بعض محتويات هذا التطبيق غير متوفرة في الوقت الحالي.
إذا استمرت هذه الحالة ، يرجى الاتصال بنا علىتعليق وإتصال
1. (WO2019008273) USE OF STRAINS OF SARCOCYSTIDAE TO PREVENT INFECTIOUS DISEASES IN POULTRY
ملاحظة: نص مبني على عمليات التَعرف الضوئي على الحروف. الرجاء إستخدام صيغ PDF لقيمتها القانونية

UTILISATION DE SOUCHES DE SARCOCYSTIDAE DANS LA PREVENTION DE MALADIES INFECTIEUSES DE LA VOLAILLE

La présente invention concerne l'utilisation de souches atténuées de parasites pour la prévention et le traitement de pathologies chez la volaille et notamment chez le jeune oiseau des espèces granivores telles que la poule domestique, la dinde et la pintade.

Les Apicomplexes sont des parasites majoritairement intracellulaires obligatoires qui possèdent un cycle de vie pouvant faire intervenir plusieurs hôtes. Le phylum de ces parasites se subdivise en plusieurs familles.

Toxoplasma gondii (T. gondii) appartient à la famille des Sarcocystidae. Le chat, hôte définitif, excrète le parasite dans l'environnement sous forme d'oocystes. Les hôtes intermédiaires (i.e. l'ensemble des homéothermes) et définitif peuvent s'infecter en ingérant des oocystes présents sur les aliments. Le parasite se transforme alors en tachyzoïtes qui se disséminent dans l'organisme et qui, sous la pression du système immunitaire, s'enkystent avec un tropisme préférentiel pour le système nerveux central, la rétine ou les muscles. L'ingestion de tissus enkystés est la deuxième cause de contamination des hôtes définitifs et intermédiaires. Les souches de T. gondii sont classées en fonction de leur degré de virulence in vivo : les souches de type I (i.e. la souche RH) sont hautement virulentes alors que les souches de type II (i.e. les souches ME49, 76K ou Pru) et III (i.e. les souches CEP ou M7741) sont moins virulentes et établissent généralement des infections chroniques. Par ailleurs, de nombreuses souches atypiques non rattachables aux trois premiers types sont identifiées notamment en Afrique et en Amérique du Sud (Howe & Sibley, 1995, J. Infect. Dis., 172(6) : 1561-6 ; Rajendran et al, 2012, Infect. Genêt Evol, 12(2) : 359-68). Récemment, une souche vivante atténuée de Toxoplasma gondii, le parasite responsable de la toxoplasmose a été mise au point par invalidation de deux gènes codant pour les protéines TgMICl et TgMIC3 (Cérède et al, 2005, J. Exp. Med., 201(3) : 453-63). Cette souche, dénommée Toxo tgmicl-3 KO génère une réponse immunitaire forte et spécifique contre Toxoplasma gondii et permet de prévenir les effets d'une infection ultérieure chez la souris (Ismael et al, 2006, J. Infect. Dis., 194(8) : 1176-83) et chez la brebis (Mévelec et al, 2010, Vet. Res., 41(4) :49).

Neospora caninum (N. caninum) est un parasite intracellulaire, responsable de la néosporose. Il appartient également à la famille des Sarcocystidae. Le cycle de vie de Neospora caninum, est très proche de celui de T. gondii avec deux phases distinctes : une phase sexuée chez l'hôte final (i.e. les canidés et le chien en particulier) qui conduit à la production d'oocystes éliminés dans les fèces et une phase asexuée chez un hôte intermédiaire (i.e. les ovins, les caprins, les bovins, les équidés, etc ..) qui conduit à la production de tachyzoïtes puis de kystes contenant les bradyzoïtes.

Plus récemment, il a été obtenu une souche vivante atténuée de Neospora caninum, la souche Neo ncmicl-3 KO, qui a été invalidée pour les gènes ncmicl et ncmic3 par recombinaison homologue. Il a été montré que cette souche mutante possède des propriétés infectieuses et immunogènes conférant aux mammifères une protection vaccinale vis-à-vis des effets délétères de la néosporose.

Toxoplasma gondii et Neospora caninum ont en commun un processus spécifique d'invasion des cellules hôtes en plusieurs étapes conduisant à la formation d'une vacuole parasitophore dans laquelle le parasite se multiplie et se développe.

Les propriétés immunostimulantes de T. gondii sont connues depuis de nombreuses années et récemment, de nouvelles études ont confirmé l'intérêt d'utiliser T. gondii comme immunostimulant et ont apporté des éléments de réponse sur les mécanismes impliqués. Chez la souris, une infection par T. gondii ou une stimulation avec un extrait parasitaire procure une résistance à une infection par Listeria monocytogenes (Neal et Knoll, 2014, PLoS, Pathog., 10(6) : el004203) par le virus de la grippe H5N1 (O'Brien et al, 2011, J. Virol, 85(17) : 8680-8), ou à une malaria cérébrale due à Plasmodium berghei (Settles et al, 2014, Infect. Immun., 82(3) : 1343-53). Dans le cas de Plasmodium berghei, l'ef et observé dépend de l'IL-12 et la protection serait potentiellement liée à la production précoce d'IFN-γ (Settles et al, 2014). Dans le cas du virus de la grippe, l'effet observé dépend de l'IFN- γ produit par les cellules NK activées par l'extrait parasitaire. Enfin, pour Lysteria monocytogenes, l'administration de la profiline de T. gondii avant ou après infection par Lysteria monocytogenes reproduit l'effet protecteur. Cette protection, dépendante du TLR11, de l'IFN-γ, mais indépendante de l'IL-12 implique les monocytes inflammatoires recrutés sur le site d'infection fortement induit par la profiline (Neal et al, 2014).

Une souche de T. gondii, non réplicative (cps) a également été utilisée dans des traitements contre des tumeurs (Baird et al., 2013, Cancer Res., 73(13) : 3842-51 ; Baird et al., 2013, J. Immunol., 190(1) :469-78 ; Sanders et al., 2015, Oncoimmunology, 5(4) : el 104447). Le parasite vivant en activant le système immunitaire inné, rompt l'immunosuppression ce qui conduit à une réactivation de l'immunité adaptative spécifique de la tumeur, cependant quelques différences existent dans les cellules et les mécanismes impliqués.

Une dizaine d'effecteurs jouent un rôle dans la régulation de la réponse de la cellule hôte suite à une infection par T. gondii.

La protéine ROP16 compte parmi les modulateurs de la réponse immunitaire de l'hôte les mieux étudiés (Saeij et al., 2007, Nature, 445(7126) : 324-7. Cette protéine de rhoptries est une protéine kinase qui interagit avec la cascade de signalisation JAK/STAT en phosphorylant STAT3 via la Tyr 705 et STAT6 via la Tyr 641 et conférant ainsi au parasite un rôle de suppresseur de l'inflammation et de contrôle de l'infection par la cellule hôte. Dans les parasites type I, II et III, ROP16 est capable de phosphoryler STAT3 et STAT6 mais c'est seulement sous sa forme de type I et III qu'elle maintient de manière constitutive et durable, la phospohorylation des STATs 3 et 6 (Saeij et al., 2007, Yamamoto et al., 2009, J. Exp. Med., 206(12) : 2747-60). L'effet immunosuppresseur de ROP16 a notamment été démontré sur une lignée de macrophages murins raw264.7 infectée avec différentes souches de Toxoplasma gondii (type I, II, III, II ROP16 Kl, II ROP16KI-NLS déficient). Une diminution de la sécrétion d'IL-12p40 au bout de 24 heures est observée lorsque les raw264.7 sont infectées avec les souches exprimant ROPI61. (Saeij et al., 2007). Par ailleurs, in vivo, chez la souris inoculée par voie intra-péritonéale avec une souche de type I ROPI61 KO, une augmentation de la réplication du parasite dans le foie, la rate, les poumons et le cerveau comparé à une souche de type I WT est observée (Butcher et al., 2011, PLoS Pathogen, 7(9). : el002236)

La protéine de granule GRA15 est également une protéine capable de modifier la réponse de l'hôte. La forme GRA15 de type II (GRA15n) présente une protéine de 635 acides aminés contrairement à la souche de type I qui présente une protéine tronquée de 312 acides aminés due à une mutation de la séquence codante qui a engendré un codon stop prématuré (Rosowski et al., 2011, J. Exp. Med., 208(1) : 195-212). Seule GRA15n permet l'activation de la voie de signalisation de NF-κΒ indépendamment des voies MyD88 et Trif (Rosowski et al., 201 1) et permet une activation classique des macrophages en Ml qui expriment des cytokines pro-inflammatoires comme IL-12/23p40, l'IL-6 et d'autres costimulateurs, CD40 et CD8 ;

permettant alors l'établissement d'une réponse de type Thl protectrice de l'hôte infecté (Jensen et al, 2011, Cell Host Microbe, 9(6) :462-83).

En synergie avec GRA15n, ROPI61 activerait également STAT5 pour moduler l'expression des gènes de la cellule hôte : Jensen et son équipe (2013) par le biais de l'utilisation d'une variété de parasites transgéniques et KO, ont démontré que GRA15n et ROPI61 permettent de limiter la réplication du parasite dans les intestins d'une souris infectée oralement et améliorent la résistance à l'infection des macrophages stimulés par le TNFa et l'IFN-γ. Ces mécanismes semblent être indépendants de STAT3 et STAT6, mais dépendants de STAT5.ROP16 induit une phosphorylation durable de STAT5 ainsi que sa translocation nucléaire (Jensen et al, 2013, Infect. Immun., 81(6) : 2156-67).

De manière surprenante, les inventeurs ont trouvé que la suppression de la fonction des deux protéines MIC3 et MICl, dans une souche de Sarcocystidae, conduit à une souche mutante qui possède des propriétés infectieuses et immunogènes conférant aux oiseaux et notamment aux volailles une protection vaccinale vis-à-vis des effets de maladies infectieuses.

La présente invention a donc pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite souche mutante de Sarcocystidae étant formulée pour une administration in ovo ou chez un poussin âgé de 0 à 72 heures.

Le terme « volaille » désigne les poules, dindes, pintades, canards, oies, cailles, pigeons, faisans, perdrix, les autruches, les nandous, les émeus et les kiwis élevés ou détenus en captivité en vue de leur reproduction, de la production de viande ou d'œufs de consommation ou de la fourniture de gibier de repeuplement.

Selon la présente invention, la souche mutante de Sarcocystidae peut être administrée in ovo, c'est-à-dire soit dans le liquide amiotique, soit dans l'embryon, après la ponte de l'œuf Le développement d'un œuf fécondé commence, par division cellulaire, dès qu'il traverse l'oviducte de la volaille qui va le pondre. Lorsque la volaille pond l'œuf, l'embryon se refroidit et le développement est suspendu.

Le développement de l'embryon commence quand la température de l'œuf dépasse 26,6 °C.

Selon la présente invention, la souche mutante de Sarcocystidae peut également être administrée chez un poussin.

Le terme « poussin » selon la présente invention désigne toute volaille âgée de 0 à 72 heures et non encore nourries. Toutefois les canards de Barbarie {Cairina moschata) ou leurs croisements peuvent être nourris.

L'utilisation des souches mutantes de Sarcocystidae selon la présente invention par ces modes d'administration, va permettre de prévenir les maladies infectieuses chez la volaille au cours de son développement et tout au long de sa vie.

Au sens de l'invention, on entend par « maladie infectieuse », une maladie provoquée par un agent infectieux choisi parmi : un virus, un parasite ou une bactérie.

La présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine virale.

La maladie d'origine virale est une maladie causée par un virus qui peut être :

- un myxo virus, en particulier le virus Influenza, ou

- un coronavirus, en particulier le virus de la bronchite infectieuse aviaire, ou

- un reo virus, en particulier du virus de l'arthrite virale du poulet, ou

- un picornavirus, en particulier le virus de l'hépatite du caneton,

- un herpesvirus, en particulier le virus de la maladie de Mareck,

- un adénovirus, en particulier le virus de l'entérite hémorragique de la dinde.

Selon un mode de réalisation particulier, la présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine virale, le virus pouvant appartenir aux groupes suivants :

• Groupe I, II de la classification de Baltimore comprenant les virus dont le génome est constitué d'ADN susceptible d'infecter un poussin, en particulier un virus

naturel appartenant à la famille des Herpesviridae, et plus particulièrement le virus de la maladie Marek chez la poule domestique,

• Groupe III, IV et V de la classification de Baltimore comprenant les virus dont le génome est constitué d'AR simple brin ou double brin et qui sont susceptibles d'affecter un poussin, en particulier des virus appartenant à la famille des Orthomyxoviridae et plus particulièrement les virus Influenza aviaires.

• Groupe VI de la classification de Baltimore comprenant les virus à ARN requérant une rétrotranscription en ADN pour la multiplication virale et susceptibles d'infecter un poussin, en particulier les virus de la famille des Retroviridae,

• Groupe VII de la classification de Baltimore comprenant les virus à ADN requérant une rétrotranscription en ARN pour la multiplication virale et susceptibles d'infecter un poussin, en particulier les virus de la famille des Hepadnaviridae, et plus particulièrement le virus de l'hépatite du canard de Pékin (DHBV).

Dans un mode de réalisation particulier, la présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine virale chez la volaille, ladite maladie d'origine virale étant la grippe aviaire.

La présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine bactérienne.

La maladie d'origine bactérienne est une maladie causée par une bactérie des genres :

- Escherichia spp., en particulier l'espèce Escherichia coli

Clostridium spp. en particulier l'espèce Clostridium perfringens

Mycoplasma spp., en particulier l'espèce Mycoplasma gallisepticum,

Salmonella spp., en particulier l'espèce Salmonella pullorum, responsable de la salmonellose aviaire.

Pasteur ella spp., en particulier l'espèce Pasteur ella multocida

Ornithobacterium spp., en particulier l'espèce Ornithobacterium rhinotracheale

Selon un mode de réalisation particulier, la présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine bactérienne (ou causée par une toxine provenant d'une bactérie), ladite bactérie pouvant appartenir aux groupes suivants :

• Des Coques GRAM positif qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant au genre Staphylococcus, Streptococcus ou Enteroccoccus ;

• Des Coques GRAM négatif qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant au genre Neisseria ;

• Des bacilles GRAM positif qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant au genre Listeria, Erysipelothryx, Corynebacterium ou Bacillus ;

• Des bacilles GRAM négatif qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant à la famille des Enterobacteriacae. Pseudomonaceae, Vibrionaceae ou appartenant aux genres Escherichia, Brucella, Haemophilus, Pasteurella, Bordetella, Legionella, Ornithobacterium ou Salmonella ;

• Des bactéries de forme spiralées GRAM positives ou négatives qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant au genre Treponema, Leptospira ou Borrelia ;

• Des bactéries de type mycoplasme qui sont susceptibles d'affecter un poussin directement ou par l'un de ces sous-produits, en particulier des bactéries appartenant au genre Mycoplasma et Ureaplasma ;

• Des bactéries non sus-mentionnées ayant la capacité d'envahir une cellule de poussin, en particulier des bactéries appartenant au genre Chlamydia, Rickettsia ou Micobacterium.

Salmonella Enteritidis est responsable de toxi-infections alimentaires et de gastro-entérites. L'Homme s'infecte par l'intermédiaire de viandes de volailles ou d'œufs contaminés. La poule domestique est l'un des plus importants vecteurs de salmonelles. Elle s'infecte par voie orale. La bactérie colonise ensuite le tube digestif et peut s'implanter durablement dans les ovaires au cours d'une phase transitoire de dissémination systémique.

Le portage long terme dans le tube digestif, notamment dans les casca, est responsable de la contamination des viandes lors de l'abattage et de la contamination de la coquille d'œuf lors du passage par le cloaque. Le portage des salmonelles dans les ovaires peut être responsable du transfert vertical des salmonelles à l'intérieur de l'œuf. Ce mode de contamination est moins fréquent mais potentiellement plus dangereux car il est difficilement détectable et il n'y a pas de mesure corrective possible.

Dans un mode de réalisation particulier, la présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine bactérienne chez la volaille, ladite maladie d'origine bactérienne étant la salmonellose aviaire.

La présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine parasitaire.

La maladie d'origine parasitaire est une maladie causée par un parasite qui peut être :

- Eimeria spp., en particulier l'espèce Eimeria acervulina responsable de la coccidiose

- Echinuria spp., en particulier l'espèce Echinuria uncinata responsable de la spirurose Trichostrongylus spp., en particulier l'espèce Trichostrongylus tenuis

Ascaris spp., en particulier l'espèce Ascaridia galli

Cestoda spp., en particulier l'espèce Choanotaenia infundibulum

Leishmania spp., en particulier l'espèce Leishmania infantum.

Selon un mode de réalisation particulier, la présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille, ladite maladie infectieuse étant une maladie d'origine parasitaire, ledit parasite pouvant appartenir aux groupes suivants :

• Protozoaires susceptibles d'affecter directement un poussin, en particulier des protozoaires appartenant à l'embranchement des sporozoaires, Rhizoflagellés, des ciliés ou appartenant aux genres Encephalitozoon, Enterocytozoon ou blastocystis ;

• Némathelminthes susceptibles d'affecter directement un poussin, en particulier des Némathelminthes appartenant au genre Trichuris, Ascaris, Anisakis, Necator, Strongyloïdes, Toxocara, Ancylostoma, Trichinella, Loa, Onchocerca, Wichereria, ou Enterobius ;

• Plathelminthes susceptibles d'affecter directement un poussin, en particulier des Plathelminthes appartenant au genre Fasciola, Paragonimus, Opisthorchis, Sasciolopsis, Dicrocoelium, Clonorchis, Taenia, Diphyllobothrium, Echinococcus, Multiceps, Hymenolepsis et Shistosoma ;

• Arthropodes susceptibles d'être responsable d'une affection ou de la vectorisation d'un agent infectieux vis-à-vis un poussin, en particulier des arthropodes appartenant à l'ordre des Anoploures des hétéroptères, des Shiphonaptères, des Diptères, des Brachycères ou des Acariens.

Les parasites du genre Eimeria sont responsables de coccidioses aviaires et de pertes économiques importantes dans les élevages avicoles. Ils ont un tropisme intestinal, allant du duodénum aux caeca et induisent des diarrhées plus ou moins sévères. Par exemple, Eimeria tenella est faiblement prévalent et fortement virulent. Ce parasite affecte les caeca et induit une entérite nécrotique hémorragique chez le poulet, responsable de taux de morbidité et de mortalité très important. A l'inverse, Eimeria acervulina envahit le duodénum et provoque une entérite modérée. Il est responsable d'une mortalité inférieure à 10% et d'une morbidité modérée qui se traduit par une perte de poids dans les élevages de poulet de chair industriels entre 1 et 3 semaines post-éclosion. Cette perte de poids peut être responsable d'un déclassement des carcasses et de pertes économiques importantes.

Dans un mode de réalisation particulier, la présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine parasitaire chez la volaille, ladite maladie d'origine parasitaire étant la coccidiose.

La famille des Sarcocystidae, dans les Apicomplexes, comprend notamment les genres Toxoplasma spp. et Neospora spp., qui renferment notamment respectivement les espèces Toxoplasma gondii et Neospora caninum.

Dans une mode de réalisation particulier, la présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche de Toxoplasma spp., en particulier de Toxoplasma gondii.

Dans un mode de réalisation particulier, la présente invention a également pour objet une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche de Neospora spp., en particulier de Neospora caninum.

Dans les souches utilisées dans la présente invention, la fonction des protéines MICl et MIC3 a été supprimée.

Les protéines sont les effecteurs de l'activité cellulaire. La suppression de la fonction d'une protéine peut résulter de son absence de biosynthèse ou de sa non fonctionnalité. L'origine de ce dysfonctionnement peut être liée à des perturbations survenant lors de la transcription du gène codant la protéine, lors de sa traduction ou encore survenir lors de processus de maturation de la protéine (modifications post-traductionelles). La délétion du gène explique également qu'aucune protéine ne puisse être synthétisée.

Les protéines MICl et MIC3 sont des protéines des micronèmes, organelles sécrétoires des Apicomplexes qui jouent un rôle central dans la reconnaissance et l'adhésion aux cellules hôtes. Elles sont respectivement codées par les gènes miel et mic3.

Dans la présente invention, on entend par « la fonction de la protéine MIC1 est supprimée », soit l'absence de l'expression de la protéine MIC1, soit l'expression d'une protéine MIC1 non fonctionnelle, par exemple l'expression d'une protéine ne possédant pas la fonction de la protéine MIC1 et ayant une certaine identité de séquence en acides aminés avec celle de la protéine MIC1.

On entend par « la fonction de la protéine MIC3 est supprimée », soit l'absence de l'expression de MIC3, soit l'expression d'une protéine MIC3 non fonctionnelle, par exemple une protéine ne possédant pas la fonction de la protéine MIC3 et ayant une certaine identité de séquence en acides aminés avec celle de la protéine MIC3.

L'absence de l'expression de la protéine MIC1 et de la protéine MIC3 peut résulter de la délétion de la totalité des gènes miel et mic3 codant respectivement pour les protéines MIC 1 et MIC3, ou de sa région codante, ou d'une mutation, d'une délétion ou d'une insertion d'un ou plusieurs nucléotides dans la région codante des gènes miel et mic3 entraînant l'absence d'expression des protéines ou des protéines avec peu d'identité de séquence en acides aminés avec les protéines MIC1 et MIC3, ou d'un dysfonctionnement de la région promotrice ou de la région régulatrice en cis ou en trans des gènes miel et mic3, ou d'un dysfonctionnement d'un ou plusieurs facteurs de transcription susceptibles de se lier à ladite région promotrice, ou d'un dysfonctionnement de la traduction de l'AR messager, ou de quelques modifications épigénétiques bien connues de l'homme de l'art.

Ainsi, la fonction d'une protéine peut être supprimée par l'inhibition de l'expression des gènes.

On entend par « inhibition de l'expression des gènes miel et mic3 », tous les mécanismes qui perturbent la transcription des gènes miel et mic3 en un ARN messager ou tous les mécanismes qui perturbent la traduction des ARN messager en protéines MIC1 et MIC3, ces deux étapes étant nécessaires à la synthèse d'une protéine MIC1 et MIC3 fonctionnelle.

Une protéine MIC1 non fonctionnelle ou une protéine MIC3 non fonctionnelle est une protéine qui ne possède pas la capacité de reconnaître les cellules hôtes ou qui ne permet pas l'adhésion du parasite audites cellules hôtes. Une protéine non fonctionnelle peut résulter d'une délétion ou d'une insertion d'un ou plusieurs acides aminés ou du décalage du cadre de lecture. Dans ce cas de figure, la modification de l'acide nucléique de la région codante ne bloque pas le mécanisme d'expression de la protéine qui peut éventuellement conserver une certaine identité de séquence en acides aminés avec celle de la protéine MIC1 ou celle de la protéine MIC3, mais change le cadre de lecture de l'ARNm correspondant lors de la traduction de la protéine. La non fonctionnalité de la protéine MIC3 et de la protéine MIC1, peut également être la conséquence de modifications post-traductionnelles inopérantes ou insuffisantes (i.e. glycosylation, isoprénylation, phosphorylation, sulfatation, amidation, acétylation, alkylation, etc) et qui lui permettaient d'assurer sa fonction.

La fonction des protéines MIC3 et MIC1, peut également être supprimée de manière indirecte, notamment en altérant ou en supprimant l'expression d'une ou plusieurs autres protéines (notamment d'autres adhésines) qui se lient aux protéines MIC3 et MIC1, pour former un complexe fonctionnel. La déstructuration d'un tel complexe entraine une perte de fonction des protéines MIC3 et MIC1.

La fonction d'une protéine peut être supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène codant pour ladite protéine, ou

- la délétion totale du gène codant pour ladite protéine, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante, ou

- une déstabilisation de TARN messager résultant de la transcription du gène codant pour ladite protéine, ou

- une inhibition de la traduction de F ARN messager du gène codant pour ladite protéine.

Par « mutation d'un ou plusieurs nucléotides », on entend la substitution, permutation ou le remplacement d'un ou plusieurs nucléotides d'une séquence nucléotidique par un ou plusieurs nucléotides non présents dans la séquence sauvage. Par séquence sauvage, on désigne la séquence nucléotidique trouvée à l'état naturel dans la souche sauvage du parasite. La séquence sauvage est par définition dépourvue de toute intervention humaine par le biais du génie génétique.

Par « délétion d'un ou plusieurs nucléotides », on entend la suppression d'un ou plusieurs nucléotides d'une séquence nucléotidique.

Par « insertion d'un ou plusieurs nucléotides », on entend l'addition, l'ajout ou l'intégration d'un ou plusieurs nucléotides dans une séquence nucléotidique.

La mutation, la délétion ou l'insertion d'un ou plusieurs nucléotides peut avoir lieu à l'intérieur d'un ou plusieurs exons du gène correspondant et modifier par conséquent la région codante dudit gène, ou bien avoir lieu à l'intérieur d'un ou plusieurs introns et modifier le site d'épissage d'un intron concerné. Cette modification du site d'épissage change par conséquent le cadre de lecture de l'ARNm et aboutit à la traduction d'une nouvelle protéine dont la séquence en acides aminés diffère de la séquence de la protéine dite sauvage.

On entend par « délétion totale du gène », la délétion de la séquence codante entière (introns et exons), la délétion de la région promotrice et la délétion des régions transcrites non traduites 5' et 3', dites 5' et 3'UTR, le terme « gène » désignant la région promotrice (également appelée promoteur), la séquence codante et les régions 5' et 3' UTR.

On entend par « délétion totale de la région promotrice », la suppression de la séquence promotrice totale c'est-à-dire la suppression de la séquence nucléotidique située en amont de la région 5' UTR transcrite non traduite qui sert de boîtier de régulation de l'expression d'un gène.

La délétion partielle de la région promotrice ou la délétion partielle de la séquence codante correspond à une délétion partielle du gène.

Par délétion partielle de la séquence codante on entend la suppression d'une partie des exons de la séquence codante, suffisante pour altérer la fonction de la protéine exprimée, ou la suppression d'une partie des introns entraînant une altération de l'épissage.

On entend par « délétion partielle de la région promotrice », la suppression d'une partie de la séquence promotrice c'est-à-dire d'une partie de la séquence nucléotidique située en amont de la région 5' UTR transcrite non traduite qui sert de boîtier de régulation de l'expression d'un gène.

Par « déstabilisation de l'ARN messager », on entend une diminution de sa durée de demi-vie, c'est-à-dire de la période de temps pendant laquelle un ARN messager est disponible pour permettre sa traduction en une protéine. La stabilisation des ARN messagers est assurée par des éléments cis (les séquences 5' et 3' UTR bordant les séquences codantes d'un gène) et des éléments trans, notamment des protéines capables de se lier aux éléments cis. La durée de

demi-vie d'un ARN messager peut varier en réponse à divers stimuli tels que des facteurs environnementaux, des facteurs de croissance ou des hormones. Une modification, réalisée in vitro par génie génétique, des séquences nucléotidiques des éléments cis est susceptible de modifier la durée de demi-vie de l'ARN messager.

Par « inhibition de la traduction de l'ARN messager d'un gène », on entend le blocage de la traduction de TARN messager en la protéine lui correspondant. Dans ce cas de figure, TARN messager d'un gène est présent dans la cellule, alors que la protéine lui correspondant est absente. L'inhibition de la traduction de l'ARN messager d'un gène peut résulter du dysfonctionnement d'un élément de la machinerie traductionnelle, notamment des ribosomes, des ARNs ribosomiques (ARNr) ou des ARNs de transfert (ARNt), ou des aminoacyl-ARNt synthétases.

La présente invention porte également sur une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies infectieuses chez la volaille :

ladite fonction de la protéine MIC3 étant supprimée par :

une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène mic3 codant pour la protéine MIC3, ou

la délétion totale du gène mic3, ou

la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène mic3, ou

une déstabilisation de l'ARN messager résultant de la transcription du gène mic3, ou une inhibition de la traduction de l'ARN messager du gène mic3 ;

et ladite fonction de la protéine MICl étant supprimée par :

une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène miel codant pour la protéine MIC 1 , ou

la délétion totale du gène miel, ou

la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène miel, ou

une déstabilisation de l'ARN messager résultant de la transcription du gène miel, ou une inhibition de la traduction de l'ARN messager du gène miel.

Dans un mode particulier de réalisation, la présente invention concerne une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche comprenant une délétion totale des gènes miel et mic3.

Dans un mode particulier de réalisation, la présente invention concerne une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, dans laquelle la fonction de la protéine ROP16I est également supprimée et/ou ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II ainsi que les moyens nécessaire à l'expression de ladite protéine.

L'expression « moyens nécessaire à l'expression » d'une protéine (le terme protéine étant utilisé pour toute molécule d'acides aminés, telle que protéine, protéine de fusion, fragment de protéine, peptide, polyprotéine, polypeptide,...) s'entend de tout moyen qui permet d'obtenir la protéine, notamment un promoteur, un terminateur de transcription, une origine de réplication et de préférence un marqueur de sélection. Les moyens nécessaires à l'expression d'un peptide sont liés de façon opérationnelle à la séquence d'acides nucléiques codant ledit peptide (d'intérêt).

Les moyens nécessaires à l'expression d'un peptide peuvent être des moyens homologues, c'est-à-dire inclus dans le génome du vecteur utilisé, ou bien être hétéro logues. Dans ce dernier cas, lesdits moyens sont clonés avec le peptide d'intérêt à exprimer.

La présente invention porte également sur une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC 1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, et dans laquelle

la fonction de la protéine ROP16I codée par le gène roplôl, est supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de TARN messager résultant de la transcription du gène roplôl ou

- une inhibition de la traduction de l'ARN messager du gène roplôl.

La présente invention porte également sur une souche mutante mutante de Sarcocystidae dans laquelle la fonction de la protéine MICl et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, dans laquelle ladite souche mutante est une souche mutante de Toxoplasma spp., et dans laquelle

• soit la fonction de la protéine ROP16I codée par le gène roplôl est supprimée, ladite fonction de la protéine ROP16I étant supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I, ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène roplôl, ou

- une inhibition de la traduction de l'ARN messager du gène roplôl ;

• soit ladite souche comprend au moins un acide nucléique exogène codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine ;

• soit la fonction de la protéine ROP16I codée par le gène roplôl est supprimée, ladite fonction de la protéine ROP16I étant supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I, ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène roplôl, ou

- une inhibition de la traduction de l'ARN messager du gène roplôl,

et ladite souche comprend au moins un acide nucléique exogène codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine.

Par l'expression « ladite souche comprend au moins un acide nucléique exogène codant pour la protéine GRA15II » on entend que ladite souche de Sarcocystidae a été manipulée de sorte qu'il soit introduit au sein de ladite souche de Sarcocystidae au moins une (nouvelle) copie de l'acide nucléique codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine. Cette introduction peut être temporaire via l'utilisation d'un vecteur non intégratif ou permanente via l'introduction de manière ciblée ou aléatoire dans le génome, e.g. par recombinaison homologue, de ladite souche de Sarcocystidae dudit au moins un acide nucléique. Par l'expression « une (nouvelle) copie de l'acide nucléique codant pour la protéine GRA15II » on entend que les souches de Sarcocystidae de l'Invention peuvent ou non posséder un acide nucléique permettant d'exprimer la protéine GRA15II. Par ailleurs, l'acide nucléique codant pour la protéine GRA15II permet avantageusement de tagger ladite prtoéine GRA15II avec un tag, e.g. HA.

La présente invention porte également sur une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, et dans laquelle

ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II ainsi que les moyens nécessaire à l'expression de ladite protéine.

Dans un mode de réalisation particulier, la présente invention concerne une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, dans laquelle la fonction de la protéine ROP16I codée par le gène roplôl, est également supprimée et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II ainsi que les moyens nécessaire à l'expression de ladite protéine.

Dans un mode de réalisation particulier, la présente invention concerne une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, dans laquelle la fonction de la protéine ROP16I codée par le gène roplôl, est également supprimée et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, à un locus différent du locus dudit gène roplôl.

Lorsqu'un gène hétérologue à la souche initiale est introduit dans le génome de ladite souche par recombinaison, cette recombinaison peut être aléatoire ou ciblée de manière à contrôler l'endroit du génome où sera inséré ledit gène.

Le terme « locus » défini un emplacement physique précis et invariable sur un chromosome. Au sens de la présente demande, un locus défini un endroit du chromosome où se situe un gène.

Ainsi, un gène hétérologue peut être inséré de manière aléatoire et ainsi à un locus différent d'un gène connu, ou il peut être inséré de manière ciblée au locus d'un gène connu, qui pourra voir été préalablement délété.

Dans un mode de réalisation particulier, la présente invention concerne une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma spp., dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, dans laquelle la fonction de la protéine ROP16I codée par le gène roplôl, est également supprimée et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, au locus dudit gène roplôl.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3 et la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii dans laquelle la fonction de la

protéine MIC3 est supprimée par une délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel, et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, à un locus différent du locus du gène roplôl codant pour la protéine ROP16I.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel, la fonction de la protéine ROP16I codée par le gène roplôl est supprimée par une délétion totale dudit gène roplôl.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel, la fonction de la protéine ROP16I codée par le gène roplôl est supprimée par une délétion totale dudit gène roplôl et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel, la fonction de la protéine ROP16I codée par le gène roplôl est supprimée par une délétion totale dudit gène roplôl et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, à un locus différent du locus dudit gène roplôl.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel, la fonction de la protéine ROP16I codée par le gène roplôl est supprimée par une délétion totale dudit gène roplôl et ladite souche comprend au moins un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, au locus dudit gène roplôl.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle la fonction de la protéine MIC1 et la fonction de la protéine MIC3 sont supprimées, pour son utilisation dans la prévention de maladies d'origine infectieuse chez la volaille ladite souche mutante étant une souche mutante de Neospora caninum dans laquelle la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3 et la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC1, la fonction de la protéine MIC3 sont supprimées, et dans laquelle la fonction de la protéine ROP16I est également supprimée et/ou ladite souche comprend un acide nucléique codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC1, la fonction de la protéine MIC3 et la fonction de la protéine ROP16I sont supprimées.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC1, la fonction de la protéine MIC3 sont supprimées, et ladite souche comprend un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaires à

l'expression de ladite protéine, à un locus différent du locus dudit gène roplôl codant pour la protéine ROP16I.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante étant une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MICl, la fonction de la protéine MIC3 et la fonction de la protéine ROP16I codée par le gène roplôl sont supprimées et ladite souche comprend un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaires à l'expression de ladite protéine, à un locus différent du locus dudit gène roplôl.

La présente invention concerne également une souche mutante dans laquelle ladite souche de Sarcocystidae est une souche de Toxoplasma spp. , en particulier une souche de Toxoplasma gondii.

La présente invention concerne également une souche mutante dans laquelle ladite souche de Sarcocystidae est une souche de Neospora spp., en particulier une souche de Neospora caninum.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante de Sarcocystidae étant une souche mutante de Toxoplasma gondii dans laquelle

la fonction de la protéine MIC3 est supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène mic3 codant pour la protéine MIC3 ou

- la délétion totale du gène mic3, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène mic3, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène mic3, ou

- une inhibition de la traduction de l'ARN messager du gène mic3

la fonction de la protéine MICl est supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène miel codant pour la protéine MICl, ou

- la délétion totale du gène miel, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène miel, ou

- une déstabilisation de TARN messager résultant de la transcription du gène miel, ou

- une inhibition de la traduction de F ARN messager du gène miel,

et dans laquelle

la fonction de la protéine ROP16I est supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I, ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène roplôl, ou

- une inhibition de la traduction de l'ARN messager du gène roplôl

et/ou

ladite souche comprend un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante de Sarcocystidae étant une souche mutante de Toxoplasma gondii dans laquelle

la fonction de la protéine MIC3 est supprimée par une délétion totale du gène mic3 la fonction de la protéine MIC1 est supprimée par une délétion totale du gène miel et la fonction de la protéine ROP16I est supprimée par une délétion totale du gène roplôl.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante de Sarcocystidae étant une souche mutante de Toxoplasma gondii dans laquelle

la fonction de la protéine MIC3 est supprimée par délétion totale du gène mic3

la fonction de la protéine MIC1 est supprimée par délétion totale du gène miel

et ladite souche comprend un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine.

La présente invention concerne également une souche mutante de Sarcocystidae, ladite souche mutante de Sarcocystidae étant une souche mutante de Toxoplasma gondii dans laquelle

la fonction de la protéine MIC3 est supprimée par délétion totale du gène mic3

la fonction de la protéine MIC1 est supprimée par délétion totale du gène miel

la fonction de la protéine ROP16I est supprimée par délétion totale du gène roplôl

et ladite souche comprend un acide nucléique codant pour la protéine GRA15II, ainsi que les moyens nécessaire à l'expression de ladite protéine, à un locus différent du locus dudit gène roplôl codant pour la protéine ROP16I.

La présente invention concerne également une souche mutante de Sarcocystidae dans laquelle ladite souche mutante est une souche mutante de Toxoplasma gondii, dans laquelle la fonction de la protéine MIC1 est supprimée, ladite fonction de la protéine MIC1 étant supprimée par :

une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène miel codant pour la protéine MIC 1 , ou

la délétion totale du gène miel, ou

la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène miel, ou

une déstabilisation de l'AR messager résultant de la transcription du gène miel, ou

une inhibition de la traduction de l'ARN messager du gène miel ;

dans laquelle la fonction de la protéine MIC3 est supprimée, ladite fonction de la protéine

MIC3 étant supprimée par :

une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène mic3 codant pour la protéine MIC3, ou

la délétion totale du gène mic3, ou

la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène mic3, ou

une déstabilisation de l'ARN messager résultant de la transcription du gène mic3, ou

une inhibition de la traduction de l'ARN messager du gène mic3 ;

et dans laquelle

• soit la fonction de la protéine ROP16I codée par le gène roplôl est supprimée, ladite fonction de la protéine ROP16I étant supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I, ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène roplôl, ou

- une inhibition de la traduction de l'ARN messager du gène roplôl ;

• soit ladite souche comprend un acide nucléique exogène codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine ;

• soit la fonction de la protéine ROP16I codée par le gène roplôl est supprimée, ladite fonction de la protéine ROP16I étant supprimée par :

- une mutation, une délétion ou une insertion d'un ou plusieurs nucléotides dans la séquence nucléotidique du gène roplôl codant pour la protéine ROP16I, ou

- la délétion totale du gène roplôl, ou

- la délétion totale ou partielle de la région promotrice et/ou la délétion totale ou partielle de la séquence codante du gène roplôl, ou

- une déstabilisation de l'ARN messager résultant de la transcription du gène roplôl, ou

- une inhibition de la traduction de l'ARN messager du gène roplôl,

et ladite souche comprend un acide nucléique exogène codant pour la protéine GRA15II ainsi que les moyens nécessaires à l'expression de ladite protéine ;

notamment ladite souche étant une souche de Toxoplasma gondii dans laquelle la fonction de la protéine MIC3 est supprimée par délétion totale du gène mic3, la fonction de la protéine MIC1 est supprimée par délétion totale du gène miel, et la fonction de la protéine ROP16I est supprimée par délétion totale du gène roplôl et ladite souche comprend un acide nucléique exogène codant pour la protéine GRA15II, ainsi que les moyens nécessaires à l'expression de ladite protéine.

La présente invention concerne également une composition pharmaceutique comprenant au moins l'une des souches mutantes de Sarcocystidae telle que définie ci-dessus.

La présente invention concerne également une composition comprenant au moins l'une des souches mutantes de Sarcocystidae telle que définie ci-dessus, pour son utilisation comme médicament.

DESCRIPTIONS DES FIGURES

Figure 1-A : cette figure est une représentation schématique du plasmide pTgMIC3-KO-CAT-GFP loxP. Ce plasmide de 9 931 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT-GFP placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. Cette cassette de sélection est encadrée par deux sites loxP identiques de même orientation, ajoutés par PCR. De part et d'autre de la cassette ont été insérées les régions homologues flanquant le gène tgmic3.

Figure 1-B : cette figure est une représentation schématique du plasmide pTgMICl-KO-CAT-GFP loxN. Ce plasmide de 10 285 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT-GFP placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. Cette cassette de sélection est encadrée par deux sites loxN identiques de même orientation, ajoutés par PCR. De part et d'autre de la cassette ont été insérées les régions homologues flanquant le gène tgmicl.

Figure 1-C : cette figure est une représentation schématique du plasmide pTSAGl- Cre recombinase. Ce plasmide de 4 694 paires de bases comprend le gène codant pour la protéine CRE-Recombinase placé sous le contrôle du promoteur du gène sagl de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. En aval du gène codant la Cre

Recombinase, la séquence 3'UTR du gène sagl de Toxoplasma gondii est insérée pour stabiliser l'ARNm codant la protéine Cre Recombinase.

Figure 2-A : cette figure illustre les 4 étapes pour obtenir la souche Toxo tgmicl-3 KO 2G. La première étape de recombinaison homologue permet l'intégration du gène codant pour l'enzyme CAT-GFP au locus du gène mic3. Une sélection par le chloramphénicol permet d'amplifier la souche simple mutante Toxo tgmic3 KO. Dans une seconde étape, le gène codant pour la protéine CAT-GFP est supprimé par action de la Cre Recombinase. La troisième étape permet l'intégration du gène codant pour l'enzyme CAT-GFP au locus du gène miel. Une sélection par le chloramphénicol permet d'amplifier la souche simple mutante Toxo tgmicl-3 KO. Enfin, dans une dernière étape, le gène codant pour la protéine CAT-GFP est supprimé par action de la Cre Recombinase.

Figure 2-B : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec la souche sauvage RH de Toxoplasma gondii, la souche Toxo tgmic3-KO, la souche Toxo tgmic3 KO 2G, la souche Toxo tgmicl-3 KO et la souche finale Toxo tgmicl-3 KO 2G en utilisant les jeux d'amorces des PCR du Tableau 3.

Figure 2-C : cette figure représente les résultats des séquençages obtenus sur la souche Toxo tgmicl-3 KO 2G et confirme que les gènes miel et mic3 ont été supprimés et remplacés respectivement par des cicatrices LoxN et LoxP.

Figure 2-D : cette figure illustre la position des amorces nucléiques utilisées dans la présente invention pour détecter la présence des trois gènes tgmic3, tgmicl, cat-gfp dans les souches sauvages et/ou des souches mutantes de Toxo tgmic3 KO et/ou Toxo tgmic3 KO 2G et/ou Toxo tgmicl-3 KO et/ou Toxo tgmicl-3 KO 2G de Toxoplasma gondii. Les chiffres représentent la numérotation des séquences d'amorces (SEQ ID NO :x) définies dans la présente demande.

Figure 3 A et B : cette figure illustre l'analyse par immunofluorescence de la détection des protéines MIC1, MIC3 ou CAT-GFP obtenus respectivement avec la souche sauvage RH de Toxoplasma gondii, la souche Toxo tgmic3 KO, la souche Toxo tgmic3 KO 2G, la souche Toxo tgmicl-3 KO et la souche Toxo tgmicl-3 KO 2G en utilisant un anticorps

spécifiquement dirigé contre la protéine MIC1 (figure 3 A), MIC3 (figure 3B) ou directement avec les propriétés fluorescentes intrinsèques de la protéine CAT-GFP.

Figure 4 : cette figure est une représentation schématique du plasmide pTgROP16-KO-CAT-tdTomato. Ce plasmide de 9 443 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT -tdTomato placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. De part et d'autre de la cassette ont été insérées les régions homologues flanquant le gène tgroplô.

Figure 5-A : cette figure illustre l'étape pour obtenir la souche Toxo tgmicl-3 KO 2G ropl6 KO. Cette étape de recombinaison homologue permet l'intégration du gène codant pour l'enzyme CAT -tdTomato au locus du gène ropl6. Une sélection par le chloramphénicol permet d'amplifier la souche simple mutante Toxo tgmicl-3 KO 2G ropl6 KO.

Figure 5-B : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec la souche Toxo tgmicl-3 KO 2G et la souche Toxo tgmic3 KO 2G et la souche Toxo tgmicl-3 KO - 2G / ROP 16 KO en utilisant les jeux d'amorces des PCR du Tableau 6.

Figure 5-C : cette figure illustre la position des amorces nucléiques utilisées dans la présente invention pour détecter la présence des deux gènes tgroplô et cat-tdtomato dans la souche sauvage et/ou la souche mutante de Toxo tgmicl-3 KO roplô KO de Toxoplasma gondii. Les chiffres représentent la numérotation des séquences d'amorces (SEQ ID NO :x) définies dans la présente demande.

Figure 6 : cette figure représente le plasmide pT230-2G GRA15n. Ce plasmide de 8108 paires de bases comprend le gène de sélection Ble placé sous le contrôle du promoteur de l'a-tubuline de Toxoplasma gondii pour permettre l'expression d'une protéine permettant la résistance à la phléomycine. En aval de cette cassette a été intégrée la cassette d'expression permettant de coder la protéine Gral5HAII.

Figure 7-A : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec les souches Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO 2G GRA15n Kl et la souche sauvage ME49, en utilisant les jeux d'amorces des PCR du Tableau 9.

Figure 7-B : cette figure illustre la position des amorces nucléiques utilisées dans la présente invention pour détecter la présence des gènes gral5 et gral5II dans les souches Toxo tgmicl- 3 KO 2G, Toxo tgmicl-3 KO 2G GRA15n Kl et la souche sauvage ME49 (type II) de Toxoplasma gondii. Les chiffres représentent la numérotation des séquences d'amorces (SEQ ID NO : x) définies dans la présente demande.

Figure 8 : cette figure illustre l'analyse par immuno fluorescence de la détection de la protéine GRA15 (via le tag HA) obtenu respectivement avec les souches Toxo tgmicl-3 KO 2G et Toxo tgmicl-3 KO 2G GRA15n Kl.

Figure 9 : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec les souches Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO 2G ropl6 KO GRA15n Kl et la souche sauvage ME49, en utilisant les jeux d'amorces des PCR du Tableau 9.

Figure 10 : cette figure illustre l'analyse par immuno fluorescence de la détection de la protéine GRA15 (via le tag HA) obtenu respectivement avec les souches Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO 2G ropl6 KO et Toxo tgmicl-3 KO 2G ropl6 KO GRA15n Kl.

Figure 11 : cette figure est une représentation schématique du plasmide pTgRopl6KO-Gral5IIKI-CAT-GFP lox2272. Ce plasmide de 12721 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT-GFP placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. Cette cassette de sélection est encadrée par deux sites lox2272 identiques de même orientation, ajoutés par PCR. En aval de cette cassette a été intégré la cassette d'expression permettant de coder la protéine Gral5HAII. Puis de part et d'autre de ces cassettes ont été insérées les régions homologues flanquant le gène tgroplô.

Figure 12-A : cette figure illustre les 2 étapes pour obtenir la souche Toxo tgmicl-3 KO ropl6 KO GRA15II KI-2G. La première étape de recombinaison homologue permet l'intégration du gène codant pour l'enzyme CAT-GFP et le gène gral5IIHA au locus du gène ropl6. Une sélection par le chloramphénicol permet d'amplifier la souche mutante Toxo tgmicl-3 KO ropl6 KO GRA15II Kl. Dans une seconde étape, le gène codant pour la protéine CAT-GFP est supprimé par action de la Cre Recombinase pour obtenir la souche Toxo tgmicl-3 KO ropl6 KO GRA15II KI-2G.

Figure 12- B : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec les souches Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO ropl6 KO GRA15II Kl et Toxo tgmicl-3 KO ropl6 KO GRA15II Kl 2G

Figure 12-C : cette figure illustre la position des amorces nucléiques utilisées dans la présente invention pour détecter la présence des trois gènes tgroplô, gral5II, cat-gfp dans les souches sauvages et/ou des souches mutantes de Toxo tgmicl-3 KO ropl6 KO Gral5II Kl de Toxoplasma gondii. Les chiffres représentent la numérotation des séquences d'amorces (SEQ ID NO :x) définies dans la présente demande.

Figure 12-D : cette figure représente les résultats des séquençages obtenus sur la souche Toxo tgmicl-3 KO ropl6 KO GRA15II Kl 2G et confirme que les gènes ropl6 et cat-gfp ont été supprimés et remplacés par la cicatrice Lox2272 et le gène gral5HAII.

Figure 13 : cette figure illustre l'analyse par immuno fluorescence de la détection de la protéine GRA15 (via le tag HA) obtenu respectivement avec les souches Toxo tgmicl-3 KO ropl6 KO GRA15II Kl et Toxo tgmicl-3 KO ropl6 KO GRA15II KI-2G en utilisant un anticorps spécifiquement dirigé contre le tag HA. Cette figure illustre également la suppression de la cassette CATGFP avec la disparition de la fluorescence GFP pour la souche Toxo tgmicl-3 KO ropl6 KO GRA15II KI-2G.

Figure 14-A : cette figure est une représentation schématique du plasmide pNcMIC3-KO-CAT-GFP loxN. Ce plasmide de 10063 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT-GFP placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. Cette cassette de sélection est encadrée par deux sites loxN identiques de même orientation, ajoutés par PCR. De part et d'autre de la cassette ont été insérées les régions homologues flanquant le gène ncmic3.

Figure 14-B : cette figure est une représentation schématique du plasmide pNcMICl-KO-CAT-GFP loxP. Ce plasmide de 10069 paires de bases comprend le gène de sélection codant pour la protéine chimérique CAT-GFP placé sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii pour permettre l'expression du gène dans le parasite. Cette cassette de sélection est encadrée par deux sites loxP identiques de même orientation, ajoutés par PCR. De part et d'autre de la cassette ont été insérées les régions homologues flanquant le gène ncmicl.

Figure 15-A : cette figure illustre les 4 étapes pour obtenir la souche Neo ncmicl -3 KO 2G. La première étape de recombinaison homologue permet l'intégration du gène codant pour l'enzyme CAT-GFP au locus du gène mic3. Une sélection par le chloramphénicol permet d'amplifier la souche simple mutante Neo ncmic3 KO. Dans une seconde étape, le gène

codant pour la protéine CAT-GFP est supprimé par action de la Cre Recombinase. La troisième étape permet l'intégration du gène codant pour l'enzyme CAT-GFP au locus du gène miel. Une sélection par le chloramphénicol permet d'amplifier la souche simple mutante Neo ncmicl-3 KO. Enfin, dans une dernière étape, le gène codant pour la protéine CAT-GFP est supprimé par action de la Cre Recombinase.

Figure 15-B : cette figure illustre la position des amorces nucléiques utilisées dans la présente invention pour détecter la présence des trois gènes ncmic3, ncmicl, cat-gfp dans les souches sauvages et/ou des souches mutantes de Neo ncmic3 KO et/ou Neo ncmic3 KO 2G et/ou Neo ncmicl-3 KO et/ou Neo ncmicl-3 KO 2G de Neospora caninum. Les chiffres représentent la numérotation des séquences d'amorces (SEQ ID NO :x) définies dans la présente demande.

Figure 15-C : cette figure représente les profils électrophorétiques des produits PCR obtenus respectivement avec la souche sauvage NC-1 de Neospora caninum, la souche Neo ncmic3 KO, la souche Neo ncmic3 KO 2G, la souche Neo ncmicl-3 KO et la souche Neo ncmicl-3 KO 2G en utilisant les jeux d'amorces des PCR du Tableau 16.

Figure 15-D : cette figure représente les résultats des séquençages obtenus sur la souche Neo ncmicl-3 KO 2G et confirme que les gènes miel et mic3 ont été supprimés et remplacés respectivement par des cicatrices LoxP et LoxN.

Figure 16- A : cette figure illustre l'analyse par immuno fluorescence de la détection de la protéine MIC3 obtenue respectivement avec la souche sauvage NC-1 de Neospora caninum et souche Neo ncmicl-3 KO 2G en utilisant un anticorps spécifiquement dirigé contre la protéine MIC3.

Figure 16-B : cette figure illustre l'analyse par immuno fluorescence de la détection de la protéine CATGFP obtenue respectivement avec la souche sauvage NC-1 de Neospora caninum et les souches mutantes de Neospora caninum en utilisant la fluorescence intrinsèque de la protéine CATGFP. Cette figure permet de mettre en évidence la présence de la protéine CATGFP ou l'absence de la protéine CATGFP suite à l'action de la Cre Recombinase.

Figure 17- A : cette figure illustre l'analyse de l'activation de NF-κΒ après infection par des souches de T. gondii et les souches dérivées de Toxo KO 2G.

Après 18 à 24H d'infection (MOI=5), l'activité de NF-κΒ est quantifiée à partir du surnageant des cellules THPl-Blue NF-κΒ. Des tests statistiques non paramétriques de Kruskal-Wallis

ont été réalisés, les souches Toxo Rop 16, Toxo Gral5 Kl et Toxo KO+ sont comparées à la souche Toxo KO 2G. (ns : non significatif ; *** p<0.001 ; **** p<0.0001).

Figure 17-B : cette figure illustre la production en IL-12p40 obtenue suite à l'infection des macrophages par différentes souches de T. gondii.

Les macrophages sont pré-stimulés durant 1H (lOpg rm ΙΚΝγ et lOOng de LPS) avant d'être infectés avec les différentes souches de T. gondii (MOI=5). L'IL12p40 est dosée par ELISA (kit Duoset IL12p40 murin - rndsystems). Des tests statistiques non paramétriques de Kruskal-Wallis ont été réalisés, les souches Toxo Rop 16, Toxo Gral5 Kl et Toxo KO+ sont comparées à la souche Toxo KO 2G. (ns : non significatif ; ** p<0.01 ; **** p<0.0001).

Figure 18 : cette figure illustre la croissance des poussins entre J4 et J27 après immunisation (A-B) par voie in ovo à dose de 103, 104 ou 105 tachyzoïtes par animal inoculé soit dans le liquide amniotique (A) soit dans l'embryon (B). (C) Immunostimulation effectuée par voie sous-cutanée à 1 jour d'âge à la dose de 104, 105 ou 106 tachyzoïtes par animal. (D-F) Analyse statistique correspondante. ANOVA deux voies avec test post-hoc de Dunnett. Les animaux ayant été sacrifiés en série, le nombre d'animaux restant par groupe est indiqué au-dessus des courbes. Moyenne +/- SEM.

Figure 19 : cette figure illustre le titre en anticorps dirigés contre Toxo-KO+ 2G après immunisation (A-B) par voie in ovo à dose de 103, 104 ou 105 tachyzoïtes par animal inoculé soit dans le liquide amniotique (A) soit dans l'embryon (B). (C) Immunostimulation effectuée par voie sous-cutanée à 1 jour d'âge à la dose de 104, 105 ou 106 tachyzoïtes par animal. (D-F) Analyse statistique correspondante. ANOVA deux voies avec test post-hoc de Bonferroni. N=5 par groupe. Moyenne +/- SEM.

Figure 20 : cette figure illustre le Poids et le gain quotidien moyen des animaux. A-B Poids des animaux infectés à J14 ou non infectés au moment de l'abattage. C-D Poids des animaux sacrifiés à J35, infectés à J7 à gauche ou infectés à J14 à droite. E-F Gain quotidien moyen des animaux sacrifiés à J35, infectés à J7 à gauche ou infectés à J14 à droite. ANOVA deux voies avec test Tukey post-hoc. Les analyses statistiques complètes sont disponibles en Annexe page 16. n=9-12 par groupe.

Figure 21 : cette figure illustre le score de lésion macroscopique intestinal mesuré sept jours après infection par Eimeria acervulina. Résultats obtenus pour les groupes infectés à 7 jours ou à 14 jours de vie. Un test de fréquence (χ2) a été utilisé pour comparer les groupes. Il n'y a pas de différence significative entre les animaux immunostimulés et les animaux contrôles. N=15-18/groupe.

Figure 22A : cette figure illustre l'Expression des IgY dirigés contre Toxoplasma gondii mesurée dans le sérum des poulets sacrifiés à J21 (infectés à J14) et à J35 (infectés à J7 et J14). Aucun titre en anticorps n'a pu être déterminé chez les animaux infectés à J7 et sacrifiés à J14 (données non représentées). ANOVA deux voies avec test post-hoc de Tukey. n=9-18/groupe.

Figure 22B : cette figure illustre l'Expression des IgY dirigés contre Toxoplasma gondii mesurée dans le sérum des poulets sacrifiés à J35. Les animaux ont été immunostimulés avec 103 ou 105 tachyzoïtes de la souche Toxo tgmicl-3 KO ropl6 KO gral5II Kl. Du DMEM (Dulbecco's modifîed eagle's médium) a été utilisé comme contrôle. Les animaux ensuite été infectés ou non par 2.105 oocystes d'Eimeria acervulina à J7 ou à J14 post immunostimulation. ANOVA deux voies avec test post-hoc de Tukey. n=9- 12/groupe.

Figure 23 : cette figure illustre la Prise de poids des poulets immunostimulés avec des tachyzoïtes frais (A-B) ou lyophilisés (C-D). (A-B) Immunostimulation effectuée à Jl à la dose de 105 tachyzoïtes (se), le DMEM (Dulbecco's modifîed eagle's médium) seul a été utilisé comme contrôle. (C-D) Immunostimulation effectuée à Jl à la dose de 107 tachyzoïtes (se), la solution F4 a été utilisée comme contrôle. Animaux infectés 7 jours post-Immunostimulation (A et C) ou 14 jours post-immunostimulation (B et D) par 2.27.104 bactéries de souche Salmonella Enteritidis par voie orale. Les animaux ont été sacrifiés en série, le nombre d'animaux restant par groupe est représenté sous les courbes. Moyenne +/-SEM. Les écarts sont plus petits que les caractères représentant les points de courbe et ne sont donc pas toujours visible. ANOVA deux voies avec test Tukey post-hoc. Ns p value > 0,05 ; ** p value < 0,001 ; *** p value < 0,0005 ; **** p value < 0,0001.

Figure 24 : cette figure représente le portage des salmonelles dans les casca de poulets immunostimulés avec des tachyzoïtes frais (A-B) ou lyophilisés (C-D). (A-B) Immunostimulation effectuée à Jl à la dose de 105 tachyzoïtes (se), le DMEM seul a été utilisé comme contrôle. (C-D) Immunostimulation effectuée à Jl à la dose de 107 tachyzoïtes lyophilisés (se), la solution F4 a été utilisée comme contrôle. Animaux infectés 7 jours post-immunostimulation (A et C) ou 14 jours post-immunostimulation (B et D) par 2.27.104 Salmonella Enteritidis par voie orale. Les données ont été transformées par la fonction logarithme avant analyse statistique et représentation graphique. Moyenne +/- SEM. Lorsque le nombre de dimension excède 2, une ANOVA deux voies avec un test post-hoc de Bonferroni a été réalisée. Dans le cas contraire, le test de t student a été employé, ns p value > 0,05 ; ** p value < 0,001 ; *** p value < 0,0005 ; **** p value < 0,0001.

Figure 25 : Titre en anticorps mesuré en ELISA à partir de sérum provenant de poulets immunostimulés avec des tachyzoïtes frais (A-B) ou lyophilisés (C-D). (A-B) Immunostimulation effectuée à un jour d'âge à la dose de 105 tachyzoïtes (se), le DMEM seul a été utilisé comme contrôle. (C-D) Immunostimulation effectuée à un jour d'âge à la dose de 107 tachyzoïtes (se), la solution F4 a été utilisée comme contrôle. Animaux infectés 7 jours post-immunostimulation (A et C) ou 14 jours post-immunostimulation (B et D) par 2.27.104 bactéries de souche Salmonella Enteritidis par voie orale. Moyenne +/- SEM. Lorsque le nombre de dimension excède 2, une ANOVA deux voies avec un test post-hoc de Bonferroni a été réalisé. Dans le cas contraire, le test de t student a été employé, ns p value > 0,05 ; ** p value < 0,001 ; *** p value < 0,0005 ; **** p value < 0,0001.

Figure 26 : Effet de P immunostimulation par Toxo-KO+ 2G sur la charge virale. Titres viraux mesurés par RT-qPCR dans les poumons, les sécrétions orotrachéales et dans les reins de poulets infectés à J6, J13 ou J20 par le virus H7N1 par voie intratrachéale (Dose représentée sur le graphique). Au préalable de cette infection, les animaux ont été immunisés par Toxo-KO+ 2G à 1 jour d'âge (105 tachyzoïtes par animal, ΙΟΟμί, s.c.) ou ont été inoculés par une solution contrôle (ΙΟΟμί de DMEM, s.c). Les valeurs des titres viraux ont été converties par la fonction logarithme avant la représentation graphique et avant les calculs statistiques. Moyenne +/- SEM. ANOVA deux voies avec test post-hoc de Sidack post-hoc. ns p value > 0,05 ; * p<0.05. EID50 : eggs infectious doses 50.

Figure 27 : Expression des ARNm de l'IFN-beta (A) et de MDA5 (B) dans le parenchyme pulmonaire de poulet préalablement immunostimulés à Jl ou ayant reçus une dose contrôle (DMEM). Les poulets ont été infectés à J6, J13 et J20 par le virus H7N1 ou ont reçus une dose contrôle (PBS). Ils ont été sacrifiés respectivement à J10, J17 et J23 pour effectuer les analyses. n=6 par groupe, moyenne +/- SEM.

Exemple 1 : Construction de la souche Toxo ts iclS KO - 2G (notée Toxo KO 2G)

L'haploïdie du génome de Toxoplasma gondii lors de la phase proliférative permet l'invalidation d'un gène en une seule recombinaison homologue.

Culture des parasites

Tous les tachyzoïtes de la souche de Toxoplasma gondii utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction des plasmides

• Plasmide pTgMIC3-KO-CAT-GFP loxP

Le plasmide pTgMIC3-KO-CAT-GFP Lox P SEQ ID NO : 34 (Figure 1A) a été construit pour supprimer le gène codant la protéine TgMIC3 de Toxoplasma gondii (référence ATCC : souche RH Pra310) par recombinaison homologue.

Le plasmide pTgMic3KO-CAT-GFP loxP SEQ ID NO : 34 contient une cassette de sélection CAT-GFP SEQ ID NO : 6 comprenant un gène de sélection cat-gfp SEQ ID NO : 2 codant pour une protéine de fusion CAT-GFP permettant à la fois la résistance au chloramphénicol (CAT) et une fluorescence verte (GFP : Green Fluorescent Protein), sous le contrôle du promoteur de Ρα-tubuline de Toxoplasma gondii SEQ ID NO : 3. En aval du gène cat-gfp SEQ ID NO :2, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 est insérée. La SEQ ID NO :6 a été amplifiée à partir du plasmide pT230 CAT-GFP SEQ ID NO : 9 en utilisant les amorces SEQ ID NO : 35 et SEQ ID NO : 36 qui permettent l'ajout des sites loxP (SEQ ID NO : 12) et des sites de restrictions HindIII et Spel. La séquence nucléotidique amplifiée par PCR (2389 pb) a ensuite été cloné dans le plasmide pT230TUB Ble SEQ ID NO : 37 par digestion enzymatique avec les enzymes de restriction HindIII et Spel. Le plasmide obtenu est dénommé pCATGFP loxP SEQ ID NO : 38.

La région 3'HR du gène tgmic3 SEQ ID NO : 39 a été obtenu par la double digestion enzymatique du plasmide pmic3KO-2 SEQ ID NO : 40 avec les enzymes de restriction Kpnl et HindIII (2145pb), puis cloné dans le plasmide pCATGFP loxP SEQ ID NO : 38 digéré par Kpnl et HindIII (5238pb). Le plasmide obtenu est dénommé p3'UTRmic3-CATGFP loxP SEQ ID NO : 41.

La région 5 'HR du gène tgmic3 SEQ ID NO : 42 a été amplifiée par PCR à partir de l'ADN génomique de la souche RH de T. gondii. Pour l'amplification, les amorces SEQ ID NO : 43 et SEQ ID NO : 44 permettent l'amplification de la région 5'UTR du gène tgmic3 et la création de deux sites de restrictions (2568pb / sites Spel et Xbal). Ces sites de restrictions ont été utilisés pour cloner le fragment 5HR digéré par Spel et Xbal (2548pb) dans le plasmide p3'UTRmic3-CATGFP loxP SEQ ID NO : 38 en aval de la cassette de sélection CAT-GFP SEQ ID NO : 6 au niveau du site Spel du plasmide précédemment décrit (7383pb) pour obtenir le plasmide pTgMic3KO-CAT-GFP loxP SEQ ID NO : 34.

Les séquences des amorces figurent dans le Tableau 1 ci-après.

Tableau 1 : Séquences des amorces utilisées pour la construction du plasmide pTgMIC3-KO- CAT-GFP loxP.


• Plasmide pTgMIC 1 -KO-CAT-GFP loxN

Le plasmide pTgMICl -KO-CAT-GFP loxN SEQ ID NO : 45 (Figure 1-B) a été construit pour supprimer le gène codant la protéine TgMICl de Toxoplasma gondii par recombinaison homologue.

Le plasmide pTgMic 1 KO-C AT-GFP loxN SEQ ID NO : 45 contient une cassette de sélection CAT-GFP SEQ ID NO : 6 comprenant le gène de sélection cat-gfp SEQ ID NO : 2 codant pour la protéine de fusion CAT-GFP permettant à la fois la résistance au chloramphénicol (CAT) et une fluorescence verte (GFP : Green Fluorescent Protein), sous le contrôle du promoteur de Ρα-tubuline de Toxoplasma gondii SEQ ID NO : 3. En aval du gène cat-gfp SEQ ID NO : 2, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 a été insérée.

La SEQ ID NO : 6 a été amplifiée à partir du plasmide pT230 CAT-GFP SEQ ID NO : 9 en utilisant les amorces SEQ ID NO : 46 et SEQ ID NO : 47 qui permettent l'ajout des sites loxN (SEQ ID NO : 5) et des sites de restrictions Clal et Xbal. La séquence nucléotidique amplifiée par PCR a ensuite été cloné dans le plasmide pNcMic3KO-DHFR SEQ ID NO : 10 digéré par Clal et Xbal (7715 pb) par digestion enzymatique avec les enzymes de restriction Clal et Xbal.

Le plasmide obtenu est dénommé pNCmic3KO CATGFP LoxN SEQ ID NO : 48.

Le fragment 5HR tgmicl SEQ ID NO : 49 a été amplifié par PCR avec les amorces SEQ ID NO : 50 et SEQ ID NO : 51 (2364pb), les sites de restriction Kpnl et Clal ont été ajoutés par PCR. Le fragment amplifié est digéré par les enzymes de restriction Kpnl et Clal (2337pb) et cloné dans le plasmide pNCmic3KO CATGFP LoxN SEQ ID NO : 48 (voir exemple 6 pour l'obtention du plasmide pNCmic3KO CATGFP LoxN) digéré par Kpnl et Clal (7740pb) pour remplacer le fragment 5HR ncmic3 (fragment digéré par Kpnl et Clal). Le plasmide obtenu est dénommé pTgmiclK05HR-NCmic3K03HR CATGFP LoxN SEQ ID NO : 111.

Puis le fragment 3HR tgmicl SEQ ID NO : 52 a été amplifié par PCR avec les amorces SEQ ID NO : 53 et SEQ ID NO : 54 (2750pb), les sites de restriction Xbal et Notl ont été ajoutés par PCR. Le fragment amplifié est digéré par les enzymes de restriction Xbal et Notl (2720 pb) puis cloné dans le plasmide pTgmiclK05HR-NCmic3K03HR CATGFP LoxN SEQ ID NO : 111 digéré par les enzymes de restriction Xbal et Notl (7565 pb) pour remplacer le fragment 3HR ncmic3 (fragment digéré par Xbal et Notl). Le plasmide obtenu est dénommé pTgmiclKO CAT-GFP LoxN SEQ ID NO : 45.

Les amorces utilisées pour les PCR sont détaillées dans le tableau 2 ci-dessous.

Tableau 2 : Amorces permettant la construction du plasmide pTgmic3KO CAT-GFP loxP.


• Plasmide pTSAGl- Cre Recombinase

Le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15 a été construit pour exprimer de manière transitoire dans le parasite Toxoplasma gondii et ses dérivés modifiés génétiquement le gène codant la protéine Cre Recombinase dérivée du bactériophage PI (Brecht et al, 1999, même référence que précédemment).

Le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15 dérive du plasmide pUC18 (plasmide commercial) qui contient une cassette d'expression de la Cre Recombinase du bactériophage Pl . Dans le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15, le gène codant la Cre Recombinase SEQ ID NO : 16, est placé sous la dépendance du promoteur du gène sagl de Toxoplasma gondii SEQ ID NO : 17, ce qui permet l'expression de la protéine Cre Recombinase dans les parasites Toxoplasma gondii transfectés. En aval du gène codant la Cre Recombinase SEQ ID NO : 16, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 est insérée. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine Cre Recombinase.

L'absence de cassette de sélection spécifique ne permet pas une intégration stable du matériel génétique transfecté mais seulement une expression transitoire de la Cre Recombinase.

Construction de la souche Toxo tgmicl-3 KO - 2G

La construction de la souche vivante atténuée de seconde génération, dénommée Toxo tgmicl-3 KO - 2G, est faite en 4 étapes distinctes (Figure 2-A) :

1. Délétion par recombinaison homologue du gène tgmic3 et son remplacement par la cassette de sélection CAT-GFP SEQ ID NO :6 encadrée par des séquences LoxP SEQ ID NO : 12.

Pour obtenir cette souche, la souche sauvage de Toxoplasma gondii RH (référence ATCC : PRA-310) est électroporée avec le plasmide pTgMIC3-KO-CAT-GFP loxP SEQ ID NO : 34. 20 μg de plasmide purifié puis linéarisé par Kpnl sont ajoutés à 107 parasites mis en suspension dans le milieu d'électroporation CYTOMIX contenant de ΓΑΤΡ (3 mM) et du Glutathion (3 mM) (Van den Hoff et al., Nucleic Acid Research, Jun 11 ; 20(11):2902), et l'électroporation a été réalisée en cuvette d'écart 4 mm, dans un volume de 800 sur un appareil BioRad (Paramètres : 2000V, 50 ohms, 25 μΡ, avec deux chocs électriques). Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24 heures après l'électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Toxo tgmic3 KO.

Dans cette souche, le gène mic3 a été délété et remplacé par la cassette de sélection CATGFP SEQ ID NO : 6. Ainsi, la séquence théorique au locus du gène mic3 délété contenant la cassette de sélection CATGFP est la SEQ ID NO : 103. Le gène miel n'étant pas délété, la séquence du gène miel SEQ ID NO : 108 est présente dans le génome de la souche.

2. Suppression de la cassette de sélection SEQ ID NO : 6 : la souche Toxo tgmic3 KO obtenue est électroporée avec le plasmide pT-SAGl-CRE-Recombinase SEQ ID NO : 15.

L'enzyme exprimée transitoirement va permettre l'excision de la cassette de sélection CAT-GFP SEQ ID NO : 6. Le protocole d'électroporation est similaire au protocole précédent. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Après 2 à 7 jours de culture, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Toxo igmic3 KO - 2G.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 19. Le gène miel n'étant pas délété, la séquence du gène miel SEQ ID NO : 108 est présente dans le génome de la souche. Délétion par recombinaison homologue du gène tgmicl et son remplacement par la cassette de sélection CAT-GFP SEQ ID NO : 6 encadrée par des séquences Lox N SEQ ID NO : 5. Pour obtenir cette souche, la souche Toxo tgmic3 KO - 2G est électroporée avec le plasmide pTgMICl-KO-CAT-GFP lox N SEQ ID NO : 45 linéarisé par Pcil, selon le protocole précédemment décrit. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24 heures après Γ électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique des clones d'intérêt. La souche obtenue est dénommée Toxo tgmicl-3 KO.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 19.

Dans cette souche, le gène miel a été délété et remplacé par la cassette de sélection CATGFP SEQ ID NO : 6. Ainsi, la séquence théorique au locus du gène miel délété contenant la cassette de sélection CATGFP est la SEQ ID NO : 104.

Suppression de la cassette de sélection SEQ ID NO : 6 : la souche Toxo tgmicl-3 KO obtenue est électroporée avec le plasmide pT-SAGl-CRE-Recombinase SEQ ID NO : 15. L'enzyme exprimée transitoirement va permettre l'excision de la cassette de sélection CAT-GFP SEQ ID NO : 6. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Après 2 à 7 jours de culture, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Toxo tgmicl-3 KO - 2G.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 19.

Dans cette souche, le gène miel a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène miel délété contenant un seul site lox N SEQ ID NO : 5, est la SEQ ID NO : 92.

Validation de la souche Toxo tgmicl-3 KO - 2G par PCR

Pour valider la souche Toxo tgmicl-3 KO - 2G des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 2-D et sont détaillées dans le Tableau 3 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 2-B). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 4 ci-dessous. Pour plus de clarté sur la figure 2-B, seules les 3 étapes de la réalisation sont représentées (tgmic3, tgmic3KO CATGFP et tgmic3KO loxP (2 G) ou tgmicl, tgmiclKO CATGFP et tgmiclKO loxN(2G)), les résultats obtenus sont conformes aux tailles attendues.

Tableau 3 : liste des amorces utilisées pour la validation des souches.


Tableau 4 : Taille attendue des amplicons (en paires de base) des différentes PCR de validation de la construction des souches KO de Toxoplasma gondii


Les électrophorèses des produits PCR réalisés avec les amorces 5 SEQ ID NO : 61 et 6 SEQ ID NO : 62 (mix 1) permettent de mettre en évidence une bande à 808 paires de bases pour la souche RH, conformément à la taille de bande attendue et confirmant la présence du gène tgmic3 dans cette souche. Cette bande n'est pas détectée dans les souches Toxo tgmic3 KO, Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO et Toxo tgmicl-3 KO - 2G confirmant la suppression du gène dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces 13 SEQ ID NO : 63 et j SEQ ID NO : 25, et les amorces k SEQ ID NO : 26 et 14 SEQ ID NO : 64 (mix 2 et 3) permettent de mettre en évidence respectivement une bande à 3253 et 3537 paires de bases pour la souche Toxo tgmic3 KO, conformément à la taille de bande attendue et confirmant la présence du gène de sélection cat-gfp SEQ ID NO : 2 dans cette souche à la place du gène tgmic3 SEQ ID NO : 107. Cette bande n'est pas détectée dans les souches RH, Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO et Toxo tgmicl-3 KO - 2G confirmant l'absence du gène de sélection cat-gfp SEQ ID NO : 2 au locus tgmic3 dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces 9 SEQ ID NO : 65 et 10 SEQ ID NO : 66 (mix 4) permettent de mettre en évidence différentes bandes conformément à la taille de bande attendue. Une bande à 1596 paires de bases pour la souche RH, confirme la présence du gène tgmic3 SEQ ID NO : 107 dans cette souche. Une bande de 2525 paires de bases est mise en évidence pour la souche Toxo tgmic3 KO confirmant la présence de la cassette de sélection CATGFP SEQ ID NO : 6 à la place du gène tgmic3. Enfin une bande de 226 paires de bases est mise en évidence pour les souches Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO et Toxo tgmicl-3 KO - 2G confirmant la suppression du gène de sélection cat-gfp SEQ ID NO :2 dans ces souches, laissant une cicatrice loxP SEQ ID NO : 12 dans le génome.

Les électrophorèses des produits PCR réalisés avec les amorces 3 SEQ ID NO : 55 et 4 SEQ ID NO : 56 (mix 5) permettent de mettre en évidence une bande à 608 paires de bases pour les souches RH, Toxo tgmic3 KO et Toxo tgmic3 KO - 2G, conformément aux tailles de bandes attendues et confirmant la présence du gène tgmicl SEQ ID NO : 108 dans ces souches. Ces bandes ne sont pas détectées dans les souches Toxo tgmicl-3 KO et Toxo tgmicl-3 KO - 2G confirmant la suppression du gène dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces 1 1 SEQ ID NO : 57 et j SEQ ID NO : 25, et les amorces k SEQ ID NO : 26 et 12 SEQ ID NO : 58 (mix 6 et 7) permettent de mettre en évidence respectivement une bande à 3040 et 3593 paires de bases pour la souche Toxo tgmicl-3 KO, conformément à la taille de bande attendue et confirmant la présence du gène de sélection cat-gfp SEQ ID NO :2 dans cette souche à la place du gène tgmic3 SEQ ID NO : 107. Cette bande n'est pas détectée dans les souches sauvage RH de T. gondii (référence ATCC : PRA-310), Toxo tgmic3 KO, Toxo tgmic3 KO - 2G, et Toxo tgmicl-3 KO - 2G confirmant l'absence du gène de sélection cat-gfp SEQ ID NO : 2 au locus tgmicl dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces 7 SEQ ID NO : 59 et 8 SEQ ID NO : 60 (mix 8) permettent de mettre en évidence différentes bandes conformément à la taille de bande attendue. Une bande à 4198 paires de bases pour les souches RH, Toxo tgmic3 KO et Toxo tgmic3 KO - 2G confirme la présence du gène tgmicl SEQ ID NO : 108 dans ces souches. Une bande de 3129 paires de bases est mise en évidence pour la souche Toxo tgmicl-3 KO confirmant la présence de la cassette de sélection CATGFP SEQ ID NO : 6 à la place du gène tgmicl. Enfin une bande de 830 paires de bases est mise en évidence pour la souche Toxo tgmicl-3 KO - 2G confirmant la suppression du gène de sélection cat-gfp SEQ ID NO : 2 dans cette souche, laissant une cicatrice loxN SEQ ID NO : 5 dans le génome.

Les produits PCR « cicatrice » (mix 4 et 8) ont été séquencés et les séquençages ont confirmés que :

• le gène tgmic3 SEQ ID NO : 107 a été supprimé et que la cassette de sélection CATGFP SEQ ID NO :6 a bien été supprimée par action de la Cre-Recombinase laissant une cicatrice LoxP SEQ ID NO : 12 conforme à la séquence attendue (Figure 2-C).

• le gène tgmicl SEQ ID NO : 108 a été supprimé et que la cassette de sélection CATGFP SEQ ID NO : 6 a bien été supprimée par action de la CRE-Recombinase laissant une cicatrice LoxN SEQ ID NO : 5 conforme à la séquence attendue (Figure 2-C).

Validation de la souche Toxo tgmicl-3 KO - 2G par immunofluorescence

Les tachyzoïtes sont cultivés 24h sur lamelles en verre recouvertes d'une monocouche de cellules HFF. Les cellules infectées ont été lavés 2 fois en PBS1X, et fixés par du formaldéhyde 4% pendant 30 min. Après 3 lavages en PBS1X, les cellules HFF infectées ont été perméabilisées avec 0,1% de Triton X-100 dans du PBS1X pendant 5 min. Après 3 lavages au PBS IX, une étape de saturation est effectuée avec une solution de PBS 1X/SVF 10% pendant 30 min. Les cellules ont ensuite été incubées avec l'anticorps primaire dilué dans 2%> SVF pendant 1 heure, lavées 3 fois au PBS IX puis incubées avec un anticorps secondaire dilué dans une solution de PBS/SVF 2% pendant 1 heure. Après 2 lavages au PBS IX, les

lamelles en verre sont montées sur lame avec de l'Immu-Mount et observés au microscope à fluorescence.

L'anticorps primaire Tgmic3 utilisé est un anticorps qui permet de détecter l'expression de la protéine TgMIC3 SEQ ID NO : 121 dans le parasite (anticorps de lapin anti-mic3 : rnAb anti-MIC3 s3) et l'anticorps secondaire commercial utilisé est l'Alexa fluor® 594 chèvre anti-lapin (Life technologies réf. A-l 1012).

L'anticorps primaire Tgmicl utilisé est un anticorps qui permet de détecter l'expression de la protéine TgMICl SEQ ID NO : 122 dans le parasite (anticorps de souris anti-miel : mAb anti-MICl T104F8E12) et l'anticorps secondaire commercial utilisé est l'Alexa fluor® 594 chèvre anti-souris, Life technologies réf. A-l 1005).

Les résultats montrent qu'aucune fluorescence n'est détectable au pôle apical du parasite révélant l'absence des protéines MIC1 et MIC3 dans des tachyzoïtes Toxo tgmicl-3 KO - 2G alors qu'une fluorescence au pôle apical du parasite de la souche sauvage démontre l'expression des protéines MIC1 et MIC3 (Figures 3 A et 3B).

Les résultats montrent que les parasites expriment une fluorescente verte reflétant l'expression de la protéine CATGFP SEQ ID NO : 120 suite à la réalisation des délétions de gènes (Toxo tgmic3 KO et Toxo tgmicl-3 KO) alors qu'après action de la Cre recombinase, les souches Toxo tgmic3 KO - 2G et Toxo tgmicl-3 KO - 2G ne sont plus fluorescentes (suppression de de la cassette CATGFP) (Figures 3A et 3B).

Exemple 2 : Construction de la souche Toxo ts iclS KO - 2G / ROP 16 KO (notée Toxo Rop 16)

L'haploïdie du génome de Toxoplasma gondii lors de la phase proliférative permet l'invalidation d'un gène en une seule recombinaison homologue.

Culture des parasites

Tous les tachyzoïtes de la souche de Toxoplasma gondii utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction du plasmide

Le plasmide pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73 (Figure 4) a été construit pour supprimer le gène codant la protéine TgROP16 de Toxoplasma gondii par recombinaison homologue.

Le plasmide pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73 dérive du plasmide pNcMIC3-KO-CAT-GFP lox N SEQ ID NO : 1. Le gène tdTomato SEQ ID NO : 128 a été amplifiée par PCR avec les amorces AGD F-AvrIIdTomato SEQ ID NO : 129et AGD RdTomatoBgUI SEQ ID NO : 130 (1459 pb) à partir du fragment synthétisé SEQ ID NO : 12131 cloné dans le plasmide commercial pRSET-B SEQ ID NO : 132. Après digestion par les enzymes Avril et BgUI (1439pb), le gène a ensuite été cloné dans le plasmide pGEMT SEQ ID NO : 133 (référence commerciale pGEM®-T Vector - Promega) puis amplifié. Le plasmide a ensuite été digéré par Avril et BgUI et cloné au niveau des sites Avril et BglII du plasmide pNcMIC3-KO-CAT-GFP lox N SEQ ID NO : 1. La nouvelle cassette de sélection cat-tdTomato SEQ ID NO : 125 codant pour la protéine chimérique CAT/tdTOMATO SEQ ID NO : 141 permettant à la fois la résistance au chloramphénicol et une fluorescence rouge, est placée sous la dépendance du promoteur de Γα-tubuline de Toxoplasma gondii SEQ ID NO : 3. En aval de la cassette CAT tdTOMATO SEQ ID NO : 125, la séquence 3'UTR du gène sagl de Toxoplasma gondii est insérée SEQ ID NO : 4. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine de fusion CAT tdTOMATO.

La région non codante amont flanquant le gène tgroplô SEQ ID NO : 134 (1899 pb) est amplifiée par PCR à partir de l'ADN génomique de T. gondii avec les amorces AGD-F-5*ROP16KpnI SEQ ID NO : 135 et AGD-R-5*ROP16BclI SEQ ID NO : 136 puis est intégrée après digestion par les enzymes Kpnl et Bcll (1885pb) dans le plasmide en amont de la cassette de sélection CAT -tdTomato SEQ ID NO : 125 au niveau des sites restrictions Kpnl et Bcll.

La région non codante aval flanquant le gène tgroplô SEQ ID NO : 137 (1790 pdb) est amplifiée par PCR à partir de l'ADN génomique de T. gondii avec les amorces AGD-F- 3*HpaIROP16 SEQ ID NO : 138 et AGD-R-3*ROP16NotI SEQ ID NO : 134 puis est intégrée après digestion par les enzymes Hpal et Notl (1782pb) dans le plasmide en aval de la cassette de sélection CAT-tdTomato SEQ ID NO : 125 au niveau des sites de restriction Hpal et Notl. Les amorces utilisées pour la construction de ce plasmide sont répertoriées dans le tableau 5 ci-dessous.

Le plasmide obtenu est appelé pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73.

Amorces utilisées pour la construction du plasmide pTgroplô KO CAT-

Construction du plasmide pTgroplô KO CAT-tdTomato

Construction de la souche Toxo tgmicl-3 KO - 2G ropl6 KO

La construction de la souche vivante atténuée, dénommée Toxo tgmicl-3 KO - 2G / ROP 16 KO est obtenue par la délétion par recombinaison homologue du gène tgroplô SEQ ID NO : 140 et son remplacement par la cassette de sélection CAT-tdTomato SEQ ID NO : 125. Pour obtenir cette souche, la souche Toxo tgmicl-3 KO - 2G, telle qu'obtenue à l'Exemple 1 , est électroporée avec le plasmide pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73. 50 μg de plasmide purifié puis linéarisés par Sacll sont ajoutés à 107 parasites mis en suspension dans le milieu d'électroporation CYTOMIX contenant de l'ATP (3 mM) et du Glutathion (3 mM) préparé selon le protocole de Van den Hoff et al., (van den Hoff MJ, Moorman AF, Lamers WH. Electroporation in 'intracellular' buffer increases cell survival, Nucleic Acid Research, 1992 Jun 11 ; 20(11):2902), et l'électroporation a été réalisée en cuvette d'écart 4 mm, dans un volume de 800 sur un appareil BioRad (Paramètres : 2000V, 50 ohms, 25 μΡ, avec

deux chocs électriques). Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24h après Γ électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits et les clones d'intérêt sont identifiés par PCR. La souche obtenue est dénommée Toxo tgmicl-3 KO - 2G / ROP 16 KO.

Validation de la souche Toxo tgmicl-3 KO - 2G ropl6 KO par PCR

L'ADN génomique des souches Toxo tgmicl-3 KO - 2G et Toxo tgmicl-3 KO - 2G ropl6 KO a été purifié par extraction au DNAzol puis différentes PCR ont été réalisés pour vérifier la délétion spécifique du gène ropl6 SEQ ID NO : 140 (Figure 5-B). Les analyses par électrophorèse sur gel d'agarose confirment l'absence du gène ropl6 et son remplacement par la cassette de sélection cat-tdTomato SEQ ID NO : 125.

Pour valider la souche Toxo tgmicl-3 KO - 2G ropl6 KO des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 5-C et sont détaillées dans le Tableau 6 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 5-B). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 7 ci-dessous.

Tableau 6 : liste des amorces utilisées pour la validation de la souche Toxo tgmicl-3 KO -2G rop 16 KO

Amorce Séquence

Tgroplô Rgl AGD rop 16CDS F SEQ m NO : 83 GTTTGAGGAAGCGCAAAAAG

(mixl)

Rg2 AGD rop 16CDS R SEQ m NO : 84 TGCTGTGATTTCGCAAGTTC

Validation KO Rg3 Rop 16KO valid 5Fl SEQ m NO : 85 ACCCCCTGACCCCTTGTCTG

en amont

(mix2)

Rg4 Amont ropl6R SEQ m NO : 86 TCGTCGTGGTATTCACTCCA

Validation KO RI Aval rop 16F SEQ ID NO : 142 ACATGGCCGTCATCAAAGA

en aval (mix3)

Rg6 Aval ropl6R SEQ m NO : 88 AAAACGAATGCGAAGGAAGA

Tableau 7 : Taille attendue des amplicons (en paires de base) des différentes PCR de validation de la construction de la souche Toxo tgmicl-3 KO - 2G roplô KO


Les électrophorèses des produits PCR réalisés avec les amorces rgl SEQ ID NO : 83 et rg2 SEQ ID NO : 84 (mix 1) permettent de mettre en évidence une bande à 1682 paires de bases pour la souche Toxo tgmicl-3 KO - 2G, conformément à la taille de bande attendue et confirmant la présence du gène tgroplô dans cette souche. Cette bande n'est pas détectée dans la souche Toxo tgmicl-3 KO - 2G roplô KO confirmant la suppression du gène dans cette souche.

Les électrophorèses des produits PCR réalisés avec les amorces rg3 SEQ ID NO : 85 et rg4 SEQ ID NO : 86 (mix 2) permettent de mettre en évidence une bande à 2759 paires de bases pour la souche Toxo tgmicl-3 KO - 2G roplô KO, conformément à la taille des bandes attendues et confirmant la suppression du gène tgroplô dans cette souche et l'insertion du gène de sélection CATtdTomato à la place du gène tgroplô. Cette bande n'est pas détectée dans la souche Toxo tgmicl-3 KO - 2G.

Les électrophorèses des produits PCR réalisés avec les amorces RI SEQ ID NO : 142 et rg6 SEQ ID NO : 88 (mix 3) permettent de mettre en évidence une bande à 3317 paires de bases pour la souche Toxo tgmicl-3 KO - 2G roplô KO, conformément à la taille des bandes attendues et confirmant la suppression du gène tgroplô dans cette souche et l'insertion du gène CATtdTomato à la place du gène tgroplô. Cette bande n'est pas détectée dans la souche Toxo tgmicl-3 KO - 2G.

Exemple 3 : Construction de la souche Toxo ts iclS KO GralSII Kl (notée Toxo

GralS Kl)

Culture des parasites

Tous les tachyzoïtes de la souche de Toxoplasma gondii utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction du plasmide pT230-2G GRA15n (Figure 6)

La construction du plasmide pT230-2G GRA15n SEQ ID NO : 76 a été élaborée à partir du plasmide pT230 2G SEQ ID NO : 143 issu du plasmide pT230-TUB5/BLE SEQ ID NO :37. Le promoteur du gène gral5n SEQ ID NO : 71, ainsi que la séquence codante de gral5n SEQ ID NO : 144 ont été amplifiés à partir de l'ADNg de la souche ME49 par PCR nichée (PCR 1 puis 2) incluant un tag HA en 3' SEQ ID NO :72 pour faciliter la localisation.

Une première PCR SEQ ID NO : 145 (PCR 1 : 4202 paires de bases) avec les amorces ForOGRA15 SEQ ID NO : 146 et rev4GRA15 SEQ ID NO : 147 sur l'ADNg de la souche ME49 permet une amplification du locus gral5II. Une seconde PCR SEQ ID NO : 143 (PCR2 : 3882 paires de bases) avec les amorces F GRA15 BamHl Spel SEQ ID NO : 149 et R GRA15 HAtag SEQ ID NO : 150 sur la PCR 1 SEQ ID NO : 145 permet une amplification du promoteur SEQ ID NO : 71 et de la phase codante de gral5II SEQ ID NO : 144 couplé à un tagHA SEQ ID NO : 72. Cette seconde PCR SEQ ID NO : 148 a été insérée par digestion enzymatique (BamHl et bout franc) dans le plasmide pT230 2G SEQ ID NO : 143 digéré par BamHl et Pmel (4470 pb). Le plasmide pT230 2G GRA15n SEQ ID NO : 76 ainsi obtenu contient également une cassette ble SEQ ID NO : 151 permettant de coder une protéine BLE SEQ ID NO : 152 permettant une résistance à la phléomycine. Les amorces utilisées pour la construction de ce plasmide sont répertoriées dans le tableau 8 ci-dessous.

Tableau 8 : Construction du plasmide pT230 2G Gral5II

ForOGRA15 SEQ ID NO : 146 G AACTGC GTC GTC GTG AGT A PCR 1 rev4GRA15 SEQ ID NO : 147 TGCCAATTGAGTCGTCTCTTC

F GRA15 SEQ ID NO : 149

BamHl Spel GGATCCACTAGTTGACTGCCACGTGTAGTATCC PCR 2

SEQ ID NO : 150

TTACGCTAGTCCGGGACGTCGTACGGGTATGGAG R GRA15 HAtag TTACCGCTGATTGTGT

Construction de la souche Toxo tgmicl-3 KO - 2G GRA15n Kl

50 μg de plasmide pT230-2G GRA15n SEQ ID NO :76 purifiés puis linéarisés par Apal ont été ajoutés à 107 parasites de la souche Toxo tgmicl-3 KO 2G (obtenue à l'exemple 1) mis en suspension dans le milieu d'électroporation CYTOMIX contenant de ΑΤΡ (3 mM) et du Glutathion (3 mM) préparé selon le protocole de Van den Hoff et al., précédemment référencé, et l'électroporation a été réalisée en cuvette d'écart 4 mm, dans un volume de 800 μΐ, sur un appareil BioRad (Paramètres : 2000V, 50 ohms, 25 μΡ, avec deux chocs électriques). Après électroporation, les tachyzoïtes ont été déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (phléomycine 20 μΜ), 24h après l'électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits et les clones d'intérêt sont identifiés par PCR. La souche obtenue est dénommée Toxo tgmicl-3 KO - 2G GRA15IIKI.

Validation de la souche Toxo tgmicl-3 KO - 2G GRA15KI par PCR

Pour valider la souche Toxo tgmicl-3 KO - 2G GRA15KI des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 7-B et sont détaillées dans le Tableau 9 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 7-A). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 10 ci-dessous. La taille attendue de la PCR avec les amorces AGD F GRA15I/II SEQ ID NO : 109 et AGD R GRA15I/II SEQ ID NO : 110 (Tableau 9) permet de distinguer la présence de la séquence codant pour GRA15n SEQ ID NO : 144 (308 pb) et celle de GRA15i endogène SEQ ID NO : 153 (560pb).

Tableau 9 : Amorces utilisées pour les PCR de validation de souches Toxo tgmicl-3 KO - 2G GRA15KI

Tableau 10 : Taille attendue des amplicons (en paires de base) des différentes PCR de validation de la construction des souches KO de Toxoplasma gondii

Les électrophorèses des produits PCR réalisés avec les amorces AGD F GRA15I/II SEQ ID NO : 109 et AGD R GRA15I/II SEQ ID NO : 110 (Tableau 9) permettent de mettre en évidence respectivement une bande à 560 et 308 paires de bases pour la souche Toxo tgmicl- 3 KO - 2G GRA15KI alors qu'une seule bande à 560 paires de bases pour la souche Toxo tgmicl-3 KO - 2G, ce qui confirme l'insertion de plasmide pT230-2G GRA15n SEQ ID NO : 76 dans la souche Toxo tgmicl-3 KO - 2G GRA15KI.

Validation de la souche Toxo tgmicl-3 KO - 2G GRA15KI par immunofluorescence

Les tachyzoïtes sont cultivés 24h sur lamelles en verre recouvertes d'une monocouche de cellules HFF. Les cellules infectées ont été lavés 2 fois en PBSIX, et fixés par du formaldéhyde 4% pendant 30 min. Après 3 lavages en PBSIX, les cellules HFF infectées ont été perméabilisées avec 0,1% de Triton X-100 dans du PBSIX pendant 5 min. Après 3 lavages au PBS IX, une étape de saturation est effectuée avec une solution de PBS 1X/SVF 10% pendant 30 min. Les cellules ont ensuite été incubées avec l'anticorps primaire dilué dans 2%> SVF pendant 1 heure, lavées 3 fois au PBSIX puis incubées avec un anticorps secondaire dilué dans une solution de PBS/SVF 2% pendant 1 heure. Après 2 lavages au PBSIX, les lamelles en verre sont montées sur lame avec de l'Immu-Mount™ et observés au microscope à fluorescence.

L'anticorps primaire utilisé est l'anticorps de souris anti-HA qui permet de détecter l'expression de la protéine GRA15n-HA SEQ ID NO : 123 dans le parasite. L'anticorps secondaire est l'anticorps secondaire commercial : Alexa fluor® 594 chèvre anti lapin (Life Technologies A-l 1012). Les anticorps sont dilués au 1/1000 dans du PBS SVF 2%.

Pour la souche sauvage Toxo tgmicl-3 KO 2G, aucune fluorescence verte n'est observée au pôle apical du parasite révélant ainsi l'absence de la protéine GRA15n-HA. Au contraire, pour la souche Toxo tgmicl-3 KO - 2G GRA15KL une fluorescence verte est observée démontrant l'expression de la protéine GRA15n-HA (figure 8).

Exemple 4 : Construction de la souche Toxo tgmicl-3 KO ropl6 KO GralSII Kl (notée Toxo KO+)

Culture des parasites

Tous les tachyzoïtes de la souche de Toxoplasma gondii utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction du plasmide pT230-2G GRA15n SEQ ID NO : 76 (Figure 6)

Voir Exemple 3, page 45

Construction de la souche Toxo tgmicl-3 KO - 2G ropl6 KO GRA15n Kl (: ToxoKO +) 50 μg de plasmide pT230-2G GRA15n SEQ ID NO :76 purifiés puis linéarisés par Apal ont été ajoutés à 107 parasites de la souche Toxo tgmicl-3 KO 2G ropl6 KO (obtenue à l'exemple 2) mis en suspension dans le milieu d'électroporation CYTOMIX contenant de ΑΤΡ (3 mM) et du Glutathion (3 mM) préparé selon le protocole de Van den Hoff et al., précédemment référencé, et l'électroporation a été réalisée en cuvette d'écart 4 mm, dans un volume de 800 sur un appareil BioRad (Paramètres : 2000V, 50 ohms, 25 μΡ, avec deux chocs électriques). Après électroporation, les tachyzoïtes ont été déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (phléomycine 20 μΜ), 24h après l'électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits et les clones d'intérêt sont identifiés par PCR. La souche obtenue est dénommée Toxo tgmicl-3 KO ropl6 KO - 2G GRA1511 Kl.

Validation de la souche Toxo tgmicl-3 KO - 2G rop!6 KO GRA15n Kl par PCR

Pour valider la souche Toxo tgmicl-3 KO - 2G ropl6 KO GRA15n Kl des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 12-B et sont détaillées dans le Tableau 9 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 9). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 10 ci-dessous. La taille attendue de la PCR avec les amorces AGD F GRA15I/II SEQ ID NO : 109 et AGD R GRA15I/II SEQ ID NO : 110 (Tableau 9) permet de distinguer la présence de la séquence codant pour GRA15n SEQ ID NO : 144 (308 pb) et celle de GRA15i endogène SEQ ID NO : 153 (560pb).

Les électrophorèses des produits PCR réalisés avec les amorces AGD F GRA15I/II SEQ ID NO : 109 et AGD R GRA15I/II SEQ ID NO : 110 (Tableau 9) permettent de mettre en évidence respectivement une bande à 560 et 308 paires de bases pour la souche Toxo tgmicl-3 KO - 2G ropl6 KO GRA15n Kl alors qu'une seule bande à 560 paires de bases pour la souche Toxo tgmicl-3 KO - 2G, ce qui confirme l'insertion de plasmide pT230-2G GRA15n SEQ ID NO :76 dans la souche Toxo tgmicl-3 KO - 2G roplô KO GRA15n Kl.

Validation de la souche Toxo tgmicl-3 KO - 2G rop!6 KO GRA15II Kl par immunofluorescence

Les tachyzoïtes sont cultivés 24h sur lamelles en verre recouvertes d'une monocouche de cellules HFF. Les cellules infectées ont été lavés 2 fois en PBS1X, et fixés par du formaldéhyde 4% pendant 30 min. Après 3 lavages en PBS1X, les cellules HFF infectées ont été perméabilisées avec 0,1% de Triton X-100 dans du PBS1X pendant 5 min. Après 3 lavages au PBS IX, une étape de saturation est effectuée avec une solution de PBS 1X/SVF 10% pendant 30 min. Les cellules ont ensuite été incubées avec l'anticorps primaire dilué dans 2%> SVF pendant 1 heure, lavées 3 fois au PBS IX puis incubées avec un anticorps secondaire dilué dans une solution de PBS/SVF 2% pendant 1 heure. Après 2 lavages au PBS IX, les lamelles en verre sont montées sur lame avec de l'Immu-Mount™ et observés au microscope à fluorescence.

L'anticorps primaire utilisé est l'anticorps de souris anti-HA qui permet de détecter l'expression de la protéine GRA15n-HA SEQ ID NO : 123 dans le parasite. L'anticorps secondaire est l'anticorps secondaire commercial : Alexa fluor® 594 chèvre anti lapin (Life Technologies A-l 1012). Les anticorps sont dilués au 1/1000 dans du PBS SVF 2%.

Pour la souche sauvage Toxo tgmicl-3 KO 2G, aucune fluorescence verte n'est observée au pôle apical du parasite révélant ainsi l'absence de la protéine GRA15n-HA. Au contraire, pour la souche Toxo tgmicl-3 KO - 2G ropl6 KO GRA15II Kl, une fluorescence verte est observée démontrant l'expression de la protéine GRA15n-HA (figure 10).

Exemple 5 : Construction de la souche Toxo tgmicl-3 KO ropl6 KO GralSII Kl (notée ToxoKO+ 2G).

L'haploïdie du génome de Toxoplasma gondii lors de la phase proliférative permet l'invalidation d'un gène en une seule recombinaison homologue.

Culture des parasites

Tous les tachyzoïtes de la souche de Toxoplasma gondii utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction du plasmide

Le plasmide pTgRopl6KO-Gral5nKI-CAT-GFP lox2272 SEQ ID NO : 67 (Figure 11) contient la cassette de sélection CAT-GFP SEQ ID NO : 6 comprenant le gène de sélection cat-gfp SEQ ID NO : 2, codant pour la protéine de fusion CAT-GFP conférant une résistance au chloramphénicol (CAT) et une fluorescence verte (GFP), sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii SEQ ID NO : 3 pour permettre l'expression du gène dans le parasite. En aval du gène de sélection SEQ ID NO : 2, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 est insérée. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine de fusion CAT-GFP.

La cassette de sélection SEQ ID NO : 6 est encadrée par deux sites Lox2272 SEQ ID NO : 68, sites de reconnaissance spécifiquement reconnus par la Cre Recombinase et qui seront utilisés ultérieurement pour supprimer la cassette de sélection CAT-GFP.

En aval du deuxième site Lox2272, une cassette d'expression du gène gral5n SEQ ID NO : 69 a été cloné. Cette cassette d'expression est constituée du promoteur de gral5n amplifié à partir de l'ADN génomique de la souche ME49 et du gène gral5n SEQ ID NO : 70 amplifié à partir de l'ADN génomique de la souche ME49, incluant un tag HA en 3' SEQ ID NO : 72 pour faciliter la localisation et de la séquence 3 'UTR du gène sagl de T. gondii SEQ ID NO :4 amplifié à partir de l'ADN génomique de la souche RH. Ce plasmide permet donc la réalisation simultanée d'un mutant ropl6 KO lox2272 CATGFP lox2272 et l'insertion de gral5IIHA au locus ropl6.

Le plasmide pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73 contient une cassette CAT-tdTomato SEQ ID NO : 125 encadrée par une séquence 5'HR du gène tgroplô SEQ ID NO : 99 et une séquence 3'HR du gène tgroplô SEQ ID NO : 100.

Le clonage a été fait à partir du plasmide pTgROP16-KO-CAT-tdTomato SEQ ID NO : 73 digéré par les enzymes SphI et Agel (6073pb). Ce clonage a nécessité 4 PCR indépendantes.

La première PCR a permis l'amplification à partir du plasmide pCATGFP lox P SEQ ID NO : 38, d'une cassette de sélection CAT-GFP SEQ ID NO : 6 comportant le promoteur aTubuline, le gène de sélection cat-gfp et la région 3 'UTR de sagl de T. gondii, avec ajout du site lox2272 SEQ ID NO : 68 avec les amorces tub F Agel SEQ ID NO : 74 et 3 UTR lox2272 R SEQ ID NO : 75 (2090pb).

La deuxième PCR a permis l'amplification à partir du plasmide pT230 2G gral5II SEQ ID NO : 76, du promoteur gral5II SEQ ID NO : 71 avec ajout en 5' du site lox2272 SEQ ID NO : 68 avec les amorces pGral5 F lox2272 SEQ ID NO : 77 et P Gral5 R SEQ ID NO : 78 (1975pb).

La troisième PCR a permis l'amplification à partir du plasmide pT230 2G gral5II SEQ ID NO :76, du gène gral5II HA avec le 3 'UTR de sagl SEQ ID NO : 79 (2092 pb) avec les amorces Gral5F SEQ ID NO : 126 et UTR sagl ropl6 R SEQ ID NO : 127.

La dernière PCR a permis l'amplification d'une partie de 3'Ropl6 SEQ ID NO : 80 avec les amorces Ropl6F SEQ ID NO : 81 et Ropl6R SphI SEQ ID NO : 82 (570pb) sur le plasmide p Tgroplô KO CAT-tdTomato SEQ ID NO : 73 comme matrice.

Les amorces utilisées pour la construction de ce plasmide sont répertoriées dans le tableau 1 1 ci-dessous.

Tableau 11 : Amorces utilisées pour la construction du plasmide pT230 2G Gral5II


Les 4 fragments de PCR amplifiés ont été directement clonés dans le vecteur pTgroplô KO CAT-tdTomato SEQ ID NO : 73 digéré par Agel et SphI grâce à au kit In-Fusion® de Ozyme (In-Fusion® HD Cloning Kit - Clonetech). La technologie de clonage In-Fusion® permet le clonage en une étape sans purification ou digestion d'un ou de plusieurs produits de PCR dans un vecteur linéarisé. Des extrémités complémentaires aux extrémités des fragments adjacents sont ajoutées par PCR. La réaction se fait selon les recommandations du constructeur. Le plasmide obtenu est dénommé pTgRopl6KO-Gral5nKI-CAT-GFP lox2272 SEQ ID NO : 67. Le plasmide dénommé pTgRopl6KO-Gral5nKI-CAT-GFP lox2272 SEQ ID NO : 67 contient donc une cassette CAT- GFP SEQ ID NO : 6 et une cassette d'expression de gral5HAII SEQ ID NO : 69, encadrées par une séquence 5'HR du gène tgroplô SEQ ID NO : 99 et une séquence 3'HR du gène tgroplô SEQ ID NO : 100.

Construction de la souche Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G

La construction de la souche vivante atténuée de seconde génération, dénommée Toxo tgmicl-3 KO roplô KO GralSII Kl -2G, est faite en 2 étapes distinctes (figure 12-A) :

Délétion par recombinaison homologue du gène ropl6 et son remplacement par la cassette de sélection CAT-GFP SEQ ID NO : 6 encadrée par des séquences Lox2272 SEQ ID NO : 38 et la cassette gral5IISEQ ID NO : 69.

Pour obtenir cette souche, la souche Toxo tgmic3 KO - 2G est électroporée avec le plasmide pTgRopl6KO-Gral5nKI-CAT-GFP lox 2272 SEQ ID NO : 67 (20 linéarisé par Pcil, selon le protocole précédemment décrit. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24 heures après Γ électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique des clones d'intérêt. La souche obtenue est dénommée Toxo tgmicl-3 KO ropl6 KO GralSII KL

Dans cette souche, le gène ropl6 a été délété et remplacé par la cassette de sélection CATGFP SEQ ID NO :6 et la cassette d'expression de gral5HAII SEQ ID NO : 69. Ainsi, la séquence théorique au locus du gène ropl6 délété contenant la cassette de sélection CATGFP et la cassette d'expression de gral5HAII est la SEQ ID NO : 112. Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO :6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 19.

Dans cette souche, le gène miel a été délété et la cassette de sélection CATGFP SEQ ID NO :6 a été excisé. Ainsi, la séquence théorique au locus du gène miel délété contenant un seul site lox N SEQ ID NO : 5, est la SEQ ID NO : 92.

Suppression de la cassette de sélection : la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl obtenue est électroporée avec le plasmide pT-SAGl-CRE-Recombinase SEQ ID NO : 15 (Figure 1-C). L'enzyme exprimée transitoirement va permettre l'excision de la cassette de sélection CAT-GFP. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Après 2 à 7 jours de culture, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Toxo tgmicl-3 KO ropl6 KO GralSII Kl -2G.

Dans cette souche, le gène ropl6 a été délété et remplacé par la cassette d'expression de gral5HAII SEQ ID NO : 69 et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène ropl6 délété contenant la cassette un seul site lox 2272 SEQ ID NO : 68 et la cassette d'expression de gral5HAII est la SEQ ID NO : 93.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 19.

Dans cette souche, le gène miel a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène miel délété contenant un seul site lox N SEQ ID NO : 5, est la SEQ ID NO : 92.

Validation de la souche Toxo tgmicl-3 KO rop!6 KO Gral5II Kl -2G par PCR

Pour valider la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl 2G des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 11-C et sont détaillées dans le Tableau 12 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 12-C). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 13 ci-dessous.

Tableau 12 : liste des amorces utilisées pour la validation de la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl 2G.

Amorce F Séquence

Rgl AGD rop 16CDS F SEQ ID NO : 83 GTTTGAGGAAGCGCAAAAAG

Tgroplô (mixl)

Rg2 AGD rop 16CDS R SEQ ID NO : 84 TGCTGTGATTTCGCAAGTTC

Validation KO en amont (mix2) Rg3 Rop 16KO valid SEQ ID NO : 85 ACCCCCTGACCCCTTGTCTG

5F1

Rg4 Amont ropl6R SEQ ID NO : 86 TCGTCGTGGTATTCACTCCA

Validation KO en aval (mix3) Rg5 Oral 5 qPCR 2F SEQ ID NO : 87 CACGTACACAACCCATCTCG

Rg6 Aval ropl6R SEQ ID NO : 88 AAAACGAATGCGAAGGAAGA

Cicatrice ropl6 KO gral5 loxP Rg7 cicroplô loxF SEQ ID NO : 89 CAGTACCAGCCACGTTAGCA (mix4) Rg8 cicroplô loxGraR SEQ ID NO : 90 CAAGCAATCTGTGGCAAAAA

Gral5I/II (mix5) Gral5I/II F SEQ ID NO : 109 GTGCAAAGCCAACTTCCACT

Gral5I/II F SEQ ID NO : 1 10 GGACCTGGATCAGAGATCGT

Tableau 13 : Taille attendue des amplicons (en paires de base) des différentes PCR de validation de la construction de la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl 2G


Les électrophorèses des produits PCR réalisés avec les amorces rgl SEQ ID NO : 83 et rg2 SEQ ID NO : 84 (mix 1) permettent de mettre en évidence une bande à 1682 paires de bases pour la souche Toxo tgmicl-3 KO - 2G, conformément à la taille de bande attendue et confirmant la présence du gène tgroplô dans cette souche. Cette bande n'est pas détectée dans les souches Toxo tgmicl-3 KO roplô KO Gral5II Kl et Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G confirmant la suppression du gène dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces rg3 SEQ ID NO : 85et rg4 SEQ ID NO : 86 (mix 2) permettent de mettre en évidence une bande à 2759 paires de bases pour la souche Toxo tgmicl-3 KO roplô KO Gral5II Kl, conformément à la taille des bandes attendues et confirmant la suppression du gène tgroplô dans cette souche et l'insertion du gène de sélection CATGFP et gral5II à la place du gène tgroplô. Cette bande n'est pas détectée dans les souches Toxo tgmicl-3 KO - 2G et Toxo tgmicl-3 KO roplô KO Gral5II KI -2G.

Les électrophorèses des produits PCR réalisés avec les amorces rg5 SEQ ID NO : 87 et rg6 SEQ ID NO : 88 (mix 3) permettent de mettre en évidence une bande à 2870 paires de bases pour les souches Toxo tgmicl-3 KO roplô KO Gral5II Kl et Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G, conformément à la taille des bandes attendues et confirmant la suppression du gène tgroplô dans cette souche et l'insertion du gène gral5II à la place du gène tgroplô. Cette bande n'est pas détectée dans la souche Toxo tgmicl-3 KO - 2G.

Les électrophorèses des produits PCR réalisés avec les amorces rg7 SEQ ID NO : 89 et rg8 SEQ ID NO : 90 (mix 4) permettent de mettre en évidence une bande de 2550 paires de bases pour la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl confirmant la présence de la cassette de sélection CATGFP SEQ ID NO : 6 à la place du gène tgroplô. Enfin une bande de 321 paires de bases est mise en évidence pour la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl -2G confirmant la suppression du gène de sélection cat-gfp SEQ ID NO : 2 dans cette souche, laissant une cicatrice lox2272 SEQ ID NO : 68 dans le génome. Aucune bande n'est pas détectée dans la souche Toxo tgmicl-3 KO - 2G.

Le produit PCR « cicatrice » obtenue pour la souche Toxo tgmicl-3 KO ropl6 KO Gral5II Kl -2G (321 paires de bases) a été séquencé et les séquençages ont confirmés que :

• le gène tgroplô a été supprimé et que la cassette de sélection CAT-GFP SEQ ID NO :

6 a bien été supprimée par action de la Cre-Recombinase laissant une cicatrice Lox2272 SEQ ID NO : 68 conforme à la séquence attendue (Figure 12-D).

Les électrophorèses des produits PCR réalisés avec les amorces SEQ ID NO : 109 et SEQ ID NO : 110 (mix 5) permettent de mettre en évidence une bande à 560 paires de bases pour les souches Toxo tgmicl-3 KO - 2G, conformément à la taille de bande attendue et confirmant la présence du gène tggral5 dans cette souche. Une bande supplémentaire à 308 paires de bases est détectée dans les souches Toxo tgmicl-3 KO roplô KO Gral5II Kl et Toxo tgmicl-3 KO ropl6 KO Gral5II Kl -2G confirmant la présence du gène gral5HAII dans ces souches.

Validation de la souche Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G par immunofluorescence

Les tachyzoïtes sont cultivés 24h sur lamelles en verre recouvertes d'une monocouche de cellules HFF. Les cellules infectées ont été lavés 2 fois en PBS1X, et fixés par du formaldéhyde 4% pendant 30 min. Après 3 lavages en PBS1X, les cellules HFF infectées ont été perméabilisées avec 0,1% de Triton X-100 dans du PBS1X pendant 5 min. Après 3 lavages au PBS IX, une étape de saturation est effectuée avec une solution de PBS 1X/SVF 10% pendant 30 min. Les cellules ont ensuite été incubées avec l'anticorps primaire dilué dans 2%> SVF pendant 1 heure, lavées 3 fois au PBS IX puis incubées avec un anticorps secondaire dilué dans une solution de PBS/SVF 2% pendant 1 heure. Après 2 lavages au PBS IX, les lamelles en verre sont montées sur lame avec de l'Immu-Mount™ et observés au microscope à fluorescence.

L'anticorps primaire utilisé est l'anticorps de souris anti-HA qui permet de détecter l'expression de la protéine GRA15n-HA SEQ ID NO : 123 dans le parasite. L'anticorps secondaire est l'anticorps secondaire commercial : Alexa fluor® 594 chèvre anti lapin (Life Technologies A-l 1012). Les anticorps sont dilués au 1/1000 dans du PBS SVF 2%.

Pour la souche sauvage Toxo tgmicl-3 KO 2G, aucune fluorescence rouge n'est observée au pôle apical du parasite révélant ainsi l'absence de la protéine GRA15n-HA. Au contraire, pour la souche Toxo tgmicl-3 KO ropl6 KO gral5II Kl, une fluorescence rouge est observée démontrant la protéine GRA15n-HA. La souche Toxo tgmicl-3 KO ropl6 KO gral5II Kl exprime une fluorescente verte reflétant l'expression de la protéine CATGFP SEQ ID NO : 120 alors qu'après action de la Cre recombinase, la souche Toxo tgmicl-3 KO ropl6 KO gral5II Kl lox2272 n'est plus fluorescente (Figure 13).

Exemple 6 : Construction de la souche Neo ncmicl-3 KO - 2G (notée Neo KO 2G)

L'haploïdie du génome de Neospora caninum lors de la phase proliférative permet l'invalidation d'un gène en une seule recombinaison homologue.

Culture des parasites

Tous les tachyzoïtes de la souche de Neospora caninum utilisés ont été produits en fîbroblastes humains (HFF Hs27 ATCC CRL-1634)) cultivés en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal (SVF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Ils ont été récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue 25G.

Construction des plasmides

• Plasmide pNcMIC3-KO-CAT-GFP loxN

Le plasmide pNcMic3KO-CAT-GFP loxN SEQ ID NO : 1 contient une cassette de sélection CAT-GFP SEQ ID NO :6 comprenant le gène de sélection cat-gfp SEQ ID NO : 2 codant pour la protéine de fusion CAT-GFP permettant à la fois la résistance au chloramphénicol (CAT) et une fluorescence verte (GFP : Green Fluorescent Protein), sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii SEQ ID NO : 3 pour permettre l'expression du gène dans le parasite. En aval du gène cat-gfp SEQ ID : 2, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 est insérée. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine de fusion CAT/GFP. Cette cassette de sélection SEQ ID NO : 6 est encadrée par deux sites loxN SEQ ID NO : 5 identiques de même orientation.

Pour obtenir ce plasmide, la cassette de sélection CAT-GFP SEQ ID NO : 6 a été amplifiée par PCR sur le plasmide pT230 CAT-GFP SEQ ID NO : 9 avec les amorces cat-gfp LoxN For SEQ ID NO :7 et catgfp loxN rev SEQ ID NO : 8 (2380pb), digérée par les enzymes de restriction Clal et Xbal (2348 pb) et clonée dans le plasmide pNcMic3KO-DHFR SEQ ID NO : 10 digéré par Clal et Xbal (7715 pb).

Le plasmide alors obtenu est le plasmide pNcMic3KO-CAT-GFP loxN SEQ ID NO : 1.

Les séquences des amorces figurent dans le Tableau 14 ci-dessous. Le plasmide pNcMic3KO-CAT-GFP loxN contient donc une cassette CAT-GFP SEQ ID NO :6 encadrée par une séquence 5 'HR du gène ncmic3 SEQ ID NO : 98 et une séquence 3'HR du gène ncmic3 SEQ ID NO : 97.

Tableau 14 : liste des amorces utilisées pour la construction du plasmide pNcMIC3-KO-CAT-GFP loxN

catgfp loxN For SEQ ID NO : 7

TCCGCTCTCAGAGAATCGATGAAGCTTATAACTTCGTATAGT ATACCTTATACGAAGTTATGATATGCATGTCCGCGTTCGTGA AATCTC Clal LoxN

catgfp loxN rev SEQ ID NO : 8

ATACGTAAACTTCTAGATCCATAACTTCGTATAAGGTATACT Xbal loxN

ATACGAAGTTATCCCTCGGGGGGGCAAGAATTGTGTTAACCG GTTCGA

• Plasmide pNcMIC 1 -KO-CAT-GFP lox

Le plasmide pNcMicl KO-CAT-GFP loxP SEQ ID NO : 1 1 contient une cassette de sélection CAT-GFP SEQ ID NO : 6 comprenant le gène de sélection cat-gfp SEQ ID NO : 2 codant pour une protéine de fusion CAT-GFP permettant à la fois la résistance au chloramphénicol (CAT) et une fluorescence verte (GFP : Green Fluorescent Protein), sous le contrôle du promoteur de Γα-tubuline de Toxoplasma gondii SEQ ID NO : 3 pour permettre l'expression du gène dans le parasite. En aval de la séquence codant CAT-GFP, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO : 4 est insérée. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine de fusion CAT/GFP. Cette cassette de sélection SEQ ID NO : 6 est encadrée par deux sites loxP SEQ ID NO : 12 identiques de même orientation.

Pour obtenir ce plasmide, la cassette de sélection CAT-GFP SEQ ID NO : 6 a été amplifiée par PCR sur le plasmide pT230 CAT-GFP SEQ ID NO : 9 avec les amorces CN10 SEQ ID NO : 13 et CN11 SEQ ID NO : 14 permettant l'ajout des sites loxP SEQ ID NO : 12 (2394 pb), digérée par les enzymes de restriction HindIII et BamHI (2339 pb) et clonée dans le plasmide pT230-ble SEQ ID NO : 37 digéré par HindIII et BamHI (293 lpb). Le plasmide alors obtenu est le plasmide pT230 CAT-GFP loxP SEQ ID NO : 113.

La région 3 HR du gène ncmicl a été amplifiée par PCR à partir de l'ADN génomique de la souche NC-1 de Neospora caninum. Pour l'amplification, les amorces 3 HR NCmicl F Kpnl et 3 HR NCmicl R HindIII (SEQ ID NO : 114 et SEQ ID NO : 115) permettent l'amplification de la région 3 HR du gène ncmicl et la création de deux sites de restrictions qui ont été utilisés pour cloner le fragment 3HR en amont de la cassette de sélection CAT-GFP dans le pT230 CAT-GFP loxP SEQ ID NO : 113. Le plasmide obtenu est dénommé pNcmicl-3HR CATGFP loxP SEQ ID NO : 118.

La région 5 HR du gène ncmicl a été amplifiée par PCR à partir de l'ADN génomique de la souche NC-1 de Neospora caninum. Pour l'amplification, les amorces 5 HR NCmicl F BamHI et 5 HR NCmicl R Notl (SEQ ID NO : 116 et SEQ ID NO : 117) permettent l'amplification de la région 5'UTR du gène ncmicl et la création de deux sites de restrictions qui ont été utilisés pour cloner le fragment 5HR en aval de la cassette de sélection CAT-GFP dans le plasmide pNcmicl-3HR CATGFP loxP SEQ ID NO : 118 (BamHI -Notl).

Le plasmide alors obtenu est le plasmide pNcMiclKO-CAT-GFP loxP SEQ ID NO : 11. Le plasmide pNcMiclKO-CAT-GFP loxP contient donc une cassette CAT-GFP SEQ ID NO : 6 encadrée par une séquence 5'HR du gène ncmicl SEQ ID NO : 96 et une séquence 3'HR du gène ncmicl SEQ ID NO : 95.

Les séquences des amorces figurent dans le Tableau 15 ci-dessous.

Tableau 15 : liste des amorces utilisées pour la construction du plasmide pNcmicl KO CATGFP loxP

Construction du plasmide pNcmicl KO CATGFP loxP

SEQ ID NO : 13

CN10 GCGGCCAAGCTT/i TAA CTTCGTA TAA TGTA TGCTA TA CGA HindIII, loxP

^Gr7¾7GATATGCATGTCCGCgttcgtgaaatctctgatcaagcgg

SEQ ID NO : 14

CN11 cgacgcacgctgtcactcaacttgctGCTAGA^C 4G7OGATCC^r 4 Spel, BamHI, loxP

CTTCGTA TA GCA TA CA TTA TA CGAA GTTA 7CCCTCGGGGG

GGCAAGAATT

3 HR NCmicl F SEQ ID NO : 114

Kpnl

Kpnl CGCGGTACCAGGCAGAAGTAAAGAAGGTTCCTC

3 HR NCmicl R SEQ ID NO : 115

HindIII

HindIII CGCAAGCTTTGATCACGCAAGAAAAGAAGC

5 HR NCmicl F SEQ ID NO : 116

BamHI

BamHI CGCGGATCCCATTTGTAGATACGGTTGCACAC

5 HR NCmicl R SEQ ID NO : 117

Notl

Notl CGCGCGGCCGCACATTCAGACGGCAGAACTCTG

• Plasmide pTSAGl- Cre Recombinase

Le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15 a été construit pour exprimer de manière transitoire dans le parasite Toxoplasma gondii et ses dérivés modifiés génétiquement le gène codant la protéine Cre Recombinase dérivée du bactériophage PI (Brecht et al, 1999, même référence que précédemment).

Le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15 dérive du plasmide pUC18 (plasmide commercial) qui contient une cassette d'expression de la Cre Recombinase du bactériophage Pl .

Dans le plasmide pT-SAGl-Cre-Recombinase SEQ ID NO : 15, le gène codant la Cre Recombinase SEQ ID NO : 16 est placé sous la dépendance du promoteur du gène sagl de Toxoplasma gondii SEQ ID NO : 17, ce qui permet l'expression de la protéine Cre Recombinase dans les parasites Toxoplasma gondii transfectés. En aval du gène codant la Cre Recombinase, la séquence 3'UTR du gène sagl de Toxoplasma gondii SEQ ID NO :4 est insérée. Cette séquence a pour objectif de stabiliser l'ARNm codant la protéine Cre Recombinase.

L'absence de cassette de sélection spécifique ne permet pas une intégration stable du matériel génétique transfecté mais seulement une expression transitoire de la Cre Recombinase.

Construction de la souche Neo ncmicl-3 KO - 2G

La construction de la souche vivante atténuée de seconde génération, dénommée Neo ncmicl-3 KO - 2G, est faite en 4 étapes distinctes :

1. Délétion par recombinaison homologue du gène ncmic3 et son remplacement par la cassette de sélection CAT-GFP SEQ ID NO : 6 encadrée par des séquences LoxN SEQ ID NO : 5.

Pour obtenir cette souche, la souche sauvage NC-1 de Neospora caninum est électroporée avec le plasmide pNcMIC3-KO-CAT-GFP lox N SEQ ID NO : 1. 20 μg de plasmide purifié puis linéarisé par Kpnl sont ajoutés à 107 parasites mis en suspension dans le milieu d'électroporation CYTOMIX contenant de ΑΤΡ (3 mM) et du Glutathion (3 mM) (Van den Hoff et al., Nucleic Acid Research, Jun l l ; 20(11):2902), et Pélectroporation a été réalisée en cuvette d'écart 4 mm, dans un volume de 800 sur un appareil BioRad (Paramètres : 2000V, 50 ohms, 25 μΡ, avec deux chocs électriques). Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24 heures après Γ électroporation. 10 à 15 jours après sélection, les parasites sont sous- clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Neo ncmic3 KO. Dans cette souche, le gène mic3 a été délété et remplacé par la cassette de sélection CATGFP SEQ ID NO :6. Ainsi, la séquence théorique au locus du gène mic3 délété contenant la cassette de sélection CATGFP est la SEQ ID NO : 101. Le gène miel n'étant pas délété, la séquence du gène miel SEQ ID NO : 106 est présente dans le génome de la souche.

2. Suppression de la cassette de sélection SEQ ID NO : 6 : la souche Neo ncmic3 KO obtenue est électroporée avec le plasmide pT-SAGl-CRE-Recombinase SEQ ID NO : 15.

L'enzyme exprimée transitoirement va permettre l'excision de la cassette de sélection CAT-GFP SEQ ID NO : 6. Le protocole d'électroporation est similaire au protocole précédent. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Après 2 à 7 jours de culture, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Neo ncmic3 KO - 2G.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 18. Le gène miel n'étant pas délété, la séquence du gène miel SEQ ID NO : 106 est présente dans le génome de la souche.

Délétion par recombinaison homologue du gène ncmicl et son remplacement par la cassette de sélection CAT-GFP SEQ ID NO : 6 encadrée par des séquences LoxP SEQ ID NO : 12.

Pour obtenir cette souche, la souche Neo ncmic3 KO - 2G est électroporée avec le plasmide pNcMICl-KO-CAT-GFP lox P SEQ ID NO : 11 linéarisé par Kpnl, selon le protocole précédemment décrit. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Pour la sélection des mutants, le milieu de culture est remplacé et supplémenté par l'agent de sélection (chloramphénicol 20 μΜ), 24 heures après Γ électroporation. 10 à 15 jours après sélection, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique des clones d'intérêt. La souche obtenue est dénommée Neo ncmicl-3 KO

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 18. Dans cette souche, le gène miel a été délété et remplacé par la cassette de sélection CATGFP SEQ ID NO : 6. Ainsi, la séquence théorique au locus du gène miel délété contenant la cassette de sélection CATGFP est la SEQ ID NO : 102.

4. Suppression de la cassette de sélection SEQ ID NO :6 : la souche Neo ncmicl-3 KO obtenue est électroporée avec le plasmide pT-SAGl-CRE-Recombinase SEQ ID NO : 15.

L'enzyme exprimée transitoirement va permettre l'excision de la cassette de sélection CAT-GFP SEQ ID NO :6. Après électroporation, les tachyzoïtes sont déposés sur une monocouche de cellules HFF en culture. Après 2 à 7 jours de culture, les parasites sont sous-clonés en plaque 96 puits sur une monocouche de cellules HFF et les clones d'intérêt sont identifiés par PCR après avoir effectué une extraction d'ADN génomique au DNAzol des clones d'intérêt. La souche obtenue est dénommée Neo ncmicl-3 KO - 2G.

Dans cette souche, le gène mic3 a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène mic3 délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 18.

Dans cette souche, le gène miel a été délété et la cassette de sélection CATGFP SEQ ID NO : 6 a été excisé. Ainsi, la séquence théorique au locus du gène miel délété contenant un seul site lox P SEQ ID NO : 12, est la SEQ ID NO : 91.

Validation de la souche Neo ncmicl-3 KO - 2G par PCR

Pour valider la souche Neo ncmicl-3 KO - 2G des analyses PCR sont effectuées à partir de l'ADN génomique extrait au DNAzol à partir d'un culot parasitaire constitué de 107 parasites. Les amorces utilisées pour les PCR sont décrites dans la Figure 15-B et sont détaillées dans le Tableau 16 ci-dessous. Les produits PCR sont analysés par électrophorèse sur gel d'agarose (Figure 15-C). Leur taille attendue et leur taille observée sont également décrites dans le Tableau 17 ci-dessous. Pour plus de clarté sur la figure 15-C, seules les 3 étapes de la réalisation sont représentées (ncmic3, ncmic3KO CATGFP et ncmic3KO loxN (2G) ou ncmicl, ncmiclKO CATGFP et ncmiclKO loxP(2G)), les résultats obtenus sont conformes aux tailles attendues

Tableau 16 : liste des amorces utilisées pour la validation des souches.


Tableau 17 : Taille attendue des amplicons (en paires de base) des différentes PCR de validation de la construction des souches KO de Neospora caninum

NC-1 ~Neoncmic3 Neo ncmic3 Neo ncmicl- Neo ncmicl-3

KO KO loxN 3 KO loxP K0 2G

Ncmic3 (mixl) 850 - - - - Validation KO - 2960 - - - 5'Ncmic3(mix2)

Validation KO 3'Ncmic3 - 3668 - - - (mix3)

Cicatrice Ncmic3 (mix4) 2163 2575 276 276 276

Ncmicl (mix5) 701 701 701 - - Validation KO 5 'Ncmicl - - - 3359 - (mix6)

Validation KO 3 'Ncmicl - - - 3421 - (mix7)

Cicatrice Ncmicl (mix8) 3161 3161 3161 2560 261

Les électrophorèses des produits PCR réalisés avec les amorces c SEQ ID NO : 22 et d SEQ ID NO : 23 (mix 1) permettent de mettre en évidence une bande à 850 paires de bases pour la souche NC-1, conformément à la taille de bande attendue et confirmant la présence du gène ncmic3 SEQ ID NO : 105 dans cette souche. Cette bande n'est pas détectée dans les souches Neo ncmic3 KO, Neo ncmic3 KO - 2G, Neo ncmicl-3 KO et Neo ncmicl-3 KO - 2G confirmant la suppression du gène dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces i SEQ ID NO : 24 et j SEQ ID NO : 25 et les amorces k SEQ ID NO : 26 et 1 SEQ ID NO : 27 (mix Ncmic3) permettent de mettre en évidence respectivement une bande à 2960 et 3668 paires de bases pour la souche Neo ncmic3 KO, conformément à la taille de bande attendue et confirmant la présence du gène de sélection cat-gfp dans cette souche à la place du gène ncmic3. Cette bande n'est pas détectée dans les souches NC-1, Neo ncmic3 KO - 2G, Neo ncmicl-3 KO et Neo ncmicl -3 KO - 2G confirmant l'absence du gène de sélection cat-gfp SEQ ID NO : 2 au locus ncmic3 dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces amorces g SEQ ID NO : 32 et h SEQ ID NO : 33 (cicatrice Ncmic3) permettent de mettre en évidence différentes bandes conformément à la taille de bande attendue. Une bande à 2163 paires de bases pour la souche NC-1, confirme la présence du gène ncmic3 SEQ ID NO : 105 dans cette souche. Une bande de 2575 paires de bases est mise en évidence pour la souche Neo ncmic3 KO confirmant la présence de la cassette de sélection CATGFP SEQ ID NO : 6 à la place du gène ncmic3. Enfin une bande de 276 paires de bases est mise en évidence pour les souches Neo ncmic3 KO - 2G Neo ncmicl-3 KO et Neo ncmicl-3 KO - 2G confirmant la suppression du gène de sélection cat-gfp SEQ ID NO : 2 dans ces souches, laissant une cicatrice loxN SEQ ID NO : 5 dans le génome.

Les électrophorèses des produits PCR réalisés avec les amorces a SEQ ID NO : 20 et b SEQ ID NO : 21 (mix Ncmicl) permettent de mettre en évidence une bande à 644 paires de bases pour les souches NC-1, Neo ncmic3 KO, Neo ncmic3 KO - 2G, conformément aux tailles de bandes attendues et confirmant la présence du gène ncmicl SEQ ID NO : 106 dans ces souches. Ces bandes ne sont pas détectées dans les souches Neo ncmicl-3 KO et Neo ncmicl-3 KO - 2G confirmant la suppression du gène dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces m SEQ ID NO :28 et j SEQ ID NO : 25 et les amorces k SEQ ID NO : 26 et n SEQ ID NO : 29 (mix Ncmicl) permettent de mettre en évidence respectivement une bande à 3359 et 3421 paires de bases pour la souche Neo ncmicl-3 KO, conformément à la taille de bande attendue et confirmant la présence du gène de sélection cat-gfp SEQ ID NO : 2 dans cette souche à la place du gène ncmicl. Cette bande n'est pas détectée dans les souches sauvage NC-1 de N. caninum, Neo ncmic3 KO, Neo ncmic3 KO - 2G, et Neo ncmicl-3 KO - 2G confirmant l'absence du gène de sélection at-gfp SEQ ID NO : 2 au locus ncmicl dans ces souches.

Les électrophorèses des produits PCR réalisés avec les amorces SEQ ID NO : 30 et f SEQ ID NO : 31 (cicatrice Ncmicl) permettent de mettre en évidence différentes bandes conformément à la taille de bande attendue. Une bande à 2182 paires de bases pour les souches NC-1, Neo ncmic3 KO, Neo ncmic3 KO - 2G confirme la présence du gène ncmicl dans ces souches. Une bande de 2560 paires de bases est mise en évidence pour la souche Neo ncmicl-3 KO confirmant la présence de la cassette de sélection CATGFP SEQ ID NO : 6 à la place du gène ncmicl. Enfin une bande de 261 paires de bases est mise en évidence pour la souche Neo ncmicl-3 KO - 2G confirmant la suppression du gène de sélection cat-gfp SEQ ID NO : 2 dans cette souche, laissant une cicatrice loxP SEQ ID NO : 12 dans le génome.

Les produits PCR « cicatrice » (mix 4 et 8) ont été séquencés et les séquençages ont confirmés que :

• le gène ncmic3 SEQ ID NO : 105 a été supprimé et que la cassette de sélection CATGFP SEQ ID NO : 6 a bien été supprimée par action de la Cre-Recombinase laissant une cicatrice LoxN SEQ ID NO : 5 conforme à la séquence attendue (Figure 15-D).

• le gène ncmicl SEQ ID NO : 106 a été supprimé et que la cassette de sélection CATGFP SEQ ID NO : 6 a bien été supprimée par action de la Cre-Recombinase laissant une cicatrice LoxP SEQ ID NO : 12 conforme à la séquence attendue (Figure 15-D).

Validation de la souche Neo ncmicl-3 KO - 2G par immunofluorescence

Les tachyzoïtes cultivés 24h sur lamelles en verre recouvertes d'une monocouche de cellules HFF. Les cellules infectées ont été lavés 2 fois en PBS1X, et fixés par du formaldéhyde 4% pendant 30 min. Après 3 lavages en PBS1X, les cellules HFF infectées ont été perméabilisées avec 0,1% de Triton X-100 dans du PBS1X pendant 5 min. Après 3 lavages au PBS IX, une étape de saturation est effectuée avec une solution de PBS 1X/SVF 10% pendant 30 min.. Les cellules ont ensuite été incubées avec l'anticorps primaire dilué dans 2% SVF pendant 1 heure, lavées 3 fois au PBS1X puis incubées avec un anticorps secondaire dilué dans une solution de PBS/SVF 2% pendant 1 heure. Après 2 lavages au PBS1X, les lamelles en verre sont montées sur lame avec de l'Immu-Mount™ et observés au microscope à fluorescence.

L'anticorps primaire Tgmic3 permet une reconnaissance de la protéine Ncmic3, il permet de détecter l'expression de la protéine NcMIC3 SEQ ID NO : 118 dans le parasite (anticorps de lapin anti-mic3 : rnAb anti-MIC3 s3) et l'anticorps secondaire commercial utilisé est l'Alexa fluor® 594 chèvre anti- lapin (Life technologies réf. A-l 1012).

Les résultats montrent qu'aucune fluorescence n'est détectable au pôle apical du parasite révélant l'absence des protéines MIC3 (Figure 16-A).

L'anticorps primaire Tgmicl ne permet pas une reconnaissance de la protéine NcMICl SEQ ID NO : 119.

Les résultats montrent que les parasites expriment une fluorescente verte reflétant l'expression de la protéine CATGFP SEQ ID NO : 120 suite à la réalisation des délétions de gènes (Neo ncmic3 KO et Neo ncmicl-3 KO) alors qu'après action de la Cre recombinase, les souches Neo ncmic3 KO - 2G et Neo ncmicl-3 KO - 2G ne sont plus fluorescentes (suppression de de la cassette CATGFP SEQ ID NO : 6) (Figure 16-B).

Exemple 7 : Amélioration des propriétés immunostimulantes de la souche Toxo

Tgmicl-3 KO - 2G.

L'objectif de cette expérimentation est d'évaluer l'impact des modifications génétiques apportées à la souche Toxo tgmicl-3 KO - 2G (la suppression du gène ropl6 et/ou l'insertion du gène gral5II) en testant le potentiel d'activation des monocytes humains (THPl-Blue) et d'une lignée de macrophages de souris (Raw264.7) par chacune des différentes souches parasitaires suivantes : la souche Me49 (typell), la souche sauvage RH, la souche Toxo tgmicl-3 KO - 2G (notée Toxo KO 2G), la souche Toxo tgmicl-3 KO - 2G / ROP 16 KO (notée Toxo Rop 16), la souche Toxo tgmicl -3KO Gral5II Kl (notée Toxo Gral5 Kl), la souche Toxo tgmicl-3¥ O ropl6 KO Gral5II Kl (notée Toxo KO+).

Matériel et méthodes

Production de parasites

La souche Me49 (typell), la souche sauvage RH, les souches Toxo KO 2G, Toxo Rop 16, Toxo Gral5 Kl et Toxo KO+ sont produites en fïbroblastes humains (HFF Hs27 ATCC CRL-1634) cultivées en milieu minimal de Dulbecco (DMEM) supplémenté par 10% de sérum de veau fœtal sud-américain. Les tachyzoïtes sont récoltés après lyse mécanique des cellules hôtes par 3 passages en seringue. Les parasites ont été énumérés sur cellule de Malassez et repris dans le milieu de stimulation pour atteindre une concentration parasitaire souhaitée.

Production de monocytes humains (THPl-Blue)

Le milieu de maintien en culture des THPl-Blue™ est composé de RPMI, 2mM de L-Glutamine ; l,5g/L de sodium bicarbonate ; 4.5g/L de glucose, lOmM d'HEPES, ImM de sodium pyruvate, 10% de S VF ultrapure (Hyclone), 1% de P/S et lOOmg/mL de Normocin.

Le milieu de stimulation est semblable au milieu de maintien en culture mais dépourvu de Normocin.

Production de macrophages de souris (Raw264.7)

Les macrophages murins de la lignée RAW264.7 sont maintenus en culture en milieu minimal de Dulbecco (DMEM) supplémenté par 10%> de sérum de veau fœtal sud-américain, 1% de glutamine, 1% de pénicilline/streptomycine.

Dosage de l 'activation de NF-KB

Les expériences d'analyse de Γ activation de NF-κΒ après infection avec les différentes souches de T. gondii sont faites in-vitro en plaque 96 puits à raison de 5.104 ΰεΐηιΐεβ/ΐθθμΐ/ρωίβ. Les parasites purifiés sont repris dans le milieu de stimulation, concentrés pour avoir un ratio de 5 parasites par cellule (MOI=5), dans un volume de ΙΟΟμΙ déposé sur les ΙΟΟμΙ de THPl-Blue™. L'activité est analysée après 18h à 24h d'infection à 37°C dans une étuve à C02.

Dans une plaque vierge spécifique pour une lecture en spectrométrie, 18μ1 de solution Quanti-Blue sont additionnés à 20μ1 de surnageant des cellules THPl stimulées. La lecture se fait en cinétique au spectromètre à 620-655nm après incubation de la plaque à 37°C durant 1 à 8H.

Dosage IL12p40 par ELISA

Les différentes souches sont testées in vitro afin d'évaluer et de comparer la production en IL12p40 en utilisant une lignée de macrophages. Les macrophages (RAW264.7) sont préstimulés durant 1H (lOpg rm IFNy et lOOng de LPS) avant d'être infectés avec les différentes souches de T. gondii (MOI=5). L'IL12p40 est dosée par ELISA (kit Duoset IL12p40 murin -RnD Systems). Les médianes sont représentées. Des tests non paramétriques sont utilisés (test de Kruskal-Wallis) pour comparer les données obtenues avec les souches recombinantes en fonction des données obtenues avec la souche Toxo KO 2G (ns : non significatif ; ** p<0.01 ; *** p<0.001 ; **** p<0.0001).

Résultats

Activation de la voie NF-KB

La protéine GRA15IIHA devrait être capable d'activer la voie NF-κΒ tout comme le fait la protéine GRA15 dans les souches de type II (Rosowski et al, 2011). Pour le valider, nous avons utilisé la lignée de monocytes THPl-BlueTM NF-κΒ (Invivogen) qui permet de doser l'activation de NF-κΒ. Les monocytes humains recombinants THPl-Blue™ NF-κΒ sont des cellules spécifiquement conçues pour l'analyse de la voie de transduction du signal NF-KB. Elles ont été génétiquement modifiées par intégration stable de la cassette d'expression du gène rapporteur codant pour la phosphatase alcaline embryonnaire sécrétée (SEAP). L'expression du gène rapporteur est inductible par l'expression du facteur de transcription de NF-κΒ. L'activation de NF-κΒ est donc quantifiée par l'activité de SEAP NF-KB-dépendante évaluée avec le Quanti-Blue, un réactif de détection SEAP.

Les différentes souches sont testées in vitro afin d'évaluer et de comparer l'activation de la voie NF-κΒ. Après 18 à 24H d'infection (MOI=5), l'activité de NF-κΒ est quantifiée à partir du surnageant des cellules THPl-Blue NF-κΒ. La comparaison entre toutes les souches a été réalisée deux fois. Quatre expériences supplémentaires ont été réalisées pour comparer les souches Toxo KO 2G et Toxo KO+. Des tests statistiques non paramétriques de Kruskal-Wallis ont été réalisés.

Par ce procédé, nous avons pu observer que les souches Toxo Gral5 Kl et Toxo KO+ étaient capables d'activer de manière significative la voie NF-κΒ comparées aux souches Toxo KO 2G et Toxo Rop 16, qui n'expriment pas de GRA15 de type II (Figure 17A).

Expression de cytokines IL12p40

La stratégie de délétion du gène codant pour la protéine ROP16I visait à augmenter la production d'IL-12p40 de la cellule hôte infectée. En effet, ROP16I via la phosphorylation de STAT3 et STAT6 inhibe la production des cytokines inflammatoires (Saeij et al., 2007). Par conséquent, après la délétion de ROP16I, nous nous attendions à avoir une augmentation significative de la production en IL-12p40, ce que nous avons pu confirmer avec la lignée de macrophage RAW264.7 pour les souches ToxoKO Ropl6 et ToxoKO + (Figure 17B).

Alors que nous constatons que l'insertion de GRA15II seule n'a pas ou peu d'effet sur la production d'IL-12p40 sur des lignées de macrophages, la délétion de ROP16I et l'insertion de GRA15II combinée nous a permis d'observer un effet synergique avec une production d'IL-12p40 plus élevée pour la souche ToxoKO + par rapport à la souche ToxoKO Ropl6 (Figure 17B).

Conclusion

L'établissement des nouvelles souches atténuées via les manipulations génétiques de GRA15II par insertion et ROP16I par délétion, nous ont permis de voir un effet des deux mutations GRA15IIKI et ROP16IKO appliquées à la souche Toxo tgmicl-3 KO 2G sur l'activation de la voie NF-κΒ et la production d'IL-12p40.

Exemple 8 : Immunostimulation ex vivo de macrophages aviaires primaires ou sous lignées de macrophage de type HP 11

L'objectif de cette expérimentation est de définir quel est le potentiel d'activation de cellules immunitaires de poulet par chacune de ces souches sous la forme vivante, inactivée ou d'extrait total.

Matériel et méthodes

Cellules primaires de poulet

Les splénocytes sont isolés à partir de rate de poulet de statut SPF (exempt d'agents pathogènes spécifiques) fournies directement par la plateforme d'expérimentation animale de l'INRA (PFIE, Nouzilly, France). Brièvement, les rates sont broyées sur un tamis cellulaire de porosité de 100 μιη (CellStrainer, Becton Dickinson, France). Les cellules immunitaires sont isolées par gradient de densité en respectant les consignes du fabriquant (Histopaque 1119, Sigma). Elles sont ensuite lavées à trois reprises dans du milieu de culture, comptées en cytométrie en flux et diluées à 2 .106 cellules vivantes par millilitre dans du milieu de culture. Les cellules primaires de poulet sont cultivées en milieu RPMI additionné de 12% de sérum de poule (Référence commerciale 16110082, Life Technology), de 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine.

Les macrophages primaires de poulet sont isolés à partir de 10 mL de sang de poulet. Après dilution au tiers, le sang dilué est déposé sur un gradient de densité de 1119 (Histopaque 1119, Sigma) et centrifugé à 1200g pendant 30 minutes sans frein. L'anneau de cellules mononuclées est récupéré, lavé à trois reprises dans du milieu de culture. Les cellules immunitaires sont quantifiées en cytométrie en flux et la concentration cellulaire sera ajusté à 5.106 cellules vivantes par millilitre. Elles sont réparties à raison de 200 par puits dans une plaque 96 puits à fond plat (Flacon, Corning) et maintenues trois heures à 37°C. Les cellules non adhérentes sont lavées à trois reprises dans du PBS (tampon phosphate salin, 7001 1036, ThermoFisher Scientifïc). Chaque puits est complété par 200 de milieu de culture frais. Après 48 heures supplémentaires d'incubation à 37°C, les cellules non adhérentes et notamment les débris plaquettaires sont éliminés par deux lavages en PBS. La pureté est mesurée en cytométrie en flux en comptant le nombre de cellules portant l'antigène membranaire KUL1 (ab25441 , Abcam), les macrophages obtenus dans cette expérience sont à un niveau de pureté supérieure ou égale à 92%>. La lignée de macrophage de poulet HD1 1 est cultivée dans du milieu DMEM (11885-084, Thermo fïsher scientifïc) auquel est ajouté 5% de sérum de veau fœtal décomplémenté et 5% de sérum de poule 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine.

Production de parasites dérivés de Toxoplasma gondii et de Neospora caninum

Les souches Toxo-KO+, Toxo tgmicl-3 KO 2G, Toxo KO+2G, Neo ncmicl-3 KO 2G, Toxoplasma gondii RH et Neospora caninum NC 1 sont entretenues par passages successifs sur une lignée de fîbroblastes de prépuce humain (HFF) cultivées dans du milieu DMEM auquel est ajouté 10%> de sérum de veau fœtal (S VF), 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Les tachyzoïtes extra-cellulaires obtenus après trois jours de culture sont utilisés dans cette étude. Ils sont concentrés et lavés par centrifugation à 900 g pendant 5 minutes à température ambiante. Après remise en suspension

dans une solution de DMEM, les tachyzoïtes sont comptés en cytométrie en flux et leur viabilité est évaluée par la proportion du nombre de tachyzoïtes n'incorporant pas l'Iodure de Propidium (P4864-10mL, Sigma-Aldrich) par rapport au nombre de tachyzoïtes total. La viabilité des tachyzoïtes utilisés dans cette expérience est supérieure à 85% lors de l'utilisation de tachyzoïtes frais.

Production des parasites inactivés

Pour produire les parasites inactivés pour chacune des souches, 109 tachyzoïtes sont produits et centrifugés à 900 g pendant 5 minutes. Ils sont remis en suspension dans une solution de PBS complémentée avec 4% de formaldéhyde (Référence commerciale 252549, Sigma) et sont laissés 30 minutes à 4°C. Après quatre lavages avec du PBS, les parasites inactivés sont recomptés en cellule de Malassez et ajustés à 109 parasites par millilitre.

Production des extraits totaux

Pour produire les extraits totaux pour chacune des lignées, 109 parasites sont produits et centrifugés à 900 g pendant 5 minutes. Ils sont remis en suspension dans de l'eau distillée dépourvue d'endotoxine (Référence commerciale 10977035, Gibco). La lyse cellulaire est effectuée par deux périodes de sonication de 10 minutes à 60W dans la glace. Les débris non solubles sont filtrés sur une membrane PVDF (polyflurorure de vinylidène) de 45 μιη faible absorbance et stérile (SLHV033RS, Merck-Millipore). La quantité de protéines totales extraites est quantifiée selon la méthode BCA (dosage par l'acide bicinchronique) en respectant les consignes du fabriquant (Référence commerciale Sigma B-9643 et C-2284). Les différents extraits produits à partir des différentes souches sont standardisés à 1 mg/mL et conservés à -80°C.

Stimulation cellulaire

Pour chacune des souches et des types cellulaires étudiés, les cellules sont stimulées 4h et 24h par les extraits totaux de chacune des souches produites, par les tachyzoïtes inactivés pour chacune des souches et par des tachyzoïtes frais aux doses indiquées.

Extraction des ARN messagers et transcription inverse

Après 4 ou 24 heures de stimulation, les cellules sont lysées avec le tampon de lyse cellulaire RLT+ (Qiagen), contenant une forte concentration en guanidine isothiocycanate, et les ARN messagers sont extraits en respectant strictement la procédure du Kit RNeasy micro kit plus (74034, Qiagen). Les ARNm sont quantifiés par spectrophotométrie (Nanodrop™) et dilués en eau distillée RNAse/DNAse free à une concentration de 200 ng^L.

Les ADN complémentaires sont produits en respectant les consignes du kit iScript™ Reverse Transcription Supermix (1708841, Bio-Rad) et à partir de 2 μg d'ARN messager.

Mesure de l 'expression cytokinaire

L'expression de l'IL-8, l'IL-Ιβ, l'IL-6, LITAF, l'IFN-γ, l'IFN-α, l'IL-12 et la GAPDH est mesurée en RT-qPCR en respectant la méthode préconisée par le fabriquant (SsoAdvanced™ Universal SYBR® Green Supermix, 1725270, Bio-Rad). Les conditions de PCR, les primers (amorces) sont décrits dans le tableau 18 ci-dessous. L'expression de chacune des cytokines est rapportée à l'expression de la GAPDH en utilisant la méthode des courbes standard.

Tableau 18 : Description des amorces et conditions de PCR

Gène Primer sens Primer anti-sens Hybridation

GAPDH SEQ ID NO : 154 SEQ ID NO : 155 60°C

GAGATGGTGAAAGTCGGAGTC TTTCCCGTTCTCAGCCTTGAC

IL12B SEQ ID NO : 156 SEQ ID NO : 157 60°C

TACTTTCCTTTGCTGCCCTTCT TGGTGTCTCATCGTTCCACT

IFN- SEQ ID NO : 158 SEQ ID NO : 159 60°C gamma CTGAAGAACTGGACAGAGAGAAA GTTTGATGTGCGGCTTTGACT

LITAF SEQ ID NO : 160 SEQ ID NO : 161 60°C

CTGTGTATGTGCAGCAACCC AACAACCAGCTATGCACCCCA

IFN- SEQ ID NO : 162 SEQ ID NO : 163 58°C alpha CCTTGCTCCTTAACGACA CGCTGAGGATACTAGAAGAGGT

IL-lbeta SEQ ID NO : 164 SEQ ID NO : 165 60°C

CTTCCTCCAGCCAGAAAGT CAGCGTTGTAGCCCTTGAT

IL-6 SEQ ID NO : 166 SEQ ID NO : 167 53°C

CAACCTCAACCTGCCCAA GGAGAGCTTCCTCAGGCATT

IL-8 SEQ ID NO : 168 SEQ ID NO : 169 58°C

CTGAGGTGCCAGTGCATTAG AGCACACCTCTCTTCCATCC

IL- 12a SEQ ID NO : 170 SEQ ID NO : 171 60°C

AAGACCTGAAAACCTACAAGGC GGCTTGCATCATGTCATCAA

Analyse statistique

Les analyses statistiques ont été calculées à l'aide du logiciel GraphPad Prism 7. Une ANOVA deux voies suivie d'un test post-hoc de Tukey ou de Bonferroni a été utilisée pour effectuer les comparaisons multiples en prenant en compte l'appariement des données, la durée de stimulation et le type de stimulation.

Résultats

Expression de cytokines pro-inflammatoires

L'expression de l'IL-8, l'IL-6, l'IL-Ιβ et l'IFN-α reflète une réponse inflammatoire active, telle que classiquement observée lors d'une infection bactérienne, virale ou parasitaire. L'expression de ces cytokines est forte dans les cellules primaires après une stimulation de type PMA/Ionomycine utilisée ici comme contrôle positif dans les macrophages. La lignée HD11 bien que réceptive aux stimuli pro-inflammatoires n'exprime pas ces cytokines à un haut niveau.

L'expression de chacune de ces cytokines est respectivement plus forte après stimulation par les souches vivantes de Toxo-KO+ et Toxo-KO+ 2G , telles qu'obtenues respectivement aux exemples 4 et 5, en regard des stimulations effectuées avec les souches, Toxo tgmicl-3 KO 2G, Toxoplasma gondii RH, Neospora caninum NC1 et Neo ncmicl-3 KO 2G. ces différences d'expression de cytokines pro -inflammatoire entre les groupes sont plus faibles lorsque les souches sont testées sous la forme d'extraits totaux ou de parasites inactivés.

Expression de cytokines pro-cytotoxiques

Les parasites du genre Apicomplexa, comme Toxoplasma spp. et Neospora spp., sont des parasites intracellulaires obligatoires. La réponse cytotoxique est directement en lien avec la production d'IFN-γ et d'IL-12 c'est pourquoi le niveau d'expression de ces deux cytokines a également été quantifié pour comparer la capacité d'activation du système immunitaire de chacune des souches dérivées de Toxoplasma gondii ou de Neospora caninum

L'expression de l'IFN-γ et de l'IL-12 est très augmentée par une stimulation avec de la PMA/Ionomycine qui est utilisée ici comme contrôle positif. Le niveau d'expression d'IL-12 et d'IFN-γ par les splénocytes est également élevé. En revanche, les macrophages primaires et HD11 produisent peu d'IFN-γ et sont plus enclins à produire de l'IL-12.

Ces deux cytokines sont exprimées dans une forte mesure en réponse à une stimulation par des parasites vivants des souches Toxo-KO+ et Toxo-KO+ 2G, telles qu'obtenues respectivement aux exemples 4 et 5. Dans une moindre mesure, l'expression de ces deux cytokines est augmentée par rapport à la condition contrôle après une stimulation par les autres souches dérivées de Toxoplasma gondii et Neospora caninum, y compris les souches sauvages.

Comme pour l'expression des cytokines pro -inflammatoires, la différence d'expression de l'IFN-γ et de l'IL-12 est diminuée lorsque la stimulation est effectuée avec des parasites inactivés et dans une plus forte mesure avec les extraits totaux de parasites. Néanmoins, l'expression est sensiblement plus forte en réponse à une stimulation par les souches Toxo-KO+ et Toxo-KO+ 2G par rapport à une stimulation par les autres souches.

Conclusion

L'effet de chacune des souches sur l'activation de la réponse immunitaire est évalué in vitro et sous la forme de tachyzoïtes vivants, de tachyzoïtes inactivés ou d'extraits totaux de parasites. Les résultats mettent en évidence une augmentation significative de l'expression des cytokines pro -inflammatoires et des cytokines favorisant la réponse cytotoxique après une stimulation par les souches Toxo-KO+ et Toxo-KO+ 2G. Cependant, chacune des souches est exploitable pour moduler l'activité du système immunitaire, soit fortement avec les souches Toxo-KO+ et Toxo-KO+ 2G, soit plus modérément avec les autres souches.

Exemple 9 : Innocuité de la souche Toxo tsmicl-3 KO wp!6 KO GralSII Kl (notée Toxo KO +2G) inoculée par voie sous-cutanée au poussin d'un jour

L'objectif de l'expérimentation est de valider l'innocuité de la souche Toxo KO +2G, telle qu'obtenue à l'exemple 5, chez la volaille nouveau-né et de vérifier que la souche Toxo KO +2G induit une réponse immunitaire.

Matériel et méthode

Production de parasites Toxo KO +2G

La souche mutante de Toxoplasma gondii Toxo KO +2G, obtenue à l'exemple 5, est entretenue par passages successifs sur une lignée de fïbroblastes de prépuce humain (HFF) cultivées dans du milieu DMEM auquel est ajouté du sérum de veau fœtal 10%, 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine.

Animaux

Cent poussins de 1 jour ont été inclus dans l'étude.

Les poussins ont été divisés en 4 lots distincts :

o Lot A : composé de 25 poussins immunostimulés avec 1.103 tachyzoïtes de la souche

Toxo KO +2G à un jour d'âge,

o Lot B : composé de 25 poussins immunostimulés avec 1.104 tachyzoïtes de la souche

Toxo KO +2G à un jour d'âge,

o Lot C : composé de 25 poussins immunostimulés avec 1.105 tachyzoïtes de la souche

Toxo KO +2G à un jour d'âge,

o Lot D : composé de 25 poussins contrôle inoculés avec du PBS à un jour d'âge.

L'ensemble des injections ont été réalisés par voie sous-cutanée à la base du cou dans un volume de ΙΟΟμί.

L'ensemble des animaux est sacrifié 28 jours après le début de l'expérimentation.

Résultats

Aucun signe clinique n'a été observé au cours de l'expérimentation et le gain de poids des poussins immunostimulés est globalement similaire au gain de poids des poussins contrôles, quel que soit la dose d'immunostimulant.

Exemple 10 : Innocuité de la souche Toxo tsmiclS KO rop!6 KO GralSII Kl (notée Toxo KO + 2G) inoculée par voie sous-cutanée au poussin d'un jour ou par voie in ovo dans le liquide amniotique ou dans l'embryon

L'objectif de l'expérimentation est de valider l'innocuité de la souche Toxo KO +2G chez le poulet de chair, telle qu'obtenue à l'exemple 5, chez la volaille nouveau-né et de vérifier que la souche Toxo KO +2G induit une réponse immunitaire après inoculation par voie in-ovo ou sous-cutanée.

Matériel et méthodes

Production de parasites Toxo KO + 2G

La souche mutante de Toxoplasma gondii Toxo KO + 2G, telle qu'obtenue à l'exemple 5, est entretenue par passage successifs sur une lignée de fïbroblastes de prépuce humain (HFF) cultivées dans du milieu DMEM auquel est ajouté du sérum de veau fœtal 10%, 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine.

Animaux

Trois-cents poussins ont été inclus dans l'étude.

Les poussins ont été divisés en 12 lots distincts :

o Lot A : composé de 25 poussins immunostimulés avec 1.103 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo trois jours avant éclosion (liquide amniotique), o Lot B : composé de 25 poussins immunostimulés avec 1.104 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo trois jours avant éclosion (liquide amniotique), o Lot C : composé de 25 poussins immunostimulés avec 1.105 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo trois jours avant éclosion (liquide amniotique), o Lot D : composé de 25 poussins immunostimulés avec 1.103 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo deux jours avant éclosion (embryon),

o Lot E : composé de 25 poussins immunostimulés avec 1.104 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo deux jours avant éclosion (embryon),

o Lot F : composé de 25 poussins immunostimulés avec 1.105 tachyzoïtes de la souche

Toxo KO + 2G par voie in ovo deux jours avant éclosion (embryon),

o Lot G : composé de 25 poussins immunostimulés avec 1.104 tachyzoïtes de la souche

Toxo KO + 2G par voie sous-cutanée une journée après éclosion,

o Lot H : composé de 25 poussins immunostimulés avec 1.105 tachyzoïtes de la souche

Toxo KO + 2G par voie sous-cutanée une journée après éclosion

o Lot I : composé de 25 poussins immunostimulés avec 1.106 tachyzoïtes de la souche

Toxo KO + 2G par voie sous-cutanée une journée après éclosion.

o Lot J : composé de 25 poussins contrôle inoculés avec 50 de DMEM par voie in ovo trois jours avant éclosion (liquide amniotique),

o Lot K : composé de 25 poussins contrôle inoculés avec 50 de DMEM par voie in ovo deux jours avant éclosion (embryon),

o Lot L : composé de 25 poussins contrôle inoculés avec 200 de DMEM par voie sous-cutanée une journée après éclosion.

Chaque semaine, 5 animaux par groupe sont sacrifiés pour étudier la cinétique d'apparition des anticorps.

Résultats

Effet clinique et mortalité

Quel que soit la dose et la voie d'inoculation testée, aucune mortalité ou effet clinique spécifique n'a été observé en comparaison avec les groupes contrôles respectifs. Après autopsie, aucune évidence de lésion aiguë ou chronique n'a été observée sur les animaux sacrifiés entre 2 et 27 jours post-immunostimulation, soit pendant toute la durée de l'expérimentation. Ces résultats suggèrent l'absence d'un effet toxique majeur de Toxo-KO+ 2G lorsqu'utilisé à des doses comprises entre 103 et 105 tachyzoïtes par animal injectés in ovo ou entre 104 et 106 tachyzoïtes par animal injectés par voie sous-cutanée.

Croissance des animaux

La croissance des animaux contrôles, ayant reçu seulement du DMEM (groupe J, K, L) par voie in ovo ou sous-cutanée est conforme aux attentes et similaire entre les trois groupes testés ce qui suggère une bonne homogénéité des conditions d'élevage entre les différentes unités de confinement.

La moyenne du poids des animaux au moment de l'abattage dans les groupes immunostimulés est signifïcativement inférieure aux moyennes observées dans les groupes contrôles respectifs (figures 18 A-C). Cette diminution du poids est observée de manière intermittente entre Jl 1 et J27 quel que soit la dose employée. De plus, pour une même voie d'inoculation, les différences de moyennes de poids au cours de l'expérimentation sont faibles ce qui suggère que la dose aurait un impact mineur sur la perte de poids induite par Toxo-KO+ 2G. De la même manière, la voie d'inoculation n'influence pas ou peu ce profil différentiel de croissance.

Pris dans leurs ensembles, ces résultats suggèrent que Toxo-KO+ 2G induit une diminution faible mais significative du poids des animaux quel que soit la voie d'inoculation et la dose testée.

Influence sur la réponse immunitaire

L'effet de Toxo-KO+ 2G sur Γ activation de la réponse immunitaire a été évalué par la quantification de la réponse humorale dirigée contre Toxo-KO+ 2G (figures 19 A-C). La présence d'anticorps anti-Toxo-KO+ 2G reflète une activation nécessairement aboutie du système immunitaire. La production d'anticorps spécifique ne peut apparaître qu'après une activation de cellules du système immunitaire innée, comme certaines cellules présentatrices d'antigène, des lymphocytes T CD4 helper et une activation puis une maturation des lymphocytes B. Ces derniers pour produire des anticorps de type IgY (IgG chez le poulet) ont nécessairement commuté de classe et ont donc ainsi été pleinement activés.

Les anticorps de sous classe IgY dirigés contre Toxo-KO+ 2G sont exprimés dès 20 jours post-éclosion quel que soit les groupes immunostimulés considérés. A J28, on observe un effet dose dépendant clair et significatif, démontrant qu'une dose faible active moins fortement le système immunitaire qu'une dose forte (figures 18 A-C). Le titre maximal en anticorps a été observé dans le groupe immunostimulé par voie sous-cutanée à dose de 106 tachyzoïtes par animal. Néanmoins, à dose égale, les titres en anticorps dans les groupes immunisés par voie sous-cutanée sont globalement plus faibles que ceux observés dans les groupes immunisés par voie in ovo (figures 18 A-C). L'immunisation par voie in ovo dans le liquide amniotique montre une meilleure efficacité sur F activation de la réponse immunitaire, notamment à dose de 105 tachyzoïtes par animal (figures 19 A-C). Ces résultats montrent que l'inoculation de Toxo-KO+ 2G induit une activation dose dépendante de la réponse immunitaire quel que soit la voie d'inoculation testée.

Conclusion

L'ef et d'une inoculation par voie in ovo ou sous-cutanée de Toxo-KO+ 2G a été évalué chez le poulet. De manière dose dépendante, un effet activateur de la réponse immunitaire de Toxo-KO+ 2G a été mis en évidence quel que soit les voies d'inoculation testées. Aux différentes doses et voies d'inoculation testées, une faible diminution de la croissance a été observée après immunostimulation. Cette diminution du poids ne s'accompagne pas d'une toxicité aiguë ou chronique visible macroscopiquement sur l'animal vivant ou après autopsie.

Pris ensemble, ces résultats montrent que l'inoculation de Toxo-KO+ 2G active la réponse immunitaire et que la dose maximale admissible en l'absence de manifestation clinique apparente est de 106 tachyzoïtes par animal.

Exemple 11 : Efficacité de la souche Toxo tsmicl-3 KO roplô KO GralSII Kl (notée

Toxo KO + 2G) dans la prévention de la coccidiose aviaire

Matériel et méthode

Production de parasites Toxo KO+ 2 G

La souche mutante de Toxo KO+ 2G telle qu'obtenue à l'exemple 5est entretenue par passage successifs sur une lignée de fibroblastes de prépuce humain (HFF) cultivées dans du milieu DMEM auquel est ajouté du sérum de veau fœtal 10%, 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Les tachyzoïtes ont été concentrés et lavés par centrifugation à 900G pendant 5 minutes à température ambiante. Après remise en suspension dans une solution de DMEM, ils ont été comptés en cellule de Malassez et dilués soit à 1.104, soit à 1.106 tachyzoïtes par millilitre. Leur viabilité a été évalué en cytométrie en flux (MACS Quant 10, Miltenyi) et a été calculée comme étant la fréquence du nombre de tachyzoïtes n'incorporant pas l'iodure de propidium (référence commerciale P4864-10ML, Sigma-

Aldrich) par rapport au nombre de tachyzoïtes total. La viabilité des tachyzoïtes est supérieure à 82%.

Production d'Eimeria acervulina

La souche d'Eimeria acervulina utilisée dans cette étude provient d'un élevage Français. Les parasites ont été amplifiés par des passages successifs sur des poulets SPF (Exempt d'agents pathogènes spécifiques) Les oocystes d'E. acervulina ont été purifiés à partir de fèces provenant de poulets infectés 5 jours auparavant.

Comme décrit dans de précédents travaux (Cloning and expression of cDNA encoding an Eimeria acervulina 70 kDa sporozoïte protein which is related to the 70 kDa heat-shock protein family. Laurent F. et al, Mol Biochem Parasitol. 1994 Aug;66(2):349-52) (Effects of whole wheat feeding on the development of coccidian infection in broiler chickens. Gabriel I, et al, Poult Sci. 2003 Nov;82(l l): 1668-76), la purification fait intervenir un processus de flottaison dans une solution de sulfate de magnésium, des lavages dans l'eau et une décontamination à l'eau de javel. Après purification les oocystes sont conservés dans une solution de PBS stérile à 4°C. Les animaux ont été inoculés per os avec 2.105 oocystes sporulés préalablement dilués dans 0.5mL d'eau de boisson stérile.

Animaux

263 poussins de race ROSS PM3 de 1 jour ont été acheté au couvoir Boyé-accouvage (La Boissière-en-Gâtine, France). Les animaux ont été hébergés dans une salle de confinement de classe II

Les animaux ont ensuite été répartis dans différents groupes présentés dans le tableau 19 ci-dessous. Au jour 1 de l'expérimentation, les poussins ont été immunostimulés par 10·^

(Dose 1) ou 10^ (Dose 2) tachyzoïtes de Toxo KO+ 2Gfrais administrés par voie sous-cutanée. Les animaux contrôles ont reçu un volume équivalent de DMEM. A 7 ou 14 jours post éclosion, les animaux ont été infectés par 2.10^ oocystes d'Eimeria acervulina per os. Une solution d'eau de boisson stérile a été administrée aux groupes contrôles.

Tableau 19 : Répartition des animaux et description des groupes


Le poids de chaque individu a été mesuré trois fois par semaine. Une semaine après chaque temps d'infection, J7 ou J14, 15 à 18 animaux par groupe ont été sacrifiés et un score macroscopique de lésion des anses duodénales a été attribué.

Résultats

Prise de poids

Une diminution de la prise de poids des animaux non-immunostimulés de 24.20% et 36.33%) a été observés après infection par Eimeria acervulina à J7 ou à J14 respectivement (*, p < 0.05, figure 20).

Pour les animaux infectés à J7, l'immunostimulation à 103 ou 105 tachyzoïtes/animal a un effet modéré et non statistiquement significatif sur la perte de poids induite par Eimeria acervulina (ns, p > 0.05, figure 20) et sur la vitesse de croissance des animaux (p>0.05, figure 20 E).

Pour les animaux infectés à J14 à la dose 103 tachyzoïtes par animal, une augmentation non significative du poids, atteignant 13.5% à J35, a été observée (ns, p > 0.05, figure 20 D) par rapport au groupe contrôle (DMEM). Les animaux immunostimulés à la dose de 105 ont présenté une forte augmentation significative du poids à partir de J28 (*, p < 0.05, figure 20 D), atteignant 29.4% d'augmentation à J35 (****, p < 0.001, figure 20 D) par rapport aux animaux contrôles infectés. Une différence significative de poids et de croissance est clairement observable à J35 entre les groupes. En effet, à J35, le poids des animaux

immunostimulés à 105 tachyzoïtes est augmenté signifïcativement de 13.78% par rapport à celui des animaux immunostimulés à 103 tachyzoïtes (*, p < 0.05).

La perte de poids enregistrée dans le groupe immunostimulé à 105 tachyzoïtes est seulement de 17.46%), soit une efficacité relative de 51.9%. Dès J21, cette amélioration clinique s'accompagne d'une augmentation significative du gain quotidien moyen qui est plus directement lié à l'état général de l'animal (figure 20 E-F). L'infection à J14 a provoqué une perte de gain quotidien moyen de 54.60%) à J30 en l'absence d'immuno stimulation et de seulement de 22.05% chez les animaux immunostimulés, soit une efficacité relative de 59.60%o (données non présentées). Ces données montrent un meilleur état clinique des animaux immunostimulés par rapport aux animaux contrôles.

Score de lésions

Sur la figure 21 est représenté le score de lésion obtenu pour chacun des groupes. La sévérité lésionnelle de l'infection semble supérieure chez les animaux infectés à J14 vis-à-vis des animaux infectés à J7. Aux deux doses testées et aux deux temps testés, il n'y a pas de différence significative entre les groupes immunostimulés et contrôles (figure 21).

Analyse de la réponse immunitaire

L'objectif d'une immunostimulation est d'introduire un biais dans la réponse naturelle de l'organisme hôte pour maximiser une réponse de type inflammatoire, humorale ou cellulaire dirigée contre un agent infectieux tierce, ici, Eimeria acervulina.

La réponse humorale dirigée contre Eimeria acervulina (tachyzoïtes) a été estimée par le dosage des anticorps de sous-classe IgY (IgG) dans le sérum. Les anticorps de type IgY anti-Eimeria sont détectables à partir 28 jours post-infection. Les titres obtenus chez les animaux préservés jusqu'à J35 sont présentés figure 22. Aucune différence entre les groupes n'a été observée chez les animaux infectés à J7. De plus, le titre en anticorps chez les animaux infectés à J14 n'est pas augmenté par P immunostimulation. L'efficacité du produit n'est donc pas liée à une réponse de type humorale.

La réponse immunitaire dirigée contre Toxo KO+ 2Ga été évaluée pour confirmer une activation d'une réponse immunitaire induite par l'administration de la dose immunostimulante. Comme attendu, les titres en anticorps sont presque nuls avant J21. Pour les animaux sacrifiés à J21 et à J35 on observe une production d'anticorps dépendant de la dose et de la durée post-Immunostimulation (figure 22). Cet effet dose et le titre en anticorps dirigés contre Toxo KO+ 2G ne sont pas pas être affectés par l'inoculation d 'Eimeria acervulina.

Conclusion

Le but de cette expérimentation était de vérifier si une immunostimulation de poussin à l'âge de 1 jour permettait d'améliorer l'état clinique et la performance des animaux soumis à une infection expérimentale par Eimeria acervulina, un des agents de la coccidiose aviaire pris ici comme exemple d'agent parasitaire. Les résultats ont clairement mis en évidence une réduction significative et forte de la perte de poids observés lors d'un épisode expérimental de coccidiose aviaire. La stratégie par immunostimulation n'étant pas spécifique d'un pathogène donné, des résultats similaires peuvent être obtenus avec la souche Toxo-KO+ 2G vis-à-vis d'autres agents parasitaires.

Exemple 12 : Efficacité de la souche Toxo tsmicl-3 KO wp!6 KO GralSII Kl (notée Toxo KO +2G) vis-à-vis de du portage de Salmonella enteritidis chez la poule

L'objectif de cette expérimentation est de déterminer si Γ immunostimulation par la souche Toxo KO +2G permet de limiter le portage intestinal et la dissémination systémique de Salmonella enteritidis chez la poule.

Matériel et méthode

Production de parasites Toxo KO +2G

La souche Toxo KO +2G, obtenue à l'exemple 5, est entretenue par passages successifs sur une lignée de fïbroblastes de prépuce humain (HFF) cultivées dans du milieu DMEM auquel est ajouté du sérum de veau fœtal décomplémenté 10 %, 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Les tachyzoïtes ont été concentrés et lavés par centrifugation à 900 g pendant 5 minutes à température ambiante. Après remise en suspension dans une solution de DMEM, ils ont été comptés en cellule de Malassez et dilués à 1.106 tachyzoïtes par millilitre. Leur viabilité a été évalué en cytométrie en flux (MACS Quant 10, Miltenyi) et a été calculée comme étant la fréquence du nombre de tachyzoïtes n'incorporant pas l'Iodure de Propidium (P4864-10ML, Sigma-Aldrich) par rapport au nombre de tachyzoïtes total. La viabilité des tachyzoïtes utilisés dans cette expérience est de 87.2% pour la tachyzoïtes utilisés en frais et 86.3% pour la tachyzoïtes destinés à la lyophilisation.

Une fois la lyophilisation terminée, les vials ont été bouchés sous vide, avant d'être remise à pression atmosphérique. Les vials ont ensuite été scellés via l'ajout d'une capsule en aluminium, puis conservés à +4°C jusqu'au jour des immunisations.

Production de la souche bactérienne de Salmonella enteritidis

Les animaux ont été infectés avec 2.27xl04 CFU (Colony Forming Unit) de Salmonella enteritidis souche 775 résistante à 20 μg/mL d'acide nalidixic et à 500 μg/mL de streptomycine. Cette souche est issue d'une mutation spontanée de la souche LA5 résistante seulement à l'acide nalidixic (Allen- Vercoe et al, 19 97, FEMS Microbiol Lett. 153:33). Elle a été cultivée in vitro, amplifiée et cryopréservée à -80°C (Lot du 28 janvier 2016, INRA Nouzilly).

Animaux

Au total 170 poussins nouveau nés de race White leghorn PA12 sont inclus dans l'étude et hébergés dans une salle de confinement de classe II.

Les poussins ont été identifiés individuellement et répartis aléatoirement en 8 groupes. Le nombre d'animaux par groupe, les temps de sacrifice et les caractéristiques propres à chacun de ces groupes sont représentés dans le tableau 20 ci-dessous. Ce même jour, les animaux ont été immunostimulés à 105 tachyzoïtes frais ou 107 tachyzoïtes lyophilisés dans un volume de ΙΟΟμί de DMEM injectés par voie sous-cutanée. Le jour 14 de l'expérimentation, à 7 ou 14 jours d'âge, les animaux ont été inoculés au niveau du jabot (per os) avec 200μί de solution contenant 2.27x104 CFU de Salmonella enteritidis. Ils ont ensuite été suivis de 1 à 4 semaines post-infection, et sacrifiés en cinétique à différents temps, comme décrit dans le tableau ci- dessous.

Tableau 20 : Répartition des animaux, traitement et description des groupes

Aux temps indiqués, les animaux ont été euthanasiés. Les caeca ont été prélevés en condition stérile. Le sang a été prélevé par voie intracardiaque pour obtention de sérum par la suite. Les caeca ont été isolés de manière stérile et pesés individuellement. Après broyage, les matrices sont diluées en série dans du PBS et étalés sur des plaques Salmonella/Shigella agar (SS médium) contenant 50(^g/mL de streptomycine. Après une incubation sur la nuit à 37°C, les colonies ont été comptées et le dénombrement a été rapporté au poids de l'organe pour déterminer la valeur de CFU par gramme d'organe.

Résultats

Mortalité et signes cliniques

L'infection par Salmonella enteritidis et Pimmunostimulation par la souche Toxo tgmicl-3 KO ropl6 KO gral5n Kl n'ont pas induit de toxicité, de signe clinique majeur ou de mortalité spécifique chez les poulets.

Le poids de chaque animal a été mesuré une fois par semaine, jusqu'à l'euthanasie et a été représenté dans la figures 23 A-D. Les animaux immunostimulés 7 jours avant l'infection avec des parasites frais (groupe D) ont un poids et une croissance similaire aux animaux contrôles du même groupe (groupe C). Dans les autres cas, une différence faible mais significative de poids est observée entre les animaux contrôles (DMEM ou F4) et les animaux immunostimulés (Frais ou Lyophilisé), notamment lorsque l'infection est effectuée 14 jours après l'immunostimulation (figures 23 B-D). Dans une moindre mesure, cette différence est retrouvée chez les animaux infectés avec des parasites frais ou lyophilisés par rapport à la condition contrôle, lorsque l'infection a eu lieu 7 jours après l'immunostimulation (figure 23. C). Pris dans leurs ensembles, les groupes immunostimulés ont un poids égal ou supérieur au poids retrouvé chez les animaux non immunostimulés démontrant l'absence d'effet néfaste ou un effet positif sur la croissance des animaux infectés par SE.

Portage de Salmonella dans les caeca

Le portage chronique dans l'intestin est le critère principal de l'étude. Il modélise le risque de contamination d'origine fécale des viandes et des œufs. Le portage des salmonelles a été étudié 1, 2, 3 et 4 semaines post-infection sur des groupes immunostimulés en frais ou en lyophilisé et sur les groupes contrôles correspondant (figure 24). Une semaine après infection, aucune différence significative n'a été mise en évidence entre les groupes immunostimulés ou contrôles, que ce soit avec une Immunostimulation avec des tachyzoïtes frais ou lyophilisés (figures 24 A-C). À l'inverse, une diminution significative de 96 à 99.9% du nombre de salmonelles par gram d'organe a été observée dans les groupes immunostimulés (Frais ou Lyophilisés, groupes B, D, F, H) par rapport aux groupes contrôles (DMEM ou F4, groupes A, C, E, G) de la seconde à la quatrième semaine post-infection.

Titrage des anticorps dirigés contre Toxo KO +2G

Les titres sériques en anticorps de type IgY dirigés contre Toxo KO +2G ont été mesurés par ELISA sur les sera prélevés le jour des autopsies. Les titrages sont représentés figure 25. Une nette différence est observable entre les groupes contrôles (DMEM) et les groupes immunostimulés avec des parasites frais, à partir de la troisième semaine post-Immunostimulation (figures 25 A-B), démontrant une réponse immunitaire dirigée contre la souche administrée en frais. A l'inverse, le titre en anticorps est très faible ou nul, lorsque la souche est administrée sous la forme lyophilisée. Ainsi, aucune différence significative n'est observable entre les groupes contrôles F4 et les groupes immunostimulés avec des tachyzoïtes lyophilisés (figures 25 C-D).

Conclusion

Dans cette expérimentation, le potentiel de la souche Toxo KO +2G comme agent préventif permettant de réduire le portage des salmonelles a été testé chez le poulet. Quelle que soit la formulation utilisée, en frais ou en lyophilisé, l'administration de la souche Toxo KO +2G limite signifïcativement le portage de salmonelle entre 96 et 99.9% ce dans les caeca. La stratégie par immunostimulation n'étant pas spécifique d'un pathogène donné, des résultats similaires peuvent être obtenus avec la souche Toxo-KO+ 2G vis-à-vis d'autres agents bactériens.

Exemple 13 : Efficacité de la souche Toxo tsmicl-3 KO rop!6 KO GralSII Kl (notée Toxo KO+ 2G) dans la prévention de la grippe aviaire

L'objectif de cette expérimentation est de déterminer si Γ immunostimulation par la souche Toxo-KO+ 2G telle qu'obtenue à l'exemple 5, permet de limiter la sévérité d'une infection expérimentale par le virus Influenza H7N1 chez la poule domestique.

Matériel et méthode

Production de parasites Toxo K0+ 2 G

La souche Toxo KO+ 2G est entretenue par passages successifs sur une lignée de fîbroblastes de prépuce humain (HFF) cultivés dans du milieu DMEM auquel est ajouté 10% de sérum de veau fœtal décomplémenté, 2mM glutamine, 100 U/mL de pénicilline et 100 U/mL de streptomycine. Les tachyzoïtes ont été concentrés et lavés par centrifugation à 900 g pendant 5 minutes à température ambiante. Après remise en suspension dans une solution de DMEM, ils ont été comptés en cellule de Malassez et dilués à 1.106 tachyzoïtes par millilitre. Leur viabilité a été évaluée en cytométrie en flux (MACS Quant 10, Miltenyi) et a été calculée comme étant la fréquence du nombre de tachyzoïtes n'incorporant pas l'Iodure de Propidium (P4864-10ML, Sigma-Aldrich) par rapport au nombre de tachyzoïtes total. La viabilité des tachyzoïtes utilisés dans cette expérience était de 82.7%.

Production des inocula d'Influenza H7N1

La souche virale H7N1 utilisée dans cette expérience dérive de l'épidémie de 1999 de grippe aviaire dans le nord de l'Italie (A/Turkey/Italy/977/1999). En dépit de sa classification parmi les souches "Low pathogenic", il est admis qu'elle est de virulence modérée chez la poule domestique, notamment dans la lignée B13 de poule pondeuse (Deletion of the C-terminal ESEV domain of NSI does not affect the replication of a low-pathogenic avian influenza virus H7N1 in ducks and chickens. Soubies SM, et al, J Gen Virol. 2013 Jan;94(Pt l):50-8. doi: 10.1099/vir.0.045153-0 - PMID: 23052391) (Length variations in the NA stalk of an H7N1 influenza virus have opposite effects on viral excrétion in chickens and ducks. Hoffmann TW, et al, J Virol. 2012 Jan;86(l):584-8. doi: 10.1128/JVI.05474-11. PMID: 22013034), (Soubies et al, J. Gen. Virol, 2013 ; Hoffmann et al, J. Virol, 2012 ).

Les lots utilisés pour l'infection ont été préparés par passages successifs sur œufs embryonnés de poulet comme décrit par Brauer en 2015 (Influenza virus propagation in embryonated chicken eggs. Brauer et al, J Vis Exp. 2015 Mar 19;(97). doi: 10.3791/52421). Ils ont ensuite été titrés par la méthode de Reed décrite en 1938 (Reed et al, Am. J. EpidemioL, 1938). Le titrage est calculé comme étant la dose requise pour infecter 50%> d'œufs embryonnés de poulet (EID50).

Animaux

Au total 96 poussins nouveau nés de race White leghorn PA12 sont inclus dans l'étude. Ils ont été hébergés en isolateur afin de préserver le statut SPF.

Le lendemain de leurs arrivées, les animaux ont été identifiés individuellement. Ils ont ensuite été immunostimulés par voie sous-cutanée à la dose de 105 tachyzoïtes frais de Toxo-KO+ 2G mis en suspension dans un volume de ΙΟΟμί de DMEM. Un volume similaire de DMEM a été utilisé pour les animaux des groupes non- immunostimulés. Conformément à la description standard du modèle, après 20 jours post-éclosion, une série d'animaux a été transférée dans un isolateur de confinement de catégorie 3. Ils ont ensuite été infectés par le virus influenza de type H7N1 par voie intra-trachéale à la dose de 2.105 EID50. Une inoculation PBS a été utilisée comme contrôle. Les animaux ont ensuite été suivis pendant 4 jours, euthanasiés, puis autopsiés. Pour mesurer si l'effet est dépendant de l'âge ou de la durée post-immunostimulation, des groupes d'animaux supplémentaires ont également été infectés à 6 et 13 jours post-éclosion.

La répartition des animaux, les temps de sacrifice et les caractéristiques propres à chacun de ces groupes sont représentés dans le tableau 21.

Tableau 21 : Répartition des animaux, traitement et description des groupes

Nom du Nombre Immunostimulation Infection Jour de Jour du groupe d'animaux n= l'infection sacrifice

A 6 - - B 6 - LD

C 6 - HD D6 D10

I 6 105 tachyzoïtes - J 6 105 tachyzoïtes LD

K 6 105 tachyzoïtes HD

D 6 - - E 6 - LD

F 6 - HD D13 D17

L 6 105 tachyzoïtes - M 6 105 tachyzoïtes LD

N 6 105 tachyzoïtes HD

G 6 - - H 6 - LD D20 D24

0 6 105 tachyzoïtes - P 6 105 tachyzoïtes LD

Quatre jours après infection, un prélèvement de 200μί de sang a été réalisé dans le sinus occipital et le sérum a été préparé. Lors de l'autopsie, toutes lésions macroscopiques présentes sur les organes vitaux ont été relevées. Trois échantillons de poumons ont été prélevés pour l'analyse histopatho logique pulmonaire. Deux échantillons de 50 mg environ ont été prélevés dans les parenchymes pulmonaires et rénaux.

Les échantillons provenant des écouvillons oro-pharyngés ont été remis en suspension dans lmL de PBS. L'ARNv a été extrait en respectant les consignes du kit QiaAmp Viral RNA mini kit (Qiagen) à partir de 140μί de suspension cellulaire.

Pour les échantillons provenant de la rate et du rein, 50mg de tissus ont été transférés dans lmL de PBS et dissociés mécaniquement en utilisant un broyeur (Retsch). Les ARNs totaux ont été extraits selon l'appendix D du protocole de référence du kit RNEasy Mini Kit plus (Qiagen).

La quantification des ARNv du segment M du génome ont été dosés par RT-qPCR une seule étape respectant les consignes du kit « Superscript III platine SYBR green » ( Bio-Rad ). Les échantillons ont été analysés en triplicat sur un thermocyleur Chromo-5 (Bio-Rad). La séquence des paires d'amorces ciblant le segment M ainsi que les conditions de qRT-PCR ont été décrites précédemment (A genetically engineered waterfowl influenza virus with a deletion in the stalk of the neuraminidase has increased virulence for chickens. Munier S. et al, J Viral. 2010 Jan;84(2):940-52. doi: 10.1128/JVI.01581-09).

Dosage des cytokines pro-inflammatoires

Les cytokines pro-inflammatoires ont été dosées par RT-qPCR deux étapes à partir des ARNs préalablement extraits de la rate et du rein. Brièvement, les ARNs ont été retrotranscrits à partir d'amorce poly-T par la mMLV-RT (Invitrogen) en respectant les consignes du fabriquant. L'expression des cytokines a été mesurée par qPCR selon les recommandations du fournisseur (Bio-Rad). Le détail des amorces, des cycles de PCR sont décrites pour chaque cible étudiée dans le tableau 18.

Résultats

Signes cliniques et mortalité

L'état général des animaux a été suivi depuis l'éclosion jusqu'au sacrifice. Aucun animal n'a présenté un affaiblissement de l'état général ou une perte de poids jusqu'au moment de l'infection par le virus H7N1.

Aux trois âges d'infection, J6, J13 et J20, les animaux ont été infectés par le virus H7N1 et ont été suivis pendant 4 jours (Tableau 22). Les animaux des groupes contrôles ont été inoculés avec un volume équivalent de PBS. Il n'a pas été observé chez ces derniers de signes cliniques ou de mortalité.

Dans les groupes non-immunostimulés, l'infection à 20 jours d'âge à la dose de 5.105 EID50 a induit une mortalité compatible aux attentes du modèle, soit environ de 67% (Tableau 22). Néanmoins, il n'a pas été observé de différence significative de mortalité entre les groupes immunostimulés et non-immunostimulés (Tableau 22).

Aux autres âges d'infection, à J6 et J13, aucune donnée de sensibilité des animaux vis-à-vis du virus H7N1 n'était disponible au préalable à cette expérience. C'est pourquoi deux doses d'infection ont été testées. Les animaux infectés à J6 ont été inoculés à la dose de 2.105 EID50 et 2,5.106 EID50 de virus H7N1. Pour les deux doses testées, le niveau acceptable de sévérité du modèle n'était pas atteint et aucune mortalité n'a été observée (Tableau 22). Les animaux infectés à J13 ont été inoculés aux doses de de 2.105 EID50 et 1,25.107 EID50 de virus H7N1. Pour les animaux infectés à faible dose, une mortalité de 50% a été observé dans les groupes immunostimulés et non-immunostimulés. De manière surprenante, les animaux infectés à une dose 50 fois supérieure ont présentés des signes cliniques moins importants. Dans ces groupes la mortalité est restée nulle quel que soit le statut d'immunisation des animaux (Tableau 22).

Tableau 22 : Mortalité des animaux post-infection par le virus H7N1


Les objectifs de modélisation de la grippe aviaire, en termes de mortalité et d'apparition de signe clinique ont été atteints lorsque le virus a été inoculé chez des animaux de 13 et 20 jours à la dose faible. En revanche, une infection plus précoce ou une infection à plus forte dose n'ont pas induit de mortalité et de signes cliniques majeurs démontrant une modélisation partielle de la grippe aviaire et une meilleure résistance des jeunes animaux. Or, cette résistance n'est pas toujours associée à une meilleure élimination du virus. Les titres viraux ont donc été déterminés chez tous les animaux quel que soit l'âge d'infection.

Titres viraux

Les titres viraux ont été estimés chez tous les animaux par RT-qPCR dans l'organe cible de l'infection, le poumon, dans les excrétions orotrachéales et à un niveau systémique dans le parenchyme rénal (figure 26). Le virus n'a pas pu être détecté dans les groupes contrôles non infectés (données non présentées).

Dans les groupes infectés à J6 et J13, aucune différence majeure ou significative n'a été observée entre les animaux immunostimulés et non-immunostimulés à faible dose (figures 26A-B). Pour ces mêmes temps d'infection, les titres viraux n'ont pas été augmentés par une augmentation de la dose d'infection. Assez curieusement, ils sont plutôt diminués. Pour les animaux infectés à J13 à forte dose, malgré le niveau d'infection plus faible, le titre viral dans les groupes immunostimulés semble légèrement inférieur à celui présent dans les groupes non-immunostimulés. Cependant, en raison du nombre d'animaux par groupe, il n'est pas possible de déterminer si cette différence est biologiquement significative ou si elle dérive d'une observation aléatoire.

Pour les animaux infectés à J20, on observe une nette et significative diminution du titre viral dans les excrétions orotrachéales dans les groupes immunostimulés par rapport au groupe contrôle non-immunostimulé. Cette diminution s'exprime par un nombre d'animaux excrétant le virus plus faible, ainsi que par une diminution quantitative du titre virale chez les animaux non-immunostimulés. Dans ces groupes, une diminution de la charge virale de plus de 92% est observée dans tous les organes testés (figure 26C). La diminution des titres viraux dans les poumons et les reins corrobore donc ces observations dans les écouvillons et confortent l'hypothèse d'un effet protecteur de Pimmunostimulation sur la charge virale de poulets infectés à J20.

Induction d'une réponse IFN-β par Toxo-KO+ 2 G

Dans le contexte de la grippe aviaire, une immunostimulation a pour objectif de préparer le système immunitaire inné pour améliorer la détection du virus, de limiter la sensibilité des cellules hôtes ou finalement pour mieux lutter contre l'infection. Lors d'une infection MDA5 identifie des AR viraux et signalise la présence du danger. La cytokine IFN- est un acteur majeur de cette signalisation. Elle active les cellules cibles en induisant l'expression d'une batterie de gènes impliqués dans la réponse antivirale.

L'expression de ΓΙΚΝ- et de MDA5 a été évaluée dans le tissu pulmonaire de tous les animaux inclus dans l'étude. L'expression de l'IFN-j8 chez les animaux immunostimulés est fortement induite à J17 en l'absence d'infection. Quel que soit l'âge des animaux, l'infection par le virus H7N1 semble induire l'expression de l'IFN-beta (figures 27A et 27B). Cette expression induite de l'IFN-j8 semble être maximisée par l'immunostimulation. Ainsi, à J10 et à J23, l'expression de l'IFN-beta chez les animaux uniquement infectés par le virus H7N1 est relativement faible et l'immunostimulation semble augmenter l'expression de cette cytokine (figures 27A et 27B). A J17, l'infection par H7N1 augmente déjà très fortement l'expression de MDA5. Dans ce cas, l'immunostimulation n'altère pas l'expression du récepteur. Celui-ci était même déjà induit par la seule immunostimulation en l'absence d'infection.

Le même profil de réponse est observé pour l'expression du récepteur MDA5. Toxo-KO+ 2G induit une expression à J17 en l'absence d'infection (figures 27A et 27B). De plus, l'expression de MDA5 est maximisée par l'immunostimulation dès J10 et à J23 chez les animaux infectés par le virus H7N1 (figures 27 A et 27B).

L'immunostimulation par l'injection à Jl de Toxo-KO+ 2G semble activer le système immunitaire et favoriser une réponse antivirale innée dépendante de l'IFN-/?.

Conclusion

L'objectif de cette expérimentation était de tester si une immunostimulation avec Toxo-KO+ 2G pouvait renforcer l'immunité des poulets et les aider à lutter contre une infection expérimentale avec la souche influenza H7N1 aviaire. Cette souche est fréquemment utilisée comme modèle d'infection standard. Elle présente l'avantage d'être modérément virulente, d'induire 50% de mortalité chez le poulet et de permettre d'étudier l'efficacité d'une solution thérapeutique. L'objectif d'une prophylaxie dirigée contre la grippe aviaire n'est pas

nécessairement d'empêcher un effet clinique individuel, comme la mortalité, mais bien de limiter au maximum la dissémination du virus et donc de diminuer le titre viral dans les excrétions de l'animal. Une infection à J20 avec 5.105 EID50 de virus inoculé par voie intra-trachéale induit une mortalité de 67% dans les groupes contrôles. Dans ces conditions, une différence significative de charge virale a été mesurée entre les groupes contrôles et immunostimulés. L'importance de cette différence est renforcée par la présence après immunostimulation d'une réponse l'IFN-ô, acteur clé de la réponse antivirale. Dans leur ensemble, ces résultats suggèrent que Toxo-KO+ 2G a une action protectrice vis-à-vis du virus influenza aviaire H7N1, même si cette protection ne semble être effective qu'à partir de J20 et qu'il n'a pas été possible de mettre en évidence une différence significative de mortalité.

La stratégie par immunostimulation n'étant pas spécifique d'un pathogène donné, des résultats similaires peuvent être obtenus avec la souche Toxo-KO+ 2G vis-à-vis d'autres agents viraux.