البحث في مجموعات البراءات الدولية والوطنية
بعض محتويات هذا الطلب غير متوفر حاليا.
إذا استمر الوضع، يرجى الاتصال بنا علىتعليق وبيانات الاتصال
1. (ES2618783) Construcción de ADN inmunomodulador no codificante
ملاحظة:نص مبني على العمليات الآلية للتعرف الضوئي على الحروف. الرجاء استخدام إصدار PDF لقيمته القانونية
DESCRIPCIÓN
Construcción de ADN inmunomodulador no codificante
Campo de la invención
La presente invención se refiere a una molécula de ácido nucleico y a su uso para la modulación del sistema inmunitario.
Antecedentes de la invención
Una estrategia emergente para combatir enfermedades complejas, tales como el cáncer, enfermedades infecciosas, alergia y asma, es utilizar el sistema inmunitario del paciente. Se sabe que el sistema inmunitario o su actividad puede modularse mediante secuencias de ADN específicas. Las secuencias cortas de ADN inmunomodificadoras más conocidas contienen un motivo de citosina y guanina (motivo CG) no metilado que han descrito Krieg et al. (Nature 1995 374: 6522546-549). La existencia de motivos CG no metilados está sustancialmente suprimida en el genoma de eucariotas en comparación con procariotas o virus. Por lo tanto, moléculas de ADN que contienen dicho motivo han evolucionado como una "señal de peligro" natural y activan el sistema inmunitario en la lucha contra patógenos procariotas o víricos. Esto puede explotarse terapéutica o profilácticamente para tratar o prevenir infecciones, así como enfermedades no infecciosas.
Las construcciones de ADN que comprenden motivos CG no metilados son capaces de provocar un efecto fisiológico considerable estimulando fuertemente células efectoras del sistema inmunitario innato incluyendo células dendríticas, macrófagos, células citolíticas naturales (NK) y NKT. Los motivos CG no metilados se detectan por el receptor de reconocimiento de patrones inmunitarios innatos receptor tipo Toll (TLR) 9. Aunque el mecanismo de reconocimiento exacto aún no se ha comprendido completamente, se han hecho progresos significativos en desentrañar las vías subyacentes (A. Krieg, Nat. Rev. Drug Disc., 5:471-484, 2006). Se asume que tras la unión de construcciones de ADN que contienen CG no metilados al receptor, se activan múltiples cascadas de señales en células respondedoras. Regulando positivamente las moléculas superficiales características y la secreción de citoquinas, se induce inmunidad adaptativa con un patrón Th1 predominante. Dichas construcciones pueden usarse en combinación con, por ejemplo, anticuerpos, quimioterapia o radioterapia, vacunas o citoquinas. Las enfermedades alérgicas y el asma están principalmente mediadas por Th2. Aumentando la proporción de Th1/Th2, se atenúan las respuestas mediadas por Th2 y de este modo estos tipos de enfermedades pueden tratarse o prevenirse.
Las moléculas superficiales incluyen, por ejemplo, CD40, CD69, CD80 o CD86, dependiendo del tipo celular específico analizado. La secreción de citoquinas también es característica para distintos tipos celulares; las citoquinas incluyen, por ejemplo, proteínas inflamatorias de macrófagos (MIP)-1alfa, MIP-1beta, interleuquina (IL)-6, IL-8, interferón (IFN)-alfa, factor de necrosis tumoral (TNF)-alfa, IFN-gamma, proteína quimiotáctica de monocitos (MCP)-1 o proteína inducida por IFN-gamma de 10 kDa (IP-10).
Para prevenir o tratar enfermedades, se ha demostrado que la vacunación es un enfoque muy eficaz. Para asegurar una respuesta inmunitaria fuerte y duradera, habitualmente se administran adyuvantes capaces de estimular células presentadoras de antígenos tales como células dendríticas, junto con el antígeno, y para ese propósito se ha demostrado que los antagonistas de TLR9 son potentes inmunoestimuladores.
Independientemente de cualquier explicación de los mecanismos subyacentes por los cuales los motivos CG no metilados influyen o modulan una respuesta inmunitaria, se desarrollaron muchos enfoques para la modulación del sistema inmunitario usando dichos motivos. El documento WO 1998/018810 desvela que secuencias inmunoestimuladoras que contienen motivos CG no metilados son incluso más eficaces cunado son parte de una hebra sencilla. Sin embargo, la administración de una molécula de ADN monocatenaria de cadena abierta no es practicable debido a la rápida degradación de ácidos nucleicos monocatenarios. Por consiguiente, se desarrollaron diferentes métodos para la protección de construcciones de ADN mono o bicatenarias que comprenden un motivo CG no metilado.
Para conseguir resistencia contra la degradación por nucleasas de ADN frecuentemente se modifican los enlaces fosfodiéster en el esqueleto de un polímero de ácido nucleico en fosforotioatos. Además de una actividad algo menos estimuladora de dichos ácidos nucleicos protegidos con fosforotioato, los ensayos clínicos en los últimos años mostraron que la toxicidad de una protección con fosforotioato excluye o limita gravemente dichos ácidos nucleicos de cualquier uso en composiciones farmacéuticas o medicamentos.
Otro enfoque para proteger secuencias de ADN que comprenden un motivo CG se desvela, por ejemplo, en el documento EP 1196 178. Este documento desvela cortas moléculas de ácido desoxirribonucleico, que comprenden una secuencia parcialmente monocatenaria, con forma de mancuerna, covalentemente cerrada de restos de nucleótidos que comprenden motivos CG ("dSLIM"). De acuerdo con la divulgación del documento EP 1196178 los motivos CG están localizados dentro de los bucles monocatenarios en ambos extremos del tronco bicatenario de la
molécula descrita o dentro del tronco bicatenario. Los bucles de horquilla monocatenarios protegen a un tronco bicatenario de la degradación por nucleasas de ADN dentro o fuera de la célula.
El documento WO 2010/039137 desvela oligonucleótidos reguladores inmunitarios como antagonistas para enfermedades mediadas por TLR que tienen una o más modificaciones químicas en la secuencia que flanquea un motivo inmunoestimulador y/o en un motivo oligonucleotídico que sería inmunoestimulador salvo por la modificación. Por tanto, la intención de los oligonucleótidos desvelados del documento WO 2010/039137 es suprimir una respuesta inmunitaria causada por TLR.
El documento WO 2005/042018 describe los nuevos oligonucleótidos llamados CpG de clase C, en el que un oligonucleótido de clase C se caracteriza por secuencias CpG, generalmente posicionadas en o cerca del extremo 5' o el extremo 3' de la molécula, y un motivo palíndromo rico en GC, generalmente posicionado en o cerca del otro extremo de la molécula. El documento desvela variaciones de la secuencia palindrómica de un ADN de clase C. El documento DE 102 11 558 A1 desvela una molécula de ARN que comprende al menos un L-nucleótido. Las moléculas de ARN se usan para la activación de cascadas de señales específicas, respectivamente la activación de factores de transcripción.
En el documento US 2008/260820 se desvelan polipéptidos resistentes a proteasa, que pueden administrarse en combinación con L-nucleósidos para el tratamiento de infecciones víricas. Los L-nucleósidos (que son análogos nucleosídicos) se usan simplemente como aditivos en combinación con el polipéptido. No se incorporan en una construcción de ADN. El contenido del documento US 2008/260820 solamente desvela un método de tratamiento de una enfermedad que comprende la administración de un polipéptido modificado.
El documento EP 2333 091 A2 desvela vectores/fragmentos de ADN que contienen uno o más elementos de ARN inmunoestimuladores. Los plásmidos eliminan todas las secuencias ajenas, incorporan un novedoso marcador detectable basado en ARN corto libre de antibiótico, aumentan la expresión eucariota usando un novedoso promotor quimérico, mejoran el rendimiento y la estabilidad durante la producción bacteriana y mejoran la inmunoestimulación. Estos vectores se utilizan en inmunización para provocar respuestas inmunitarias mejoradas o terapia para inducir producción de interferón de tipo 1.
En el documento US 2002/095033 A1 se desvelan L-nucleósidos y métodos de su fabricación. Aunque estos L-nucleósidos pueden usarse para tratar infecciones o cáncer, por ejemplo, este documento no centra su interés en las construcciones de ADN que contienen CG.
El documento EP 2 246 433 A1 desvela una molécula de ADN concatemérica que comprende secuencias CG usadas para inmunomodulación. Este documento desvela una estructura que comprende varias subunidades, que están unidas covalentemente entre sí.
Breve sumario de la invención
Con respecto al estado de la técnica un objetivo de la presente divulgación es proporcionar construcciones alternativas de ADN inmunomodulador que sean estables después de transferencia en células eucariotas y que eviten efectos secundarios dañinos.
La presente divulgación muestra una construcción de ADN que comprende al menos un motivo de secuencia N 1N 2CGN 3N 4, en la que N 1N 2 y N 3N 4 es cualquier combinación de C, G, A, y T, y C es desoxicitidina, G es desoxiguanosina, A es desoxiadenina y T es desoxitimidina y en la que solamente al menos un nucleótido de los cinco nucleótidos terminales localizados en el extremo 5' y/o 3' de un ADN monocatenario está en conformación L. N 1N 2 podría ser un elemento seleccionado entre el grupo que comprende GT, GG, GA, AT o AA, N 3N 4 es un elemento seleccionado entre el grupo que comprende CT o TT.
La invención proporciona adicionalmente una construcción de ADN con al menos un tramo G de al menos tres desoxiguanosinas consecutivas localizadas cerca del extremo 5' y/o 3', en la que un tramo G puede localizarse entre dos motivos de secuencia de acuerdo con la reivindicación 1 o 2.
El espaciado entre dos motivos de secuencia de acuerdo con las reivindicaciones 1 o 2 puede ser al menos cinco bases, especialmente cuando ninguna desoxiguanosina es un elemento de la secuencia.
Se pretende adicionalmente que la secuencia de ADN sea una construcción de ADN de cadena abierta lineal que comprende al menos un extremo con un bucle monocatenario.
El motivo de secuencia N 1N 2CGN 3N 4 definido anteriormente se localizará dentro de la región monocatenaria y/o bicatenaria de la secuencia de ADN.
Como realización adicional la construcción comprende pares de bases inter y/o intramoleculares y al menos una región monocatenaria desapareada.
Además, se proporciona una construcción multimérica, en la que al menos dos construcciones que comprenden pares de bases inter y/o intramoleculares y al menos una región monocatenaria desapareada se ligan entre sí. Además, la construcción puede comprender al menos un nucleótido en conformación L o D que está modificado con un grupo funcional seleccionado entre el grupo que comprende los grupos carboxilo, amina, amida, almidina, cetal, acetal, éster, éter, disulfuro, tiol y aldeido.
El nucleótido modificado puede ligarse a un compuesto seleccionado entre el grupo que comprende péptidos, proteínas, carbohidratos, anticuerpos, moléculas sintéticas, polímeros, microproyectiles, partículas metálicas, nanopartículas, micelas, vehículos lipídicos, o una fase sólida.
La divulgación proporciona una construcción de ADN que tiene un primer tramo G en el extremo 5' y tres motivos de secuencia de acuerdo con las reivindicaciones 1 o 2, en la que al menos cinco bases están localizadas entre el primer y segundo motivo, excluyendo desoxiguanosina, y un tramo G, que está localizado entre el segundo y tercer motivo de secuencia y en la que dos de los tres desoxinucleótidos 3' terminales están en conformación L.
Las construcciones de acuerdo con la presente divulgación pueden usarse para el tratamiento de cáncer o enfermedades autoinmunitarias o para la modulación del sistema inmunitario.
Como realización adicional de la presente divulgación se proporciona una composición farmacéutica que comprende una construcción de ADN descrita anteriormente. La composición farmacéutica también puede comprender un agente quimioterapéutico.
Además, se proporciona una vacuna que comprende una construcción de ADN descrita anteriormente. En la misma, la construcción de ADN puede estar comprendida como adyuvante.
Descripción detallada de la invención
Dentro del significado de la presente divulgación, una secuencia de ADN de cadena abierta lineal se denomina como construcción de ADN. Dicha secuencia de ADN puede ser monocatenaria o parcial o completamente bicatenaria. El término construcción de ADN no indica una limitación de la longitud de la secuencia de ADN correspondiente. Las unidades monoméricas de construcciones de ADN son nucleótidos.
Una construcción de ADN puede fabricarse sintéticamente o ser parcial o completamente de origen biológico, en la que un origen biológico incluye métodos basados genéticamente de fabricación de secuencias de ADN.
ADN-L o nucleótidos en conformación L se refiere a nucleótidos, que comprenden L-desoxirribosa como el resto de azúcar en lugar de la D-desoxirribosa de origen natural. La L-desoxirribosa es enantiómero (imagen especular) de D-desoxirribosa. Las construcciones de ADN constan parcial o completamente de nucleótidos en conformación L pueden ser parcial o completamente mono o bicatenarias; sin embargo, los nucleótidos en conformación L no pueden hibridar con nucleótidos en conformación D (Hauser et al., Nucleic Acid Res. 2006 34: 5101-11). El ADN-L es igualmente soluble y selectivo que el ADN-D. Además, el ADN-L es resistente a degradación por enzimas de origen natural, especialmente exonucleasas, de modo que el ADN-L está protegido contra degradación biológica (Urata et al., Nucleic Acids Res. 199220: 3325-32). Por lo tanto, el ADN-L es ampliamente aplicable.
Un "tronco" de acuerdo con la presente divulgación debe entenderse como una doble hebra de ADN formada por apareamiento de bases dentro de la misma molécula de ADN (que entonces es parcialmente auto-complementaria) o dentro de diferentes moléculas de ADN (que son parcial o completamente complementarias). El apareamiento de bases intramolecular designa un apareamiento de bases dentro de la misma molécula y un apareamiento de bases entre diferentes moléculas de ADN se llama como apareamiento de bases intermolecular.
Un "bucle" dentro del significado de la presente divulgación deberá entenderse como una región monocatenaria desapareada dentro de o en el extremo de una estructura de tronco. Una "horquilla" es una combinación distinta de un tronco y un bucle, que sucede cuando dos regiones autocomplementarias de la misma molécula de ADN hibridan para formar un tronco con un bucle desapareado. Una forma de mancuerna describe una construcción de ADN lineal con horquillas y ambos extremos flanqueando una región de tronco. Por tanto, una "construcción de ADN lineal" dentro del contexto de la presente divulgación describe una construcción de ADN de cadena abierta lineal que comprende ADN mono o bicatenario o una construcción de ADN con forma de mancuerna lineal que comprende bucles monocatenarios en ambos extremos de un tronco de ADN bicatenario.
La expresión "extremo de ADN", ya sea indicando un extremo 5' o 3' de una hebra sencilla de ADN, se refiere no solamente al nucleótido terminal, sino que comprende los cinco nucleótidos terminales o incluso los tres últimos nucleótidos con respecto al extremo de ADN respectivo. Una modificación de un extremo de ADN se refiere a al
menos uno de los nucleótidos respectivos.
Un "tramo G" deberá entenderse dentro del significado de la presente divulgación como una secuencia de al menos tres desoxiguanosinas consecutivas.
Una "fase sólida" a la cual los nucleótidos se adhieren covalente o no covalentemente se refiere a, aunque sin restricción, como a una columna, una matriz, perlas, vidrio incluyendo vidrio modificado o funcionalizado, sílice o materiales basados en sílice incluyendo silicio y silicio modificado, plásticos (comprendiendo polipropileno, polietileno, poliestireno y copolímeros de estireno y otros materiales, acrílicos, polibutileno, poliuretanos, etc.), nylon o nitrocelulosa, resinas, polisacáridos, carbono así como vidrios inorgánicos, metales, nanopartículas, y plásticos. Por tanto, las placas de microtitulación también están dentro del ámbito de una fase sólida de acuerdo con la presente divulgación.
La inmunomodulación de acuerdo con la presente divulgación se refiere a inmunoestimulación e inmunosupresión. La inmunoestimulación significa preferentemente que las células efectoras del sistema inmunitario se estimulan para proliferar, migrar, diferenciarse o llegar a ser activas en cualquier otra forma. La proliferación de células B por ejemplo puede inducirse sin señales co-estimuladoras por moléculas de ADN inmunoestimuladoras, que normalmente requieren una señal co-estimuladora de células T auxiliares.
La inmunosupresión por otro lado deberá entenderse como la reducción de la activación o eficacia del sistema inmunitario. La inmunosupresión se induce generalmente de forma deliberada para evitar por ejemplo el rechazo de un órgano trasplantado, para tratar la enfermedad de injerto contra hospedador después de un trasplante de médula ósea, o para el tratamiento de enfermedades autoinmunitarias tales como, por ejemplo, artritis reumatoide o enfermedad de Crohn.
En este contexto, inmunomodulación también puede hacer referencia la influencia de la naturaleza o el carácter de una reacción inmunitaria, afectando a una reacción inmunitaria que aún se está desarrollando o madurando o modulando el carácter de una reacción inmunitaria establecida.
El término "vacunación" usado en esta divulgación se refiere a la administración de un material antigénico (una vacuna) para producir inmunidad contra una enfermedad. Las vacunas pueden prevenir o mejorar los efectos de infección por muchos patógenos tales como virus, hongos, parásitos protozoarios, bacterias, pero también para enfermedades alérgicas y asma, así como de tumores. Las vacunas normalmente contienen uno o más adyuvantes, por ejemplo, ácidos nucleicos inmunoestimuladores, usados para reforzar la respuesta inmunitaria. La vacunación se considera generalmente que es el método más eficaz y más rentable para prevenir enfermedades infecciosas y otras enfermedades.
El material administrado puede ser, por ejemplo, formas vivas pero debilitadas de patógenos (bacterias o virus), formas muertas o inactivadas de estos patógenos, materiales purificados tales como proteínas, ácidos nucleicos que codifican antígenos, o células tales como células tumorales o células dendríticas. En particular, la vacunación con ADN se ha desarrollado recientemente. La vacunación con ADN funciona por inserción (y expresión, activando el reconocimiento del sistema inmunitario) de ADN que codifica antígenos en células humanas o animales. Algunas células del sistema inmunitario que reconocen las proteínas expresadas montarán un ataque contra estas proteínas y contra las células que las expresan. Una ventaja de las vacunas con ADN es que son muy fáciles de producir y almacenar. Además, las vacunas de ADN tienen varias ventajas sobre las vacunas convencionales, incluyendo la capacidad de inducir un intervalo más amplio de tipos de respuesta inmunitaria.
La vacunación puede usarse como enfoque profiláctico, lo que conduce a inmunidad contra el antígeno en el individuo vacunado sano tras la exposición al antígeno. Como alternativa, una vacunación terapéutica puede causar una respuesta mejorada del sistema inmunitario del individuo vacunado enfermo, guiando al sistema inmunitario del individuo hacia los antígenos. Tanto la vacunación profiláctica como la terapéutica pueden aplicarse a seres humanos, así como a animales.
La expresión "terapia génica" usada en esta divulgación se refiere a la modificación genética transitoria o permanente (por ejemplo, inserción, alteración o eliminación de genes) de las células de un individuo y/o los tejidos biológicos para tratar enfermedades, tales como tumores o enfermedades autoinmunitarias. La forma más habitual de terapia génica implica la inserción de genes funcionales en una localización genómica no especificada para reemplazar un gen mutado, pero otras formas implican corregir directamente la mutación o modificar un gen normal que posibilite una infección vírica o incluso transferir un gen o un fragmento génico a una célula para su transcripción.
"Terapia génica autóloga" se refiere a usar tejidos o células del propio individuo. Las células o tejidos aislados se modificarán por terapia génica y se reintroducirán en el donante. En contraste, la "terapia génica alogénica" se refiere a usar células para terapia génica de un individuo diferente al individuo aceptor. Tras la modificación genética, las células alogénicas se introducen en el aceptor.
La expresión "terapia génica ex-vivo" se refiere a un enfoque terapéutico en el cual las células de un individuo, por ejemplo, células madre hematopoyéticas o células progenitoras hematopoyéticas, se modifican genéticamente ex vivo y posteriormente se introducen en el individuo a tratar. La expresión "terapia génica in-vivo" se refiere a un enfoque terapéutico en el cual las células de un individuo, por ejemplo, células madre hematopoyéticas o células progenitoras hematopoyéticas, se modifican géticamente in vivo, usando vectores víricos u otras construcciones de expresión, por ejemplo.
La terapia génica también puede clasificarse en "terapia génica de línea germinal" y "terapia génica somática". En el caso de "terapia génica de línea germinal", las células germinales, es decir, espermatozoides u óvulos, se modifican genéticamente. Los cambios genéticos se integran de forma ordinaria en sus genomas. Por lo tanto, el cambio debido a la terapia sería heredable y pasaría a las generaciones posteriores. Este enfoque es útil para el tratamiento de trastornos genéticos y enfermedades hereditarias. En el caso de "terapia génica somática", los genes terapéuticos se transfieren a las células somáticas de un individuo. Cualquier modificación y efecto se restringirá al individuo solamente, y no se heredará por la descendencia del individuo o las generaciones posteriores.
El término "cáncer" comprende enfermedades cancerosas o un tumor que se está tratando o previniendo que se selecciona entre el grupo que comprende, aunque sin limitación, carcinomas mamarios, melanoma, neoplasias cutáneas, linfoma, leucemia, tumores gastrointestinales, incluyendo carcinomas de colon, carcinomas de estómago, carcinomas pancreáticos, cáncer de colon, cáncer del intestino delgado, carcinomas de ovario, carcinomas cervicales, cáncer pulmonar, cáncer de próstata, carcinomas de células renales y/o metástasis hepáticas.
Las enfermedades autoinmunitarias de acuerdo con la presente divulgación comprenden artritis reumatoide, enfermedad de Crohn, lupus sistémico (SLE), tiroiditis autoinmunitaria, tiroiditis de Hashimoto, esclerosis múltiple, enfermedad de Graves, miastenia grave, enfermedad celiaca y enfermedad de Addison.
La presente divulgación proporciona una secuencia de ADN de cadena abierta lineal que comprende al menos un motivo CG y al menos un nucleótido en conformación L. Debido a la conformación L parcial/completa el ADN no puede actuar como sustrato para enzimas degradantes de ADN específicas de conformación D de origen natural. De este modo, las construcciones de ADN de la presente invención están protegidas contra degradación enzimática sin tener que usar un esqueleto fosforotioato que ha demostrado ser tóxico. Además, las construcciones de ADN solamente constan de una cantidad mínima de nucleótidos que las hacen pequeñas y de este modo mejoran significativamente su captación por las células del paciente.
El efecto de las construcciones de ADN que contienen CG depende de su interacción con TLR9, y la interacción ADN-proteína depende de la conformación tanto del ADN como de la proteína. Como la capacidad quiral de las moléculas individuales es decisiva para la conformación del polímero resultante no se sabía si una molécula de ADN en conformación L parcial o completa sería capaz de unirse a y activar TLR9. Los datos experimentales demuestran que dichas moléculas de ADN protegidas son sorprendentemente adecuadas para la inducción de una respuesta inmunitaria. Como se muestra en los ejemplos y figuras, al menos un cambio parcial en la capacidad quiral de los nucleótidos individuales obviamente aún permite la unión a y activación de TLR9. Por lo tanto, las moléculas de ADN con motivos CG y los nucleótidos en conformación L pueden usarse para inmunomodulación.
Sorprendentemente, el patrón de estimulación inducido difiere del patrón de estimulación inducido por la molécula desvelada en el documento EP 1196 178 que desvela la molécula con forma de mancuerna que comprende motivos CG en los bucles monocatenarios en ambos extremos de la molécula o en el tronco bicatenario ("dSLIM"), como puede observarse en las figuras, incluso cuando se emplean secuencias idénticas de nucleótidos.
La construcción de ADN puede ser monocatenaria o parcial o completamente bicatenaria. Esto incluye apareamiento de bases dentro de la misma molécula (intramolecular) o dentro de diferentes moléculas (intermolecular) o cualquier combinación de los mismos. También es posible que la construcción comprenda al menos una región monocatenaria desapareada. Como realización adicional, se incluyen estructuras de horquilla. Debido a la conformación L parcial o completa, se asegura una semi-vida más larga de la construcción ya que los nucleótidos en conformación L no se someten a degradación.
También se pretende que al menos dos moléculas, que son monocatenarias o parcial o completamente bicatenarias pueden ligar entre sí para formar construcciones multiméricas. Estas construcciones multiméricas incorporan por tanto al menos tantos motivos CG como patrones de ligamiento, empaquetados firmemente dentro de una molécula, y por lo tanto se espera que provoquen una respuesta inmunitaria considerable. Las construcciones multiméricas resultantes monocatenarias o parcial o completamente bicatenarias pueden estar covalentemente cerradas comprendiendo nucleótidos en conformación L dentro de la molécula o construcciones multiméricas abiertas comprendiendo nucleótidos en conformación L en o cerca del extremo 5' y/o 3' para su protección contra degradación enzimática.
De acuerdo con la presente divulgación, el motivo o motivos CG están localizados dentro de la región monocatenaria y/o bicatenaria de la construcción. Como se ha desvelado en el documento EP 1 196 178, los motivos CG son capaces de provocar una respuesta inmunitaria ya sea incluidos dentro de la región monocatenaria o dentro de la
región bicatenaria de la molécula.
La divulgación comprende adicionalmente modificaciones químicas de al menos un nucleótido en conformación L o D con un grupo funcional seleccionado entre el grupo que comprende grupos carboxilo, amina, amida, aldimina, cetal, acetal, éster, éter, disulfuro, tiol y aldehído. Esto permite el acoplamiento de la construcción de ADN a un compuesto seleccionado entre el grupo que comprende péptidos, proteínas, lípidos, vesículas, micelas, carbohidratos, anticuerpos, moléculas sintéticas, polímeros, microproyectiles, partículas metálicas, nanopartículas o una fase sólida mediante, por ejemplo, adsorción, unión covalente o iónica. La modificación puede seleccionarse específicamente para el propósito respectivo. La construcción de este modo puede usarse, por ejemplo, para transportar otras moléculas a la célula específica que responde al motivo o motivos CG incorporados. Además, es posible mediante dichas modificaciones acoplar la construcción a microproyectiles que pueden usarse para transferir la construcción al interior de la célula. La construcción también puede acoplarse a una fase sólida, por ejemplo, una placa de microtitulación.
La activación Th1-desviada implica la activación de células NK y células T citotóxicas y estas respuestas inmunitarias puede explorarse para la terapia contra el cáncer. Como las construcciones de ADN que contienen motivos CG no metilados preferiblemente conducen a activación Th1, las construcciones de la presente divulgación pueden usarse para tratar el cáncer. Están en curso numerosos ensayos clínicos que implican agonistas de TLR9 para el tratamiento del cáncer. Dichas moléculas se han administrado de forma eficaz solas o en combinación con, por ejemplo, radioterapia, cirugía, quimioterapia y crioterapia (Krieg, J. Clin. Invest. 2007117: 1184-94). Debido a su potente inmunomodulación, su pequeño tamaño y su estabilidad, se espera que las construcciones de la presente divulgación sean muy ventajosas a este respecto. Además, su distinto perfil inmunológico las distingue de otros ligandos de TLR9 menos ventajosos, y este perfil puede explotarse para tratamiento específico contra el cáncer. Por otro lado, los agonistas de TLR9 también están implicados en la generación de células T reguladoras y por tanto pueden usarse para el tratamiento de enfermedades autoinmunitarias. La vía de administración parece ser una variable que determina el efecto de las construcciones de ADN que contienen motivos CG in vivo (Krieg, J. Clin. Invest. 2007117: 1184-94).
El efecto inmunoestimulador de dichas moléculas de ADN que contienen motivos CG ha demostrado mejorar la eficacia de enfoques terapéuticos convencionales tales como agentes quimioterapéuticos, en terapia contra el cáncer. Por lo tanto, también se proporcionan composiciones farmacéuticas, que comprenden las construcciones de la presente divulgación. De nuevo, las características ventajosas de las construcciones de la presente divulgación en comparación con los agonistas de TLR9 del estado de la técnica hacen de las construcciones de la presente divulgación herramientas prometedoras para el tratamiento de enfermedades tales como el cáncer, enfermedades infecciosas, alergias y asma. El tratamiento de alergias y asma (principalmente Th2-mediadas) de este modo se beneficia de la preferencia de la activación Th1.
Como los agonistas de TLR9 han demostrado ser potentes adyuvantes en vacunas, también se proporcionan vacunas que comprenden las construcciones de ADN de la presente divulgación. Las construcciones de la presente divulgación solamente comprenden las secuencias relevantes para la estimulación de TLR9 y son estables debido a la modificación de nucleótidos L. Por lo tanto, pueden evitarse los efectos secundarios debidos a secuencias no relevantes. La semi-vida más larga de la molécula asegura una estimulación eficaz de modo que se espera una fuerte respuesta inmunitaria.
Las moléculas de ADN de la presente divulgación se produjeron usando una columna de síntesis y los nucleótidos respectivos (Beta-L-desoxi "NT" (n-bz) CED fosforamidita; "NT" significa adenosina, citidina, guanosina o timidina). Las moléculas de ADN se purificaron posteriormente por HPLC.
Para poner de manifiesto el efecto de usar ADN con L-ribosa en lugar de D-ribosa, se usaron las siguientes moléculas de ADN para los experimentos iniciales descritos en este documento (Tabla 1).
Tabla 1: Secuencias de las construcciones de ADN inmunoestimuladoras no codificantes y los controles.
Los experimentos usando las secuencias de la Tabla 1 mostraron que las secuencias lineales protegidas con L-ribosa que contenían motivos CG son capaces de estimular el sistema inmunitario y la respuesta inmunitaria inducida difiere claramente de la respuesta inmunitaria inducida por dSLIM como se desvela en el documento EP 1 196 178. Por tanto, una secuencia modificada llamada ODN2216 (GGGGGACGATCGTCGGGGGG; SEC ID 6) y modificaciones de la misma se usaron para investigar la influencia de la diferencia estructural como la influencia de los tramos G con respecto a su presencia, longitud y posición, el espaciado entre los motivos CG y la distancia entre tramos G con nucleótidos de L-ribosa y motivos CG respectivamente.
La Tabla 2 resume las secuencias usadas y su efecto sobre la secreción de IFN-alfa e IP-10 en comparación con ODN2216 que tiene los dos primeros y los seis últimos nucleótidos modificados con fosforotioato, donde las letras en negrita representan nucleótidos que comprenden L-ribosa, las letras en cursiva se refieren a un tramo G y las letras subrayadas se refiere a un motivo CG. Una raya situará a la secuencia respectiva en su sitio para la comparación con CKm508, pero no indica una modificación estructural ni una modificación funcional de la secuencia.
Tabla 2: Efecto de las secuencias indicadas sobre la secreción de IFN-alfa e IP-10 en comparación con ODN2216 (ODN2216 que tiene los dos primeros y los seis últimos nucleótidos modificados con fosforotioato).
Se obtuvieron buenos resultados con secuencias que tienen al menos un tramo G, especialmente en o cerca del extremo 3'. La estimulación es también dependiente de la presencia de motivos CG (CKm477), demostrando de nuevo que la estimulación no es un efecto de la L-ribosa, sino de los motivos CG.
Los resultados obtenidos con secuencias modificadas de ODN 2216 que identifican componentes estructurales positivos se transfirieron a la secuencia de ADN de CKm374. La Tabla 3 muestras los resultados de emplear las secuencias modificadas en comparación con dSLIM con forma de mancuerna como se devela en el documento EP 1 196 178. De nuevo, las letras en negrita representan nucleótidos que comprenden L-ribosa, las letras en cursiva se
refieren a un tramo G, las letras con doble subrayado representan nucleótidos modificados con fosforotioato y las letras subrayadas se refieren a un motivo GC.
Como puede extraerse de los resultados de la tabla 3, un tramo G localizado directamente en el extremo 5' parece ser ventajoso (comp. CKm532 y CKm499). Además, el uso de cuatro en lugar de tres desoxiguanosinas en el extremo 5' aumenta adicionalmente la estimulación de IFN-alfa e IP-10 (comp. CKm501 y CKm532).
La adición de un tramo G adicional entre motivos CG parecer ser también beneficioso (comp. CKm532 y CKm520). La distancia entre el primer y el segundo tramo G influye adicionalmente en la eficacia de la molécula de ADN. Además, el empleo de desoxinucleótidos que comprenden L-ribosa solamente en o cerca del extremo 3' parece producir un grado suficiente de estabilización de la molécula de ADN. Puede observarse una buena estimulación de IFN-alfa e IP-10, que es lo que se pretende (véase a continuación). Como IL-8 ha demostrado ser responsable de la inducción de neo-angiogénesis, parece ser beneficioso que la secreción de IL-8 se induzca solamente en pequeñas cantidades.
Claramente, la presencia y la posición cuidadosamente elegida de los tramos G en combinación con el efecto estabilizador de los desoxinucleótidos que contienen L-ribosa permite la producción de una molécula de ADN que supera la eficacia estimuladora de la molécula dSLIM.
Tabla 3: Comparación del efecto de las secuencias indicadas sobre la secreción de IFN-alfa, IP-10 e IL-8 en comparación con dSLIM.
Breve descripción de las figuras
La divulgación se ilustrará adicionalmente mediante ejemplos y figuras sin limitarse las realizaciones desveladas. Muestra:
Fig. 1 Electroforesis en gel de agarosa de construcciones de ADN después de digestión enzimática.
Fig. 2 Intensidad de GFP después de estimulación de una línea celular de macrófagos de ratón.
Fig. 3 Concentración de MIP-1alfa después de estimular células dendríticas plasmacitoides (PDC).
Fig. 4 Concentración de MIP-1beta después de estimular PDC.
Fig. 5 Concentración de IL-8 después de estimular PDC.
Fig. 6 Concentración de IL-6 después de estimular PDC.
Fig. 7 Concentración de IFN-alfa después de estimular PDC.
Fig. 8 Concentración de TNF-alfa después de estimular PDC.
Fig. 9 Concentración de MCP-1 e IL-8 después de estimular células mononucleares de sangre periférica (PBMC).
Fig. 10 Frecuencia de células T activadas después de estimular PBMC.
Fig. 11, 12 Secreción de IFN-alfa, IP-10 e IL-8 de PBMC.
Fig. 13 Efecto de desoxinucleótidos terminales modificados con L-ribosa sobre la estimulación de células ELAM9.
Fig. 14 Estimulación inmunitaria de células B y PDC por CKm532 y dSLIM, en comparación con el estado no estimulado.
Descripción detallada de las figuras
La Figura 1 muestra un gel de todas las construcciones de ADN que se están sometiendo a digestión por la T7-polimerasa del bacteriógafo T7. Se incubaron 6 µg de cada construcción de ADN con 10 unidades de T7-polimerasa (volumen de reacción total: 20 µl). Después de 0, 1, 2, 5, 30, y 1500 minutos, se retiró una alícuota de 3 µl de mezcla de incubación de la muestra y se diluyó con 5 µl de colorante Sanger que contenía formamida. Todas las alícuotas se cargaron en un gel de agarosa al 3 %, que se procesó a 100 voltios durante 40 minutos.
Se descubrió que la molécula de ADN no modificada lin-30L2 (carril 2) estaba completamente digerida tras una incubación de 5 minutos con T7-polimerasa, mientras que la construcción de acuerdo con la presente invención (CKm337; carril 3), así como dSLIM (carril 1) y las construcciones modificadas con fosforotioato CKm338 (carril 4) y CKm339 (carril 5) retenían presencia significativa incluso después de 1500 minutos de incubación. De hecho, CKm337 mostró la mayor estabilidad de todas las moléculas ensayadas. Debido a su estabilidad insuficiente, Lin 30L2 se excluyó de estudios adicionales.
La Figura 2 muestra la estimulación de células ELAM9 con diferentes construcciones de ADN estimuladoras. Las células ELAM9 son células macrófagos murinas TLR9-positivas (RAW264) que se transfectaron de forma estable con d1-eGFP bajo el control del promotor de la elastina humana (hELAM) que contienen varios elementos de respuesta a NFκB. Un día después de sembrar las células, se estimularon con las construcciones de ADN representadas (3 µM) durante 7 h. La media geométrica de la intensidad de GFP se midió por citometría de flujo. La construcción de ADN con todos los nucleótidos en conformación L excepto la última T (CKm336) no tenía capacidad estimuladora. Sin embargo, la construcción de ADN con nucleótidos en conformación L en ambos extremos (CKm337) estimuló la expresión de GFP. Esto fue bastante inesperado ya que no se sabía si las construcciones de ADN que contienen motivos CG con nucleótidos en conformación L serían capaces de unirse a y activar TLR9. Además, se espera que CKm337 sea captada por las células más fácilmente que dSLIM (molécula desvelada en el documento EP 1196 178), y sea menos tóxica que las construcciones modificadas con fosforotioato (CKm338 y CKm339).
La Figura 3 a la Figura 8 muestran los efectos de las construcciones de ADN sobre pDC respecto las quimioquinas y citoquinas secretadas. Las pDC se enriquecieron a partir de PBMC purificadas en Ficoll usando un procedimiento de clasificación combinado de Miltenyi, kit Diamond PDC: primero, se agotaron las PBMC de las no pDC usando el cóctel de Biotina-anticuerpo pDC del kit de Miltenyi, después las células se clasificaron positivamente para las pDC usando las microperlas de diamante CD304 (BDCA-4) del kit PDC Diamond. Las PDC se sembraron a 2,5 x 10 5/ml con 10 ng/ml de IL-3 en el medio (RPMI1640, suero de ternera fetal al 10 %, 100 unidades/ml de penicilina, 100 unidades/ml de estreptomicina glutamina 2 mM, 37 ºC, CO2 al 5 %), y se estimularon durante 2 días por construcciones individuales aplicadas a 3 µM.
Para la determinación de la cantidad de compuestos secretados tras la estimulación celular, se recogió el sobrenadante aclarado de las células estimuladas y se analizó usando un sistema múltiplex (FlowCytomix de eBioscience/Bender MedSystems) o ELISA.
Sorprendentemente, las pDC estimuladas con CKm337 mostraron un efecto similar sobre la secreción de MIP-1alfa, -1beta e IL-8 en comparación con la estimulación con dSLIM. La secreción de MIP-1alfa, -1beta e IL-8 tras la estimulación con lin CKm338 y CKm339 fue ligeramente mayor (Figura 3, 4 y 5). Sin embargo, todas las construcciones modificadas con fosforotioato heredan varias desventajas como se ha descrito anteriormente.
Respecto a la secreción de IL-6, dSLIM, CKm337 y CKm338 tuvieron un efecto similar sobre las pDC. CKm339 fue ligeramente más eficaz (Figura 6).
Es de observar que CKm337 tuvo un efecto sorprendentemente más fuerte sobre la secreción de IFN-alfa de pDC en comparación con todas las demás construcciones lineales (Figura 7).
dSLIM, CKm337, CKm338 y CKm339 tuvieron todas un efecto similar sobre la secreción de TNF-alfa de pDC (Figura 8).
Las PBMC se aislaron de capas leuco-plaquetarias humanas mediante un gradiente de densidad de Ficoll. Para el análisis funcional, se estimularon 10 6 células/ml en medio (RPMI1640, suero de ternera fetal al 10 %, 100 unidades/ml de penicilina, 100 unidades/ml de estreptomicina glutamina 2 mM, 37 ºC, CO2 al 5 %) durante 2 días por los compuestos individuales aplicados a las concentraciones indicadas (2-3 µM).
La Figura 9 (A y B) muestra el efecto de las construcciones de ADN representadas (3 µM cada una) sobre PBMC respecto a la secreción de MCP-1 e IL-8. Como se esperaba a partir de los experimentos con pDC, la construcción de ADN con todos los nucleótidos en conformación L (CKm336) no tuvo capacidad estimuladora cuando se aplicaba a PBMC. Sin embargo, CKm337 fue eficaz en provocar la secreción tanto de MCP-1 como de IL-8. Sorprendentemente, su efecto respecto a la secreción de IL-8 fue más fuerte en comparación con dSLIM y menos fuerte respecto a la secreción de MCP-1.
Para la determinación de subpoblaciones celulares y el estado de activación de las mismas, se marcaron marcadores superficiales característicos con anticuerpos selectivos marcados con fluoróforo. La tinción con anticuerpo se realizó con 10 6 células/serie de tinción; cada serie se incubó con hasta 4 anticuerpos diferentes acoplados a grupos fluoróforos, finalmente se resuspendieron en 400 µl de tampón FACS y se analizaron por citometría de flujo sobre al menos 100.000 células vivas. La estrategia de abertura para la determinación de células T y las células activadas en las mismas fue CD3+/CD56- con el marcador de activación CD69.
La Figura 10 muestra el efecto de las construcciones de ADN representadas (2 µM cada una) sobre la frecuencia de células T activadas dentro de la población de PBMC. Las cinco construcciones tuvieron una capacidad estimuladora comparable. Las células T no expresan TLR9. Por lo tanto, tras la estimulación con las construcciones de ADN, se activaron las células dentro de la población de PBMC que a su vez fueron capaces de activar las células T.
La optimización de las secuencias reveló que la introducción de tramos G aumenta la eficacia de los oligonucleótidos después de la transfección. La eficacia es además dependiente de la distancia entre motivos CG. Las secuencias de ADN lineales pueden protegerse suficientemente contra la degradación mediante el uso de desoxinucleótidos que comprenden L-ribosa en el extremo 3' el oligonucleótido (comp. tabla 2 y 3). Los oligos CKm501 (SEQ ID NO: 33), CKm527 (SEQ ID NO: 32), CK 532 (SEQ ID NO: 31) y CKm534 (SEQ ID NO: 34) mostraron inesperados buenos resultados, como puede extraerse de la tabla 3. Las Figuras 11 y 12 muestran el efecto de las construcciones de ADN indicadas sobre la secreción de las citoquinas IFN-alfa (parte superior), IP-10 (centro) e IL-8 (parte inferior) en PBMC. Los experimentos se realizaron como ya se ha descrito anteriormente.
La Figura 11 muestra que CKm501 y CKm527 causan elevados niveles de secreción de IFN-alfa y CKm527 aumenta la secreción de IP-10 también en comparación con dSLIM con forma de mancuerna. La secreción de IL-8 es baja comparable con respecto a dSLIM, pero inferior en comparación con CKm339, que es la secuencia de bucles monocatenarios de dSLIM con forma de mancuerna protegida en ambos extremos con desoxinucleótidos modificados con fosforotioato.
Como puede extraerse de la figura 12, CKm532 muestra una inducción elevada significativa e inesperada de secreción de IFN-alfa e IP-10, pero una inducción baja comparable de secreción de IL-8. Por tanto, CKm532 confirma que el elemento estructural de un tramo G localizado directamente en el extremo 5' y un tramo G adicional localizado entre dos motivos CG (segundo y tercer motivo GC) parece ser ventajoso. La comparación de CKm520 y CKm532 en la Tabla 3 indica que la localización de un tramo G entre el segundo y tercer motivo CG en CKm532 es responsable del aumento pretendido en la secreción de IFN-alfa e IP-10, mientras que CKm520 aumenta principalmente la secreción de IL-8. Además, la protección del oligo solamente con dos desoxinucleótidos que comprenden L-ribosa en el extremo 3' parece ser suficiente.
El acortamiento del tramo G en el extremo 5' provoca una reducción de la eficacia como puede extraerse de la comparación de CKm532 y CKm 534 en la Figura 12. De nuevo, CKm532 demuestra las ventajas de los componentes estructurales identificados con respecto a una secreción aumentada de IFN-alfa e IP-10 y una baja secreción de IL-8.
La Figura 13 muestra en la parte superior los resultados de la estimulación de células ELAM9 con las construcciones de ADN indicadas, que comprenden desoxinucleótidos con un grado diferente de modificaciones de L-ribosa. Los nucleótidos que comprenden L-ribosa se representan en las secuencias en la parte inferior de la figura 13 en letras en negrita. Los experimentos se hicieron por duplicado (L-dSLIM032 y L-dSLIM030).
El grado y posición de desoxinucleótidos que comprenden L-ribosa tiene influencia sobre la estimulación de las células ELAM9. Una secuencia completa en conformación L (CKm 336; SEQ ID NO: 2) no tiene ningún efecto estimulador en absoluto, lo que está de acuerdo con la divulgación del documento WO 2010/039137. Se obtienen buenos efectos usando oligos que comprenden motivo CG protegidos por desoxinucleótidos que comprenden L-ribosa en el extremo 3' y 5', mientras que una larga extensión de los desoxinucleótidos que comprenden L-ribosa en
el extremo 5' es contraproducente (comp. CKm489 y CKm490). Además, la modificación de los motivos CG con desoxinucleótidos que comprenden L-ribosa conduce a una pérdida de efecto. Por tanto, para conseguir buenos efectos estimuladores, los motivos CG no deben comprender L-ribosa y la extensión de desoxinucleótidos modificados con L-ribosa en ambos extremos debe estar restringida, concretamente no más de ocho desoxinucleótidos terminales en el extremo 5' y el máximo de desoxinucleótidos 3' terminales tras el último motivo CG.
La Figura 14 muestra la estimulación inmunitaria por CKm532 y dSLIM, en comparación con el estado no estimulado. Se realizaron experimentos FACS de acuerdo con el protocolo empleado para los experimentos descritos en la Figura 10 y adaptado a células B (estrategia de abertura: CD19 positivas, CD86 como marcador de activación) y PDC (estrategia de abertura: linaje negativo, células HLA-DR positivas, CD123 positivas, CD40 y HLA-DR como marcador de activación), respectivamente. Los datos mostrados se basan en las mediciones de tres preparaciones diferentes de capa leuco-plaquetaria.
La parte superior de la Figura 14 muestra la estimulación de células B, como se evidencia por el marcador CD86. Claramente, CKm532 causa una estimulación aumentada de células B, en comparación con dSLIM y el estado no estimulado. Esto muestra el aumento en la maduración de células B, tales como células productoras de anticuerpos, que es una característica importante de la estimulación inmunitaria.
La parte inferior de la Figura 14 muestra la estimulación de PDC, detectada usando el marcador HLA-DR. HLA-DR es parte de las moléculas MHC, y por tanto parte de los procesos de presentación de antígeno del sistema inmunitario. De nuevo, CKm532 muestra un aumento más fuerte de esta característica inmunoestimuladora, que dSLIM o las células no estimuladas.
En conclusión, CKm337 (construcción de ADN D con nucleótidos en conformación L en ambos extremos) sorprendentemente tuvo un efecto estimulador tanto sobre PBMC como sobre pDC aisladas mientras que la construcción de ADN con todos los nucleótidos en conformación L (CKm336) no tuvo efecto. Aparentemente, la conformación de CKm337 aún permite la unión a TLR9, y CKm336 es estéricamente incapaz de unirse a o estimular TLR9.
Inesperadamente, el patrón de estimulación inducido por CKm337 en comparación con dSLIM con forma de mancuerna y oligos modificados con fosforotioato, fue único en comparación con todas las demás construcciones. CKm337 indujo las cantidades mayores de IFN-alfa secretado por pDC. La secreción de IL-8 por PBMC fue más débil en comparación con moléculas modificadas con fosforotioato, pero más fuerte en comparación con dSLIM. En contraste, dSLIM indujo una mayor cantidad de MCP-1 secretada por PBMC, pero Ckm337 fue comparable a las moléculas modificadas con fosforotioato.
Fue posible aumentar los efectos observados con CKm337 introduciendo los llamados tramos G directamente en el extremo 5' de la molécula de ADN lineal. Además, resultó que la mera protección contra la degradación mediante desoxinucleótidos que comprenden L-ribosa en el extremo 3' es suficiente para estabilizar el oligo. Las características estructurales identificadas de tramo G, motivos CG, espaciado de los motivos CG y protección usando diferentes grados y posiciones de desoxinucleótidos modificados con L-ribosa permite una modulación del efecto inmunoestimulador de oligonucleótidos que comprenden L-ribosa. Parece bastante obvio que la presente divulgación pone de manifiesto nuevas herramientas para la construcción de construcciones de ADN inmunoestimuladoras para una estimulación dirigida de células o el sistema inmunitario.
IFN-alfa se ha conocido como una citoquina antivírica durante muchos años. Estimula el desarrollo de células Th1, promoviendo por lo tanto los efectos de moléculas de ADN que contienen CG. IFN-alfa también muestra actividad antitumoral en neoplasias de ratón y humanas y es capaz de disminuir la tumorigenicidad de células tumorales transplantadas, parcialmente mediante la activación de células T citotóxicas y de este modo aumentando la probabilidad de citolisis de las células tumorales. La actividad de células NK y macrófagos, ambas también importantes para la citotoxicidad antitumoral, también se aumentan por IFN-alfa (Brassard et al., J. Leukoc. Biol.
2002 71: 565-81). Por lo tanto, se espera que el aumento en la cantidad de IFN-alfa tras la estimulación con las construcciones de ADN de la presente divulgación sea beneficioso para el tratamiento del cáncer.
IP-10 ha demostrado recientemente ser una potente proteína angiostática in vivo. Por tanto, la inducción de IP-10 especialmente en el tratamiento de enfermedades tumorales parece ser también ventajosa.
IL-8 es una citoquina proinflamatoria, que se sabe que media la activación y migración de neutrófilos en tejido de sangre periférica. La infiltración neutrofílica resultante puede ser parcialmente responsable de la inhibición del crecimiento tumoral como se ha demostrado para cáncer de ovario (Lee et al., J. Immunol. 2000 164: 2769-75). Además, IL-8 también es quimiotáctico para células T y basófilos. Por lo tanto, para el tratamiento o prevención de al menos algunos tipos de tumores es ventajoso regular positivamente de forma selectiva IL-8 en respuesta a construcciones de ADN que contienen CG. Por otro lado, se ha establecido que IL-8 activa la angiogénesis, de modo que la inducción de la secreción de IL-8 podría ser contraproducente. Por tanto, los diferentes grados de inducción de IL-8 por las diferentes moléculas de ADN de la presente invención podrían permitir una adaptación de la molécula
para los efectos terapéuticos deseados.
Se sabe que MCP-1 desempeña una tarea en el reclutamiento de monocitos/macrófagos a sitios de lesión e infección y de este modo está posiblemente implicada en la estimulación de respuestas antitumorales del hospedador. Se ha demostrado que MCP-1 puede activar monocitos para que sean más citostáticos contra varios tipos de células tumorales humanas in vitro (Zachariae et al., J. Exp. Med. 1990 171: 2177-82). Por lo tanto, de forma similar a IL-8 es beneficioso modular la expresión de MCP-1 dependiendo del contexto tumoral específico. Por tanto, el patrón de citoquinas específico inducido es beneficioso para el tratamiento y prevención de distintos tipos de tumor. Obviamente, el contexto específico en que se presenta el motivo CG no metilado a TLR9 determina el patrón de estimulación respectivo individual inducido en las células respondedoras.
LISTADO DE SECUENCIAS
<110> MOLOGEN AG
<120> Construcción de ADN inmunomodulador no codificante
<130> 80523WO
<160> 52
<170> PatentIn versión 3.5
<210> 1
<211> 30
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, lin 30L2
<400> 1
tcattggaaa acgttcttcg gggcgttctt 30
<210> 2
<211> 27
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm336
<220>
<221> misc_feature
<223> completamente en conformación L, excepto para la última T
<400> 2
tggaaaacgt tcttcggggc gttcttt 27
<210> 3
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm337
<220>
<221> misc_feature
<223> 1, 2, 29 y 30 en conformación L
<400> 3
tcattggaaa acgttcttcg gggcgttctt t 31
<210> 4
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm338
<220>
<221> misc_feature
<223> todos salvo los últimos enlaces fosfodiéster modificados en fosforotioatos
<400> 4
tcattggaaa acgttcttcg gggcgttctt t 31
<210> 5
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm339
<220>
<221> misc_feature
<223> los dos primeros así como del segundo y tercero hasta el último enlace fosfodiéster modificados en fosforotioatos
<400> 5
tcattggaaa acgttcttcg gggcgttctt t 31
<210> 6
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, ODN2216
<220>
<221> misc_feature
<223> todos los enlaces fosfodiéster modificados en fosforotioatos
<400> 6
gggggacgat cgtcgggggg t 21
<210> 7
<211> 25
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm508
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 23-24: en conformación L Nucleótidos 3-7 y 17-22: tramo G Nucleótidos 9-10, 13-14 y 16-17: motivo CG
<400> 7
gggggggacg atcgtcgggg ggggt 25
<210> 8
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm458
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 4-5 y 15-18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 8
ggaggacgat cgtcgggggg t 21
<210> 9
<211> 20
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm481
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 18-19: en conformación L Nucleótidos 3-5 y 15-17: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 9
gggggacgat cgtcgggggt 20
<210> 10
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm461
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 5 y 15-18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 10
ggaagacgat cgtcgggggg t 21
<210> 11
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm361-2
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 15-18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 11
gggggacgat cgtcgggggg t 21
<210> 12
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm479
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 20-21: en conformación L Nucleótidos 3-6 y 16-19: tramo G Nucleótidos G 8-9, 12-13 y 15-16: motivo CG
<400> 12
ggggggacga tcgtcggggg gt 22
<210> 13
<211> 25
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm503
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 23-24: en conformación L Nucleótidos 3-7 y 17-22: tramo G Nucleótidos G 9-10, 13-14 y 16-17: motivo CG
<400> 13
aagggggacg atcgtcgggg ggaat 25
<210> 14
<211> 25
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm507
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 23-24: en conformación L Nucleótidos 3-7 y 17-22: tramo G Nucleótidos G 9-10, 13-14 y 16-17: motivo CG
<400> 14
ttgggggacg atcgtcgggg ggttt 25
<210> 15
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm459
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5, 15-16 y 18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 15
gggggacgat cgtcggaggg t 21
<210> 16
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm506
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 20-21: en conformación L Nucleótidos 3-5 y 16-19: tramo G Nucleótidos G 7-8, 11-12 y 15-16: motivo CG
<400> 16
gggggacgat cgtgcggggg gt 22
<210> 17
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm478
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 15-16: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 17
ggggggcgat cgtcggaagg t 21
<210> 18
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm480
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 15-18: tramo G Nucleótidos G 7-8 y 14-15: motivo CG
<400> 18
gggggacgat gctcgggggg t 21
<210> 19
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm462
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 15-16: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 19
gggggacgat cgtcggaagg t 21
<210> 20
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm505
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 16-18: tramo G Nucleótidos G 7-8, 11-12 y 15-16: motivo CG
<400> 20
gggggacgat cgtgcggggg t 21
<210> 21
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm476
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 20-21: en conformación L Nucleótidos 3-5 y 16-17: tramo G Nucleótidos G 8-9, 12-13 y 15-16: motivo CG
<400> 21
gggggaacga tcgtcggaag gt 22
<210> 22
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm464
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 15-18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 22
ggcccccgat cgtcgggggg t 21
<210> 23
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm476
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 20-21: en conformación L Nucleótidos 3-5 y 16-17: tramo G Nucleótidos G 8-9, 12-13 y 15-16: motivo CG
<400> 23
gggggaacga tcgtcggaag gt 22
<210> 24
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm460
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 4-5, 15-16 y 18: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 24
ggaggacgat cgtcggaggg t 21
<210> 25
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm475
<220>
<221> misc_feature
<223> Nucleótidos 1-7 y 17-21: en conformación L Nucleótidos 15-16: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 25
cccccccgat cgtcgggggg gt 22
<210> 26
<211> 22
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm477
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 20-21: en conformación L Nucleótidos 3-5 y 16-19: Tramo G
<400> 26
gggggagcat gctgcggggg gt 22
<210> 27
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm463
<220>
<221 > misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 5 y 15-16: tramo G Nucleótidos G 7-8, 11-12 y 14-15: motivo CG
<400> 27
ggaagacgat cgtcggaagg t 21
<210> 28
<211> 21
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm504
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 19-20: en conformación L Nucleótidos 3-5 y 15-18: tramo G Nucleótidos G 11-12 y 14-15: motivo CG
<400> 28
gggggagcat cgtcgggggg t 21
<210> 29
<211> 20
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm510
<220>
<221> misc_feature
<223> Nucleótidos 1-2 y 18-19: en conformación L Nucleótidos 3-5, 14-15 y 17: tramo G Nucleótidos G 6-7, 10-11 y 13-14: motivo CG
<400> 29
gggggcgatc gtcggagggt 20
<210> 30
<211> 24
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm509
<220>
<221> misc_feature
<223> Nucleótidos 1-6 y 19-23: en conformación L Nucleótidos 3-5 y 17-18: tramo G Nucleótidos G 9-10, 13-14 y 16-17: motivo CG
<400> 30
ccccccctcg atcgtcgggg gggt 24
<210> 31
<211> 34
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm532
<220>
<221 > misc_feature
<223> Nucleótidos 32-33: en conformación L Nucleótidos 1-4 y 21-24: tramo G Nucleótidos G 13-14, 20-21 y 25-26: motivo CG
<400> 31
ggggtcatta aacgttcttc ggggcgttct tttt 34
<210> 32
<211> 35
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm527
<220>
<221 > misc_feature
<223> Nucleótidos 33-34: en conformación L Nucleótidos 1-4, 21-24 y 26-30: tramo G Nucleótidos G 13-14, 20-21 y 25-26: motivo CG
<400> 32
ggggtcatta aacgttcttc ggggcggggg ttttt 35
<210> 33
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm501
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 1-3 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG
<400> 33
gggtcattaa acgttcttcg gggcgttctt ttt 33
<210> 34
<211> 34
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm534
<220>
<221 > misc_feature
<223> Nucleótidos 32-33: en conformación L Nucleótidos 1-3 y 21-24: tramo G Nucleótidos G 13-14, 20-21 y 25-26: motivo CG
<400> 34
gggtcattaa aacgttcttc ggggcgttct tttt 34
<210> 35
<211> 37
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm520
<220>
<221 > misc_feature
<223> Nucleótidos 35-36: en conformación L Nucleótidos 1-4 y 28-32: tramo G Nucleótidos G 13-14, 20-21 y 27-28: motivo CG
<400> 35
ggggtcatta aacgttcttc gttcttcggg ggttttt 37
<210> 36
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm535
<220>
<221 > misc_feature
<223> Nucleótidos 29-30: en conformación L Nucleótidos 17-20 y 22-26: tramo G Nucleótidos G 9-10, 16-17 y 21-22: motivo CG
<400> 36
tcattaaacg ttcttcgggg cgggggtttt t 31
<210> 37
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm528
<220>
<221> misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 1-3 y 20-23: tramo G Nucleótidos G 13-14, 19-20 y 24-25: motivo CG
<400> 37
gggtcattaa aacgttctcg gggcgttctt ttt 33
<210> 38
<211> 30
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm339
<220>
<221> misc_feature
<223> Nucleótidos 6-7 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG Nucleótidos 1-2 y 29-30: enlaces fosforotioato
<400> 38
tcattggaaa acgttcttcg gggcgttctt 30
<210> 39
<211> 36
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm498
<220>
<221 > misc_feature
<223> Nucleótidos 34-35: en conformación L Nucleótidos 6-7 y 27-33: tramo G Nucleótidos G 12-13, 19-20 y 26-27: motivo CG
<400> 39
tcattggaaa acgttcttcg ttcttcgggg gggttt 36
<210> 40
<211> 28
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm536
<220>
<221 > misc_feature
<223> Nucleótidos 26-27: en conformación L Nucleótidos 1-3 y 16-19: tramo G Nucleótidos G 8-9, 15-16 y 20-21: motivo CG
<400> 40
gggaaaacgt tcttcggggc gttctttt 28
<210> 41
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm499
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 6-8 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG
<400> 41
tcattgggaa acgttcttcg gggcgttctt ttt 33
<210> 42
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm533
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 1-3, 15-17 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG
<400> 42
gggtcattaa acgtgggtcg gggcgttctt ttt 33
<210> 43
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm500
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 9-11 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG
<400> 43
tcattaaagg gcgttcttcg gggcgttctt ttt 33
<210> 44
<211> 25
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm521
<220>
<221 > misc_feature
<223> Nucleótidos 23-24: en conformación L Nucleótidos 1-3 y 14-17: tramo G Nucleótidos G 6-7, 13-14 y 18-19: motivo CG
<400> 44
gggaacgttc ttcggggcgt ctttt 25
<210> 45
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm502
<220>
<221 > misc_feature
<223> Nucleótidos 21-22: en conformación L Nucleótidos 1-3 y 12-15: tramo G Nucleótidos G 4-5, 11-12 y 16 17: motivo CG
<400> 45
gggcgttctt cggggcgtct ttt 23
<210> 46
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm374
<220>
<221 > misc_feature
<223> Nucleótidos 1-2 y 29-30: en conformación L Nucleótidos 6-7 y 20-23: tramo G Nucleótidos G 12-13, 19-20 y 24-25: motivo CG
<400> 46
tcattggaaa acgttcttcg gggcgttctt t 31
<210> 47
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm497
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 6-7 y 27-30: tramo G Nucleótidos G 12-13, 19-20 y 26-27: motivo CG
<400> 47
tcattggaaa acgttcttcg ttcttcgggg ttt 33
<210> 48
<211> 33
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm524
<220>
<221 > misc_feature
<223> Nucleótidos 31-32: en conformación L Nucleótidos 1-3 y 21-24: Tramo G
<400> 48
gggtcattaa agcttcttgc ggggcttctt ttt 33
<210> 49
<211> 31
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm525
<220>
<221 > misc_feature
<223> Nucleótidos 1-2 y 29-30: en conformación L Nucleótidos 6-7 y 21-24: Tramo G
<400> 49
tcattggaaa agcttcttgc ggggcttctt t 31
<210> 50
<211> 27
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm526
<220>
<221 > misc_feature
<223> Nucleótidos 25-26: en conformación L Nucleótidos 1-3 y 15-18: tramo G Nucleótidos G 7-8, 14-15 y 19-20: motivo CG
<400> 50
gggaaacgtt cttcggggcg ttctttt 27
<210> 51
<211> 35
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm537
<220>
<221 > misc_feature
<223> Nucleótidos 33-34: en conformación L Nucleótidos 1-4, 16-18, 21-24 y 26-30: tramo G Nucleótidos G 13-14, 20-21 y 25-26: motivo CG
<400> 51
ggggtcatta aacgtgggtc ggggcggggg ttttt 35
<210> 52
<211> 32
<212> ADN
<213> Secuencia artificial
<220>
<223> oligodesoxinucleótido sintético, CKm538
<220>
<221 > misc_feature
<223> Nucleótidos 30-31: en conformación L Nucleótidos 1-4, 9-12, 16-19 y 23-27: tramo G Nucleótidos G 8-9, 15-16 y 22-23: motivo CG
<400> 52
ggggaaacgg ggttcggggt tcgggggttt tt 32