될  수  있다.    "배자계열  유전자  치료"의  경우,  생식  세포,  즉  정자  또는  난자가  유전적으로  변형된다.    유전자  변화는  통상적으로  그의  게놈  내에  통합된다.    따라서,  치료에  의한  변화는  유전될  것이며,  후대에  전달될  것이다.    이  접근은  유전적  장애  및  유전적  질환의  치료에  유용하다.    "체세포  유전자  치료"의  경우,  치료적  유전자는  개인의  체세포  내에  전달된다.    임의의  변형과  효과는  오직  개인에게만  한정될  것이며,  그  개인의  자손  또는  후대까지  유전되지  않을  것이다.
 용어 "암"은, 비제한적으로는, 유방 암종, 흑색종, 피부 신생물, 림프종, 백혈병, 위장 종양, 예컨대 결장 암종, 위 암종, 췌장 암종, 결장암, 소장 암, 난소 암종, 자궁경부 암종, 폐암, 전립선암, 신장세포 암종 및/또는 간 전이를 포함하는 군으로부터 선택되는, 치료 또는 예방되는 암 질환 또는 종양을 포함한다.
 본 발명의 개시내용에 따른 자가면역 질환은 류마티스 관절염, 크론병, 전신계 루푸스(systemic lupus, SLE), 자가면역성 갑상선염, 하시모토 갑상선염(Hashimomto's thyroiditis), 다발성 경화증, 그레이브스병(Graves' disease), 중증근무력증, 복강 질환 및 애디슨병(Addison's disease)을 포함한다.
 본  발명의  개시내용은  하나  이상의  CG  모티프  및  L-입체형태의  하나  이상의  뉴클레오타이드를  포함하는  선형의  개방된  쇄  DNA  서열를  제공한다.    부분적/완전한  L-입체형태로  인해,  DNA는  자연  발생  D-입체형태-특이적  DNA-분해  효소에  대한  기질로서  작용할  수  없다.    이로  인해,  본  발명의  DNA  구조체는,  독성인  것으로  나타나는  포스포로티오에이트  주쇄를  굳이  사용하지  않고서,  효소  분해에  대항하여  보호된다.    또한,  DNA  구조체들은  오직  그들을  작게  하는  최소의  뉴클레오타이드로만  이루어지며,  이로  인해  환자의  세포에  의한  그들의  흡수를  상당히  개선시킨다.
 CG-함유  DNA  구조체의  효과는  그의  TLR9와의  상호작용에  의존적이며,  DNA-단백질  상호작용은  DNA와  단백질  모두의  입체형태에  따라  달라진다.    단일  분자의  키랄성(chirality)은  생성되는  중합체의  입체형태에  따라  결정되기  때문에,  부분적  또는  완전한  L-입체형태의  DNA  분자가  TLR9에  결합하고  이를  활성화시킬  수  있을  지에  대해서는  알려져  있지  않다.    실험  데이터에서는,  이러한  보호된  DNA  분자가  놀랍게도  면역  반응의  유도에  적합하다는  것을  입증한다.    실시예  및  도면에  제시된  바와  같이,  단일  뉴클레오타이드의  키랄성에서의  적어도  일부  변화는  여전히  분명하게는  TLR9에  대한  결합  및  이의  활성화를  허용한다.    따라서,  CG  모티프  및  L-입체형태의  뉴클레오타이드를  갖는  DNA  분자는  면역조절에  사용될  수  있다.
 놀랍게도, 유도된 자극 패턴은, 동일한 뉴클레오타이드 서열을 사용할 경우에도, 도면에서 볼 수 있는 바와 같이, 분자의 양 말단에서의 단일가닥 루프에서 또는 이중가닥 줄기("dSLIM")에서 CG 모티프를 포함하는 아령형 분자를 개시하고 있는, EP 1 196 178에 개시된 분자에 의해 유도된 자극 패턴과 상이하다.
 DNA  구조체는  단일가닥이거나,  또는  부분적으로  또는  완전하게  이중가닥일  수  있다.    이에는,  동일한  분자  내에서(분자내)  또는  다른  분자  내에서(분자간)의  염기-쌍짓기,  또는  이들의  조합이  포함된다.    또한,  구조체는  하나  이상의  홑  단일가닥  구역을  포함하는  것도  가능하다.    다른  실시양태로서,  헤어핀  구조체가  포함되어  있다.    부분적  또는  완전한  L-입체형태로  인해,  구조체의  더욱  긴  반감기는  L-입체형태의  뉴클레오타이드가  분해되지  않은  채로  보장된다.
 또한,  단일가닥이거나,  또는  부분적으로  또는  완전하게  이중가닥인  2개  이상의  분자는  다량체성(multimeric)  구조체를  형성하기  위해  서로  결찰할  수  있다.    따라서,  이들  다량체성  구조체는  하나의  분자  내에  적어도  치밀하게  패킹된  결찰  파트너만큼  많은  CG  모티프를  통합시키며,  따라서  상당한  면역  반응을  유도할  것으로  기대된다.    생성되는  단일가닥,  또는  부분적으로  또는  완전하게는  이중가닥의  다량체성  구조체는,  분자  내에  L-입체형태의  뉴클레오타이드를  포함하여  공유결합적으로  폐쇄되거나,  또는  효소  분해에  대항하여  보호하기  위해,  5'-  및/또는  3'-말단에서  또는  그  근처에서  L-입체형태의  뉴클레오타이드를  포함하는  개방된  다량체성  구조체일  수  있다.
 본  발명의  공개내용에  따르면,  CG  모티프(들)는  구조체의  단일가닥  및/또는  이중가닥  구역  내에  위치한다.    EP  1  196  178에  공개된  바와  같이,  CG  모티프들은,  이들이  분자의  단일가닥  또는  이중가닥  구역  내에  포함되는  지에  따라  면역  반응을  이끌어낼  수  있다.
 공개내용에서는,  카르복실,  아민,  아미드,  알드이민(aldimine),  케탈,  아세탈,  에스테르,  에테르,  디설파이드,  티올  및  알데히드  기를  포함하는  군으로부터  선택되는  작용기로,  L-또는  D-입체형태인  하나  이상의  뉴클레오타이드의  화학적  변형을  추가로  포함한다.    이는,  펩타이드,  단백질,  지질,  소포(vesicle),  미셀(micelle),  탄수화물,  항체,  합성  분자,  고분자,  마이크로  프로젝틸(micro  projectile),  금속  입자,  나노  입자  또는  고체  상을  포함하는  군으로부터  선택된  화합물에  대하여  예컨대  흡착,  공유  또는  이온  결합에  의한  DNA  구조체의  커플링을  허용한다.    변형은  각각의  목적을  위해  특별히  선택될  수  있다.    이로  인해,  구조체는  예컨대  혼입되는  CG  모티프(들)에  대해  반응하는  특이적  세포까지의  다른  분자의  왕복(shuttle)을  위해  사용될  수  있다.    또한,  이러한  변형에  의하면,  구조체를  세포  내에  전달하는  데  사용될  수  있는  마이크로  프로젝틸에  구조체를  커플링시킬  수  있다.    구조체는  또한  고체상,  예컨대  미세적정(microtiter)  플레이트에  커플링될  수  있다.
 Th1-바이어스된  활성화는  NK  세포  및  세포독성  T  세포의  활성화를  포함하며,  이들  면역  반응은  암  치료에  활용될  수  있다.    비메틸화된  CG  모티프를  함유하는  DNA  구조체가  바람직하게는  Th1  활성화로  이어지기  때문에,  본  발명의  개시내용의  구조체는  암  치료에  사용될  수  있다.    수많은  임상  시도들이  암의  치료를  위한  TLR9  작용제를  포함하여  진행하고  있다.    이러한  분자들은  예컨대  방사선  치료,  외과수술,  화학요법  및  냉동요법(cryotherapy)으로  단독  또는  조합하여  효과적으로  투여되어  왔다(크리그(Krieg,  J.)의  문헌  [Clin  Invest.2007  117:  1184-94]).    그들의  강력한  면역조절,  그들의  작은  크기  및  그들의  안정성으로  인해,  본  발명의  구조체는  이  점에서  매우  유용할  것으로  예상된다.    또한,  자신의  독특한  면역  프로파일은  다른  덜  유리한  TLR9  리간드와  그들을  구별시키고,  이  프로필은  암-특이적  치료를  위해  활용될  수  있다.
 반면에,  TLR9  작용제는  또한  규제  T  세포의  생성에  관여하며,  따라서  면역  질환의  치료에  사용될  수  있다.    투여의  경로는  생체  내에서  CG  모티프를  포함하는  DNA  구조체의  효과를  결정하는  변수들  중  하나가  될  것으로  보인다(크리그(Krieg,  J.)의  문헌  [Clin.  Invest.2007  117:  1184-94]).
 CG-모티프를  함유하는  이러한  DNA  분자의  면역자극  효과는,  암  치료에서  화학요법과  같은  표준  치료적  접근의  효능을  향상시키는  것으로  제시되어  왔다.    따라서,  본  발명의  개시내용의  구조체를  포함하는  약학  조성물이  또한  제공된다.    당해  분야의  TLR9  작용제와  비교되는  본  발명의  개시내용의  구조체의  유리한  특징들은,  본  발명의  구조체를  암,  전염성  질환,  알러지  및  천식과  같은  질환의  치료를  위한  유망한  도구로  만든다.    이로  인해,  Th1  활성화에  대한  선호(preference)로부터  (주로  Th2-매개된)  알러지와  천식의  치료에  유익하게  된다.
 TLR9  작용제는  백신  내의  강력한  애주번트인  것으로  제시되어  왔기  때문에,  본  발명의  개시내용의  DNA  구조체를  포함하는  백신도  또한  제공된다.    본  발명의  개시내용의  구조체는  오직  TLR9  자극을  위한  관련  서열만을  포함하며,  L-뉴클레오타이드  변형으로  인해  안정적이다.    따라서,  비-관련  서열로  인한  부작용을  피할  수  있다.    분자의  더  긴  반감기는  효율적인  자극을  보장하여서  강한  면역  반응이  예상된다.
 본  발명의  개시내용의  DNA  분자는  합성  칼럼  및  각각의  뉴클레오타이드(베타-L-데옥시  "NT"(n-bz)  CED  포스포르아미다이트(phosphoramidite);  "NT"는  아데노신,  사이티딘,  구아노신  또는  티미딘을  의미한다)를  사용함으로써  제조되었다.    DNA  분자는  이후  HPLC에  의해  정제되었다.
 D-리보오스 대신에 L-리보오스를 갖는 DNA를 사용하는 효과를 밝히기 위하여, 본원에 기재된 초기 실험에 하기 DNA 분자들이 사용되었다(표 1).
 
표 1
비-코딩 면역자극의 DNA 구조체 및 대조군의 서열
서열번호 명칭 서열(5'-3') 변형된 뉴클레오타이드
1 lin 30L2 TCATTGGAAAACGTTCTTCGGGGCGTTCTT 없음
2 CKm336, Lin L TGGAAAACGTTCTTCGGGGCGTTCTTT 최종 T를 제외한, 완전한 L-입체형태
3 CKm337, CKm374 TCATTGGAAAACGTTCTTCGGGGCGTTCTTT L-입체형태인 1, 2, 29 및 30
4 CKm338, linPT TCATTGGAAAACGTTCTTCGGGGCGTTCTTT 모두, 단 최종 포스포르디에스테르 결합이 포스포로티오에이트로 변형됨
5 CKm339, Lin2tPT TCATTGGAAAACGTTCTTCGGGGCGTTCTTT 최종으로부터 2번 및 3번째 뿐만 아니라, 최초 2개는 포스포르디에스테르 결합이 포스포로티오에이트로 변형됨
 표  1의  서열을  사용하는  실험에서는,  CG  모티프를  함유하는  L-리보오스  보호된  선형  서열이  면역계를  자극할  수  있으며,  유도된  면역  반응이  EP  1  196  178에  개시된  바와  같이  dSLIM에  의해  유도된  면역  반응과  분명하게  다르다고  제시된다.    따라서,  ODN2216(GGGGGACGATCGTCGGGGGG,  서열번호  6)로  지칭되는  변형된  서열  및  그의  변형체들은,  각각,  그의  존재,  길이  및  위치,  CG-모티프들  사이의  공간,  및    L-리보오스  뉴클레오타이드와  CG-모티프  사이의  거리와  관련된  G-스트레치의  영향과  같은  구조적  차이의  영향을  조사하는  데  사용되었다.
 표  2는,  포스포로티오에이트로  변형된  최초  2개  및  최종  6개의  뉴클레오타이드를  갖는  ODN2216과  비교되는,  사용된  서열  및  IFN-α와  IP-10의  분비에  대한  그의  효과를  요약하며,  여기서  볼드체  문자는  뉴클레오타이드를  포함하는  l-리보스를  나타내고,  이탤릭체  문자는  G-스트레치를  나타내며,  밑출친  문자는  CG-모티프를  나타낸다.    대시(dash)는  CKm508과  비교되는  제자리의  각  서열의  위치이지만,  서열의  구조적  또는  기능적  변형을  나타내는  것은  아니다.
 
표 2
 하나  이상의  G-스트레치를  특히  3'  말단에서  또는  그  근처에서  갖는  서열에서  좋은  결과들이  얻어졌다.    자극은  CG-모티프의  존재에  또한  의존적이며(CKm477),  이는  다시  l-리보오스의  효과가  아닌  CG  모티프의  효과임을  나타낸다.  
 포지티브(positive)  구조적  구성요소를  식별하는  ODN  2216의  변형된  서열에서  얻어진  결과들은  CKm374의  DNA  서열로  옮겨졌다.    표  3에서는,  EP  1  196  178에  개시된  바와  같이  아령형  dSLIM과  비교되는,  변형된  서열을  사용하는  결과들을  제시한다.    다시,  볼드체  문자는  l-리보오스-포함  뉴클레오타이드를  나타내고,  이탤릭체  문자는  G-스트레치를  나타내고,  이중  밑출친  문자는  포스포로티오에이트  변형된  뉴클레오타이드를  나타내며,  밑출친  문자는  GC-모티프를  나타낸다.  
 표  3에서의  결과로부터  취할  수  있는  바와  같이,  5'  말단에  직접  위치하는  G-스트레치는  유리한  것으로  보인다(comp.  CKm532  및  CKm499).    또한,  5'  말단에서  3개의  데옥시구아노신  대신에  4개를  사용하면,  IFN-α와  IP-10의  자극을  추가로  증가시킨다(comp.  CKm501  및  CKm532).
 CG-모티프들  사이에  추가의  G-스트레치를  부가하는  것이  역시  유리한  것으로  보인다(comp.  CKm532  및  CKm520).    1번째와  2번째  G-스트레치  사이의  거리는  DNA  분자의  효능에  추가로  영향을  미친다.    또한,  오직  3'에서  또는  그  근처에서  l-리보오스-포함  데옥시뉴클레오타이드를  사용하면,  충분한  정도의  DNA  분자의  안정화를  얻는  것으로  보인다.    의도되는  IFN-α와  IP-10의  우수한  자극이  관찰될  수  있다(아래  참조).    IL-8이  신혈관형성의  유도에  대한  책임이  있는  것으로  나타났기  때문에,  IL-8  분비는  단지  소량으로  유도되는  것이  유리한  것으로  보인다.
 분명하게는, l-리보오스 함유 데옥시뉴클레오타이드의 안정화 효과와 함께 G-스트레치의 존재 및 신중하게 선택된 위치는, DNA 분자의 생산을 위해 dSLIM 분자의 자극 효율을 능가하게 할 수 있다.
  TIFF 112013066112857-pct00002.png 165 146
 도  1은,  T7  박테리오파지로부터의  T7-중합효소에  의해  소화되는  모든  DNA  구조체의  겔을  보여준다.    각  DNA  구조체  6  μg은  T7-중합효소  10개의  단위로  배양하였다(총  반응  부피:  20  μl).    0,  1,  2,  5,  30  및  1500  분  후,  배양  혼합물  3  μl의  분취물을  샘플로부터  제거하고,  포름아미드-함유  생거(Sanger)  염료  5  μl로  희석하였다.    모든  분취물을  3  %  아가로스  겔  위에  적재되며,  이는  40  분  동안  100  볼트에서  진행되었다.
 비변형된  DNA  분자  lin-30L2(레인  2)는  T7-중합효소로  5  분  배양  후에  완전하게  소화된  것으로  밝혀졌지만,  dSLIM(레인  1)  및  포스포로티오에이트-변형된  구조체  CKm338(레인  4)와  CKm339(레인  5)  뿐만  아니라  본  발명에  따른  구조체(CKm337;  레인  3)는  심지어  배양  1500  분  후에도  상당히  존재하였다.    사실상,  CKm337은  시험된  모든  분자들  중  가장  높은  안정성을  보였다.      그의  부족한  안정성으로  인해,  Lin  30L2는  추가  연구에서  제외되었다.
 도  2는,  여러  자극  DNA  구조체를  사용하는  ELAM9  세포의  자극을  보여준다.    ELAM9  세포는,  몇몇  NFκB  반응  요소를  함유하는  인간  엘라스틴(Elastin)  프로모터(hELAM)의  제어  하에서  d1-eGFP로  안정적으로  세포감염된(transfect)  TLR9-포지티브  쥐  대식세포(RAW264)이다.    세포를  씨딩한(seed)  후  1일에,  그들은  7  시간  동안  지정된  DNA  구조체(3  μM)로  자극하였다.    GFP  강도의  Geo  Mean을  유동  세포측정법에  의해  측정하였다.
 최종  T를  제외한  L-입체형태인  모든  뉴클레오타이드를  갖는  DNA  구조체(CKm336)는  전혀  자극  용량을  갖지  않는다.    그러나,  L-입체형태인  뉴클레오타이드를  양  말단에  갖는  DNA  구조체(CKm337)는  GFP-발현을  자극하였다.    오히려  이는,  L-입체형태의  뉴클레오타이드와  함께  CG  모티프를  함유하는  DNA  구조체가  TLR9에  결합하고  이를  활성화시킬  수  있는  지에  대해  알려져  있지  않기  때문에  예상되지  못하였다.    또한,  CKm337는  dSLIM보다  더  쉽게  세포에  의해  취해지는  것으로  예상되고(EP  1  196  178에  개시된  분자),  포스포로티오에이트-변형된  구조체보다  덜  독성인  것으로  예상된다(CKm338  및  CKm339).
 도  3  내지  8은  분비된  케모카인과  사이토카인에  관한  pDC에  대한  DNA  구조체의  효과를  제시한다.    pDC는  밀테니(Miltenyi),  다이아몬드  PDC  키트(Diamond  PDC  Kit)로부터의  조합된  분류  절차를  사용하는  피콜(Ficoll)-정제된  PBMC로부터  풍부해지고(enrich);  우선,  PBMC는  밀테니의  키트로부터의  pDC  Biotin-Antibody  Cocktail을  사용하여  비-pDC로부터  제거된  후,  세포들은  PDC  다이아몬드  키트로부터의  CD304(BDCA-4)  다이아몬드  마이크로비이드를  사용하여  비-pDC에  대해  포지티브하게  분류하였다.    PDC는  배지(RPMI1640,  10  %  소  태아  혈청,  100  단위/ml  페니실린,  100  단위/㎖  스트렙토마이신(streptomycine)  2  mM의  글루타민,  37  ℃,  5  %  CO 2)에서 10 ng/ml IL-3로 2.5 × 10 5/㎖에서 씨딩하고, 3 μM에서 적용된 개별 구조체에 의해 2일 동안 자극하였다.
 세포의 자극에 따라 분비된 화합물의 양을 결정하기 위해, 자극된 세포의 제거된 상청액을 수거하고, 멀티플렉스 시스템(eBioscience/Bender MedSystems로부터의 FlowCytomix) 또는 ELISA를 사용하여 분석하였다.
 놀랍게도,  CKm337로  자극된  pDC에서는,  dSLIM을  사용하는  자극과  비교하여,  MIP-1α,  -1β  및  IL-8에  대한  유사한  효과를  보였다.    lin  CKm338  및  CKm339를  사용하는  자극에  따른  MIP-1α,  -1β  및  IL-8  분리는  약간  더  높았다(도  3,  4,  5).    그러나,  모든  포스포로티오에이트-변형된  구조체는  앞서  기재된  바와  같이  몇몇  단점을  물려받는다.  
 IL-6의  분비와  관련하여,  dSLIM,  CKm337  및  CKm338은  pDC에  대한  유사한  효과를  가졌다.    CKm339은  약간  더  효과적이었다(도  6).
 그 중에서, CKm337은, 다른 모든 선형 구조체와 비교하여, 놀랍게도 더욱 강한 pDC의 IFN-α 분비에 대한 효과를 가졌다(도 7).
 dSLIM, CKm337, CKm338 및 CKm339 모두는 pDC의 TNF-α 분비에 대한 유사한 효과를 가졌다(도 8).
 PBMC는  피콜  밀도  구배를  통해  인간  버피  코트(buffy  coat)로부터  격리시켰다.    기능  분석을  위해,  배지(RPMI1640,  10  %  소  태아  혈청,  100  단위/ml  페니실린,  100  단위/㎖  스트렙토마이신  2  mM의  글루타민,  37  ℃,  5  %  CO 2)에서 10 6 세포/ml를 지정된 농도(2 내지 3 μM)에서 적용된 개별 화합물에 의해 2일 동안 자극하였다.
 도  9(A  및  B)는  MCP-1과  IL-8의  분비에  관한  PBMC에  대한  지정된  DNA  구조체(각각  3  μM)의  효과를  보여준다.    pDC를  사용하는  실험으로부터  예상되는  바와  같이,  L-입체형태인  모든  뉴클레오타이드를  갖는  DNA  구조체(CKm336)는  PBMC에  적용되는  경우  자극  용량을  전혀  갖지  못하였다.    그러나,  CKm337은  MCP-1과  IL-8  분비  모두를  자극하는  데  효과적이었다.    놀랍게도,  IL-8  분비와  관련된  그의  효과는  dSLIM에  비해  더욱  강하며,  MCP-1  분비와  관련되어서는  덜  강하였다.
 세포  모집단(subpopulation)  및  그  활성  상태의  결정을  위해,  특징적인  표면  마커(marker)는  선택적  형광단(fluorophore)-접합된  항체로  표지하였다.    항체  염색은  10 6  세포/염색  세트로  수행하였으며;  각  세트는  형광단-그룹에  커플링된  4개  이하의  다른  항체로  배양하고,  최종적으로  400  μl  FACS  완충액  중에  재현탁시키고,  적어도  100,000개의  살아있는  세포에  대해  유동  세포측정법에  의해  분석하였다.    T  세포  및  그  안의  활성화된  세포의  결정을  위한  게이트(gate)  전략은,  활성  마커  CD69를  갖는  CD3+/CD56-이었다.
 도  10은,  PBMC의  집단  내의  활성화된  T  세포의  빈도에  대한  지정된  DNA  구조체(각각  2  μM)의  효과를  보여준다.    모든  5개의  구조체는  필적할만한  자극  용량을  가졌다.    T  세포는  TLR9를  발현하지  않는다.    따라서,  DNA  구조체로  자극함에  따라,  PBMC  집단  내의  세포는  활성화된  후,  다시  T  세포를  활성화시켰다.
 서열의  최적화에서는,  G-스트레치의  도입이  형질전환  후  올리고뉴클레오타이드의  효능을  증가시키는  것으로  드러났다.    효능은  CG-모티프들  사이의  거리에  더  의존적이다.    선형  DNA  서열은  올리고뉴클레오타이드의  3'  말단에  L-리보오스-포함  데옥시뉴클레오타이드의  사용에  의해  분해로부터  충분하게  보호될  수  있다(comp  표  2  및  3).      올리고  CKm501(서열번호  33),  CKm527(서열번호  32),  CK  532(서열번호  31)  및  CKm534(서열번호  34)는  표  3에서  취할  수  있는  바와  같이  예상치  못한  우수한  결과를  보였다.    도  11  및  12는  PBMC에서  사이토카인  IFN-α(상부),  IP-10(중간)  및  IL-8(하부)의  분비에  대한  지정된  DNA  구조체의  효과를  나타낸다.    이미  앞서  기재된  바와  같이,  실험을  수행하였다.
 도  11은,  CKm501  및  CKm527은  IFN-α  분비의  높은  수준을  초래하고,  CKm527은  아령형  dSLIM에  비해  IP-10  분비를  너무  증가시키는  것으로  나타난다.    IL-8의  분비는  dSLIM과  관련하여  상당히  낮지만,  포스포티오에이트  변형된  데옥시뉴클레오타이드로  양  말단에  대해  보호된  아령형  dSLIM의  단일가닥  루프의  서열인  CKm339에  비해  더욱  낮다.
 도  12로부터  취할  수  있는  바와  같이,  CKm532는  IFN-α와  IP-10  분비의  상당한  예상치  못한  높은  유도를  보여주지만,  IL-8  분비의  상당히  낮은  유도를  보여준다.    따라서,  CKm532에서는,  5'  말단에  직접  위치하는  G-스트레치  및  2개의  CG-모티프들(2번째와  3번째  GC-모티프)  사이에  위치하는  추가  G-스트레치의  구조적  요소가  장점을  갖는  것으로  확인된다.    표  3에서  CKm520과  CKm532를  비교하면,  CKm532에서  2번째와  3번째  CG-모티프들  사이의  G-스트레치의  위치가  IFN-α와  IP-10  분비의  의도된  증가에  대한  책임이  있는  반면,  CKm520은  주로  IL-8의  분비를  증가시킴을  나타낸다.    또한,  3'  말단에서  데옥시뉴클레오타이드를  포함하는  2개의  l-리보오스만을  오직  갖는  올리고의  보호는  충분한  것으로  보인다.
 5'  말단에서의  G-스트레치를  단축시키는  것은,  도  12에서  CKm532와  CKM  534의  비교로부터  취할  수  있는  바와  같이  효능의  감소를  초래한다.    다시,  CKm532에서는,  증가된  IFN-α와  IP-10  분비  및  낮은  IL-8  분비와  관련하여  확인된  구조적  구성요소의  장점을  입증하고  있다.
 도  13에서는,  그의  상부에서,  다른  정도의  l-리보오스  변형을  갖는  데옥시뉴클레오타이드를  포함하는  지정된  DNA  구조체를  사용하는  ELAM9  세포  자극의  결과를  보여준다.    L-리보오스-포함  뉴클레오타이드는  도  13의  하부에  서열에서  볼드체  문자로  표시된다.      실험은  이중으로  수행하였다(L-dSLIM032  및  L-dSLIM030).
 L-리보오스-포함  데옥시뉴클레오타이드의  정도와  위치는,  ELAM9  세포의  자극에  대한  영향을  갖는다.    L-입체형태의  완전한  서열(CKM  336,  서열번호  2)은  전혀  자극  효과를  갖지  않으며,  이는  WO  2010/039137의  공개내용에  따른  것이다.    우수한  효과는,  3'  및  5'  말단에서  L-리보오스-포함  데옥시뉴클레오타이드에  의해  보호된  올리고를  포함하는  CG-모티프를  사용하여  얻어지는  반면,  5'  말단에서  L-리보오스-포함  데옥시뉴클레오타이드의  긴  확장부(extension)는  역효과를  갖는다(comp  CKm489  및  CKm490).    또한,  L-리보오스-포함  데옥시뉴클레오타이드를  사용하는  CG-모티프의  변형은  효과의  손실로  이어진다.  따라서,  우수한  자극  효과를  달성하기  위해서는,  CG-모티프는  L-리보오스를  포함하지  않아야  하며,  양  말단에서  L-리보오스-변형된  데옥시뉴클레오타이드의  확장부는  제한되어야  하는  데,  즉  최종  CG-모티프를  따르는,  5'에서  8개  이하의  터미널  데옥시뉴클레오타이드  및  최대  3'  터미널  데옥시뉴클레오타이드로  제한되어야  한다.
 도  14는,  자극받지  않은  상태와  비교되는,  CKm532  및  dSLIM에  의한  면역  자극을  보여준다.    FACS  실험은  각각  도  10에서  기재되고  B  세포(게이트  전략:  CD19  포지티브,  활성  마커로서  CD86)  및  PDC(게이트  전략:  선형  네거티브(lineage  negative),  HLA-DR  포지티브,  CD123  포지티브  세포,  활성화  마커로서  CD40  및  HLA-DR)에  적합한  실험에  사용된  프로토콜에  따라  수행되었다.    제시된  데이터는  3가지  다른  버피  코트  준비물의  측정을  기반으로  한다.
 도  14의  상부는,  마커  CD86에  의해  입증되는  바와  같이,  B  세포의  자극을  보여준다.    분명하게는,  dSLIM과  비자극된  상태와  비교되는  경우,  CKm532는  B  세포의  증가된  자극을  초래한다.    이는,  면역  자극의  중요한  특징인,  항체-생성  세포와  같은  B  세포의  성숙에서의  증가를  보여준다.  
 도  14의  하부에서는,  마커  HLA-DR을  사용하여  검출된  바와  같이,  PDC의  자극을  보여준다.    HLA-DR은  MHC  분자의  일부이며,  따라서  면역계의  항원  제공  과정의  일부이다.    다시,  CKm532는  dSLIM  또는  비자극된  세포보다  더  강력한  이  면역  자극  특징의  증가를  표시한다.